Research Article Evidence against the Presence of

Research ArticleEvidence against the Presence of Wolbachia in a Population ofthe Crayfish Species Procambarus clarkii

Daniel A Heneghan Immo A Hansen William J Boecklen and Avis C James

Department of Biology New Mexico State University PO Box 30001MSC 3AF Las Cruces NM 88003 USA

Correspondence should be addressed to William J Boecklen wboecklenmsuedu

Received 29 July 2014 Accepted 3 December 2014 Published 22 December 2014

Academic Editor Sveinn Are Hanssen

Copyright copy 2014 Daniel A Heneghan et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Wolbachia is a genus of intracellular alpha-Proteobacteria that is maternally inherited and is capable of inducing a variety ofreproductive alterations in host species The host range of Wolbachia is not determined completely but is known to contain anumber of arthropod taxa including crustaceans Wolbachia has not been reported in crayfish but sampling has been limited todate We examine a species of crayfish Procambarus clarkii forWolbachia infection using a suite ofWolbachia-specific primers inPCR assays All specimens yielded negative results forWolbachia infection and mathematical analysis of sample size shows a near100 probability of detection for populations with greater than 01 infection rate

1 Introduction

There is much interest among evolutionary biologists inthe genus Wolbachia a maternally inherited intracellularbacterium within the order Rickettsiales [1ndash3] This intereststems from Wolbachiarsquos large host range [4 5] and from itseffects on host reproductive biology including cytoplasmicincompatibility host feminization of geneticmales inductionof parthenogenesis and male killing (reviewed by [3]) Cyto-plasmic incompatibility (CI) causes incompatibility betweenthe sperm of infected males and the eggs of uninfectedfemales [6] Feminization is aWolbachia induced phenotypicchange observed in both insects [7ndash9] and isopods (Bouchonet al 1998 [10ndash12]) that results in a genetic male host devel-oping as a reproductively functional female Parthenogenesisinduction in hosts causes the asexual production of femaleoffspring [13ndash15] Wolbachia induced male killing occursduring embryogenesis and is theorized to give a fitnessadvantage to surviving female offspring [16ndash18] Owing to thewide range of phenotypic alterations in Wolbachia-infectedhosts there has been much recent interest in the use ofWolbachia as biological control agents [19]

The host range for Wolbachia is not determined fullybut it has been estimated that in insects alone 169 to

507 million species are infected [4] Wolbachia is alsofound in filarial nematodes [20] isopods [12] and mites[21] Intertaxon transmission is consistent with aspects ofWolbachia phylogeny [22] and has been shown to occurbetween Drosophila simulans and the parasitoid Leptopilinaboulardi under lab conditions [23] Wolbachia intertaxontransmission has also been implicated in Australian spiders[24] and a variety of crustacean hosts [25] suggesting thatthe host range ofWolbachiamay be broader than is currentlyassumedHowever attempts to detectWolbachia in other taxahave been met with mixed results For example Schilthuizenand Gittenbergerrsquos (1998) assay of 38 species of mollusks andFitzsimmons (2004) assay of 203 Daphnia pulex failed todetectWolbachia Baldo et al (2007) reported the presence ofWolbachia super group F in eleven species of South Africanscorpions Wolbachia is common in filarial nematodes butremains unconfirmed in nonfilariid nematodes despite an in-depth study [26] Intracellular Rickettsia-like bacteria havebeen found in some species of crayfish [27] but Vogt et al[28] failed to detectWolbachia inmarbled crayfish using lightmicroscopy

Here we examine Procambarus clarkii (Decapoda Asta-cidea) usingWolbachia-specific molecular markers onmulti-ple tissue types P clarkii is the most commercially important

Hindawi Publishing CorporationAdvances in EcologyVolume 2014 Article ID 731291 4 pageshttpdxdoiorg1011552014731291

2 Advances in Ecology

Table 1 Multiplex primers

Primer Primer sequence Approximate fragment size SourceWolbachia specific forward CATACCTATTCGAAGGGATAG 450 [31]Wolbachia specific reverse AGCTTCGAGTGAAACCAATTCwsp 81F TGGTCCAATAAGTGATGAAGAAAC 600 [32]wsp 691R AAAAATTAAACGCTACTCCAcoxA F1 TTGGRGCRATYAACTTTATAG 500 [33]coxA R1 CTAAAGACTTTKACRCCAGTftsZ F1 ATYATGGARCATATAAARGATAG 550 [33]ftsZ R1 TCRAGYAATGGATTRGATAT

species of crayfish in North America and is a known vectorfor the European crayfish plague Aphanomyces astaci [29]

2 Materials and Methods

21 Husbandry and Sample Preparation We acquired 60southern Louisiana wild caught P clarkii from AtchafalayaBiological Supply Company of Raceland Lafourche ParishLA USA These crayfish were sampled from two or threenatural or seminatural ponds and were not exposed toantibiotics or microbial inhibitors (Danny Kraemer perscomm) At New Mexico State University crayfish were keptalive in 55 liter tanks and fed Hikari Crab Cuisine for fourdays prior to sample extraction

Gonad and heart tissue samples were isolated from 60P clarkii DNA extractions were done using the QiagenDNeasycopy blood and tissue kit DNA concentrations weremeasured via nanodrop and diluted to 20 ng120583L

22 Polymerase Chain Reaction Assay P clarkiiDNA isolateswere tested for PCR-viable DNA using a universal inverte-brate 16s primer pair 16Sar-5101584016Sbr-31015840 [30] PCR reactionstotaling 12 120583L consisted of 6 120583L Promegacopy PCR master mix2 120583L DNA and 4 120583L of 25 120583Mprimer mix Negative controlsconsisted of nuclease free water run through the DNAextraction protocol replacing DNA template in the PCRmixCycling conditions were 60 seconds at 95∘C 35 cycles of 60seconds at 94∘C 60 seconds at 42∘C and 90 seconds at 72∘Cand 10 minutes at 72∘C

We used PCR amplification with a multiplex of119882-specwsp coxA and ftsZ primers to test for the presence ofWolbachia in P clarkii tissue samples that tested positive forPCR-viable DNA PCR reactions totaling 19 120583L consisted of95 120583L Promegacopy PCR master mix 15 120583L DNA and 8 120583Lof multiplex primer mix Multiplex primer mix consistedof 150 nm coxA F1 150 nm coxA R1 150 nm ftsZ F1 150 nmftsZ R1 50 nmwsp F1 50 nmwsp R1 50 nm119882-spec F1 and50 nm 119882-spec R1 (Table 1) Multiplex PCR cycling condi-tions were 60 seconds at 95∘C 35 cycles of 60 seconds at 94∘C60 seconds at 53∘C ramp of 20 per second to 72∘C and 60seconds at 72∘C and 10 minutes at 72∘C

Three positive controls were used containing DNA fromthe three lines of Wolbachia-infected Drosophila simulansknown to have wMa wAu or wRi strains ofWolbachia [34]The negative control was DNA isolated from an uninfected

strain of D simulans Concentration sensitivity of the mul-tiplex was tested using a serial dilution of positive controlDNA template All samples and controls were then retestedusing an annealing temperature of 48∘C All PCR productswere run on 15 agarose gels to verify the presence ofamplified fragments multiplex PCR products had to be runfor a minimum of 45 minutes at 140V to be able to visualizeall four bands

3 Results And Discussion

Of the 120 samples tested with the universal invertebrate16s rDNA primer pair 116 tested positive yielding fragmentsapproximately 600 base pairs in length and indicating thepresence of PCR-viable DNA in the heart and gonad isolatesof 57 crayfish The multiplex used on the isolates from the57 crayfish failed to amplify any gene fragments Wolbachia-infected D simulans multiplex positive controls amplifiedappropriate sized gene fragments from all strains includingserial diluted template with a concentration of 02 ng120583LThenegative results from the multiplex assays of crayfish samplessupport the conclusion that Wolbachia pipientis is absentfrom this population of P clarkii

These results are consistent with a preliminary study ofWolbachia infection in P clarkia and Orconectes virilis [35]Using a different set of primers we failed to detectWolbachiain 15 individuals of O virilis collected from the Rio Grandenear Las Cruces NM we also failed to detect Wolbachia in12 individuals of wild caught P clarkia purchased from aLouisiana provider

It is not possible to prove the negative in this case thatP clarkii lacksWolbachia It is possible however to assess thelikelihood of a false negative given the experimental designThe probability of a false negative for Wolbachia infectionassays can be determined by the number of individuals testedand the infection frequency of the populationTheprobabilityof observing at least one infected individual in a sampleof 119899 individuals taken from a population with an infectionfrequency of 120583 is 1minus (1minus120583)119899 There is a near 100 probabilityof at least one positive result for an infection frequency of120583 = 01 and a 95 chance for infection frequencies as lowas 120583 = 005 (Figure 1) Consequently we feel that our resultsprovide robust evidence against the presence ofWolbachia inthis population of P clarkii

Advances in Ecology 3

Infection frequency (120583)000 005 010 015 020

Prob

abili

ty o

f det

ectio

n

00

02

04

06

08

10

Figure 1 The probability that at least one individual out of 57 willtest positive forWolbachia as a function of the population infectionfrequency 120583

In determining the frequency ofWolbachia across speciesand within individual species PCR assays are an invaluabletool However it must be recognized thatWolbachia infectionrates within a species can exist at low frequency [5] andthat Wolbachia-specific primers may not be effective onWolbachia strains exhibiting high levels of sequence diver-gence [30] In addition Wolbachia infection studies testingsmall numbers of individuals have a high likelihood of falsenegatives and can lead to erroneously low estimates of speciesinfection rates [5] As investigation continues intoWolbachiarsquoshost range effort must be made to prevent false negativeswhere possible

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Danny Kraemer for crayfish samplesand Bethany Cook for crayfish maintenance This work wassupported in part by NSF Grant (DUE 0926743) to W JBoecklen and A C James

References

[1] J H Werren ldquoBiology of Wolbachiardquo Annual Review of Ento-mology vol 42 pp 587ndash609 1997

[2] R Stouthamer J A J Breeuwer and G D D Hurst ldquoWolbachiapipientis microbial manipulator of arthropod reproductionrdquoAnnual Review of Microbiology vol 53 pp 71ndash102 1999

[3] J H Werren L Baldo and M E Clark ldquoWolbachia mastermanipulators of invertebrate biologyrdquo Nature Reviews Microbi-ology vol 6 no 10 pp 741ndash751 2008

[4] J H Werren D Windsor and L Guo ldquoDistribution of Wol-bachia among neotropical arthropodsrdquo Proceedings of the Royal

Society Series B Biological Sciences vol 262 no 1364 pp 197ndash204 1995

[5] K Hilgenboecker P Hammerstein P Schlattmann ATelschow and J H Werren ldquoHow many species are infectedwith Wolbachiamdasha statistical analysis of current datardquo FEMSMicrobiology Letters vol 281 no 2 pp 215ndash220 2008

[6] A A Hoffmann andM Turelli ldquoUnidirectional incompatibilityin Drosophila simulans inheritance geographic variation andfitness effectsrdquo Genetics vol 119 pp 435ndash444 1988

[7] M Hiroki Y Kato T Kamito and K Miura ldquoFeminization ofgenetic males by a symbiotic bacterium in a butterfly Euremahecabe (Lepidoptera Pieridae)rdquo Naturwissenschaften vol 89no 4 pp 167ndash170 2002

[8] I Negri M Pellecchia P J Mazzoglio A Patetta and AAlma ldquoFeminizing Wolbachia in Zyginidia pullula (InsectaHemiptera) a leafhopper with an XXXO sex-determinationsystemrdquo Proceedings of the Royal Society B Biological Sciencesvol 273 no 1599 pp 2409ndash2416 2006

[9] S Narita D Kageyama M Nomura and T Fukatsu ldquoUnex-pected mechanism of symbiont-induced reversal of insectsex feminizing Wolbachia continuously acts on the butterflyEurema hecabe during larval developmentrdquo Applied and Envi-ronmental Microbiology vol 73 no 13 pp 4332ndash4341 2007

[10] P Juchault T Rigaud and J P Mocquard ldquoEvolution of sex-determining mechanisms in a wild population of Armadihid-ium vulgare Latr (Crustacea Isopoda) competition betweentwo feminizing parasitic sex factorsrdquoHeredity vol 69 pp 382ndash390 1992

[11] T T M Vandekerckhove S Watteyne W Bonne et al ldquoEvolu-tionary trends in feminization and intersexuality in woodlice(Crustacea Isopoda) infected with Wolbachia pipientis (120572-Proteobacteria)rdquo Belgian Journal of Zoology vol 133 no 1 pp61ndash69 2003

[12] D Bouchon T Rigaud and P Juchault ldquoEvidence for wide-spread Wolbachia infection in isopod crustaceans molecularidentification and host feminizationrdquo Proceedings of the RoyalSociety B Biological Sciences vol 265 no 1401 pp 1081ndash10901998

[13] R Stouthamer and D J Kazmer ldquoCytogenetics of microbe-associated parthenogenesis and its consequences for gene flowin Trichogramma waspsrdquo Heredity vol 73 no 3 pp 317ndash3271994

[14] N Arakaki T Miyoshi and H Noda ldquoWolbachia-mediatedparthenogenesis in the predatory thrips Franklinothrips vespi-formis (Thysanoptera Insecta)rdquo Proceedings of the Royal SocietyB Biological Sciences vol 268 no 1471 pp 1011ndash1016 2001

[15] A R Weeks and J A J Breeuwer ldquoWolbachia-induced parthe-nogenesis in a genus of phytophagous mitesrdquo Proceedings of theRoyal Society Series B Biological Sciences vol 268 no 1482 pp2245ndash2251 2001

[16] R F Fialho and L Stevens ldquoMale-killing Wolbachia in a flourbeetlerdquo Proceedings of the Royal Society B Biological Sciencesvol 267 no 1451 pp 1469ndash1474 2000

[17] F M Jiggins G D D Hurst J H G V D Schulenburg andM E N Majerus ldquoTwo male-killing Wolbachia strains coexistwithin a population of the butterfly Acraea encedonrdquo Heredityvol 86 no 2 pp 161ndash166 2001

[18] K A Dyer and J Jaenike ldquoEvolutionarily stable infection by amale-killing endosymbiont in Drosophila innubila molecularevidence from the host and parasite genomesrdquoGenetics vol 168no 3 pp 1443ndash1455 2004


[19] G Bian Y Xu P Lu Y Xie and Z Xi ldquoThe endosymbiotic bac-terium Wolbachia induces resistance to dengue virus in Aedesaegyptirdquo PLoS Pathogens vol 6 no 4 Article ID e1000833 2010

[20] K Fenn C Conlon M Jones et al ldquoPhylogenetic relation-ships of the Wolbachia of nematodes and arthropodsrdquo PLoSPathogens vol 2 no 10 article e94 2006

[21] J A J Breeuwer and G Jacobs ldquoWolbachia intracellularmanipulators of mite reproductionrdquo Experimental and AppliedAcarology vol 20 no 8 pp 421ndash434 1996

[22] J H Werren W Zhang and L R Guo ldquoEvolution andphylogeny ofWolbachia reproductive parasites of arthropodsrdquoProceedings of the Royal Society B Biological Sciences vol 261no 1360 pp 55ndash63 1995

[23] B D Heath R D J Butcher W G F Whitfield and SF Hubbard ldquoHorizontal transfer of Wolbachia between phy-logenetically distant insect species by a naturally occurringmechanismrdquo Current Biology vol 9 no 6 pp 313ndash316 1999

[24] S M Rowley R J Raven and E A McGraw ldquoWolbachiapipientis in Australian spidersrdquo Current Microbiology vol 49no 3 pp 208ndash214 2004

[25] R Cordaux A Michel-Salzat and D Bouchon ldquoWolbachiainfection in crustaceans novel hosts and potential routes forhorizontal transmissionrdquo Journal of Evolutionary Biology vol14 no 2 pp 237ndash243 2001

[26] S R Bordenstein D H A Fitch and J H Werren ldquoAbsenceofWolbachia in nonfilariid nematodesrdquo Journal of Nematologyvol 35 no 3 pp 266ndash270 2003

[27] L H Evans and B F Edgerton ldquoPathogens parasites andcommensalsrdquo in Biology of Freshwater Crayfish D M HoldichEd pp 377ndash438 Blackwell Oxford UK 2002

[28] G Vogt L Tolley and G Scholtz ldquoLife stages and reproductivecomponents of the marmorkrebs (marbled crayfish) the firstparthenogenetic decapod Crustaceanrdquo Journal of Morphologyvol 261 no 3 pp 286ndash311 2004

[29] J V Huner ldquoProcambarusrdquo in Biology of Freshwater CrayfishD M Holdich Ed pp 541ndash584 Blackwell Publishing OxfordUK 2002

[30] S R Palumbi ldquoNucleic acids II the polymerase chain reactionrdquoin Molecular Systematics C Moritz D M Hillis and B KMable Eds p 236 Sinauer Associates SunderlandMass USA1996

[31] J HWerren and DMWindsor ldquoWolbachia infection frequen-cies in insects evidence of a global equilibriumrdquo Proceedings ofthe Royal Society B Biological Sciences vol 267 no 1450 pp1277ndash1285 2000

[32] W Zhou F Rousset and S OrsquoNeill ldquoPhylogeny and PCR-basedclassification of Wolbachia strains using wsp gene sequencesrdquoProceedings of the Royal Society B Biological Sciences vol 265no 1395 pp 509ndash515 1998

[33] L Baldo J C D Hotopp K A Jolley et al ldquoMultilocussequence typing system for the endosymbiont Wolbachia pip-ientisrdquo Applied and Environmental Microbiology vol 72 no 11pp 7098ndash7110 2006

[34] A C James and J W O Ballard ldquoExpression of cytoplasmicincompatibility in Drosophila simulans and its impact oninfection frequencies and distribution of Wolbachia pipientisrdquoEvolution vol 54 no 5 pp 1661ndash1672 2000

[35] D A Heneghan I A Hansen W J Boecklen and A CJames ldquoEvidence against the presence of Wolbachia in thecrayfish species Orconectes virilis and Procambarus clarkiirdquo

in Proceedings of the 97th Annual Ecological Society of Amer-ica Meeting (ESA rsquo12) Portland Ore USA August 2012httpecoconfexcomeco2012webprogramPaper39443html

Submit your manuscripts athttpwwwhindawicom

Forestry ResearchInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Environmental and Public Health

Journal of



EcosystemsJournal of


MeteorologyAdvances in

EcologyInternational Journal of


Marine BiologyJournal of


Hindawi Publishing Corporationhttpwwwhindawicom

Applied ampEnvironmentalSoil Science

Volume 2014

Advances in


Environmental Chemistry

Atmospheric SciencesInternational Journal of



Waste ManagementJournal of

Hindawi Publishing Corporation httpwwwhindawicom Volume 2014

International Journal of

Geophysics


Geological ResearchJournal of

EarthquakesJournal of


BiodiversityInternational Journal of


ScientificaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

OceanographyInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Journal of Computational Environmental SciencesHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


ClimatologyJournal of


Table 1 Multiplex primers

Primer Primer sequence Approximate fragment size SourceWolbachia specific forward CATACCTATTCGAAGGGATAG 450 [31]Wolbachia specific reverse AGCTTCGAGTGAAACCAATTCwsp 81F TGGTCCAATAAGTGATGAAGAAAC 600 [32]wsp 691R AAAAATTAAACGCTACTCCAcoxA F1 TTGGRGCRATYAACTTTATAG 500 [33]coxA R1 CTAAAGACTTTKACRCCAGTftsZ F1 ATYATGGARCATATAAARGATAG 550 [33]ftsZ R1 TCRAGYAATGGATTRGATAT

species of crayfish in North America and is a known vectorfor the European crayfish plague Aphanomyces astaci [29]

2 Materials and Methods

21 Husbandry and Sample Preparation We acquired 60southern Louisiana wild caught P clarkii from AtchafalayaBiological Supply Company of Raceland Lafourche ParishLA USA These crayfish were sampled from two or threenatural or seminatural ponds and were not exposed toantibiotics or microbial inhibitors (Danny Kraemer perscomm) At New Mexico State University crayfish were keptalive in 55 liter tanks and fed Hikari Crab Cuisine for fourdays prior to sample extraction

Gonad and heart tissue samples were isolated from 60P clarkii DNA extractions were done using the QiagenDNeasycopy blood and tissue kit DNA concentrations weremeasured via nanodrop and diluted to 20 ng120583L

22 Polymerase Chain Reaction Assay P clarkiiDNA isolateswere tested for PCR-viable DNA using a universal inverte-brate 16s primer pair 16Sar-5101584016Sbr-31015840 [30] PCR reactionstotaling 12 120583L consisted of 6 120583L Promegacopy PCR master mix2 120583L DNA and 4 120583L of 25 120583Mprimer mix Negative controlsconsisted of nuclease free water run through the DNAextraction protocol replacing DNA template in the PCRmixCycling conditions were 60 seconds at 95∘C 35 cycles of 60seconds at 94∘C 60 seconds at 42∘C and 90 seconds at 72∘Cand 10 minutes at 72∘C

We used PCR amplification with a multiplex of119882-specwsp coxA and ftsZ primers to test for the presence ofWolbachia in P clarkii tissue samples that tested positive forPCR-viable DNA PCR reactions totaling 19 120583L consisted of95 120583L Promegacopy PCR master mix 15 120583L DNA and 8 120583Lof multiplex primer mix Multiplex primer mix consistedof 150 nm coxA F1 150 nm coxA R1 150 nm ftsZ F1 150 nmftsZ R1 50 nmwsp F1 50 nmwsp R1 50 nm119882-spec F1 and50 nm 119882-spec R1 (Table 1) Multiplex PCR cycling condi-tions were 60 seconds at 95∘C 35 cycles of 60 seconds at 94∘C60 seconds at 53∘C ramp of 20 per second to 72∘C and 60seconds at 72∘C and 10 minutes at 72∘C

Three positive controls were used containing DNA fromthe three lines of Wolbachia-infected Drosophila simulansknown to have wMa wAu or wRi strains ofWolbachia [34]The negative control was DNA isolated from an uninfected

strain of D simulans Concentration sensitivity of the mul-tiplex was tested using a serial dilution of positive controlDNA template All samples and controls were then retestedusing an annealing temperature of 48∘C All PCR productswere run on 15 agarose gels to verify the presence ofamplified fragments multiplex PCR products had to be runfor a minimum of 45 minutes at 140V to be able to visualizeall four bands

3 Results And Discussion

Of the 120 samples tested with the universal invertebrate16s rDNA primer pair 116 tested positive yielding fragmentsapproximately 600 base pairs in length and indicating thepresence of PCR-viable DNA in the heart and gonad isolatesof 57 crayfish The multiplex used on the isolates from the57 crayfish failed to amplify any gene fragments Wolbachia-infected D simulans multiplex positive controls amplifiedappropriate sized gene fragments from all strains includingserial diluted template with a concentration of 02 ng120583LThenegative results from the multiplex assays of crayfish samplessupport the conclusion that Wolbachia pipientis is absentfrom this population of P clarkii

These results are consistent with a preliminary study ofWolbachia infection in P clarkia and Orconectes virilis [35]Using a different set of primers we failed to detectWolbachiain 15 individuals of O virilis collected from the Rio Grandenear Las Cruces NM we also failed to detect Wolbachia in12 individuals of wild caught P clarkia purchased from aLouisiana provider

It is not possible to prove the negative in this case thatP clarkii lacksWolbachia It is possible however to assess thelikelihood of a false negative given the experimental designThe probability of a false negative for Wolbachia infectionassays can be determined by the number of individuals testedand the infection frequency of the populationTheprobabilityof observing at least one infected individual in a sampleof 119899 individuals taken from a population with an infectionfrequency of 120583 is 1minus (1minus120583)119899 There is a near 100 probabilityof at least one positive result for an infection frequency of120583 = 01 and a 95 chance for infection frequencies as lowas 120583 = 005 (Figure 1) Consequently we feel that our resultsprovide robust evidence against the presence ofWolbachia inthis population of P clarkii



Prob

abili

ty o

f det

ectio

n

00

02

04

06

08

10





Acknowledgments


References











































Journal of












Volume 2014

Advances in









Geophysics
















Prob

abili

ty o

f det

ectio

n

00

02

04

06

08

10





Acknowledgments


References











































Journal of












Volume 2014

Advances in









Geophysics





































Journal of












Volume 2014

Advances in









Geophysics


















Journal of












Volume 2014

Advances in









Geophysics














Documents

Research Article Evidence against the Presence of