Research Article AP-1 Gene Expression Levels May Be ... Gene Expression Levels May... · [] L. Oua k, C. Berenguer-Daize, and Y. Berthois, Adrenom- edullin promotes cell cycle transit

Hindawi Publishing CorporationJournal of Signal TransductionVolume 2013 Article ID 497383 5 pageshttpdxdoiorg1011552013497383

Research ArticleAP-1 Gene Expression Levels May Be Correlated with Changes inGene Expression of Some Stemness Factors in Colon Carcinomas

Panagiotis Apostolou Maria Toloudi Eleni Ioannou Marina ChatziioannouEleni Kourtidou Ioanna Vlachou and Ioannis Papasotiriou

Research Genetic Cancer Centre Ltd (RGCC Ltd) Filotas 53070 Florina Greece

Correspondence should be addressed to Ioannis Papasotiriou papasotiriouioannisrgcc-genlabcom

Received 13 August 2013 Accepted 30 October 2013

Academic Editor Leonidas C Platanias

Copyright copy 2013 Panagiotis Apostolou et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

The AP-1 transcription factor is a heterodimer protein that regulates gene expression in response to a variety of extrinsic stimulithrough signal transduction It is involved in processes including differentiation proliferation and apoptosis Among the genes itregulates are transcription factors that contribute to the stemness phenotype Cancer stem cells have the ability to self-renew andinitiate differentiation into heterogenic cancer cells whichmay cause metastasis and relapses In the present study we evaluated theeffect ofAP-1 complexes aswell as theC-FOS andC-JUN genes in relation toNANOGOCT34 and SOX2 transcription factors Allassays were undertakenwith colon cancer stem cells Knockdown experiments with siRNAwere performed for each individual geneas well as their combination Changes in gene expression were calculated with quantitative polymerase chain reaction experimentswhile the effect on cell cycle distribution and apoptosis was studied by flow cytometry The results differed depending on thepercentage of repression as well as the gene that was suppressed In all cases the number of apoptotic cells was increased Thesefindings indicate that AP-1 may have a crucial role in the maintenance of cancer stem cells

1 Introduction

The AP-1 transcription factor consists of various proteinsincluding C-FOS and C-JUN Its function is to regulate geneexpression in response to many stimuli and it is involvedin multiple cellular processes such as differentiation pro-liferation and apoptosis [1 2] The monomers of the AP-1complex are encoded by different genes These transcriptionfactors are located downstreammany transduction pathwaysthus making their role critical [3 4] Cancer stem cells(CSCs) are cells that are defined by their ability to self-renewand undergo asymmetric cell division proliferation anddifferentiationWith respect to their origin these cellsmay becaused by disturbance of the self-renewal and differentiationprograms occurring in multipotential stem cells tissue-specific stem cells progenitor cells mature cells and cancercells [5] The hallmarks of the CSC phenotype are definedby many genes however NANOG POU5F1 (OCT34) andSOX2 have crucial roles [6 7]

Recent experimental data indicated that C-JUN is impor-tant for themaintenance of the self-renewal and tumorigenic-ity of glioma stem-like cells [8] According to another study incolon cancer C-JUN and TCF4 promoted a subpopulation ofcolorectal cancer tumor cells to adopt a stem-like phenotypevia the NANOG promoter [9] Moreover C-FOS maintainshematopoietic stem cells in quiescence [10]Thepresent studyaimed to identify the relationship between the AP-1 complexand stemness transcription factors We attempted to addresswhether the AP-1 transcription factor is necessary to activateor suppress NANOG OCT34 and SOX2 transcriptionfactors as well as if it has an effect on apoptosis and the cellcycle

2 Materials and Methods

21 Cell Culture Human colon cancer stem cells (36112-39PCelprogen) were cultured in appropriate growth medium

2 Journal of Signal Transduction

(M36112-39PS Celprogen) supplemented with 10 FBS in25 cm2 flasks (E36102-29P-T25 Celprogen) at 37∘C in a 5CO2environment

22 Knockdown During the exponential phase of prolifera-tion cells were seeded in 24-well plates (E36112-39 Celpro-gen) and transfected with small interfering RNA (siRNA)specific for C-JUN and C-FOS genes using Lipofectamine2000 (11668-027 Invitrogen) according to themanufacturerrsquosinstructions The siRNA were designed in accordance withthe rules of Reynolds et al [11] and the sequences were as fol-lows C-FOS 51015840 UAUCUGAGAAUCCAUCUUAUU 31015840 andC-JUN 51015840 ACAUCAUGGGCUAUUUUUA 31015840 All sequenceswere run onBLAST to exclude sequences that would suppressundesired genes and to ensure specificity After 48 h incuba-tion the cells were harvested by trypsinization (25200-072Invitrogen) Samples incubated with Lipofectamine alone(without siRNA) were also tested to study the effect ofcompound alone on gene expression

23 Evaluation of Cells Cells were tested in both cellularand molecular assays The cellular assays were based onthe ability of CSCs to form microspheres in semisuspen-sion using an inverted light microscope The cultures havepreviously been evaluated by molecular analyses includinggene expression analysis for specific transcription factors [12]The authentication of the control cell line was tested eachtime using molecular biology assays such as short tandemrepeat profiling the results of which were compared with themanufacturerrsquos profile Cultivation was continued for morethan 30 passages to exclude the possibility of incorporatingembryonic stem cells (ESCs) in the experiments since cancerstem cells are immortal unlike ESCs

24 Molecular Analysis RNA was extracted from cell cul-tures using an RNeasy Mini Kit (74105 Qiagen) The RNAsamples were evaluated both spectrophotometrically and onagarose gel by checking the 18S-28S rRNA bands Then 1120583gof each sample was used as template for cDNA synthesisusing an iScript cDNA synthesis kit (1708891 Bio-Rad)Finally the upper strand was used as template for real-time polymerase chain reaction (PCR) which was performedusing the iTaq Universal SYBR Green Supermix (1725124Bio-Rad) Specific primers for each marker and for anendogenous control gene (18S rRNA) were designed usingGene Expression 11 software The sequence of primers wasrun on BLAST to exclude those that would amplify unde-sired genes The sequence of the primers was as follows18SrRNA forwardmdash51015840 TGCCCTATCAACTTTCGATGG-TAGTC 31015840 reversemdash51015840 TTGGATGTGGTAGCCGTTTCT-CA 31015840NANOG forwardmdash51015840 TGAGATGCCTCACACGGA-GACTG 31015840 reversemdash51015840 GGGTTGTTTGCCTTTGGGACT-G 31015840 POU5F1 forwardmdash51015840 GGTGCCTGCCCTTCTAGG-AATG 31015840 reversemdash51015840 TGCCCCCACCCTTTGTGTTC 31015840SOX2 forwardmdash51015840 CAACGGCAGCTACAGCATGATG 31015840reversemdash51015840 GCGAGCTGGTCATGGAGTTGTACT 31015840 C-FOS forwardmdash51015840 CCTTCACCCTGCCTCTCCTCAAT 31015840reversemdash51015840 GCCTGGATGATGCTGGGAACA 31015840 C-JUN

forwardmdash51015840 CCAACTCATGCTAACGCAGCAGTT 31015840reversemdash51015840 ACCCTTGGCTTTAGTTCTCGGACAC 31015840 ThePCR program was as follows initial denaturation at 95∘Care 50 cycles of denaturation at 95∘C for 10 sec followedby annealing at 59∘C for 30 sec A final extension step wasperformed at 72∘C for 10min followed by melting curveanalyses Data were analyzed according to the Livak method[13]

25 Flow Cytometry Cells were stained with PE Annex-in V and 7-Amino-Actinomycin (7AAD) (559763 BD Bio-sciences) for 15min and then resuspended in 05 mL sheathfluid (8546859 Beckman Coulter) followed by flow cyto-metric analysis of more than 50000 events The data wereanalyzed with FCS Express Software (DeNovo) In each casepositive and negative controls were used

26 Statistical Analysis The quantitative polymerase chainreaction (qPCR) results were tested according to theKolmogorov-Smirnov test all samples had normal distribu-tionMedian values were used for the analysis FinallyMann-Whitney U tests were also performed on the qPCR data

3 Results and Discussion

31 Gene Expression Knockdown was up to 55 for C-FOSand up to 45 when C-FOS and C-JUN were knocked downsimultaneously while lower rates were observed followingknockdown of C-JUN The suppression of C-FOS led toincreases in the gene expression of stemness transcriptionfactors In comparison with the control cells the increasein gene expression was 235-fold for NANOG 293-fold forPOU5F1 (Oct34) and 268-fold for SOX2 Knockdown ofC-JUN led to increases in POU5F1 and SOX2 expression of130 and 30 respectively while no changes were observedin NANOG this was in contrast to data resulting fromsimultaneous repression of C-JUN and C-FOS The resultsalso differed depending on the rate of reduction in geneexpression In all cases an increase was observed in POU5F1expression with decreases in the other genes Suppression ofthe AP-1 complex by 45 led to a 90 increase in POU5F1expression and a reduction of 10 and 3 in NANOGand SOX2 expression respectively NANOG expression wasreduced up to 50 when knockdown reached up to 35POU5F1 and SOX2 were less affected Figures 1 2 3 and 4graphically represent the above results

32 Cell Cycle Distribution The number of cells undergoingapoptosis was three times higher following suppression ofboth genes by 45 Under the same conditions it wasobserved that there was an increase in dead cells of 15 timesthat of the control cells C-FOS knockdown only led to adoubling of dead cells however there was no change in thenumber of cells undergoing apoptosis (Table 1)

CSCs are defined by their ability to self-renew differ-entiate and proliferate These cells are proposed to initiatetumor formation and propagate metastasis [14] Accordingto experimental data there is evidence to indicate that

Journal of Signal Transduction 3

000

050

100

150

200

250

300

Control C-FOS knockdown

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)

Figure 1 Relative gene expression analysis of stemness transcriptionfactors Nanog Oct34 and Sox2 after c-FOS knockdown Changesin gene expression caused by the suppression of C-FOS Thepercentage of knockdown reached 55

000010020030040050060070080

Control C-JUN knockdown

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)

Figure 2 Relative gene expression analysis of stemness transcrip-tion factors Nanog Oct34 and Sox2 after C-JUN knockdownChanges in gene expression caused by the suppression ofC-JUNThepercentage of knockdown reached 30

the hallmarks of CSCs are defined by many transcriptionfactors but the most important are NANOG OCT34 andSOX2 NANOG is expressed in ESCs and has an importantrole inmaintaining pluripotencyOverexpression ofNANOGcauses self-renewal of ESCs while its absence leads todifferentiation [15ndash18] To maintain stemness the presenceand most likely collaboration of two further transcriptionfactors OCT34 and SOX2 are required OCT34 expressionis also associated with the undifferentiated stage and self-renewal It forms a heterodimer with SOX2 which bindsDNA SOX2 is a transcription factor essential formaintainingpluripotency but its ectopic expression may be related toabnormal differentiation of colorectal cancer cells [19ndash21]

Although little is known about their origin CSCs are asubpopulation of heterogeneous tumors that has the abilityto enter the bloodstream and migrate to colonize secondarysites thus resulting in metastases and relapses The epithelial

000

010

020

030

040

050

Control AP-1 knockdown

minus020

minus010

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)

Figure 3 Relative gene expression analysis of stemness tran-scription factors Nanog Oct34 and Sox2 after AP-1 complexknockdown Changes in gene expression caused by the suppressionof AP-1 The percentage of knockdown reached 45

000Control AP-1 knockdown (II)

minus100

minus080

minus060

minus040

minus020

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)

Figure 4 Relative gene expression analysis of stemness transcrip-tion factors Nanog Oct34 and Sox2 after AP-1 complex knock-down (II) Changes in gene expression caused by the suppression ofAP-1 The percentage of knockdown reached 35

to mesenchymal transition (EMT) and the reverse process(mesenchymal to epithelial transition (MET)) contribute tothis [22 23]

The AP-1 transcription factor consists mainly of the C-FOS and C-JUN proteins C-FOS is a protooncogene andhas a leucine zipper DNA-binding domain [24] C-JUN isalso a proto-oncogene that has important roles in cellularproliferation and apoptosis [25] The AP-1 transcription fac-tor acts downstream many transduction pathways thereforemany processes are implicated Recent studies have demon-strated that C-JUN and C-FOS are also involved in stemnesspathways C-JUN has a pivotal role in the maintenance ofself-renewal and tumorigenicity in glioma stem-like cells Incontrast another study has implicated AP-1 andNF-120581B in thedifferentiation of mouse ESCs [8 26ndash28]


Table 1 Percentage of dead cells and cells undergoing apoptosisbefore and after knockdown

Cell line Cells undergoingapoptosis () Dead cells ()

Control 148 440C-FOS knockdown 168 742C-JUN knockdown 493 406AP-1 knockdown (45) 639 576AP-1 knockdown (35) 261 371

Therefore it is clear that there is a relationship betweenthe AP-1 transcription factor and stemness The presentstudy aimed to clarify this relationship in colon CSCsThe contribution of the AP-1 complex has been shown inapoptosis alongside that of the individual proteins AP-1seems to play a crucial role in the maintenance of stemnessby controlling NANOG OCT34 and SOX2 Suppression ofAP-1 led to a reduction in the levels of NANOG and SOX2gene expression which in turn led to an increase in thenumber of cells undergoing apoptosis It may be that cellswhich cannot maintain the hallmarks of stemness eventuallyundergo apoptosis

4 Conclusions

Thepresent study indicated that the AP-1 transcription factormay be strongly related to the stemness phenotype in colonCSCs The reduction of its expression leads to changes in theexpression of major transcription factors that are essentialfor maintaining pluripotency and undifferentiation Furtherstudies need to be performed to further investigate thiscorrelation

Abbreviations

CSCs Cancer stem cellssiRNA Small interfering RNAqPCR Quantitative polymerase chain reactionESCs Embryonic stem cellsEMT Epithelial to mesenchymal transitionMET Mesenchymal to epithelial transitionNF-120581B Nuclear factor kappa-light-chain-enhancer

of activated B cells

Conflict of Interests

The authors declare that they have no competing interests

References

[1] J Hess P Angel and M Schorpp-Kistner ldquoAP-1 subunitsquarrel and harmony among siblingsrdquo Journal of Cell Sciencevol 117 part 25 pp 5965ndash5973 2004

[2] M Ameyar MWisniewska and J BWeitzman ldquoA role for AP-1 in apoptosis the case for and againstrdquo Biochimie vol 85 no 8pp 747ndash752 2003

[3] L Ouafik C Berenguer-Daize and Y Berthois ldquoAdrenom-edullin promotes cell cycle transit and up-regulates cyclin D1protein level in human glioblastoma cells through the activa-tion of c-JunJNKAP-1 signal transduction pathwayrdquo CellularSignalling vol 21 no 4 pp 597ndash608 2009

[4] C-J Weng C-F Chau Y-S Hsieh S-F Yang and G-CYen ldquoLucidenic acid inhibits PMA-induced invasion of humanhepatoma cells through inactivating MAPKERK signal trans-duction pathway and reducing binding activities of NF-120581B andAP-1rdquo Carcinogenesis vol 29 no 1 pp 147ndash156 2008

[5] Y Bu and D Cao ldquoThe origin of cancer stem cellsrdquo Frontiers inBioscience vol 4 pp 819ndash830 2012

[6] S-H Chiou C-C Yu C-Y Huang et al ldquoPositive correlationsof Oct-4 and Nanog in oral cancer stem-like cells and high-grade oral squamous cell carcinomardquo Clinical Cancer Researchvol 14 no 13 pp 4085ndash4095 2008

[7] R Xiang D Liao T Cheng et al ldquoDownregulation of transcrip-tion factor SOX2 in cancer stem cells suppresses growth andmetastasis of lung cancerrdquo British Journal of Cancer vol 104no 9 pp 1410ndash1417 2011

[8] C-H Yoon M-J Kim R-K Kim et al ldquoc-Jun N-terminalkinase has a pivotal role in the maintenance of self-renewal andtumorigenicity in glioma stem-like cellsrdquo Oncogene vol 31 no44 pp 4655ndash4666 2012

[9] E E Ibrahim R Babaei-Jadidi A Saadeddin et al ldquoEmbryonicNANOG activity defines colorectal cancer stem cells andmodulates through AP1- and TCF-dependent mechanismsrdquoStem Cells vol 30 no 10 pp 2076ndash2087 2012

[10] S Okada T Fukuda K Inada and T Tokuhisa ldquoProlongedexpression of c-fos suppresses cell cycle entry of dormanthematopoietic stem cellsrdquo Blood vol 93 no 3 pp 816ndash8251999

[11] A Reynolds D Leake Q Boese S ScaringeW SMarshall andA Khvorova ldquoRational siRNA design for RNA interferencerdquoNature Biotechnology vol 22 no 3 pp 326ndash330 2004

[12] M Toloudi P Apostolou M Chatziioannou and I Papa-sotiriou ldquoCorrelation between cancer stem cells and circulatingtumor cells and their valuerdquoCase Reports inOncology vol 4 no1 pp 44ndash54 2011

[13] K J Livak and T D Schmittgen ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the 2-ΔΔCT methodrdquoMethods vol 25 no 4 pp 402ndash408 2001

[14] X Z Wu ldquoOrigin of cancer stem cells the role of self-renewaland differentiationrdquo Annals of Surgical Oncology vol 15 no 2pp 407ndash414 2008

[15] G Pan and J AThomson ldquoNanog and transcriptional networksin embryonic stem cell pluripotencyrdquo Cell Research vol 17 no1 pp 42ndash49 2007

[16] N Hattori Y Imao K Nishino et al ldquoEpigenetic regulationof Nanog gene in embryonic stem and trophoblast stem cellsrdquoGenes to Cells vol 12 no 3 pp 387ndash396 2007

[17] B Boer J L Cox D Claassen S K Mallanna M Desler andA Rizzino ldquoRegulation of the Nanog gene by both positiveand negative cis-regulatory elements in embryonal carcinomacells and embryonic stem cellsrdquo Molecular Reproduction andDevelopment vol 76 no 2 pp 173ndash182 2009

[18] S Das S Jena and D N Levasseur ldquoAlternative splicingproduces nanog protein variants with different capacities forself-renewal and pluripotency in embryonic stem cellsrdquo TheJournal of Biological Chemistry vol 286 no 49 pp 42690ndash42703 2011


[19] D J Rodda J-L Chew L-H Lim et al ldquoTranscriptionalregulation of Nanog by OCT4 and SOX2rdquo The Journal ofBiological Chemistry vol 280 no 26 pp 24731ndash24737 2005

[20] Y Tani Y Akiyama H Fukamachi K Yanagihara andY Yuasa ldquoTranscription factor SOX2 up-regulates stomach-specific pepsinogen A gene expressionrdquo Journal of CancerResearch and Clinical Oncology vol 133 no 4 pp 263ndash2692007

[21] Z Zhu G Wu H Wei et al ldquoInvestigation of the permeabilityand optical clearing ability of different analytes in humannormal and cancerous breast tissues by spectral domain OCTrdquoJournal of Biophotonics vol 5 no 7 pp 536ndash543 2012

[22] S A Mani W Guo M-J Liao et al ldquoThe epithelial-mesenchymal transition generates cells with properties of stemcellsrdquo Cell vol 133 no 4 pp 704ndash715 2008

[23] R Kalluri and R A Weinberg ldquoThe basics of epithelial-mesenchymal transitionrdquo The Journal of Clinical Investigationvol 119 no 6 pp 1420ndash1428 2009

[24] J N M Glover and S C Harrison ldquoCrystal structure of theheterodimeric bZIP transcription factor c-Fos-c Jun bound toDNArdquo Nature vol 373 no 6511 pp 257ndash261 1995

[25] S-R Yang S-D Cho N-S Ahn et al ldquoThe role of p38 MAPkinase and c-Jun N-terminal protein kinase signaling in thedifferentiation and apoptosis of immortalized neural stem cellsrdquoMutation Research vol 579 no 1-2 pp 47ndash57 2005

[26] Y Wo D Zhu Y Yu and Y Lou ldquoInvolvement of NF-120581B andAP-1 activation in icariin promoted cardiac differentiation ofmouse embryonic stem cellsrdquo European Journal of Pharmacol-ogy vol 586 no 1ndash3 pp 59ndash66 2008

[27] U Steidl F Rosenbauer R G W Verhaak et al ldquoEssential roleof Jun family transcription factors in PU1 knockdown-inducedleukemic stem cellsrdquo Nature Genetics vol 38 no 11 pp 1269ndash1277 2006

[28] S Mruthyunjaya M Rumma G Ravibhushan S Anjali andS Padma ldquoc-JunAP-1 transcription factor regulates laminin-1-induced neurite outgrowth in human bone marrow mes-enchymal stem cells role of multiple signaling pathwaysrdquo FEBSLetters vol 585 no 12 pp 1915ndash1922 2011

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


(M36112-39PS Celprogen) supplemented with 10 FBS in25 cm2 flasks (E36102-29P-T25 Celprogen) at 37∘C in a 5CO2environment

22 Knockdown During the exponential phase of prolifera-tion cells were seeded in 24-well plates (E36112-39 Celpro-gen) and transfected with small interfering RNA (siRNA)specific for C-JUN and C-FOS genes using Lipofectamine2000 (11668-027 Invitrogen) according to themanufacturerrsquosinstructions The siRNA were designed in accordance withthe rules of Reynolds et al [11] and the sequences were as fol-lows C-FOS 51015840 UAUCUGAGAAUCCAUCUUAUU 31015840 andC-JUN 51015840 ACAUCAUGGGCUAUUUUUA 31015840 All sequenceswere run onBLAST to exclude sequences that would suppressundesired genes and to ensure specificity After 48 h incuba-tion the cells were harvested by trypsinization (25200-072Invitrogen) Samples incubated with Lipofectamine alone(without siRNA) were also tested to study the effect ofcompound alone on gene expression

23 Evaluation of Cells Cells were tested in both cellularand molecular assays The cellular assays were based onthe ability of CSCs to form microspheres in semisuspen-sion using an inverted light microscope The cultures havepreviously been evaluated by molecular analyses includinggene expression analysis for specific transcription factors [12]The authentication of the control cell line was tested eachtime using molecular biology assays such as short tandemrepeat profiling the results of which were compared with themanufacturerrsquos profile Cultivation was continued for morethan 30 passages to exclude the possibility of incorporatingembryonic stem cells (ESCs) in the experiments since cancerstem cells are immortal unlike ESCs

24 Molecular Analysis RNA was extracted from cell cul-tures using an RNeasy Mini Kit (74105 Qiagen) The RNAsamples were evaluated both spectrophotometrically and onagarose gel by checking the 18S-28S rRNA bands Then 1120583gof each sample was used as template for cDNA synthesisusing an iScript cDNA synthesis kit (1708891 Bio-Rad)Finally the upper strand was used as template for real-time polymerase chain reaction (PCR) which was performedusing the iTaq Universal SYBR Green Supermix (1725124Bio-Rad) Specific primers for each marker and for anendogenous control gene (18S rRNA) were designed usingGene Expression 11 software The sequence of primers wasrun on BLAST to exclude those that would amplify unde-sired genes The sequence of the primers was as follows18SrRNA forwardmdash51015840 TGCCCTATCAACTTTCGATGG-TAGTC 31015840 reversemdash51015840 TTGGATGTGGTAGCCGTTTCT-CA 31015840NANOG forwardmdash51015840 TGAGATGCCTCACACGGA-GACTG 31015840 reversemdash51015840 GGGTTGTTTGCCTTTGGGACT-G 31015840 POU5F1 forwardmdash51015840 GGTGCCTGCCCTTCTAGG-AATG 31015840 reversemdash51015840 TGCCCCCACCCTTTGTGTTC 31015840SOX2 forwardmdash51015840 CAACGGCAGCTACAGCATGATG 31015840reversemdash51015840 GCGAGCTGGTCATGGAGTTGTACT 31015840 C-FOS forwardmdash51015840 CCTTCACCCTGCCTCTCCTCAAT 31015840reversemdash51015840 GCCTGGATGATGCTGGGAACA 31015840 C-JUN

forwardmdash51015840 CCAACTCATGCTAACGCAGCAGTT 31015840reversemdash51015840 ACCCTTGGCTTTAGTTCTCGGACAC 31015840 ThePCR program was as follows initial denaturation at 95∘Care 50 cycles of denaturation at 95∘C for 10 sec followedby annealing at 59∘C for 30 sec A final extension step wasperformed at 72∘C for 10min followed by melting curveanalyses Data were analyzed according to the Livak method[13]

25 Flow Cytometry Cells were stained with PE Annex-in V and 7-Amino-Actinomycin (7AAD) (559763 BD Bio-sciences) for 15min and then resuspended in 05 mL sheathfluid (8546859 Beckman Coulter) followed by flow cyto-metric analysis of more than 50000 events The data wereanalyzed with FCS Express Software (DeNovo) In each casepositive and negative controls were used

26 Statistical Analysis The quantitative polymerase chainreaction (qPCR) results were tested according to theKolmogorov-Smirnov test all samples had normal distribu-tionMedian values were used for the analysis FinallyMann-Whitney U tests were also performed on the qPCR data

3 Results and Discussion

31 Gene Expression Knockdown was up to 55 for C-FOSand up to 45 when C-FOS and C-JUN were knocked downsimultaneously while lower rates were observed followingknockdown of C-JUN The suppression of C-FOS led toincreases in the gene expression of stemness transcriptionfactors In comparison with the control cells the increasein gene expression was 235-fold for NANOG 293-fold forPOU5F1 (Oct34) and 268-fold for SOX2 Knockdown ofC-JUN led to increases in POU5F1 and SOX2 expression of130 and 30 respectively while no changes were observedin NANOG this was in contrast to data resulting fromsimultaneous repression of C-JUN and C-FOS The resultsalso differed depending on the rate of reduction in geneexpression In all cases an increase was observed in POU5F1expression with decreases in the other genes Suppression ofthe AP-1 complex by 45 led to a 90 increase in POU5F1expression and a reduction of 10 and 3 in NANOGand SOX2 expression respectively NANOG expression wasreduced up to 50 when knockdown reached up to 35POU5F1 and SOX2 were less affected Figures 1 2 3 and 4graphically represent the above results

32 Cell Cycle Distribution The number of cells undergoingapoptosis was three times higher following suppression ofboth genes by 45 Under the same conditions it wasobserved that there was an increase in dead cells of 15 timesthat of the control cells C-FOS knockdown only led to adoubling of dead cells however there was no change in thenumber of cells undergoing apoptosis (Table 1)

CSCs are defined by their ability to self-renew differ-entiate and proliferate These cells are proposed to initiatetumor formation and propagate metastasis [14] Accordingto experimental data there is evidence to indicate that


000

050

100

150

200

250

300


NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)


000010020030040050060070080


NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)




000

010

020

030

040

050


minus020

minus010

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)



minus100

minus080

minus060

minus040

minus020

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)









4 Conclusions


Abbreviations





References





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


000

050

100

150

200

250

300


NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)


000010020030040050060070080


NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)




000

010

020

030

040

050


minus020

minus010

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)



minus100

minus080

minus060

minus040

minus020

NANOGOCT34SOX2

2minusΔΔ

Ct

(log2

)









4 Conclusions


Abbreviations





References





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






4 Conclusions


Abbreviations





References





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



















Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Documents

Research Article AP-1 Gene Expression Levels May Be ... Gene Expression Levels May... · [] L. Oua k, C. Berenguer-Daize, and Y. Berthois, Adrenom- edullin promotes cell cycle transit