REGULATION OF VERTEBRATE PLANAR CELL POLARITY

by

Jason Trinh

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Molecular Genetics

University of Toronto

© Copyright by Jason Trinh 2009

ii

REGULATION OF VERTEBRATE PLANAR CELL POLARITY Jason Trinh Master of Science 2009 Graduate Department of Molecular Genetics, University of Toronto Abstract

Planar cell polarity (PCP) provides positional information to a field of cells, coordinating

the orientation of polarized structures or the direction of polarized cell movements. An

evolutionarily conserved signalling pathway regulates PCP, however, the cue that

establishes PCP is unknown. There is a strong precedent for Wnt signalling to act as the

cue to establish PCP. Here I perform in vivo assays of cell polarity to examine the role of

non-canonical Wnt signalling in regulating PCP, using zebrafish neural progenitor cells

and asymmetric membrane localization of GFP-Prickle (a PCP cytoplasmic effector

molecule) as a model system. My preliminary evidence suggests Wnt4a provides

positional information to cells in the neural tube. In addition, using a membrane-yeast-

two-hybrid approach to discover novel regulators of PCP, I identified Ring Finger 41 as a

new binding partner to Van-gogh-like-2 (an essential PCP signalling molecule) and a

novel regulator of vertebrate PCP.

iii

Acknowledgements I would like to thank Dr. Brian Ciruna for his supervision, guidance and support

throughout my graduate school studies. I would like to thank my committee members,

Dr. Julie Brill and Dr. Helen McNeill for their guidance and expertise. Thank you to the

Ontario Graduate Scholarship Program and SickKids Research Training Centre for

providing funding. In addition, thank you to: Dr. Dan Voskas for being a mentor and

friend, Dr. Dani Gelinas for her continuous encouragementand support, Sasha Fernando

for his expert care of the zebrafish as well as all past and present members of the Ciruna

Lab. I would like to thank my family for supporting me without really understanding

what I do. Finally, I would like to thank Andrea for being my fellow passenger on this

adventure. You are my light.

iv

Table of Contents CHAPTER 1: BACKGROUND 1 1.0: Introduction 1 1.1: Planar Cell Polarity Signalling 2 1.2: Regulation of Planar Cell Polarity 5 1.3: Vertebrate Planar Cell Polarity Regulates Morphogenesis 8 1.4: Vertebrate Planar Cell Polarity Signalling 12 1.5: Regulation of Vertebrate Planar Cell Polarity 16 1.5.1: Non-canonical Wnt signalling regulates planar cell polarity 16 1.5.2: Vertebrate specific regulators of planar cell polarity are associated with Wnt signalling 17 1.5.3: The search for a global cue that establishes planar cell polarity 19 1.6: References 20 CHAPTER 2: INVESTIGATING THE ROLE OF WNT SIGNALLING IN VERTEBRATE PLANAR CELL POLARITY 24 2.0: Introduction 24 2.1: Results 30

2.1.1: Heterochronic cell transplantation is possible 30 2.1.2: Characterization of Wnt clones 33 2.1.3: Localized ectopic Wnt4a expression is able to alter neural

progenitor cell behaviour 38 2.2: Discussion 43

2.2.1: Anterior-posterior Wnt4a gradient provides positional information to neural progenitor cells 43

2.3: Methods 46 2.3.1: Materials 46 2.3.2: Zebrafish embryo microinjection 47 2.3.3: Cell transplants 48 2.3.4: Microscopy 48 2.3.5: Transgenesis 48

2.4: References 49 CHAPTER 3: DISCOVERY OF NOVEL REGULAORS OF PLANAR CELL POLARITY 3.0: Introduction 51 3.1: Results 54 3.1.1: Characterization of baits 54 3.1.2: Analysis of screen hits 56 3.1.3: Validation of MYTH screen 62 3.1.4: Ectopic expression of RNF41 disrupts PCP signalling 65 3.1.5: RNF41 subcellular localization suggests a new link between PCP and cilia 71

v

3.2: Discussion 72 3.2.1: RNF41 may regulate planar cell polarity through Vangl2 72 3.2.2: RNF41 localizes to the basal body and may regulate non-canonical signalling 74 3.3: Methods 74 3.3.1: Materials 74 3.3.2: Bait/Prey vector construction by homologous recombination gap repair 75 3.3.3: NubG/I Test 76 3.3.4: MYTH 76 3.3.5: Zebrafish microinjection 77 3.3.6: Immunoprecipitation and western blotting 78 3.2.7: in situ hybridization 79 3.2.8: Microscopy 79 3.4: References 80

CHAPTER 4: FUTURE DIRECTIONS 4.0: Preliminary results suggest Wnt4a provides positional information to neural progenitor cells 81 4.1: Addressing the instructive/permissive role of non-canonical Wnts 82 4.2: The role of RNF41 in regulating planar cell polarity 85 4.3: The cue that establishes planar cell polarity remains elusive 86 4.4: References 88

vi

List of Figures and Tables Figure 1 Planar cell polarity generates positional information 3 Figure 2 Models of PCP establishment 6 Figure 3 Convergent extension movements 10 Figure 4 Wnt signalling 13 Figure 5 Instructive versus permissive functions of Wnt 25 Figure 6 GFP-Pk as a maker of PCP 28 Figure 7 Heterochronic cell transplants are possible and do not disrupt

PCP 32 Figure 8 Injected Wnt mRNA is expressed and secreted 34 Figure 9 Ectopic non-canonical Wnt expression induces morphological defects 36 Figure 10 Ectopic Wnt4a expression induces neural tube defects with GFP-Pk puncta localized to the membrane 37 Figure 11 Neural progenitor cells respond differently to a Wnt4a clone with respect to its position 40 Figure 12 Transgenic approach to generate localized Wnt source in the neural tube 42 Figure 13 Wnt4a gradients may provide positional information to neural progenitor cells 44 Figure 14 Membrane yeast two hybrid (MYTH) 53 Table 1 Summary of bait construction 57 Figure 15 Characterization of baits 57-58 Table 2 MYTH screen hits 59 Figure 16 Analysis of hits 63 Figure 17 Validation of MYTH screen with known protein interactions 64 Figure 18 Co-immunoprecipitation shows that Vangl2 and RNF41 physically interact 66 Figure 19 Endogenous RNF41 expression 68 Figure 20 Ectopic RNF41 expression induces convergent extension defets 69 Figure 21 RNF41 regulates GFP-Pk localization 70 Figure 22 RNF41 localization suggests a role in regulating cilia 73 Figure 23 Temperature versus voltage standard curve 84 Figure 24 Local heat shock with a modified soldering iron is able to induce transgene expression in cells in the neural tube 84

1

CHAPTER 1: Background 1.0: Introduction

Cell polarity exists when cellular components have asymmetric characteristics at

different points within the cell. Potentially, proteins are localized or cellular structures are

formed in one region of the cell and not another. Many different cell types exhibit

individual or cellular polarization. For example, epithelial cells are polarized along the

apical-basal axis and mesenchymal cells are polarized in the direction of migration. During

animal development, cells are individually polarized, but often groups of cells within a

tissue are coordinated with the polarity of the tissue [1]. Tissue or planar polarity is

required to give cells positional information in the plane in order to position polarized

structures or undergo directed cell movement. [2]. Coordinated polarization across a field

of cells is called planar cell polarity (PCP). There are many examples of PCP in numerous

model systems. PCP has been shown to be required for proper alignment of hairs on

mammalian skin and on the Drosophila wing as well as coordinated mass movements of

cells during vertebrate embryonic development [1][3]. Early studies of PCP were

conducted in Drosophila, as it was one of the first animals where PCP was recognized

and can be found in adult tissues [2][4]. In Drosophila, mutations of PCP genes caused

disorganization of cuticle structures and the compound eye [2]. More specifically, wing

cells which are normally polarized along the proximal-distal axis, display swirly hair

patterns [2]. In the Drosophila eye, PCP mutants have defects in the organization of

photoreceptors [2]. Based on these phenotypes, mutants were identified and a group of

genes (core PCP genes) that are required in all polarized tissues was identified [4].

2

1.1: Planar Cell Polarity Signalling

The genetic control of PCP was first studied in the cuticle structures of

Drosophila, namely the hairs of the wing blade where loss-of function mutants displayed

swirly hair patterns [2]. A set of six genes were discovered, the core PCP genes that are

required in all tissues: frizzled (fz), which encodes a seven-pass transmembrane protein

with an extracellular cysteine-rich domain (CRD) which binds Wingless/Wnt protein;

dishevelled (dsh), which encodes a cytoplasmic adaptor protein that interacts with small

GTPases; van gogh (vang), which encodes a four-pass transmembrane protein that

interacts with Prickle (Pk), a cytoplasmic effector protein; flamingo (fmi), which encodes

a seven-pass transmembrane atypical cadherin; and diego (dgo) which encodes a

cytoplasmic effector ankryin-repeat protein. In the wing, the core PCP genes are required

for placement of hairs that are produced by each cell [1]. Normally, the hairs grow on the

apical surface of the distal side of the wing cell, growing out distally (Figure 1A). Loss-

of-function mutations in the core PCP genes disrupt the organization of hairs resulting in

growth of hairs from the centre of the apical surface of the wing cell [1].

Cells within a plane require PCP for positional information to orient polarized

structures like hairs. The generation of positional information is possibly the result of

asymmetric sub-cellular localization of the core PCP gene products (Figure 1B). In the

Drosophila wing, before the onset of PCP signalling, all core PCP proteins are localized

uniformly around the apical-lateral membrane, partially overlapping with cellular

junctions [2]. PCP signalling induces asymmetric localization of the PCP components

into two complexes across the proximal-distal axis. At the distal side, Fz recruits Dsh

3

Figure 1: Planar Cell Polarity Generates Positional Information (A) PCP genes give positional information to a field of cells required to orient a polarized structure. In the Drosophila wing, hairs are formed on the distal side of the cell, where in core PCP mutants, cells are not polarized in the plane and hairs are formed in the centre of the cell. (B) The core PCP components generate positional information from asymmetric localization of the core PCP components inside the cell. Fz, Dsh and Dgo act positively to promote PCP are localized to the distal side of the wing cell, while negative factors are localized to the proximal side of the wing cell.

4

and Dgo and acts positively, promoting downstream activation of Dsh effectors and

ultimately generation of a polarized structure. At the proximal side, Vang and Pk are

localized and act negatively to limit Dsh activation [5]. The only core PCP protein that is

not asymmetrically localized is Fmi, as it localizes to both Fz and Vang. The localization

of the core PCP proteins appears to be dependent on the transmembrane core PCP

proteins. Absence of Fz, Vang or Fmi results in loss of or strongly reduced apical

localization of the other core PCP components. Loss of Dsh, Pk or Dgo alone does not

affect apical localization of the other core PCP proteins [4].

Fz and Vang are able to induce polarization of PCP components in both cell-

autonomous and non-autonomous fashion. Fz and Vang are required for apical

localization of the core PCP components and recruitment of downstream effectors to

distal and proximal sides. In addition, Fz and Vang can also alter polarization and

localization of PCP components in neighbouring cells, suggesting that Fz/Vang are

involved in cell-cell communication and propagation of PCP establishment. Clonal

analysis of fz and vang in Drosophila has clearly demonstrated domineering non-

autonomy of fz and vang, which means that loss-of-function fz clones in the Drosophila

wing are able to affect the polarity of adjacent WT cells, resulting in hairs pointing

towards the fz clone. Similarly, loss-of-function of vang clones are able to change

polarity of neighbouring wing cells, however the hairs point away from the vang clone.

When examining other PCP genes like dsh or fmi, loss-of-function clones of dsh or fmi do

not act cell non-autonomously as indicated by normal polarization of hairs in adjacent

wildtype (WT) cells [4]. A possible mechanism for non-autonomy may be through direct

interaction of the Fz CRD and Vang, which have been shown to interact physically [6].

5

Alternatively, PCP propagation may be mediated through Fmi. Fmi is required for apical

localization of PCP components, but does not act non-autonomously to polarize

neighbouring cells. However, Fmi interacts homophilically in trans with Fmi on adjacent

cells to stabilize Fz and Vang complexes [4]. It has been proposed that Fmi-Fmi

interaction between cells activates Vang and represses Fz in the adjacent cell. Another

possibility is that Fmi is required to localize Fz and Vang in close proximity such that Fz

can directly interact with Vang. How PCP is propagated across a field of cells is still

unknown. One model suggests that complexes with the core PCP proteins form in trans

and propagate PCP in a ‘domino effect’ where polarization is initiated in a subset of cells

and is propagated across the plane through neighbouring cell-cell communication (Figure

2A) [7].

1.2: Regulation of Planar Cell Polarity

Polarization across a field of cells may occur by domineering non-autonomy of Fz

and Vang; however, another models suggest that a global cue may polarize the entire

plane (Figure 2B) [7]. Common to both models is an initial polarization event that either

begins the cascade of polarization mediated through cell-cell communication or acts to

polarize the entire plane. The identity of this initial polarization cue remains elusive. A

likely candidate is a diffusible cue that establishes PCP by acting on the core PCP

proteins. This cue most likely acts on Fz, Vang or Fmi since Pk, Dsh, Dgo act

downstream of Fz, Vang and Fmi [4]. There are no known soluble ligands of Vang or

Fmi; however, Fz is the receptor for the Wnt family [4]. Potentially Wnt proteins may

act as cue to establish

6

Figure 2: Models of PCP Establishment (A) Cell-Cell relay model: PCP is established and is propagated through a field of cells by domineering non-autonomy, or responding cells generate a polarizing cue that is secreted from one cell to the next. (B) Gradient model: PCP is established by a diffusible cue, and cells are polarized in the direction of the gradient.

7

PCP. However, clonal analysis of wingless (wg)/wnt mutants in the Drosophila abdomen,

revealed no changes in polarity of adjacent cells with all seven Wg/Wnt proteins tested

individually [8]. Unlike in the wing and compound eye, hedgehog signalling influences

PCP in the abdomen and may mask affects of mutant wg/wnt clones or possibly Wg/Wnt

proteins are functionally redundant [4]. Gain-of-function experiments with dWnt4 can

alter cellular orientation of PCP in the wing, however Drosophila Wnt proteins activate

other downstream pathways and it is difficult to distinguish a direct from indirect effects

on PCP signalling. Possibly there is an undiscovered Fz ligand that acts to polarize cells

[4]. Models for PCP establishment often include a diffusible cue termed Factor X. Factor

X could act in a long-ranged gradient produced by a few cells and spread across the

plane, or as a short-range cue generated throughout the field of cells, but in varying

amount based on the position of the cells [5].

In addition to the core PCP proteins, three additional genes fat (ft), dachsous (ds)

and four-jointed (fj), generate similar mutant phenotypes such as swirly hair and

disorganized photoreceptors. ft and ds are atypical cadherins that interact in trans, while fj

encodes a type II membrane protein localized to the Golgi. The role of the Ft-Ds group is

unclear, but there is evidence to support an upstream and parallel role to the core PCP

group. Ds and Fj are expressed in a gradient in the eye, wing and abdomen, creating a Ft

activity gradient. The only identified downstream effector of the Ft-Ds signalling is

atrophin, a transcriptional co-repressor downstream of Ft [9]. In the Drosophila wing,

ft/ds mutant clones alter Dsh, Pk and Fmi localization, whereas the localization of Ft and

Ds is unaltered in fz mutant clones [10]. Based on the Ft-Ds expression and epistasis data,

the Ft-Ds group could act upstream of the core PCP components and establish polarity.

8

However, it is unclear if Ft or Atrophin acts directly on the core PCP components. There

is also evidence to support a parallel role between the core PCP and Ft-Ds group. Clonal

analysis in the Drosophila abdomen shows that gain- and loss-of-function ft or ds clones

are able to repolarize neighbouring mutant fz and fmi cells [11]. In the larvae cuticle, PCP

defects are only observed when both the core PCP and Ft-Ds groups are affected. In

addition, fmi and ft double mutants have a more severe phenotype than the single

mutants, suggesting the core PCP and Ft-Ds group act in parallel [11].

1.3: Vertebrate Planar Cell Polarity Regulates Morphogenesis

The study of PCP in vertebrates is complex relative to the fly, as most PCP genes

have numerous homologues in vertebrates as compared to only one homologue in

Drosophila. For example, although there are five Drosophila frizzled genes, only one (fz)

regulates tissue polarity, whereas the other four show similar phenotypes to wingless (wg)

mutants [12]. In mice, there are ten frizzled genes and fz3 and fz6 have been implicated

in, but not dedicated to, regulation of PCP [4][13]. In addition, some homologues have

non-overlapping expression patterns, while others have overlapping expression patterns

and are functionally redundant. As a result, creating loss-of-function mutants is difficult,

especially if numerous genes are required to achieve a full PCP defect [4].

The same genes that control PCP in Drosophila are conserved in vertebrates,

where they give positional information to a field of cells to coordinate polarized

structures. For example, PCP is required for proper orientation of hairs on the mouse coat

[2]. In addition to the planar polarization of epithelia cells, vertebrate PCP can also be

extended to the polarization of mesenchymal cells. During vertebrate embryogenesis,

9

hundreds of individual cells move together in a highly organized pattern [3]. PCP has

been shown to regulate polarized cell movement that shapes the vertebrate body plan

[14]. One type of mass movement controlled by PCP is convergent extension (CE),

which results in narrowing of one axis and elongation of an orthogonal axis (Figure 3).

CE was initially studied by Xenopus researchers examining morphogenesis of the

posterior mesoderm and neuroectoderm. It was observed that the mesoderm cells

underwent radial and mediolateral (ML) intercalation, while the neuroectoderm cells

predominately performed ML intercalation [15]. Similar observations have been made in

zebrafish with the movements of mesoderm and neuroectoderm during gastrulation and

neurulation respectively [16][17].

The study of vertebrate PCP in zebrafish embryos combines several features that

are ideal for cellular and molecular analysis of PCP. Zebrafish embryos develop rapidly

externally and are easily accessible for embryonic manipulations such as cell

transplantations and microinjections. Simultaneous knock-down of many genes can be

performed with injection of anti-sense morpholino oligonucleotides. Zebrafish embryos

are optically clear making these embryos ideal for real-time in vivo imaging at the

morphological and cellular levels. Although zebrafish is hindered likewise with other

vertebrate models with redundancy and numerous homolouges of PCP genes, the distinct

advantages make zebrafish an amenable vertebrate model to study PCP.

During early zebrafish gastrulation, lateral mesoderm cells converge to the dorsal

side by directed migration. On the dorsal side, the axial mesoderm undergoes ML

intercalations that narrows the ML axis extends the anterior-posterior (AP) axis (Figure

3A). The presomitic mesoderm undergoes extension of the AP axis as a result of radial

10

B. Coordinated radial/medial Intercalation

Figure 3: Convergent Extension Movements Convergent extension movements result in anisotropic tissue movements where narrowing of one axis and elongation of an orthogonal axis occurs. A: Mediolateral (ML) Intercalation occurs within the same plane, where cells converge along one axis, resulting in extension in an orthogonal-planar axis. B: Coordinated radial/medial intercalation occurs where cells enter the plane and immediately medially intercalate. Convergence of two planes occurs, with extension of an orthogonal axis. C: Radial intercalation occurs where cells enter the plane and directly intercalate, extending the orthogonal axis. This results in the same mass movement as coordinate radial.medial intercalation, where there is convergence of two cell planes and extension of the orthogonal axis. D: Radial/ML intercalation occurs when cells enter the plane and separate medial cells, expanding the mediolateral axis. Radial/ML intercalations extend the orthogonal axis to coordinate radial/medial and radial intercalations. Adapted from Yin et al. JCB, 2008.

A. Mediolateral Intercalation

C. Radial Intercalation

D. Radial/Mediolateral Intercalation

11

intercalation, more specifically three types of polarized movements that result in

anisotropic tissue expansion [16]. The first type of anisotropic radial intercalation is

coordinated radial/medial intercalation, where a cell enters the plane and immediately

intercalates medially, extending the AP axis (Figure 3B) [16]. The second type is

radial/AP intercalation, where a cell intercalates directly into the plane and extends the

AP axis (Figure 3C) [16]. Finally, the third is radial/ML intercalation, where a cell enters

the plane and separates the medial cells, expanding the ML axis, counteracting CE

movements (Figure 3D) [16]. The majority of presomitic mesoderm during gastrulation

has been observed to undertake radial intercalations that result in extension of the AP

axis, where the majority of cells appear to undergo radial/AP intercalation [16]. Defects

in PCP signalling result in an embryo with shortened AP axis and broaden ML axis. More

specifically, the frequencies of cell intercalations are altered in PCP mutants, resulting

from impaired ML intercalation of axial mesoderm, and the anteroposterior bias of radial

intercalations is lost in the presomitic mesoderm [16][18].

During zebrafish neurulation, a single-cell layer of neuroepithelium called the

neural plate folds inwards forming a solid structure termed the neural keel [19]. The

neural keel eventually rounds up and detaches from the adjacent epidermis to form the

neural rod [19]. The neural tube is formed by retraction of the apical surfaces of cells at

the midline to form a lumen [19]. During neural keel stage, neural progenitor cells

(NPCs) undergo stereotypic cell divisions where dividing NPCs equally contribute

daughter cells to both sides of the developing neural tube [17]. More specifically, as a

NPC begins to divide, it rounds up its cell body and approaches the midline, while

maintaining contact with the basal side of the neural keel [17]. At the midline, the NPC

12

divides and the apical daughter cell directs protrusions towards the contralateral side

along the mediolateral axis, while the basal daughter cell reinserts into the ipsilateral side

[17]. The apical daughter NPC intercalates between neighbouring cells, resulting in

extension along the AP axis and convergence of the ML axis. In zebrafish vang (vangl2)

mutants, loss of PCP results in decreased CE and a neural tube defect, where NPCs

accumulate ectopically at the midline. PCP signalling is required during neurulation to

accommodate the act of cell division. When a NPC divides, the daughter loses contact to

the neuroepithelium; it requires PCP to provide positional information to direct cellular

protrusions and intercalate to the contralateral side. In vangl2 mutants where PCP is

absent, apical daughter cells have no directional information. They fail to form stable

protrusions and cannot intercalate, instead the daughter cell remains in the position where

it was born. The result is an accumulation of daughter cells at the midline [17].

1.4: Vertebrate Planar Cell Polarity Signalling

In vertebrates, there are approximately 10 frizzled genes, where fz7 is best

characterized in zebrafish and acts in the PCP pathway [20][21][22]. There are three

pathways that have been characterized downstream of Fz: canonical Wnt, Wnt-Ca++ and

non-canonical Wnt/PCP signalling (Figure 4). The canonical Wnt signalling pathway

regulates patterning by controlling transcription. In the absence of Wnt, ß-catenin (ß-

cat), a transcriptional activator, is degraded by the destruction complex. The destruction

complex consists of two scaffold proteins, Axin and Adenomatous polyposis coli (APC),

which bind ß-cat, and two kinases, Glycogen synthase kinase 3 (GSK3) and Casein

kinase 1α (CK1α). The two kinases phosphorylate ß-cat, which is then recognized by a

13

Figure 4: Wnt Signalling (A) Canonical Wnt signalling is ß-catenin dependent and induces a transcriptional response. (B) Wnt/Ca++ signalling is vertebrate specific and results in an increase in intracellular calcium. (C) Non-canonical Wnt/PCP signalling is ß-catenin independent and affects cell polarity.

14

Cullin E3 ubiquitin ligase that targets ß-cat for degradation. In the absence of canonical

Wnt signalling, there are low levels of ß-cat inside the cell and as a result target genes

remain repressed by Groucho, a transcriptional repressor that binds to Lymphoid

enhancer factor (LEF) and T cell factor (TCF), co-transcription factors. In the presence of

canonical Wnt signalling, Wnt binds Fz and its co-receptor Low-density-lipoprotein

receptor-related protein (LRP) 5/6 forming a complex at the cell surface. Inside the cell,

the Fz-LRP complex activates Dsh and recruits Axin to the LRP co-receptor. This

prevents formation of the destruction complex and ß-cat is not degraded. Stabilized ß-cat

accumulates in the cytoplasm and begins to translocate into the nucleus, where it

displaces Groucho from LEF/TCF and promotes transcription of LEF/TCF targeted genes

[23]. In zebrafish, canonical Wnt signalling is responsible for formation of the dorsal-

ventral (DV) axis, where it plays two distinct roles to specify dorsal and ventral cell fates

[24]. Before the onset of gastrulation, maternal ß-cat is asymmetrically localized to the

future dorsal side of the embryo [24]. Canonical Wnt signalling is required for formation

of the dorsal organizer, where an increase or decrease of ß-cat causes dorsalization or

ventralization respectively [24]. Later, during gastrulation, canonical Wnt signalling is

also important for specifying ventral cell fates [24]. Wnt8 is expressed in a decreasing

ventral to dorsal gradient, where increases or decreases in Wnt8 can cause ventralization

or dorsalization respectively [24].

The Wnt/Ca++ signalling pathway is the least characterized of the three pathways

and appears to be vertebrate specific [4]. Fz is classified as a novel type of G-protein

coupled receptor, where signalling downstream of the receptor may occur through

15

trimeric G-proteins. Upon Wnt stimulation, phospholipase C mediated increase in

intracellular Ca++ levels lead to activation of Ca++/calmodulin dependent effectors [25].

Unlike the canonical Wnt signalling pathways, the non-canonical Wnt/PCP

signalling does not require transcriptional activity of ß-cat. In vertebrates, non-canonical

Wnt/PCP signalling controls CE during gastrulation and neurulation. Similar to

Drosophila PCP, Fz recruits Dsh and Diversin (homologue of Drosophila Diego) and

acts positively, promoting downstream activation of Dsh effectors. One effector is the

Rho family of small GTPases that affects cytoskeleton actin-dynamics [26]. Vangl2 and

Pk are asymmetrically localized opposite to Fz and Dsh and are thought to act negatively

to limit Dsh activation. Similar to Drosophila, positional information is generated

through asymmetric localization of the core PCP components in vertebrates. In zebrafish,

Dsh and Pk have been shown to localize asymmetrically in cells undergoing CE

movements. Fluorescent protein tagged-Dsh localizes to the posterior apical membrane in

mesoderm cells, whereas GFP-Pk localizes to the anterior apical membrane in NPC

[16][17]. Together, these data suggest that the vertebrate core PCP proteins are localized

across the AP axis. In Drosophila, the asymmetric localization of core PCP components

lies along the same axis as planar polarization. In the Drosophila wing, the core PCP

components are found along the proximal-distal axis, where Fz localization coincides

with hair formation [5]. Although in zebrafish, subcellular asymmetries exist within the

cell, the localization of PCP components is orthogonal to the axis of polarized movement,

more specifically, protrusion formation and intercalation occurs along the ML axis. There

may be a difference how PCP is interpreted between epithelial and mesenchymal cells. It

appears that asymmetries of the core PCP components are a universal hallmark of PCP

16

signalling; however, the positional information that is generated appears to be interpreted

differently in mesenchymal cells.

1.5: Regulation of Vertebrate Planar Cell Polarity

1.5.1: Non-canonical Wnt signalling regulates planar cell polarity

Although there is no clear Drosophilia Wg/Wnt implicated in PCP signalling,

there is strong evidence in zebrafish to support a role for a non-canonical Wnt protein to

regulate PCP. First, several zebrafish mutants exhibit reduced CE movements without

major patterning defects [15]. The trilobite (tri), silberblick (slb), pipetail (ppt) and

knypek (kny) zebrafish mutants all exhibit CE defects, suggesting that these genes lie in

the same pathway. The tri mutant encodes for a core PCP component, Vangl2. [27]. Both

slb and ppt are Wnt proteins, Wnt11 and Wnt5b respectively, which have been classified

as non-canonical Wnt ligands [15]. kny encodes a member of the glypican family of

heparin sulphate proteoglycans, which potentate non-canonical Wnt signalling [28].

Based on the classification of Wnt from ectopic expression studies in Xenopus, there are

three non-canonical Wnt genes: wnt4, wnt5, wnt11. More specifically, the zebrafish non-

canonical wnt homologues that have been identified are: wnt4a, wnt4b, wnt5b, wnt11 and

wnt11-related. wnt4b and wnt11-related are most likely not involved in establishing PCP

since they are first expressed at later stages of development, approximately at 18- and

14-somite stages respectively [29][30], whereas wnt4a, wnt5b and wnt11 are expressed

when the embryo is undergoing CE movements [31][32][33]. There is no known mutant

for wnt4a; however, morpholino oligonucleotides (MO) that block translation of wnt4a

mRNA were shown to exacerbated the CE defect in slb;ppt mutants as compared with the

17

double mutant alone [17]. In addition, the absence of wnt4a/5b/11 leads to the loss of

polarized Pk localization in zebrafish embryos. Taken together, non-canonical Wnt

proteins are able to regulate PCP, as seen in the wnt5 and wnt11 mutants with CE defects,

as well as loss of GFP-Pk localization, an indicator of disrupted PCP signalling.

1.5.2: Vertebrate specific regulators of planar cell polarity are associated with Wnt

signalling

In vertebrates, Wnt protein has been classified as either canonical or non-

canonical depending on which signalling pathway is activated; however, another model

suggests that receptor availability may also regulate which pathway is activated [34]. For

example, it has been shown that LRP5/6 is necessary for canonical Wnt signalling. With

non-canonical Wnt signalling, a few co-receptors have been implicated in vertebrate

PCP: Knypek (Kny), Protein Tyrosine Kinase 7 (PTK7), RYK and ROR2. In vertebrates,

other regulators in addition to the core PCP group that appear to be able to regulate PCP;

however, it is unclear whether these regulators aid in interpreting the global PCP cue.

Kny is thought to be a positive regulator of PCP, where it may act to bind and promote

transmission of the non-canonical Wnt signal [35]. Kny has been shown to physically

interact with Dickkopf-1 (Dkk1), a secreted protein that negatively modulates canonical

Wnt signalling by inhibiting the LRP5/6-Fz interaction. Possibly Kny may promote PCP

signalling by down-regulating canonical signalling, for example, by increasing Fz

receptor occupancy for non-canonical Wnt protein [36]. The requirement for Kny in PCP

signalling appears to be permissive, since kny mutants are rescued with global expression

with kny mRNA [35].

18

PTK7 encodes a single-pass transmembrane protein with seven extracellular

immunoglobulin (Ig) domains and an intracellular tyrosine kinase homology domain.

PTK7 has been shown to genetically interact with Vangl2 in mice and loss-of-function

studies in the mouse reveal defects in CE movements and neural tube closure [37].

Studies in Xenopus show physical interaction between PTK7 and Fz and ability of PTK7

to recruit Dsh to the membrane; however, PTK7 mouse mutants show no difference in

Dsh localization [38][39]. PTK7 appears to play a conserved role in regulating CE

movements in vertebrates, yet whether it has a direct effect on PCP signalling is unclear.

RYK is a single-pass transmembrane atypical receptor tyrosine kinase identified

initally to play a role in axon guidance and neurite outgrowth in flies and mammals [40].

RYK consists of an extracellular WIF (Wnt inhibitory factor) domain, an intracellular

atypical kinase domain and PDZ binding motif [40]. Studies in Xenopus suggest a role in

regulating PCP, since over-expression or knock-down results in CE defects [41]. RYK

has been characterized as a Wnt receptor since it is able to bind Wnt1/3/5a independent

of Fz, but it also appears to form complexes with Wnt1/Fz8 and Wnt11/Fz7 [41]. Tertiary

complex formation of Wnt, Fz and RYK appears to regulate PCP signalling by

controlling Fz-Dsh endocytosis and receptor trafficking [41].

ROR2 is a single-pass transmembrane orphan receptor tyrosine kinase consisting of

extracellular CRD and Kringle domains and an intracellular tyrosine kinase domain [42].

Although ror2-/- mutant mice do not exhibit CE or neural tube defects, ROR2 has been

implicated in PCP since the mutant phenotype resembles the wnt5a-/- mutant and in vitro

studies show a physical interaction between Wnt5a and ROR2 [42].

19

1.5.3: The search for a global cue that establishes vertebrate planar cell polarity

Based on Drosophila PCP studies, the global cue that establishes vertebrate PCP

most likely affects the core membrane PCP components, Fmi, Vangl2 and Fz. Fmi is

believed to play an adhesion role since it forms homodimers with adjacent cells with its

extracellular cadherin domains. Fmi may regulate PCP signalling by stabilizing PCP

complexes rather than responding to cues that establish PCP, since it appears that Fmi

regulates PCP only in complex with Fz. Over-expression of Fmi in zebrafish embryos

does not disrupt Dsh localization, but is able to block Fz induced membrane localization

of Dsh [21].

Given that there are no known ligands for Vangl2, its role in PCP may be to

propagate PCP signalling to adjacent cells. In zebrafish, Vangl2 acts cell non-

autonomously, as wildtype NPC loose polarity when transplanted into a vangl2 mutant

host [17]. Vertebrate PCP may also be propagated as in Drosophila by domineering non-

autonomy through interaction of Vangl2 with the Fz CRD [6]. However there is a

possibility that there is an undiscovered Vangl2 ligand or co-receptor that responds to a

global PCP cue to establish polarity. Investigation into new binding partners of Vangl2

may help discover other cues that may globally regulate PCP.

In vertebrates, Wnt proteins are able to regulate PCP where loss-of-function of

wnt4/5/11 zebrafish embryos display CE and neural tube defects. The vertebrate

extracellular regulators of PCP further support a role for non-canonical Wnt protein to

regulate PCP, since RYK and ROR2 are able to bind non-canonical Wnts and Kny and

PTK7 physically interacts with receptors of Wnt signalling. Fz is a core PCP protein and

may act to receive polarity information from a non-canonical Wnt protein. Non-canonical

20

Wnt(s) may act as the initial polarization cue, which is propagated through the plane by

cell-cell communication or possibly acting in a global Wnt gradient that establishes

polarity across the entire plane. In this thesis, I examined the regulation of vertebrate

PCP. More specifically, I investigated the role of non-canonical Wnt signalling in

regulating vertebrate PCP (Chapter 2). To identify novel regulators of PCP, I performed

a screen for new protein interactions with Vang (Chapter 3). Finally, I discuss the

preliminary results obtained and possible future directions (Chapter 4).

1.6: References

[1] D. Strutt, “Frizzled signalling and cell polarisation in Drosophila and vertebrates,” Development (Cambridge, England), vol. 130, Oct. 2003, pp. 4501-4513.

[2] J.R.K. Seifert and M. Mlodzik, “Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility,” Nature Reviews. Genetics, vol. 8, Feb. 2007, pp. 126-138.

[3] R. Keller, D. Shook, and P. Skoglund, “The forces that shape embryos: physical aspects of convergent extension by cell intercalation,” Physical Biology, vol. 5, 2008, p. 15007.

[4] J. Wu and M. Mlodzik, “A quest for the mechanism regulating global planar cell polarity of tissues,” Trends in Cell Biology, vol. 19, Jul. 2009, pp. 295-305.

[5] M. Fanto and H. McNeill, “Planar polarity from flies to vertebrates,” Journal of Cell Science, vol. 117, Feb. 2004, pp. 527-533.

[6] J. Wu and M. Mlodzik, “The frizzled extracellular domain is a ligand for Van Gogh/Stbm during nonautonomous planar cell polarity signaling,” Developmental Cell, vol. 15, Sep. 2008, pp. 462-469.

[7] H. Strutt and D. Strutt, “Long-range coordination of planar polarity in Drosophila,” BioEssays: News and Reviews in Molecular, Cellular and Developmental Biology, vol. 27, Dec. 2005, pp. 1218-1227.

[8] P.A. Lawrence, J. Casal, and G. Struhl, “Towards a model of the organisation of planar polarity and pattern in the Drosophila abdomen,” Development (Cambridge, England), vol. 129, Jun. 2002, pp. 2749-2760.

[9] M. Fanto, L. Clayton, J. Meredith, K. Hardiman, B. Charroux, S. Kerridge, and H. McNeill, “The tumor-suppressor and cell adhesion molecule Fat controls planar polarity via physical interactions with Atrophin, a transcriptional co-repressor,” Development (Cambridge, England), vol. 130, Feb. 2003, pp. 763-774.

[10] D. Ma, C. Yang, H. McNeill, M.A. Simon, and J.D. Axelrod, “Fidelity in planar cell polarity signalling,” Nature, vol. 421, Jan. 2003, pp. 543-547.

[11] J. Casal, P.A. Lawrence, and G. Struhl, “Two separate molecular systems,

21

Dachsous/Fat and Starry night/Frizzled, act independently to confer planar cell polarity,” Development (Cambridge, England), vol. 133, Nov. 2006, pp. 4561-4572.

[12] C. Wu and R. Nusse, “Ligand receptor interactions in the Wnt signaling pathway in Drosophila,” The Journal of Biological Chemistry, vol. 277, Nov. 2002, pp. 41762-41769.

[13] Y. Wang, N. Guo, and J. Nathans, “The role of Frizzled3 and Frizzled6 in neural tube closure and in the planar polarity of inner-ear sensory hair cells,” The Journal of Neuroscience: The Official Journal of the Society for Neuroscience, vol. 26, Feb. 2006, pp. 2147-2156.

[14] R. Keller, “Shaping the vertebrate body plan by polarized embryonic cell movements,” Science (New York, N.Y.), vol. 298, Dec. 2002, pp. 1950-1954.

[15] M. Tada, M.L. Concha, and C.P. Heisenberg, “Non-canonical Wnt signalling and regulation of gastrulation movements,” Seminars in Cell & Developmental Biology, vol. 13, Jun. 2002, pp. 251-260.

[16] C. Yin, M. Kiskowski, P. Pouille, E. Farge, and L. Solnica-Krezel, “Cooperation of polarized cell intercalations drives convergence and extension of presomitic mesoderm during zebrafish gastrulation,” The Journal of Cell Biology, vol. 180, Jan. 2008, pp. 221-232.

[17] B. Ciruna, A. Jenny, D. Lee, M. Mlodzik, and A.F. Schier, “Planar cell polarity signalling couples cell division and morphogenesis during neurulation,” Nature, vol. 439, Jan. 2006, pp. 220-224.

[18] N.S. Glickman, C.B. Kimmel, M.A. Jones, and R.J. Adams, “Shaping the zebrafish notochord,” Development (Cambridge, England), vol. 130, Mar. 2003, pp. 873-887.

[19] E. Hong and R. Brewster, “N-cadherin is required for the polarized cell behaviors that drive neurulation in the zebrafish,” Development (Cambridge, England), vol. 133, Oct. 2006, pp. 3895-3905.

[20] S. Witzel, V. Zimyanin, F. Carreira-Barbosa, M. Tada, and C. Heisenberg, “Wnt11 controls cell contact persistence by local accumulation of Frizzled 7 at the plasma membrane,” The Journal of Cell Biology, vol. 175, Dec. 2006, pp. 791-802.

[21] F. Carreira-Barbosa, M. Kajita, V. Morel, H. Wada, H. Okamoto, A. Martinez Arias, Y. Fujita, S.W. Wilson, and M. Tada, “Flamingo regulates epiboly and convergence/extension movements through cell cohesive and signalling functions during zebrafish gastrulation,” Development (Cambridge, England), vol. 136, Feb. 2009, pp. 383-392.

[22] S. El-Messaoudi and A. Renucci, “Expression pattern of the frizzled 7 gene during zebrafish embryonic development,” Mechanisms of Development, vol. 102, Apr. 2001, pp. 231-234.

[23] S. Angers and R.T. Moon, “Proximal events in Wnt signal transduction,” Nature Reviews. Molecular Cell Biology, vol. 10, Jul. 2009, pp. 468-477.

[24] A.F. Schier and W.S. Talbot, “Molecular genetics of axis formation in zebrafish,” Annual Review of Genetics, vol. 39, 2005, pp. 561-613.

[25] G. Schulte and V. Bryja, “The Frizzled family of unconventional G-protein-coupled receptors,” Trends in Pharmacological Sciences, vol. 28, Oct. 2007, pp. 518-525.

[26] H. Moeller, A. Jenny, H. Schaeffer, T. Schwarz-Romond, M. Mlodzik, M. Hammerschmidt, and W. Birchmeier, “Diversin regulates heart formation and

22

gastrulation movements in development,” Proceedings of the National Academy of Sciences of the United States of America, vol. 103, Oct. 2006, pp. 15900-15905.

[27] J.R. Jessen, J. Topczewski, S. Bingham, D.S. Sepich, F. Marlow, A. Chandrasekhar, and L. Solnica-Krezel, “Zebrafish trilobite identifies new roles for Strabismus in gastrulation and neuronal movements,” Nature Cell Biology, vol. 4, Aug. 2002, pp. 610-615.

[28] J. Topczewski, D.S. Sepich, D.C. Myers, C. Walker, A. Amores, Z. Lele, M. Hammerschmidt, J. Postlethwait, and L. Solnica-Krezel, “The zebrafish glypican knypek controls cell polarity during gastrulation movements of convergent extension,” Developmental Cell, vol. 1, Aug. 2001, pp. 251-264.

[29] A. Liu, A. Majumdar, H.E. Schauerte, P. Haffter, and I.A. Drummond, “Zebrafish wnt4b expression in the floor plate is altered in sonic hedgehog and gli-2 mutants,” Mechanisms of Development, vol. 91, Mar. 2000, pp. 409-413.

[30] T. Matsui, A. Raya, Y. Kawakami, C. Callol-Massot, J. Capdevila, C. Rodríguez-Esteban, and J.C. Izpisúa Belmonte, “Noncanonical Wnt signaling regulates midline convergence of organ primordia during zebrafish development,” Genes & Development, vol. 19, Jan. 2005, pp. 164-175.

[31] C.P. Heisenberg, M. Tada, G.J. Rauch, L. Saúde, M.L. Concha, R. Geisler, D.L. Stemple, J.C. Smith, and S.W. Wilson, “Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation,” Nature, vol. 405, May. 2000, pp. 76-81.

[32] B. Kilian, H. Mansukoski, F.C. Barbosa, F. Ulrich, M. Tada, and C.P. Heisenberg, “The role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish gastrulation,” Mechanisms of Development, vol. 120, Apr. 2003, pp. 467-476.

[33] A.R. Ungar, G.M. Kelly, and R.T. Moon, “Wnt4 affects morphogenesis when misexpressed in the zebrafish embryo,” Mechanisms of Development, vol. 52, Aug. 1995, pp. 153-164.

[34] A.J. Mikels and R. Nusse, “Purified Wnt5a protein activates or inhibits beta-catenin-TCF signaling depending on receptor context,” PLoS Biology, vol. 4, Apr. 2006, p. e115.

[35] J. Topczewski, D.S. Sepich, D.C. Myers, C. Walker, A. Amores, Z. Lele, M. Hammerschmidt, J. Postlethwait, and L. Solnica-Krezel, “The zebrafish glypican knypek controls cell polarity during gastrulation movements of convergent extension,” Developmental Cell, vol. 1, Aug. 2001, pp. 251-264.

[36] L. Caneparo, Y. Huang, N. Staudt, M. Tada, R. Ahrendt, O. Kazanskaya, C. Niehrs, and C. Houart, “Dickkopf-1 regulates gastrulation movements by coordinated modulation of Wnt/beta catenin and Wnt/PCP activities, through interaction with the Dally-like homolog Knypek,” Genes & Development, vol. 21, Feb. 2007, pp. 465-480.

[37] X. Lu, A.G.M. Borchers, C. Jolicoeur, H. Rayburn, J.C. Baker, and M. Tessier-Lavigne, “PTK7/CCK-4 is a novel regulator of planar cell polarity in vertebrates,” Nature, vol. 430, Jul. 2004, pp. 93-98.

[38] I. Shnitsar and A. Borchers, “PTK7 recruits dsh to regulate neural crest migration,” Development (Cambridge, England), vol. 135, Dec. 2008, pp. 4015-4024.

[39] W.W. Yen, M. Williams, A. Periasamy, M. Conaway, C. Burdsal, R. Keller, X. Lu, and A. Sutherland, “PTK7 is essential for polarized cell motility and convergent

23

extension during mouse gastrulation,” Development (Cambridge, England), vol. 136, Jun. 2009, pp. 2039-2048.

[40] W. Lu, V. Yamamoto, B. Ortega, and D. Baltimore, “Mammalian Ryk is a Wnt coreceptor required for stimulation of neurite outgrowth,” Cell, vol. 119, Oct. 2004, pp. 97-108.

[41] G. Kim, J. Her, and J. Han, “Ryk cooperates with Frizzled 7 to promote Wnt11-mediated endocytosis and is essential for Xenopus laevis convergent extension movements,” The Journal of Cell Biology, vol. 182, Sep. 2008, pp. 1073-1082.

[42] I. Oishi, H. Suzuki, N. Onishi, R. Takada, S. Kani, B. Ohkawara, I. Koshida, K. Suzuki, G. Yamada, G.C. Schwabe, S. Mundlos, H. Shibuya, S. Takada, and Y. Minami, “The receptor tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway,” Genes to Cells: Devoted to Molecular & Cellular Mechanisms, vol. 8, Jul. 2003, pp. 645-654.

24

CHAPTER 2: Investigating the Role of Wnt Signalling in Vertebrate Planar Cell Polarity 2.0: Introduction

There are two models for planar cell polarity (PCP) establishment, the cell-cell

relay model and gradient model (Figure 2). The cell-cell relay model results in sequential

polarization of a field of cells, where Factor X initiates polarization and adjacent cells are

polarized either by production of a secreted cue acting in small gradients or by

domineering non-autonomy. The gradient model suggests that PCP is established by a

long-ranged gradient of Factor X, where cells sense an increasing/decreasing gradient and

establish polarity accordingly. The identity of Factor X is unknown, however there is a

strong precedent for non-canonical Wnt protein to establish PCP in vertebrates. One of

the core PCP components is Frizzled (Fz), a transmembrane protein that contains an

extracellular cysteine-rich domain (CRD), which binds Wnt protein. Zebrafish non-

canonical Wnt mutants (wnt5b/11) display convergent extension (CE) defects that

phenocopy other core PCP mutants. Finally, other vertebrate regulators of PCP, knypek,

protein tyrosine kinase 7, RYK and ROR2 are all associated with Wnt signalling.

In both models of PCP establishment, Factor X needs to act instructively to

establish PCP across the plane. To generate polarity across a field of cells, the initial cue

needs to create directionality. An instructive cue can elicit different responses within a

plane, whereas the response a cell has to the cue will vary with its relative position

(Figure 5). In the gradient model, an instructive cue would polarize the entire plane with

each cell responding to a gradient of Factor X. In the cell relay model, the initial factor

25

Figure 5: Instructive Versus Permissive Functions of Wnt The role of Wnt signalling in regulating PCP is unclear. Wnt signals could possibly act in two ways to regulate PCP either as an instructive or permissive signal. Wnt as an instructive signal: Wnt signals are required for PCP and establish the direction of cell polarization (arrows). The polarity of cells surrounding a Wnt source will reflect their relative position to the localized polarizing cue. Example: Wnt PCP. Wnt as a permissive cue: Wnt signals are required for PCP, however they do not dictate the direction of cell polarization. The polarity of cells is established irrespective of the Wnt source. Potentially another factor instructs PCP. Example: Wnt + FactorX PCP.

Wnt

Wnt

X

Permissive

Instructive

26

dictates the directionality, where positional information the first cell receives from the

cue will be propagated to the next cell and eventually across the entire plane. Conversely,

a signal that is required by the cell, where the cell’s response is the same irrespective of

its position, to the cue is considered a permissive cue (Figure 5). To gauge whether non-

canonical Wnt proteins act as Factor X in establishing PCP, non-canonical Wnt protein

needs to be assayed for either a permissive or instructive role in regulating PCP. There is

some evidence from zebrafish studies suggesting that Wnt11 acts permissively and wnt5b

acts instructively to regulate PCP. wnt11 mutants can be rescued with global over-

expression of wnt11 mRNA, demonstrating that graded/localized Wnt11 expression is not

required to establish PCP [1]. However, rescue of the wnt5b mutant cannot be achieved

with ubiquitous expression of wnt5b mRNA, possibly because a specific Wnt5b

expression pattern is required in the embryo to establish PCP [2]. There is evidence from

other model organisms showing the Wnt protein can act as instructive cues. In the

developing chick embryo, myocytes normally elongate parallel to the neural tube. When

a cell expressing Wnt11 is transplanted in between two somites, elongating myocytes are

found swirling around the local Wnt11 source. When Wnt11 is globally over-expressed,

myocyte elongation is disorganized. Taken together, it suggests that Wnt11 acts

instructively to regulate myotcye elongation in the chick embryo [3]. During C. elegans

development at the four-cell stage, the P2 cell (signalling cell) determines the division

plane in the EMS (responding cell). Positional MOM-2 (C. elegans Wnt) signal secreted

from the P2 cell acts instructively on the EMS cell directing spindle orientation [4].

Although Wnt Protein can act instructively, PCP has not been implicated in directing

myocyte elongation or spindle orientation in the EMS cell. To assay if Wnt acts

27

instructively to establish PCP, similar assays with a local Wnt source need to be

performed, however in a system/process where PCP signalling is required.

Zebrafish neurulation is a model system that can be used to assay the affects of

local Wnt protein expression on PCP. It is amenable to embryonic manipulation, in which

there are various means to induce localized ectopic Wnt expression. To gauge if Wnt

protein is acting instructively or permissively, differences in Prickle (Pk) localization can

be used. Asymmetric localization of the PCP components is a hallmark of PCP

signalling. In the developing zebrafish neural tube, it has been shown that a green

fluorescent protein (GFP)-Pk fusion localizes to the anterior side of the membrane in

discrete puncta in neural progenitor cells (NPCs) (Figure 6A). Disruption of PCP such as

in vangl2 mutant and wnt5b/11 double mutant embryos injected with wnt4 morpholino

oligonucleotide (MO) show loss of puncta on the anterior membrane (Figure 6B) [5]. In

response to a local Wnt source, the polarity of NPCs can be examined. If Wnt acts

permissively to establish PCP, a local Wnt source should not change the directionality of

polarization. Accordingly, GFP-Pk localization should not be altered around the local

Wnt clone. If Wnt protein acts instructively to establish PCP, GFP-Pk localization should

change with respect to the local Wnt source. Potentially, normal polarity (GFP-Pk

anterior localization) would be observed in one direction, while polarity may be reversed

in the opposite direction.

There are three non-canonical Wnts, wnt4a, wnt5b and wnt11, that are expressed

during zebrafish gastrulation/neurulation. wnt11 expression in WT zebrafish embryos is

first detected in the germ ring at shield stage and is later detected in the anterior paraxial

mesoderm and neuroectoderm [1]. By late gastrulation, the neuroectoderm domain lies

28

Figure 6: GFP-PK as a marker of PCP (A) In WT zebrafish neural progenitor cells (NPCs), GFP-Prickle (Pk) puncta localized to the anterior membrane. (B) When PCP signalling is disrupted like in materal-zygotic vangl2 mutants, GFP-Pk puncta at the anterior membrane is lost. GFP-Pk remains cytoplasmic. Ciruna et al. Nature (2006) 439, 220-224.

29

posterior to the presumptive forebrain [1]. wnt5b is maternally provided and zygotic

expression is first detected in the germ ring at shield stage and later in the posterior

paraxial and axial mesoderm, adjacent to the wnt11 expression, becoming restricted to the

posterior mesendoderm and tailbud [2]. wnt4 is first detected at the 3-somite stage in the

forebrain and spreads posteriorly through the hindbrain, along the lateral dorsal neural

keel stopping short of the tailbud at approximately the 8-10 somite stage [7]. At later

stages, wnt4a is found in the anterior lateral plate mesoderm and mainly in the floor plate

of the neural tube [6]. The non-canonical Wnts have over-lapping expression patterns and

appear to act redundantly to regulate PCP. wnt11 mutants can be rescued with injection

of wnt5b mRNA. Loss-of-function of all three non-canonical Wnts is required to achieve

the most severe phenotype [17]. As a result, creating single mutant loss-of-function Wnt

clones and assaying polarity on neighbouring cells may not be informative. Using gain-

of-function clones, each non-canonical Wnt protein can be assayed for its instructive or

permissive affect on PCP.

To assay the direct affect of Wnt on PCP, a clone expressing Wnt protein was

introduced into the neural keel. This requires spatial and temporal control of the clone.

One method is to transplant beads coated with growth factors, which can be transplanted

into any location at any point in development. The major limitation to this method is the

isolation and purification of the growth factor of interest. Although Wnt proteins are

secreted, active Wnt molecules are difficult to solubilize and consequently difficult to

purify [8]. Their inability to solubilize is a result of lipid-modifications resulting in a

more hydrophobic protein than predicted by the amino acid sequence [8]. To generate

Wnt clones, an in vivo approach was taken where cells that ectopically express high level

30

of Wnt protein were transplanted into the neural keel labelled with GFP-Pk, the marker of

cell polarity. One method to generate chimeras in zebrafish is by homochronic cell

transplantation, where donor cells from a mid-blastua stage embryo (donor) are

transplanted into a staged-matched embryo (host). The donor embryo is injected with wnt

mRNA and cells are transplanted into the presumptive neural tube of a GFP-Pk labelled

host embryo. Although homochronic cell transplantation would generate Wnt clones in

the neural tube, there are two concerns that may complicate the analysis. First, the Wnt

clone will be active throughout development and it will be unclear whether observed

changes in polarity are a direct result of Wnt on NPC or a secondary result from altered

PCP during gastrulation. Second, many Wnt clones will be generated, possibly making

the analysis difficult when examining NPC surrounded by multiple Wnt clones and

attempting to determine the direction of the Wnt gradient. To clearly demonstrate an

instructive or permissive role for Wnt on PCP, one Wnt clone that is active only during

neurulation needs to be generated. Accordingly, any observed differences in the polarity

of NPC can be attributed to the Wnt clone. Described herein is the first demonstration

that transplantation of mid-blastula stage cells directly into the neural keel is possible and

can be used to assay the role of Wnt in regulating PCP. My preliminary results suggest

that Wnt4a is able to alter NPC behaviour in the developing neural tube.

2.1: Results

2.1.1: Heterochronic cell transplantation is possible

Transplantation is usually performed with mid-blastula staged embryos since the

cells are easily manipulated and have less adhesion between them. Cells can be

31

withdrawn or deposited into the mid-blastula staged embryo without altering

development. For temporal and spatial control of the Wnt clone, heterochronic cell

transplants (HCT) were performed, where cells from a donor mid-blastula staged embryo

injected with wnt mRNA were transplanted into the neural keel of host embryo labelled

with GFP-Pk. To test whether HCT were possible, donor cells labelled with membrane-

GFP (mGFP) were transplanted into a membrane red fluorescent protein (memRFP)

labelled host. Using confocal microscopy, host embryos were imaged two hours after

transplantation for the presence of transplanted cells (mGFP labelled) in the neural tube

(Figure 7A). The donor cells are much larger than the NPC since the donor cells are taken

from an earlier staged embryo and transplanted into a later staged host. There is no non-

specific or absent fluorescence indicating donor cells are alive and transplantation does

not cause cellular damage. The donor cells appear to be well integrated into the host

suggesting that HCT are possible.

The affect of HCT on the endogenous polarity was investigated to ensure that

HCT did not disrupt PCP signalling. GFP-Pk was used as a marker of polarity, as GFP-

Pk forms membrane associated puncta localized to the anterior membrane in wildtype

(WT) NPCs. If PCP is disrupted, as with loss-of-function of non-canonical Wnts, GFP-Pk

puncta are lost from the membrane. To test whether HCT disrupts PCP in the host, WT

mid-blastula staged cells labelled with mGFP were transplanted into the neural keel of a

memRFP and GFP-Pk scatter labelled host. GFP-Pk was not globally expressed since it is

difficult to discern anterior localization of puncta in one cell from posterior localization

of puncta in an adjacent cell when all cells are labelled. Instead, GFP-Pk was scatter-

labelled, where one blastomere of an 8-cell staged embryo was injected resulting in

32

Figure 7: Heterochronic cell transplants are possible and do not disrupt PCP A. Cells from sphere stage embryo labelled with mGFP transplanted into host 4-6 somite staged embryo labelled with memRFP. Confocal section, dorsal view. B. Cells from sphere stage embryo injected with mGFP transplanted into host 4-6 somite stage embryo labelled with memRFP and scatter-labeled with GFP-Pk. Puncta are found on the anterior side of the membrane. Confocal sections, dorsal view.

Ant

33

patches of GFP-Pk labelled cells. Examining the host embryos after HCT showed

integrated donor cells (mGFP) in the neural keel (memRFP). The localization of GFP-Pk

puncta was along the anterior membrane in cells near the donor cells, suggesting that

HCT does not disrupt PCP in the host embryo (Figure 7B).

2.1.2: Characterization of Wnt clones

HCT is a method that allows for mid-blastula cells to be transplanted into the host

neural keel; however, it is unclear if the transplanted donor cells can act as a source of

Wnt signal. For the Wnt clone to act as a local source of Wnt protein, secretion of

functional Wnt protein to neighbouring NPCs is required. To characterize the donor cells,

several tests were performed to show that cells transplanted from embryos injected with

wnt mRNA could express, secrete and generate functional Wnt protein. First, to show that

wnt mRNA injected into embryos is translated into protein, mRNA encoding wnt11 fused

to yellow fluorescent protein (YFP) mRNA was injected into 1-cell stage embryos and

observed at mid-blastula stage for YFP fluorescence. Injected embryos at mid-blastula

showed YFP fluorescence indicating the injected wnt mRNA is translated into protein

(Figure 8A). Next, to test if Wnt protein is secreted, cells from embryos injected with

wnt11YFP mRNA at mid-blastula stage were transplanted into the animal cap of a

memRFP labelled stage-matched host. Using confocal microscopy, host embryos were

imaged and donor cells expressing Wnt11YFP were detected. YFP fluorescence was

observed as cytoplasmic puncta inside the donor cells as well as discrete puncta among

the host cells suggesting that Wnt protein is secreted from transplanted mid-blastula stage

cells (Figure 8B).

34

Figure 8: Injected Wnt mRNA is expressed and secreted A. WT embryo injected with wnt11YFP mRNA, sphere stage embryo, lateral view, brightfield. A’. YFP fluorescence. B. Transplanted sphere stage cells from WT embryo injected with wnt11YFP (green) into WT sphere stage host labelled with memRFP (red). Confocal section, animal pole view.

35

To test whether injected wnt mRNA results in functional Wnt protein, non-

canonical wnt mRNA was globally over-expressed in zebrafish embryos and scored for

an extension defect at a mid-somite stage (Figure 9). Wnt misexpression has been shown

to induce morphogenesis defects such as decreased extension of axial tissues and anterior

migration of cells [1][2][7]. Comparing phenotypes to uninjected controls, injection of

200 pg of wnt11YFP and wnt5b consistently generated an over-expression phenotype, as

seen with decreased anterior-posterior extension of the embryo. Surprisingly, injection of

20 pg of wnt4a was able to generate a similar phenotype. Although the non-canonical

Wnts may be functionally redundant as demonstrated with the rescue of the wnt11 mutant

with wnt5b expression, they appear to have distinct activities where rescue of wnt11

mutants is achieved with ten times less wnt11 than wnt5b mRNA. Wnt4a was the first

Wnt chosen to assay using HCT since a low amount of mRNA was required to generate a

phenotype, and further increases in mRNA concentration would be possible without

inducing non-specific mRNA toxicity indicated by necrosis or the embryo.

To further characterize the effect of Wnt4a ectopic expression on NPCs, wnt4a

mRNA was injected into WT 1-cell stage embryos and the neural tube was examined for

neural tube defects and the presence of GFP-Pk puncta at mid-somite stage. As seen with

vangl2 mutants, disruption of PCP leads to defects in neural tube formation, where an

ectopic accumulation of apical daughter cells occurs at the midline. Embryos were

injected with 20 pg of wnt4a mRNA and labelled with memRFP. Using confocal

microscopy, injected embryos displayed an accumulation of cells in the neural tube

suggesting Wnt4a is capable of disrupting PCP (Figure 10A). To gauge if Wnt protein

36

Figure 9: Ectopic non-canonical Wnt expression induces morphogenesis defects A-D: Lateral views, anterior is to the right, posterior is to the left. A. Non-injected WT embryo during segmentation period (12-16 hpf). B. WT embryos injected with 20 pg of wnt4 mRNA. C. WT embryos injected with 200 pg of wnt11YFP mRNA. D. WT embryo injected with 200 pg of wnt5 mRNA. E. WT embryos injected with 200 pg of wnt11r mRNA.

37

Figure 10: Ectopic Wnt4 expression induces neural tube defects with a persistence of GFP-Pk puncta localized to the membrane A: Confocal section, dorsal view of WT embryo injected with 20 pg of wnt4 mRNA labelled with memRFP. NT (neural tube) is highlighted with dotted white line and Som (somites) are found on either side of the NT. Ectopic accumulation of cells occurs with global over-expression of wnt4 mRNA. B. Confocal section, dorsal view of WT embryo injected with 20 pg of wnt4 mRNA labelled with memRFP and GFP-Pk. GFP-Pk puncta persist and are localized to the membrane in response to global over-expression of wnt4.

38

acts instructively (changes in GFP-Pk puncta localization) or permissively (no changes

in GFP-Pk puncta localization), GFP-Pk puncta need to be present in response to a Wnt

clone. To test if GFP-Pk puncta persist in NPC in response to ectopic Wnt4a expression,

embryos were injected with wnt4a mRNA and labelled globally with memRFP and GFP-

Pk. Using confocal microscopy, NPCs in injected embryos had GFP-Pk puncta present at

the membrane, demonstrating in response to ectopic Wnt4a, GFP-Pk puncta persist and

can be used to as a readout for the Wnt instructive/permissive assay (Figure 10B). Since

the GFP-Pk are present, differences in localization or quantity of puncta can be examined

in response to a localized Wnt4a source.

2.1.3: Localized ectopic Wnt4a expression is able to alter neural progenitor cell

behaviour

After ensuring HCT were possible and did not disrupt endogenous PCP as well as

characterizing the donor cells as a Wnt clone capable of secreting functional Wnt, HCT

were performed generating a Wnt4a clone inside the neural keel. If Wnt4a plays an

instructive role, it would be expected that the polarity of NPCs would be established with

respect to the location of the Wnt clone. Based on wnt4a in situ hybridization data, there

is an endogenous decreasing gradient along the anterior-posterior axis. Possibly, normal

polarity (anterior localized GFP-Pk puncta) would be established posterior to the Wnt

clone since NPCs would be exposed to the same decreasing gradient. In addition, polarity

would be reversed anterior to the Wnt clone, as the NPCs would be exposed to an

increasing Wnt4a gradient, opposite to the endogenous gradient. Thus, if Wnt4a acts

39

permissively, polarity should be affected equally anterior and posterior to the Wnt clone,

and GFP-Pk localization should be the same in all NPCs surrounding the Wnt clone.

Unfortunately, the majority of attempts to perform the assay were unsuccessful,

generating uninformative data. The main issue was that variability within each step of the

procedure decreased the overall success of the experiment. The position of the Wnt clone

is not fixed, when imaging the transplant location (near the 6th somite) donor cells were

often not detected suggesting the donor cells shifted position or died. GFP-Pk labeling

was clustered and uneven, making it difficult to determine on which membrane the

puncta were localized. In addition, the entire anterior-posterior axis was not labelled,

making it difficult to compare anterior and posterior regions relative to the Wnt clone.

Finally, due to the length of the procedure, there are a finite number of HCTs that can be

performed and examined by confocal microscopy, making it difficult to achieve a high

number of replicates. Taken together, it is unclear whether Wnt4a acts instructively or

permissively to establish PCP.

Despite the majority of data being uninformative, a small proportion (n=2) of

HCT resulted in a surprising phenotype. NPCs appear to respond differently to a local

Wnt4a source with respect to its relative position. Although the GFP-Pk labeling could

not be used to gauge if PCP was affected, GFP-Pk labeling was used as a cell tracer.

Scatter-labeling by injection of one blastomere at the 8-cell stage often results in labeling

cells on one half of the embryo along the anterior-posterior axis. During neurulation,

NPC from one side of the neural tube will divide generating a daughter cell that will cross

the midline and intercalate into the contralateral side. As a result, there is equal

contribution

40

Figure 11: Neural progenitor cells respond differently to a Wnt4a clone with respect to its position Heterochronic cell transplants generating a local Wnt4a clone. A-C confocal sections, dorsal views, anterior top, posterior bottom. Wnt source (*), donor cells labelled with mGFP and injected with 20 pg of Wnt4. A. Majority of neural progenitor cells anterior to the Wnt source do not cross the midline. B. Neural progenitor cells adjacent to the Wnt source are disordered. No clear midline is found. C. Posterior to the Wnt source, neural progenitor cells can be found on both sides of the neural tube.

Anterior

Posterior

*

*

*

41

of cells from both sides of the neural tube. In the HCT assay, NPCs posterior to the

Wnt4a clone appear to behave normally, with a distribution of GFP-Pk labelled cells on

both sides of the neural tube (Figure 11C). NPCs adjacent to the Wnt4a clone are

disordered, and there is no clear midline (Figure 11B). Anterior to the Wnt4a clone, GFP-

Pk labelled cells appear to have not crossed the midline to the contralateral side, but have

not accumulated at the midline (Figure 11A). The HCT data suggest that Wnt4a affects

NPC behaviour along the anterior-posterior axis.

To support the results obtained from HCT, a transposon-mediated transient

transgenic approach was used. The transient transgenic approach permits temporal and

some spatial control in generating Wnt clones. The temporal control results from using a

heat-shock promoter to drive gene expression at a desired time in development. Spatial

control of Wnt clones results from chimeric integration of the transgene, such that only a

few cells will express the transgene (Figure 12B). The transgene used to generate Wnt4a

clones consisted of a heat-shock promoter driving expression of wnt4a fused to an

internal ribosomal entry site (IRES) and mGFP reporter (Figure 12A). Successful

transgene activation was indicated by mGFP expression. To track cell movement, cells

were scatter labelled with memRFP by injecting one blastomere at the 8-cell stage. Such

cells will often mark only half the embryo along the anterior-posterior axis. As NPCs

begin to divide, apical daughter cells will intercalate into the contralateral membrane,

where cells labelled with memRFP should be found on sides of the developing neural

tube (Figure 12C). Embryos were heat-shocked at 6-somite stage and imaged using

confocal microscopy. The cells surrounding the Wnt4a clone were examined for

42

Figure 12: Transgenic approach to generate localized Wnt source in the neural tube Transgenesis is mediated by injection of tol2 transposase mRNA and transgene vector (A) is chimeric. Confocal sections, dorsal view. B. Heatshock induced transgenic with low level of transgene integration C. Control embryo scatter labelled with memRFP demonstrating that as cells divide, apical daughter cells are deposited on the contralateral side of the developing neural tube. D. Heatshock transgenic embryo scatter labelled with memRFP. Cells expressing transgene are labelled with mGFP. Cells anterior to Wnt4 source are found on one side of the neural tube, while cells posterior to the Wnt4 source are found on both sides of the embryo.

HSP70 Wnt IRES mGFP

C

A

43

differences in cell movement across the midline anterior and posterior to the local Wnt4a

source. Similar to the HCT experiment, NPCs posterior to the Wnt4a clone were found

on both sides of the neural tube. NPCs anterior to the Wnt4a clone were only found one

side of the neural tube (Figure 12D). Taken together, Wnt4a appears to affect the

behaviour of NPC across the midline anterior to the Wnt4a clone.

2.2: Discussion

2.2.1: Anterior-posterior Wnt4a gradient provides positional information to neural

progenitor cells

There is a striking difference to the response of NPC anterior and posterior to a

local Wnt4a source. Comparing the anterior and posterior regions, the main difference is

the direction of the Wnt4a gradient that is formed. Posterior to the Wnt4a clone, a

decreasing gradient along the anterior-posterior axis is generated, which is the same

direction as the endogenous wnt4a gradient. The NPCs anterior to the Wnt4a clone are

exposed to an increasing gradient along the anterior-posterior axis, opposite to the

endogenous wnt4a gradient. The Wnt4a gradient along the anterior-posterior possibly

provides some kind of information, where a ‘reverse’ gradient may alter NPC behaviour

(Figure 13). Considering the expression pattern of wnt5b and wnt11 at early somite

stages, wnt5b expression is found in the tailbud and the posterior mesendoderm, while

wnt11 expression is found in the forebrain and anterior mesoderm. Possibly, Wnt5b

and/or Wnt11 act to establish the anterior-posterior identity by PCP signalling and Wnt4a

either acts redundantly or has a distinct role in regulating neural tube morphogenesis.

This is based on the assumption that Wnt4a is being secreted and Wnt4a is able to

44

Figure 13: Wnt4a gradients may provide positional information to neural progenitor cells Generation of a local Wnt4a source and resulting Wnt4a gradients may provide positional information to neural progenitor cells. Cells posterior to the Wnt4a source are exposed to a ‘normal’ anterior-posterior decreasing gradient and labelled cells are found on both sides of the neural tube. Cells anterior to the Wnt4a source are exposed to a ‘reverse’ anterior-posterior increasing gradient and labelled cells are found on one side of the neural tube. Cells adjacent to the Wnt4a are exposed to no gradient and labelled cells accumulate ectopically at the midline.

45

mediate a respond in NPCs in both directions. Potentially, Wnt4a is not secreted in the

anterior direction, which can be confirmed by generating a local Wnt source expressing

fluorescently tagged Wnt protein. If fluorescent Wnt puncta are found anterior to the

clone, it suggests that Wnt protein is secreted in the anterior direction. To test whether

NPC anterior to the Wnt clone are able to transduce Wnt4a signal, a downstream effector

such as GFP-Pk localization can be used. If anterior NPCs are able to respond to Wnt4a,

potentially a change in GFP-Pk localization will be observed.

If Wnt4a is secreted in all directions and all NPCs can respond to Wnt4a, there are

three possibilities for how a reversed Wnt4a gradient may affect NPCs. First, Wnt4a

could regulate the direction of intercalation. PCP has been shown to couple cell division

with mediolateral intercalation; however, the mechanism by which the direction of

intercalation is decided is unknown. In Drosophila studies, Fz co-localizes with the

position of the polarized structure. Conversely, in vertebrates, Fz has not been shown to

co-localize with stable mediolateral cellular protrusions. The localization of GFP-Pk

suggests that the PCP components in vertebrates are localized along the anterior-posterior

axis. It is unclear how Wnt4a would regulate the position of protrusion formation.

Possibly in response to the endogenous decreasing anterior-posterior gradient, apical

daughter cells intercalate into the contralateral side. When apical daughter cells are

exposed to a reverse gradient, an increasing anterior-posterior gradient, the apical

daughter cell intercalates into the ipsilateral side. As seen with the HCT data (Figure

12B) and Wnt4a global over-expression (Figure 10A), possibly when no Wnt4a gradient

is present, the ability to direct protrusions to either side is disrupted, resulting in NPCs

accumulating ectopically The loss of the Wnt4a gradient such as with wnt4a morphants,

46

no phenotype observed, suggesting that the Wnt4a gradient does not inhibit formation of

protrusions. Possibly, loss of a Wnt4a gradient randomizes the direction of protrusions,

where in wnt4a morphants, daughter cells are deposited randomly on either side, but

equally from both sides, which would possibly result in no morphological phenotype.

The second and third possibilities are potential affects of Wnt4a on cell division.

Possibly, Wnt4a may affect the direction of cell division, where the absence of NPCs

crossing the midline is a result of NPC divisions along the anterior-posterior axis. The

third possibility is that Wnt4a regulates the decision for NPCs to divide. NPCs found

anterior to the Wnt4a source may not divide, resulting no daughter NPCs crossing the

midline. It is unclear how a reversed gradient would affect cell division; however both

scenarios are possible since either could result in NPCs not crossing the midline.

To determine the specific role of Wnt4a, NPC division needs to be observed in

response to a local Wnt4a source. Using confocal microscopy and time-lapse imaging,

NPCs can be tracked to determine if cells are dividing and in which direction. The

evidence from the HCT experiments, supported by the transgenic data, suggests that

Wnt4a provides positional data to NPCs. It is unclear if Wnt4a acts through PCP

signalling. To determine if the differential NPC behaviour is a result of changes in PCP

signalling, differences in GFP-Pk localization can compared with NPC movement in

response to a local Wnt4a source.

2.3: Methods

2.3.1: Materials

An in vitro RNA synthesis kit to generate capped mRNA for microinjection and DEPC-

47

treated water used to dilute mRNA was obtained from Ambion. Restriction enzymes,

bovine serum albinum and alkaline phosphatase were obtained from New England

Biosciences. High-fidelity Taq Phusion PCR kit was obtained from Finzymes and

primers used in PCR were obtained from Sigma-Aldrich. Cloning was performed using

DH5α, TOP10 cells and all gateway cloning reagents (LR clonase, BP clonase) were

obtained from Invitrogen. DNA ligation kit was obtained from Roche Biosciences.

Plasmid DNA isolation, gel extraction and PCR purification kits were obtained from

Qiagen. Glass capillary tubes with filaments and without filaments were obtained from

World precision instruments and were pulled on a Sutter Instruments Co. glass puller to

generate needles for microinjections and cell transplantation. Phenol red, low melt agarose,

pronase and other biological buffers/reagents were obtained from Sigma-Aldrich.

Embryos were mounted in glass bottom Petri dishes obtained from MatTek Corporation

and imaged using LSM710 confocal microscope from Zeiss equipped with ZEN software.

Figures were processed using ZEN and Adobe Creative Suite 4.

2.3.2: Zebrafish embryo microinjection

Zebrafish embryos were obtained from natural mating of wildtype (WT) TL and AB

hybrid backgrounds. Plasmids containing membrane-localized red fluorescent protein

(memRFP), membrane-localized green fluorescent protein (mGFP), EGFP-Prickle (GFP-

Pk), Wnt4a, Wnt5b, Wnt11, Tol2, were linearized and sense-strand-capped mRNA was

synthesized with the mMESSAGE mMACHINE system. Zebrafish embryos were

dechorionated by treatment of pronase and injected at the one-cell stage. Scatter labeling

48

was obtained by injecting two blastomeres at the eight-cell stage.

2.3.3: Cell transplants

Cell transplants were performed with mid-blastula stage embryos. For Wnt secretion

assay, embryos were dechorionated with Pronase treatment. Donor and host embryos

were injected at the 1-cell stage with capped wnt11-yfp and memRFP mRNA

respectively. Approximately 20 cells were transplanted into the animal cap of the host

embryo. Heterochronic cell transplants were performed with mid-blastua stage and 6-

somite staged embryos. With initial transplants, donor cells were labeled with rhodhamin-

dextran. Host embryos were injected with memRFP mRNA and scattered labeled with

GFP-Pk mRNA to the 6-stage. Donor embryos were injected with mGFP and Wnt

mRNA to the mid-blastua stage. 10-20 cells from the donor embryo were transplanted

into a single location at the 6-somite in the host embryo.

2.3.4: Microscopy

Live embryos were mounted in 0.8% low melt agarose before imaging. Fluorscent images

of embryos injected with memRFP, mGFP, GFP-Pk or transgenics were obtained with a

Zeiss 510/710 confocal microscope. Images were captured along the dorsal-ventral axis

through the neuroepithelium to the notocord at the 6-12 somite stage.

2.3.5: Transgenesis

To generate transgenic zebrafish, tol2 mediated transgenesis was used. Using the Gateway

49

cloning system from Invitrogen following the manufacture’s instructions, middle entry

clones containing Wnt open reading frames were amplified with recombination sites from

plasmids by Phusion polymerase chain reaction (PCR) from Finnzymes following the

manufacteur’s instructions. Primers used to generate inserts for middle entry vectors:

Heat-shock protein 70 (Hsp70) promoter in 5’entry plasmid, and IRES:mGFP 3’entry

plasmids were obtained from the Lawson Tol2 Kit. Entry plasmids were recombined into

a destination vector to generate Hsp70:wnt:IRESmGFP constructs. Chorinated zebrafish

embryos obtained from a natural mating were injected with 25 pg of Tol2 mRNA and 25

pg of transgene plasmid DNA. Embryos at early somite stages were subject to heat-

shock at 37°C for 30 minutes to induce expression of Wnt protein and drive mGFP

expression.

2.4: References

[1] C.P. Heisenberg, M. Tada, G.J. Rauch, L. Saúde, M.L. Concha, R. Geisler, D.L. Stemple, J.C. Smith, and S.W. Wilson, “Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation,” Nature, vol. 405, May. 2000, pp. 76-81.

[2] B. Kilian, H. Mansukoski, F.C. Barbosa, F. Ulrich, M. Tada, and C.P. Heisenberg, “The role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish gastrulation,” Mechanisms of Development, vol. 120, Apr. 2003, pp. 467-476.

[3] J. Gros, O. Serralbo, and C. Marcelle, “WNT11 acts as a directional cue to organize the elongation of early muscle fibres,” Nature, vol. 457, Jan. 2009, pp. 589-593.

[4] B. Goldstein, H. Takeshita, K. Mizumoto, and H. Sawa, “Wnt signals can function as positional cues in establishing cell polarity,” Developmental Cell, vol. 10, Mar. 2006, pp. 391-396.

[5] B. Ciruna, A. Jenny, D. Lee, M. Mlodzik, and A.F. Schier, “Planar cell polarity signalling couples cell division and morphogenesis during neurulation,” Nature, vol. 439, Jan. 2006, pp. 220-224.

[6] T. Matsui, A. Raya, Y. Kawakami, C. Callol-Massot, J. Capdevila, C. Rodríguez-Esteban, and J.C. Izpisúa Belmonte, “Noncanonical Wnt signaling regulates midline convergence of organ primordia during zebrafish development,” Genes &

50

Development, vol. 19, Jan. 2005, pp. 164-175. [7] A.R. Ungar, G.M. Kelly, and R.T. Moon, “Wnt4 affects morphogenesis when

misexpressed in the zebrafish embryo,” Mechanisms of Development, vol. 52, Aug. 1995, pp. 153-164.

[8] M. Kurayoshi, H. Yamamoto, S. Izumi, and A. Kikuchi, “Post-translational palmitoylation and glycosylation of Wnt-5a are necessary for its signalling,” The Biochemical Journal, vol. 402, Mar. 2007, pp. 515-523.

[9] B. Geldmacher-Voss, A.M. Reugels, S. Pauls, and J.A. Campos-Ortega, “A 90-degree rotation of the mitotic spindle changes the orientation of mitoses of zebrafish neuroepithelial cells,” Development (Cambridge, England), vol. 130, Aug. 2003, pp. 3767-3780.

51

CHAPTER 3: Discovery of Novel Regulators of Planar Cell Polarity

3.0: Introduction

Drosophila planar cell polarity (PCP) studies suggest the global cue that

establishes PCP most likely acts through the membrane proteins of the core PCP group,

namely Flamingo (Fmi), Frizzled (Fz) or Van gogh like 2 (Vangl2). Fmi is a seven-pass

atypical cadherin, thought to regulate adhesion between cells and support formation of

complexes with Fz and Vangl2. The global cue that establishes PCP is not likely

transduced through Fmi since Fmi acts cell autonomously and is not asymmetrically

localized across the cell. Fz is characterized as a Wnt receptor, suggesting that Wnt

protein may regulate PCP. The role of Wnt signalling in regulating PCP is the topic of

investigation in Chapter 2. Vangl2 is a four pass transmembrane protein that is

asymmetrically localized and acts cell non-autonomously. There are no known soluble

ligands for Vangl2 and very few membrane proteins interact with Vangl2. Scribble and

Discs Large, two proteins involved in apical-basal polarity and Fmi have been identified

to physically interact in cis [1][2]. To further characterize Vangl2, an essential PCP

component, a screen for novel protein interactions was performed to potentially discover

a novel co-receptor that may respond to the global cue to establish PCP.

A common approach to search for novel protein-protein interactions is to perform

a yeast-two-hybrid (YTH), where a bait protein is screened against a library of prey

proteins. The bait consists of the protein of interest fused to a portion of a transcription

factor. The prey consists of a protein from a library fused to the complementary portion

of the transcription factor. When the bait and prey proteins interact, the complementary

portions of the transcription factor interact and form an intact functional transcription

52

factor. Subsequently, the bait-prey complex can enter the nucleus and activate target

reporter genes. Although the conventional YTH is a useful tool to assess protein-protein

interactions, there are some limitations. Integral membrane proteins, due to their highly

hydrophobic nature cannot be analyzed by the conventional method since they are unable

to translocate to the nucleus to activate the reporter genes.

To detect protein-protein interactions with membrane proteins, a modified YTH

method has been employed in collaboration with Igor Stagjlar. Membrane-yeast-two-

hybrid (MYTH) allows for membrane protein-protein interactions to be detected. MYTH

uses a split-ubiquitin approach, where the transcription factor translocates to the nucleus

independent of the bait and prey proteins, allowing membrane proteins to be used in the

screen (Figure 14) [3]. MYTH is based on observation that ubiquitin can be separated

into two components (termed Nub and Cub) that functionally reconstitute when in close

proximity to one another [3]. The bait is tagged with the Cub (C-terminal half of

ubiquitin) and an artificial transcription factor [3]. The prey is tagged with the Nub (N-

terminal half of ubiquitin). The bait-prey interaction brings the Cub and Nub moieties in

close proximity to each other and facilitates reconstitution of ubiquitin [3]. The presence

of ubiquitin is recognized by ubiquitin-specific proteases found in all eukaryotic cells,

resulting in cleavage of the transcription factor attached to the Cub domain [3]. The

released transcription factor enters the nucleus and activates the reporter genes [3].

53

Figure 14: Membrane Yeast Two Hybrid (MYTH) A. Membrane protein of interest is fused to Cub domain followed by an artificial transcription factor LexA-VP16, while another prey protein (cytosolic or membrane) is fused to the NubG domain. If bait and prey do not interact, the Cub and Nub domains will not reconstitute to form ubiquitin, no cleavage of the transcription factor occurs, resulting in no activation of the reporter genes. B. If bait and prey interact, Nub and Cub domains are brought into close proximity and ubiquitin reconstitution is able to occur. Ubiquitin is recognized by proteases inside the cell and cleaves the artificial transcription factor and enters the nucleus. Inside the nucleus, the transcription factor binds the LexA operator activating reporter genes.

54

In zebrafish, there are two Vang homologues, vangl1 and vangl2. The expression

of zebrafish vangl2 is widely expressed throughout zebrafish development and is

maternally provided. vangl1 is not expressed maternally and is first detected at the 15-

somite stage in the developing nervous system [4]. The expression of vangl1 appears to

not overlap with vangl2, since by 1 day post fertilization, vangl1 expression is restricted

to the hindbrain whereas vangl2 expression is found in the neuroectoderm, neural tube

and hatching gland [4]. Despite the non-overlapping expression patterns, injection of

vangl1 mRNA into vangl2 mutant zebrafish embryos is able to partial rescue convergent

extension defects, suggesting a functional similarity between Vangl1 and Vangl2 [4]. The

distinct roles of Vangl1 and Vangl2 is unclear. The objective of the MYTH screen is to

discover novel regulators of PCP by identifying new protein-protein interactions with

Vangl1 and Vangl2. Possibly, other membrane proteins that may act as PCP co-receptors

will be identified as well as downstream proteins that will show similar or distinct roles

for Vangl1 and Vangl2.

3.1: Results

3.1.1: Characterization of Baits

Bait proteins were constructed using an in vivo recombination approach in yeast.

Using primers, the open reading frames of Vangl1 and Vangl2 were amplified by

polymerase chain reaction (PCR) with flanking regions homologous to the bait vector.

Bait vectors were linearized and transformed into competent yeast cells with purified

PCR products. Bait vectors encode the leu2 gene product, which permits yeast to grow on

selective plates without leucine. Yeast growing on plates without leucine were

55

individually picked and plasmids were isolated and sequenced. Vangl1 and Vangl2 baits

with N- and C-terminal tags were constructed using this method.

To characterize the constructed bait proteins, tests for activation of the reporter,

localization of the bait and stringency of interaction were performed. The NubG/I test

was used, inwhich the N-terminal portion of ubiquitin (NubI) or N-terminal portion of

ubiquitin with a point mutation (NubG) is transformed with the bait vector into

competent yeast cells. NubI acts as a positive control since it has a high affinity for the

Cub component and will spontaneously reconstitute in vivo to form ubiquitin. The

transcription factor is cleaved and able to translocate into the nucleus to activate the three

reporter genes, HIS3, ADE2 and lacZ. The gene products of HIS3 and ADE2 allow yeast

to grow on plates without histidine and adenine, which normally inhibits growth. Growth

on plates (without histidine and adenine) suggests that the bait constructs are functional

and capable of activating the reporter.

NubG acts as a negative control since it contains a point mutation that prevents

spontaneous reconstitution with the Cub domain. Instead, NubG needs to be brought into

close proximity, such as with bait-prey interaction. However since only NubG will be

transformed with the bait, no interaction should occur, resulting in no activation of the

reporter. Any growth on the selective plates is indicative of background that will be

obtained in the MYTH screen. To determine the stringency of the screen, yeast cells were

transformed with the bait and NubG and assayed on selective plates (minus histidine and

adenine) with varying concentrations of 3-amino-1,2,4-triazole (3-AT). 3-AT is a

competitive inhibitor of the HIS3 gene product and can be added to the plate media to

remove background due to the leakiness of the reporter. Finally to test for localization of

56

the bait construct, the Nub proteins were targeted to the plasma membrane and assayed

for presence in the endoplasmic reticulum (ER). The localization of the bait can be

gauged by localization of the NubI, activation of the reporter and growth on the selective

plates.

Four bait constructs consisting of N- and C-terminal Cub tagged Vangl-1 and

Vangl-2 were generated (Table 1). All constructs appeared to be capable of activating

reporter since there was growth when the baits were transformed with NubI. The N-

terminal Cub-Vangl1 appeared to localize to the ER and plasma membrane. However, the

N-terminal Cub-Vangl2 bait appeared to localize only to the plasma membrane (Figure

15C). The C-terminal Vangl1/2-Cub fusion appeared to localize to both the ER and the

plasma membrane. Examining the leakiness of the reporter, there appeared to be some

background with the C-terminal Vangl2-Cub bait, which can be decreased by addition of

10 mM 3-AT. Since the C- terminus of Vangl2 is better characterized and was shown to

consist of a PDZ binding domain, the MYTH screen was conducted with the C-terminal

Cub baits.

3.1.2: Analysis of MYTH screen hits

Three screens were performed with the C-terminal baits for Vangl-1 and -2.

Collectively, the Vangl-1 screens generated 90 hits of which 39 were unique hits. The

Vangl-2 screen generated 67 hits where 56 hits were unique (Table 2). Expected hits such

as other members of the PCP signalling pathway, namely Dishevelled and Prickle, were

not detected in the screen. However, proteins affiliated with the pathway, such as

Receptor Tyrosine Kinase-like Orphan receptor 1 (ROR1) and Vangl-1 were found to

57

Table1: Summary of bait construction Bait Plasma ER Stringency

V1-Cub Y Y 0 mM V2-Cub Y Y 10 mM Cub-V1 Y Y 0 mM Cub-V2 N Y 0 mM

A

B

AS

58

C

D

Figure 15: Characterization of Baits NubG/I test to check for activation of reporter, localication and background of bait proteins NubI has a high affinity for the Cub domain, acts as a positive control. NubG contains a point mutation and needs to be brought into close proximity with protein interaction. NubG should act as a negative control since no prey protein is present. Selective conditions are indicated as follows: W - tryptophan, L - Leucine, A – Adenine, H – Histidine, 10/25/50/100 mM amounts of 3AT. –W selects for presence of prey vector, -L selects for presence of bait vector. –AH selects for activation of reporter genes. A. Cub-Vangl1 is localized to the ER and plasma membrane and is able to activate the reporter without any background B. Vangl1-Cub is localized to both the ER and plasma membrane and is able to activate the reporter without any background. C. Cub-Vangl2 is localized only to the plasma membrane and is able to activate the reporter without any background. D. Vangl2-Cub localizes to both the ER and plasma membrane and is able to activate the reporter with little background. Addition of 3AT diminishes the background.

59

Table2a: Vangl1 MYTH screen hits Accession # Gene Frequency NM_001001995 glycoprotein M6B (GPM6B) 2 NM_001044 solute carrier family 6 member 3 (SLC6A3) 2 NM_001083592 receptor tyrosine kinase-like orphan receptor 1 (ROR1) 8 NM_002155 heat shock 70kDa protein 6 1 NM_002333 low density lipoprotein receptor-related protein 3 1 NM_002501 nuclear factor I/X (CCAAT-binding TF) (NFIX) 1 NM_003257 tight junction protein 1 (zona occludens 1) (TJP1) 1 NM_003277 claudin 5 1 NM_004607 tubulin folding cofactor A (TBCA) 1 NM_005669 receptor accessory protein 5 (REEP5) 1 NM_005745 B-cell receptor-associated protein 31 (BCAP31) 10 NM_005909 microtubule-associated protein 1B (MAP1B) 1 NM_006044 histone deacetylase 6 (HDAC6) 1 NM_006292 tumor susceptibility gene 101 (TSG101) 1 NM_014041 signal peptidase complex subunit 1 homolog 1 NM_014051 transmembrane protein 14A 12 NM_014145 chromosome 20 open reading frame 30 (C20orf30) 1 NM_014445 stress-associated endoplasmic reticulum protein 1 1 NM_014713 lysosomal-associated protein transmembrane 4 alpha 1 NM_015407 abhydrolase domain containing 14A (ABHD14A) 1 NM_016145 chromosome 19 open reading frame 56 (C19orf56) 1 NM_016224 sorting nexin 9 (SNX9) 1 NM_017655 GIPC PDZ domain containing family, member 2 (GIPC2) 1 NM_018930 protocadherin beta 10 (PCDHB10) 2 NM_018936 protocadherin beta 2 (PCDHB2) 1 NM_020762 SLIT-ROBO Rho GTPase activating protein 1 1 NM_021009 ubiquitin C 2 NM_024532 sperm associated antigen 16 (SPAG16) 1 NM_032927 transmembrane protein 128 (TMEM128) 1 NM_138959 vang-like 1 (van gogh, Drosophila) (VANGL1) 1 NM_152464 transmembrane protein 199 (TMEM199) 1 NM_153757 nucleosome assembly protein 1-like 5 (NAP1L5) 1 NM_173834 Yip1 domain family, member 6 (YIPF6) 2 NM_173852 keratinocyte associated protein 2 (KRTCAP2) 1 NM_177424 syntaxin 12 (STX12) 1 NM_194359 ring finger protein 41 (RNF41) 20 NM_207521 reticulon 4 (RTN4) 1 XM_001717663 PREDICTED: similar to hCG23722 (LOC100128731) 1 XM_002344544 PREDICTED: similar to Cytochrome c oxidase subunit 2 1

60

Table2b: Vangl2 MYTH screen hits Accession # Gene Frequency NM_175607 contactin 4 (CNTN4) 1 NM_178014 tubulin, beta (TUBB) 1 ABG29260 NADH dehydrogenase subunit 2 1 NM_001002021 phosphofructokinase, liver (PFKL) 1 NM_001003 ribosomal protein, large, P1 (RPLP1) 1 NM_001006623 WD repeat domain 33 (WDR33) 1 NM_001008390 CGG triplet repeat binding protein 1 (CGGBP1) 1 NM_001024660 kalirin, RhoGEF kinase (KALRN) 1 NM_001040058 secreted phosphoprotein 1 (SPP1) 1 NM_001204 bone morphogenetic protein receptor, type II 2 NM_001614 actin, gamma 1 (ACTG1) 3 NM_001806 CCAAT/enhancer binding protein (C/EBP), gamma (CEBPG) 1 NM_002045 growth associated protein 43 (GAP43) 1 NM_002055 glial fibrillary acidic protein (GFAP) 2 NM_002585 pre-B-cell leukemia homeobox 1 (PBX1) 1 NM_002601 phosphodiesterase 6D, cGMP-specific, rod, delta (PDE6D) 1 NM_002792 proteasome subunit, alpha type, 7 (PSMA7) 1 NM_002847 protein tyrosine phosphatase receptor N polypeptide2(PTPRN2) 1 NM_003127 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 2 NM_003277 claudin 5 1 NM_003388 CAP-GLY domain containing linker protein 2 (CLIP2) 1 NM_004537 nucleosome assembly protein 1-like 1 (NAP1L1) 1 NM_004615 tetraspanin 7 (TSPAN7) 1 NM_005345 heat shock 70kDa protein 1 NM_005917 malate dehydrogenase 1, NAD (soluble) (MDH1) 1 NM_007369 G protein-coupled receptor 161 (GPR161) 1 NM_013442 stomatin (EPB72)-like 2 (STOML2) 1 NM_014717 zinc finger protein 536 (ZNF536) 1 NM_014787 DnaJ (Hsp40) homolog, subfamily C, member 6 (DNAJC6) 1 NM_015123 FERM domain containing 4B (FRMD4B) 1 NM_015570 autism susceptibility candidate 2 (AUTS2) 1 NM_017811 ubiquitin-conjugating enzyme E2R 2 (UBE2R2) 1 NM_017812 coiled-coil-helix-coiled-coil-helix domain containing 3 (CHCHD3) 1 NM_017921 nuclear protein localization 4 homolog 1 NM_018273 transmembrane protein 143 (TMEM143) 1 NM_020240 CDC42 small effector 2 (CDC42SE2) 1 NM_021948 brevican (BCAN) 1 NM_022777 RAB, member RAS oncogene family-like 5 (RABL5) 1 NM_022895 chromosome 12 open reading frame 43 (C12orf43) 1 NM_030939 chromosome 6 open reading frame 62 (C6orf62) 1 NM_033119 naked cuticle homolog 1 (Drosophila) (NKD1) 1 NM_170692 RAS protein activator like 2 1 NM_170774 Ras association domain family member 2(RASSF2) 1 NM_182472 EPH receptor A5 (EPHA5) 1 NM_182480 coenzyme Q6 homolog, monooxygenase 1

61

Table 2b: Vangl2 MYTH screen hits (continued) Accession # Gene Frequency NM_194317 LY6/PLAUR domain containing 6 (LYPD6) 1 NM_194359 ring finger protein 41 (RNF41) 7 NM_203401 stathmin 1/oncoprotein 18 (STMN1) 1 NM_206962 protein arginine methyltransferase 2 (PRMT2) 1 XM_001716421 R3H domain and coiled-coil containing 1 (R3HCC1) 1 XM_001721542 hypothetical protein 1 XM_035299 zinc finger, SWIM-type containing 6 (ZSWIM6) 1 XR_017149 PREDICTED: Homo sapiens misc_RNA (LOC392437) 1 XR_017548 PREDICTED: Homo sapiens misc_RNA (LOC399942) 1 XR_040065 PREDICTED: Homo sapiens misc_RNA (OTUD1) 1 XR_041470 PREDICTED: Homo sapiens misc_RNA (LOC389634) 1

62

interact with Vangl-1 [5]. The Vangl-2 screen showed interaction with Naked Cuticle

and Bone Morphogenetic Protein Receptor, both of which have been implicated in PCP

signalling [6][7]. MYTH data were analyzed through the use of Ingenuity Pathways

Analysis, where the hits were clustered into known signalling networks and signalling

pathways (Ingenuity® Systems, www.ingenuity.com). The screens resulted in being

clustered to the molecular/cellular network, more specifically cellular

assembly/organization (Figure 16A). The top signalling pathway associated with the hits

was tight-junction signalling for both Vang homologues (Figure 16B). In Drosophila

studies, the core PCP proteins have been found to localize and interact with many of the

junction components, suggesting the identified interactions in the MYTH screen are valid

[8].

3.1.3: Validation of MYTH screen

The MYTH screens conducted did not yield any known protein-protein

interactions that have been shown to interact physically with Vangl1/2. To ensure the hits

obtained from the MYTH screen represented valid protein-protein interactions, positive

control prey constructs were made. Scribble and Prickle have been shown to interact

physically with Vangl-2 and by transforming the Vangl-2-Cub bait with NubG-Scribble

or NubG-Prickle prey vectors, revealed a direct protein interaction (Figure 17) [1][9].

Both NubG-Scribble and NubG-Prickle1 activated the reporter, where growth was

observed on selective plates. Another method to validate the MYTH screen was to choose

one of the hits and check for physical interaction with Vangl1/2. The hit selected was

63

Figure 16: Analysis of Hits Using Ingenuity Pathway Analysis software, hits from the MYTH screen were clustered into (A) Network Functions and (B) Signalling Pathways.

A

B

64

Figure 17: Validation of MYTH Screen with Known Protein Interactions To validate the screen, prey constructs of proteins known to interact with Vangl2 were chosen. –W (tryptophan) selects for presence of prey vector. –L (Leucine) selects for presence of bait. –AH (adenine, histidine) selects for interaction. 3AT, 25 mM is added to remove possible background. Xgal, substrate for ß-galacosidase reporter gene, results in blue colonies. Scribble and Prickle have been shown to interact physically with Vangl2, which is shown by growth on selective plates with stringency and blue colonies on the selective Xgal plate. PTK7 although implicated in PCP signalling has not been shown to interact with Vangl2. No growth is seen on selective plates with 3AT and no blue colony is formed.

65

RING Finger 41 (RNF41), since it was found to interact with both Vangl-1 and Vangl-2

with the highest frequency. To confirm the interaction, an in vivo approach was taken

utilizing zebrafish embryos. Zebrafish RNF41 was cloned from cDNA and subcloned

into an in vitro mRNA expression vector. mRNA encoding myc-tagged zebrafish Vangl-

2 and flag-tagged zebrafish RNF41 were injected into zebrafish embryos and protein

lysate was collected. To test for a physical interaction, co-immunoprecipitation was

performed which showed that Vangl-2 and RNF41 physically interact (Figure 18).

RNF41 encodes an E3 ubiquitin ligase that contains a ring finger motif and USP8

interaction domain. E3 ubiquitin ligases are involved in transferring ubiquitin from the

E2 ubiquitin ligase to the substrate to be ubiquitinated. The ring finger motif is

responsible for substrate specificity. USP8 is a deubiquitinating enzyme, which has been

shown to physically interact with RNF41 in the USP8 interaction domain. RFN41 has

been shown to interact and regulate steady-state levels of the ErbB3 receptor,

ubiquitinates Parkin as well as regulating its own stability [10]. Expression of USP8

appears to stabilize RNF41, further suggesting that RNF41 is ubiquitinated. From the

MYTH screen, possibly RNF41 may regulate the trafficking or stability of Vangl-1 and -

2 and may act as a novel regulator of PCP signalling. Ubiquitination has recently been

shown to regulate PCP signalling and potentially RNF41 may act in the pathway to

regulate PCP protein stability[11].

3.1.4: Ectopic expression of RNF41 disrupts PCP signalling

The protein interaction between RNF41 and Vangl2 suggests RNF41 may

regulate PCP. First, the endogenous expression was examined to determine if RNF41 is

66

Figure 18: Co-immunoprecipitation shows that Vangl2 and RNF41 physically interact IB: Immunoblotted, IP: Immunoprecipitated, IgGH: Immunoglobulin Heavy-chain, IgGL: Immunoglobulin Light-chain, + presence, - absence. A light-chain specific antibody was used since Vangl2-Myc separated to approximately the same molecular weight as the heavy-chain. Two murine antibodies were used to IP and IB and even with the IgGL-specific secondary antibody, a faint band was detected in all sample lanes, most likely corresponding to the heavy chain. * indicates a higher molecular weight band detected in blots probed with myc antibody when Vangl2-myc is expressed. * appears in the lysate control (not shown) and IP, suggesting Vangl2-Myc was immunoprecipitated. Protein concentrations were not equalized between samples.

Flag-RNF41 - + + - Vangl2-Myc + - + -

IP: Myc

IB: Flag

IgG L

IgG H

Flag-RNF41 - + + -

Vangl2-Myc + - + -

Lysates

IB: Myc

IB: Flag

IB: Myc

* *

67

expressed at time when the embryo is undergoing convergent extension (CE) movements

(Figure 19). An anti-sense RNA probe was generated using the full length RNF41.

Zebrafish RNF41 appears to be expressed maternally and persists ubiquitously after the

onset of zygotic transcription and at early stages of neurulation. Since RNF41 mRNA is

expressed when the embryo is undergoing convergent extension movements, the next

assay was to determine if RNF41 could regulate PCP signalling. To test whether PCP

signalling was disrupted, RNF41 was ectopically expressed by injecting RNF41 mRNA

into the 1-cell stage embryo. A concentration dependent defect in the extension of the

embryo was observed as compared to un-injected embryos, suggesting that RNF41 may

regulate PCP (Figure 20A-E). To ensure a defect in CE was the cause of the phenotype,

embryos injected with 200 pg of RNF41 mRNA were probed for krox20 and myoD which

marks the midbrain-hindbrain boundary and somites respectively to clearly show the

presence of a CE defect (Figure 20F,G). Embryos were time-matched and flat mounted

and comparing a non-injected embryo to a RNF41 mRNA injected embryo, the embryo

with RNF41 over-expression shows a broader and shorter body axis as compared to the

non-injected control.

To determine if RNF41 has a direct role in regulating PCP signalling, GFP-Pk

localization was examined in response to RNF41 over-expression. Embryos were

injected with GFP-Pk at the 1-cell stage and subsets of those embryos were injected again

with varying concentrations of RNF41 mRNA (Figure 21). WT embryos injected with

GFP-Pk possess puncta localized to the membrane. With increasing concentrations of

RNF41, the number of puncta decreased, where with injection 400 pg of RNF41 mRNA,

68

Figure 19: Endogenous RNF41 expression RNF41 RNA in situ hybridization of zebrafish embryos at different stages. A-C: RNF41 anti-sense RNA probe. D-F: RNF41 sense probe A,D: 2-cell stage. B,D: Sphere stage. C,E:. 6-somite stage.

69

Figure 20: Ectopic RNF41 expression induces convergent extension defects A-E: Lateral views of zebrafish embryos at 14-16 hpf. A: WT. B. 100 pg RNF41 mRNA injection. C: 200 pg RNF41 mRNA injection. D: 200 pg GFP-RNF41 mRNA injection. E: 400 pg GFP-RNF41 mRNA injection. F,G: Flat mount MyoD and Krox20 anti-sense RNA in situ hybridization of time-matched zebrafish embryos at 14-16 hpf. * indicates Krox20 staining. Dash line indicates MyoD staining. F: WT embryo. G: 200 pg RNF41 mRNA injection.

* *

70

Figure 21: RNF41 regulates GFP-Pk localization Confocal microscopic sections along the dorsal-ventral axis of 14-16 hpf zebrafish embryos injected with memRFP (red) and GFP-Pk (green). All WT embryos were injected with GFP-Pk and memRFP. A: Subset of embryo with no second injection. B: Subset of embryos with second injection of 100 pg of RNF41 mRNA. C: Subset of embryos with second injection of 200 pg of RNF41 mRNA. D: Subset of embryos with second injection of 400 pg of RNF41 mRNA.

A B

C D

71

GFP-Pk puncta localization was lost. The cytoplasmic levels of GFP-Pk also appeared to

be reduced in a concentration dependent manner, with the levels of memRFP remaining

constant at all concentrations. This suggests that RNF41 may directly regulate PCP

signalling by interacting with GFP-Pk and potentially regulating its stability.

3.1.5: RNF41 subcellular localization suggests a new link between PCP and cilia

To further characterize the role of RNF41, GFP-RNF41 fusion protein was

constructed and injected into zebrafish embryos. GFP fluorescence was found throughout

the neural keel with weak cytoplasmic staining. At neural rod stages, GFP puncta were

observed just below the apical midline, near the ventral floor plate. The punctate pattern

observed appeared similar to the organization of cilia at the floor plate of the neural tube

(Figure 22A). To determine if GFP-RNF41 puncta were related to cilia, a marker of cilia

available in the lab was used. GFP-RNF41 mRNA was injected into Cilia-RFP marker

transgenic embryos and imaged using confocal microscopy (Figure22B). Examining the

ventral floor plate at neural rod stages showed similar expression pattern, where RNF41

puncta localized to the base of the cilium, possibly at the basal body.

3.2: Discussion

3.2.1: RNF41 may regulate planar cell polarity through Vangl2

RNF41 is an E3 ubiquitin ligase that directly interacts with Vangl2 and may

regulate PCP by affecting Vangl2 stability, Vangl2 localization or Pk stability.

Ubiquitination of membrane proteins causes either the recycling of the membrane protein

72

Figure 22: RNF41 localization suggests a role in regulating cilia Confocal sections along the dorsal-ventral axis of zebrafish neural rod. A: Embryos injected with memRFP (red) and 200 pg of GFP-RNF41 (green) mRNA. GFP-RNF41 is cytoplasmic and found in all cells the neural keel/rod. When the midline forms, puncta can be found on either side of the midline, close to the membrane. B: Embryos derived from a cross of cilia-RFP/- transgenic zebrafish (red) injected with 200 pg of GFP-RNF41 (green) mRNA. RNF41 appear to localize with each cilium.

A B

73

through the endosomal pathway or it is degraded by the lysosome. It is unclear whether

Vangl2 is ubiquitinated, since no other E3 ubiquitin ligase has been found to interact with

Vangl2. To begin to assess whether RNF41 regulate Vangl2 stability, injection of

zebrafish embryos with Vangl2-GFP and RNF41 can be performed. If RNF41 regulates

Vangl2 stability, loss of Vangl2-GFP at the membrane would be expected with co-

expression of RNF41. If RNF41 does not regulate Vangl2 stability, Vangl2-GFP

membrane fluorescence would expected to be comparable to WT expression.

Asymmetric localization of PCP components is a hallmark of PCP signalling. Studies in

cell culture have shown that Smurf E3 ubiquitin ligases regulate asymmetric localization

of Pk [11]. Upon complex formation of Pk, Dsh and Par6, Smurf is recruited to the

complex and targets Pk for ubiquitin-dependent degradation [11]. Possibly, Vangl2 is

degraded by RNF41 and if RNF41 is itself asymmetrically localized, it may promote the

asymmetric distribution of Vangl2. The endogenous localization of RNF41 needs to be

examined. It is unclear whether RNF41 acts on Vangl2 or Pk to regulate PCP. The loss of

GFP-Pk puncta could result from RNF41 directly regulating Pk stability. Vangl2 could

act to recruit Pk and RNF41, allowing RNF41 to interact and target Pk for ubiquitin-

mediated degradation. This additional method to regulate Pk protein levels could act with

Smurf to provide a means to regulate Pk stability across the entire cell. The model that I

propose is that Vangl2 acts as a scaffold to localize Pk and RNF41. When in close

proximaty, RNF41 binds and ubiquitinates Pk, targeting it for degradation.

74

3.2.2: RNF41 localizes to the basal body and may regulate non-canonical signalling

Disruption of basal body by loss-of-function of basal body proteins such as

bardet-biedl syndrome 4 (bbs4) in zebrafish results in embryos with CE defects [12].

Furthermore, epistasis analysis indicates that bbs4 functions downstream of wnt5b and

wnt11 [12]. In addition to the PCP defects, bbs4 morphants also possess canonical Wnt

defects, indicated by the expanded axin2 domain relative to wild-type [12]. The affect on

canonical and non-canonical Wnt signalling was further characterized with in vitro

experiments. In mono-ciliated mammalian cells, stimulation of Wnt5a has been shown to

inhibit canonical signalling by inhibiting up-regulation of the canonical Wnt signalling co-

transcription factor (TCF/LEF). With disruption of the basal body, the ability of Wnt5a

to suppress TCF/LEF up-regulation is lost [12]. Possibly disruption of the basal body

alters the behaviour of a common effector molecule to both pathways, desensitizing the

cell to Wnt stimulation [12]. A possible candidate is Dsh as it mediates both canonical

and non-canonical Wnt signalling as well as mis-expression of Dsh is able to partially

rescue bbs4 morphants [12]. Potentially, RNF41 localizes to the basal body and is able to

mediate some aspect downstream of non-canonical Wnt signalling.

3.3: Methods

3.3.1: Materials

Amino acids, agar and components for yeast media were obtained from BioShop.

Bait/prey vectors and Human embryonic cDNA library were obtained from Igor

Stagljar/Dualsystems Biotech. Saccharomyces cercisiae THY.AP4 [MATa leu2-3, 112

75

ura3-52 trp1-289 lexA::HIS3 lexA::ADE2 lexA::lacZ] yeast strain was obtained from

Igor Stagljar Lab. Plasmid isolation, gel extraction and PCR puficiation kits were

obtained from Qiagen. Other biological reagents and buffers were obtained from Sigma-

Aldrich. High-fidelity Taq Phusion PCR kit was obtained from Finzymes and primers

used in PCR were obtained from Sigma-Aldrich. Human Vangl-1, Vangl-2 and Prickle-1

clones were obtained from Open Biosystems and the mouse Scribble plasmid was

obtained from Jane McGlade’s Laboratory.

3.3.2: Bait/Prey vector construction by homologous recombination/gap repair

PCR primers containing the homologous region of vector backbone and 5’ or 3’ region of

the open-reading frame of the gene of interest (Vangl-1, Vangl-2, Prickle-1, Scribble)

were used to obtain a PCR product with homologous regions flanking both ends of the

open-reading frame. Primers used to generate bait/prey inserts: Vangl2-Cub Forward:

ATGTCTGATGCGGCTCCTTCATTGAGCAATCTATTTTATATGGACACCGAGTC

CCAGTAC, Reverse: GTTGATCTGGAGGGATCCCCCCCGACCAATCTATTTTATA

TGGATACCGAATCCACTTATTC. Vangl1-Cub Forward: ATGTCTGATGCGGCTCC

TTCATTGAGCAATCTATTTTATATGGATACCGAATCCACTTATTC, Reverse:

GTTGATCTGGAGGGATCCCCCCCGAC ATGGTCGACGGTATAACGGATGTCT

CAGACTGTAAGC. Cub-Vangl2 Forward: GCCA GGCCTTTAATTAAGGCCCCAAT

GGACACCGAGTCCCAGTAC, Reverse: CATGACCT ATTAAGATCTGACGTCAGC

GCTCCGCGTCCGCGTCACACTGAGGTCTCAGACTG. Cub-Vangl1 Forward:

GCCAGGCCTTTAATTAAGGCCGCCTCGGCCCCAATGGATAC CGAATCCACTT

ATTC, Reverse: CATGACCTATTAAGATCTGACGTCAGCGCTCCGC GTTAAACG

76

GATGTCCAGACTG. Nub-Scrib Forward: CCAAGCAGTGGTATCAACGCAGAGTG

GCCATTACGGCCCATGCTGAAGTGCATCCCGC. Reverse: CGAATTCTCGAG

AGGCCGAGGCGGGCCGACATGTTTTTTCCCCTAGGAGGGCACAGGGCCC.

Nub-Prickle1 Forward: CCAAGCAGTGGTATCAACGCAGAGTGGCCATTACG

GCCCATGCC TTTGGAGATGGAGCCC , Reverse: CGAATTCTCGAGAGGCCGA

GGCGGGCCGACAT GTTTTTTCCCTTAAGAAATAATACAATTTTTGCCC. PTK7-

Nub Forward: CCAAGCAG TGGTATCAACGCAGAGTGGCCATTACGGCCCATGG

GAGCTGCGCGGGGATCC, Reverse: CGAATTCTCGAGAGGCCGAGGCGGCCGA

CATGTTTTTTCCCTCACGGCT TGCTGTCCACGG. High-fidelity Taq Phusion PCR

kit was used to amplify the open-reading frame following the manufacture’s protocol

without any deviations. PCR products were purified using Qiagen PCR purification kits

following the manufacture’s directions without any changes. Compentent yeast cells were

transformed with linearized bait (pCCWSTE linearized with HindIII and PstI, pBTN3

linearized with NcoI and SacII) or prey (SmaI) and PCR products containing open-reading

frames of Vangl-1 and -2. Bait and prey plasmids containing insert were selected for by

growing transformed yeast on media plates without leucine or tryptophan respectively.

3.3.3: NubG/I Test

Bait vectors are transformed into competent yeast cells and plated on selective plates (-

leucine) for successful transformation. Yeast containing bait vectors are grown to

competency and transformed with empty prey vectors (Nub domain only) targeted either

to the plasma membrane or endoplasmic reticulum (ER). Two different Nub domains are

used, NubI and NubG to test for ability to activate the reporter (positive control) and the

77

amount of background (negative control) respectively. To test for the level of stringency,

the transformed yeast containing both the bait and empty prey vectors are plated on

media with different concentrations of 3-aminotriazole, a competitive inhibitor of the his3

reporter gene.

3.3.4: MYTH

Bait vectors are transformed into competent yeast cells and plated on selective plates (-

leucine) for successful transformation. Yeast containing bait vectors are grown to

competency and transformed with a cDNA prey library (human fetal brain obtained from

the Igor Stagljar Lab). Transformed yeast was selected for interaction on plates without

leucine, tryptophan, adenine, histidine and corresponding amount of 3-AT (10

mMVangl2-Cub and 0 mM Vangl1-Cub) as determined by the NubG/I test. Colonies on

selection plates were replated on plates containing x-gal, where positive blue colonies

were picked and plasmid DNA was isolated using QIAGEN plasmid DNA isolation kits.

Prey cDNA was amplified using High-fidelity Taq Phusion PCR kit with primers:

Forward: GTCGAAATTCAAGACAA GG, Reverse: CGTGAATGTAAGCGTGAC.

PCR products were purified using QIAGEN PCR purification kits and sequenced using

the forward PCR primer for sequencing. Sequenced prey cDNA was identified using

BLAST against human genome.

3.3.5: Zebrafish microinjection

Zebrafish embryos were obtained from natural mating of wildtype (WT) TL and AB

hybrid backgrounds. Plasmids containing membrane-localized red fluorescent protein

78

(memRFP), EGFP-Prickle (GFP-Pk), Myc-Vangl2, RNF41, GFP-RNF41, Flag-

RNF41were linearized and sense-strand-capped mRNA was synthesized with the

mMESSAGE mMACHINE system. Zebrafish embryos were dechorionated by treatment

of pronase and injected at the one-cell stage. Scatter labeling was obtained by injecting

two blastomeres at the eight-cell stage.

3.3.6: Immunoprecipitation and Western Blotting

WT embryos at the 1-cell stage were injected with Myc-Vangl2 and/or Flag-RNF41

mRNA. Embryos were developed to sphere stage and cells were mechanically dissociated

using calcium-free conditions following the procedure outline in the Zebrafish Book

(Westerfield, M. (2000). The zebrafish book. A guide for the laboratory use of zebrafish

(Danio rerio). 4th ed., Univ. of Oregon Press, Eugene.). Sphere stage embryos were

rinsed in calcium-free Ringer’s solution (116 mM NaCl, 2.9 mM KCl, 5 mM HEPES pH

7.2). Approximately 100 embryos were placed in a single drop of Ringer’s solution on a

tissue culture plate. A glass cover-slip was placed onto the embryos and smashed. Petri

dish was washed with Ringer’s solution and using a narrow glass pipette, the dissociated

cells were collected into eppendorf tubes. Dissociated cells were pelleted for 5 min at 300

g and resuspended with a narrow bore glass pipette with Ringer’s solution to remove

excess yolk and centrifuged again. Cell pellets were frozen at -80ºC for future use. To

prepare protein for western blotting, cell pellets were resuspended in PLC lysis buffer,

run through needle syringe and centrifuged 13000 rpm to precipitate protein and remove

cellular debris. For immunoprecipitation, protein pellet was resuspended in PLC lysis

buffer and 40 µl of Protein G beads were added with 1 µg of Myc-antibody and PLC

79

lysis buffer was added to a total volume of 1 ml. Mixture was incubated at 4ºC for 2-3

hours with nutation. Beads were pelleted at 4ºC and supernatant was removed. Beads

were washed with PLC lysis buffer and centrifuged and repeated three times. 2x sample

buffer was added to the beads and boiled for 5 minutes. An acrylamide gel was prepared

and boiled samples were loaded in the gel. SDS-PAGE was performed according to

manufacture’s instructions. Separated proteins in the gel were transferred to PVDF

membrane and blotted with anti-flag antibody (Sigma, 1:2500) and detected with goat-

anti-mouse-HRP (BioRad, 1:10000). Protein lysate controls were blotted with anti-myc

antibody (Abcam, 1:5000) and anti-flag antibody and detected with goat-anti-mouse-

HRP. Protein bands were detected by chemilummenescence using ECL plus (GE Health

Care).

3.3.7: in situ hybridization

Embryos for in situ hybridization were fixed overnight in 4% paraformaldehyde in PBS.

Standard whole-mount in situ hybridization protocol was performed using digoxygenin-

labeled anti-sense RNA probes synthesized by in vitro transcription (Roche).

myoD/krox20, RNF41 riboprobes at 0.5-1.0 ng/µl were used and stained embryos were

imaged using Leica dissecting scope and OpenLab software.

3.3.8: Microscopy

Live embryos were mounted in 0.8% low melt agarose before imaging. Fluorescent images

of embryos injected with memRFP, GFP-Pk or transgenics were obtained with a Zeiss

510/710 confocal microscope. Images were captured along the dorsal-ventral axis through

80

the neuroepithelium to the notocord at the 6-12 somite stage.

3.4: References

[1] L.M. Kallay, A. McNickle, P.J. Brennwald, A.L. Hubbard, and L.T. Braiterman, “Scribble associates with two polarity proteins, Lgl2 and Vangl2, via distinct molecular domains,” Journal of Cellular Biochemistry, vol. 99, Oct. 2006, pp. 647-664.

[2] O. Lee, K.K. Frese, J.S. James, D. Chadda, Z. Chen, R.T. Javier, and K. Cho, “Discs-Large and Strabismus are functionally linked to plasma membrane formation,” Nature Cell Biology, vol. 5, Nov. 2003, pp. 987-993.

[3] K. Iyer, L. Bürkle, D. Auerbach, S. Thaminy, M. Dinkel, K. Engels, and I. Stagljar, “Utilizing the split-ubiquitin membrane yeast two-hybrid system to identify protein-protein interactions of integral membrane proteins,” Science's STKE: Signal Transduction Knowledge Environment, vol. 2005, Mar. 2005, p. pl3.

[4] J.R. Jessen and L. Solnica-Krezel, “Identification and developmental expression pattern of van gogh-like 1, a second zebrafish strabismus homologue,” Gene Expression Patterns: GEP, vol. 4, May. 2004, pp. 339-344.

[5] J.L. Green, S.G. Kuntz, and P.W. Sternberg, “Ror receptor tyrosine kinases: orphans no more,” Trends in Cell Biology, vol. 18, Nov. 2008, pp. 536-544.

[6] T.J. Van Raay, R.J. Coffey, and L. Solnica-Krezel, “Zebrafish Naked1 and Naked2 antagonize both canonical and non-canonical Wnt signaling,” Developmental Biology, vol. 309, Sep. 2007, pp. 151-168.

[7] D.C. Myers, D.S. Sepich, and L. Solnica-Krezel, “Bmp activity gradient regulates convergent extension during zebrafish gastrulation,” Developmental Biology, vol. 243, Mar. 2002, pp. 81-98.

[8] J. Wu and M. Mlodzik, “A quest for the mechanism regulating global planar cell polarity of tissues,” Trends in Cell Biology, vol. 19, Jul. 2009, pp. 295-305.

[9] A. Jenny, R.S. Darken, P.A. Wilson, and M. Mlodzik, “Prickle and Strabismus form a functional complex to generate a correct axis during planar cell polarity signaling,” The EMBO Journal, vol. 22, Sep. 2003, pp. 4409-4420.

[10] X. Wu, L. Yen, L. Irwin, C. Sweeney, and K.L. Carraway, “Stabilization of the E3 ubiquitin ligase Nrdp1 by the deubiquitinating enzyme USP8,” Molecular and Cellular Biology, vol. 24, Sep. 2004, pp. 7748-7757.

[11] M. Narimatsu, R. Bose, M. Pye, L. Zhang, B. Miller, P. Ching, R. Sakuma, V. Luga, L. Roncari, L. Attisano, and J.L. Wrana, “Regulation of planar cell polarity by Smurf ubiquitin ligases,” Cell, vol. 137, Apr. 2009, pp. 295-307.

[12] J.M. Gerdes, Y. Liu, N.A. Zaghloul, C.C. Leitch, S.S. Lawson, M. Kato, P.A. Beachy, P.L. Beales, G.N. DeMartino, S. Fisher, J.L. Badano, and N. Katsanis, “Disruption of the basal body compromises proteasomal function and perturbs intracellular Wnt response,” Nature Genetics, vol. 39, Nov. 2007, pp. 1350-1360.

81

CHAPTER 4: Future Directions

4.0: Preliminary results suggest Wnt4a provides positional information to neural

progenitor cells.

Non-canonical Wnt molecules have been shown in vertebrates to regulate planar

cell polarity (PCP). There is some evidence to suggest that Wnts act redundantly;

however, the specific role of each non-canonical Wnt has not been fully characterized.

There is no known mutant for wnt4a and knock-down by morpholino oligonucleotides

(MO) does not show a phenotype. However, Wnt4a has been implicated in PCP

signalling since further knock-down of wnt4a in wnt5b/11 double mutants generates a

more severe phenotype. In addition, Prickle (Pk) tagged with green fluorescent protein

(GFP), a marker of polarity is lost compared to the double mutant. To examine the

specific role of Wnt4a in regulating PCP, a local source of Wnt4a was generated in the

developing neural tube and the affect of Wnt4a on neighbouring neural progenitor cells

(NPCs) was examined. Although the initial objective was to determine differences in

PCP using GFP-Pk localization, technical difficulties with the heterochronic cell

transplantation procedure limited the depth of analysis. However, an interesting

observation did arise from a subset of the experiments. Generation of a local Wnt4a

source appeared to alter the behaviour of NPCs along the anterior-posterior axis. Based

on in situ hybridization data, wnt4a is normally expressed in a decreasing gradient along

the anterior-posterior axis, and I propose that this gradient provides positional

information to NPCs during neurulation. When this gradient is disrupted, differences in

NPC cell behaviour will be observed. When NPCs are exposed to a ‘reversed’ gradient,

an increasing anterior-posterior gradient, NPCs appear to not cross the midline. It is

82

unclear what the mechanism is as it could possibly result from changes in the direction of

intercalation or direction of cell division; however, this phenotype has been observed by

two different methods. To begin to understand how alterations in Wnt4a affect NPC

behaviour, real-time in vivo imaging needs to be performed to address how NPC

division/movement is affected when exposed to different Wnt4a gradients. Although

loss-of-function of wnt4a does not result in a morphological phenotype, there may be a

cell movement phenotype. My preliminary results suggest that loss of Wnt4a may alter

the direction of protrusions, where loss of wnt4a results in daughter NPCs to be deposited

randomly but equally on both sides, which would not result in a phenotype. Potentially,

by observing NPC movement in a wnt4a morphant, a cellular phenotype may be

observed.

First to address the assumption that Wnt4a is not being secreted in all directions

from the Wnt clone, a local source of Wnt needs to be generated expressing GFP tagged

Wnt and the secretion pattern examined. To assay whether NPCs anterior/posterior to the

Wnt clone are able to sense the Wnt signal, GFP-Pk or GFP-Dsh localization can be used.

Enriched fluorescence at the membrane will indicate NPCs are able to respond to Wnt4a.

Second, to specifically characterize the affect of Wnt4a on NPCs, individual cell tracking

needs to be performed. After generation of a local Wnt4a source in an embryo with single

cells labelled (homochronic cell transplants/scatter labeling with a membrane marker),

individual cells can be observed for ability to divide, the direction of cell division and

direction of intercalation after cell division. By capturing the behaviour of NPCs in real-

time, the affect of Wnt4a on NPC behaviour can be determined.

83

4.1: Addressing the instructive/permissive role of non-canonical Wnt

The instructive/permissive role of non-canonical Wnts in regulating PCP is still

an outstanding question that needs to be addressed. The heterochronic cell transplant

procedure requires more optimization to increase the overall success rate of the

technique. For example, to improve the GFP-Pk scatter labeling, transplantation of GFP-

Pk labeled cells into the presumptive neural tube may generate more even labeling along

the anterior-posterior axis. Possibly performing transplants into hosts at earlier/later

stages will improve the likelihood of finding the donor cells in the transplant location

during confocal examination. Despite its shortcomings, heterochronic cell transplantation

remains one method to generate a local Wnt source in the developing neural tube.

Another method to generate one Wnt clone with spatial temporal control is with the use

of transgenics. Transient Wnt transgenics were used in this study (Figure 12), where

embryos were heat shocked to generate Wnt clones. However the number of Wnt clones

was variable since the transgene was not stably expressed and global heat shock was

performed. To generate a single Wnt clone in the developing neural tube, stable

transgenic lines with ubiquitous transgene expression in the neural tube are required.

Spatial and temporal control can be achieved by heat shocking a local area at a chosen

time point, driving expression of the transgene consisting of a heat-shock promoter

inducing Wnt and GFP expression. A similar technique has previously been used to

activate transgene expression in the zebrafish eye and somites and preliminary work has

been successful at adapting this procedure for analysis in the neural tube [1]. To heat-

shock a small region in the neural tube, a modified soldering iron has been constructed

and attached to a power supply where the voltage can be adjusted. Changes in voltage

84

correspond to different solder iron tip temperatures, where 28 V results in solder iron tip

temperature of 60°C measured in air (Figure 23). To optimize the local heat-shock, a

strong GFP (FGFR-GFP) line was used, where embryos were heat-shocked and GFP

expression was scored 4-6 hours after induction. Heat-shock between 3-5 minutes was

able to induce varying degrees of GFP expression. Examination of GFP fluorescence

showed a range of expression where individual cells to small clusters were induced

(Figure 24). The local heat-shock method allows targeting at a specific time and place for

a Wnt clone to be produced. In comparison to the heterochronic cell transplantation

procedure, the local heat-shock method can generate more replicates with better accuracy

in a less time-consuming manner. The only drawback is the generation of stable

transgenic lines and screening for founders with ubquitious transgene expression. Once

the stable transgenic lines have been established, transgenic embryos can be scatter-

labelled with GFP-Pk. At early somite stages, these embryos can be locally heat-shocked

and screened 4-6 hours later for GFP expression under a dissecting scope. Embryos

positive for a Wnt clone can be analyzed by confocal microscopy for differences in GFP-

Pk localization with respect to the Wnt clone. Hopefully by using this approach, the

instructive/permissive role of non-canonical Wnts can be found.

4.2: The role of RNF41 in regulating planar cell polarity

Preliminary evidence suggests that RNF41 regulates PCP; however, the specific

mechanism is unclear. RNF41 is an E3 ubiquitin ligase that physically interacts with

Vangl2, which suggests that Vangl2 may be a substrate for RNF41. To determine if

RNF41 directly regulates Vangl2, co-expression studies with GFP tagged Vangl2 and

85

Figure 23: Temperature Voltage Standard Curve By adjusting the voltage supply to the modified soldering iron, the temperature of the tip proportionally changes

A Aʼ

Figure 23: Local heat shock with a modified soldering iron is able to induce transgene expression in cells in the neural tube (A) Transgenic embryo 4 hours post-heat-shock, dorsal view. (A’) Enlargement of heat-shock area showing individual cells expressing transgene

86

RNF41 can be performed. It would be expected if RNF41 regulates Vangl2, membrane

fluorescence of Vangl2-GFP would decrease with co-expression of RNF41 in a

concentration dependent manner. To further suggest that whether loss of Vangl-2 is a

result of ubiquitin-dependent degradation, embryos can be treated with proteasome

blockers, which should block the loss of Vangl2 membrane fluorescence. To show that

Vangl-2 is ubiquitinated, immunoblots for ubiquitinated Vangl2 can be performed. To

test and screen for substrates of RNF41, a mass-spectrometry approach can be taken,

where cells over-expressing RNF41 and treated with proteasome blockers can be

analyzed for ubiquitinated peptides. As a positive control, the known targets (ErbB3,

Parkin, RNF41) should be detected. Potentially either Vangl2 or Pk will be detected,

indicating the substrate of RNF41. Finally, In zebrafish, knock-down of gene function is

easily accomplished by injection of MO. To further characterize the role of RNF41 in

regulating PCP, loss-of-function studies can be performed.

4.3: The cue that establishes planar cell polarity remains elusive

The global cue that establishes PCP remains elusive; however, non-canonical Wnt

remain a likely candidate. To investigate the role of non-canonical Wnts in regulating

PCP, the various techniques to generate a local Wnt source in the neural tube can be

further developed and eventually applied. If non-canonical Wnts do not play instructive

roles in regulating PCP, there are many other possible leads generated by the membrane-

yeast-two-hybrid screen, which identified 95 protein-protein interactions with Vangl1/2.

The MYTH screen will not directly determine the global PCP cue; however, other

membrane proteins that may act as co-receptors may be found or other signalling

87

pathways that interact with Vangl1/2 can be tested where the upstream components of the

interacting protein might included a ligand that may regulate PCP as well.

From the screen, there are some interesting hits that should be validated by

immunoprecipitation and further characterized. Receptor-tyrosine kinase-like orphan

receptor 1 (ROR1) is a functional homologue to ROR2, which has been shown in

mammalian cell culture to bind Wnt5a. ROR1/2 contain an intracellular tyrosine kinase

domain, which may possibly phosphorylate Vangl2 or other PCP components. Another

possibility is that Bone morphogenetic protein (BMP) may act as a global cue since

BMP receptor type II was found to interact with Vangl2. BMP has been previously

implicated in regulating CE during zebrafish gastrulation [41]. During gastrulation, BMP

is expressed along the dorsal-ventral axis in a gradient with highest Bmp expression on

the ventral side. Examining cell movements in regions of different Bmp concentration,

different cell movement behaviours were observed [41]. Bmp appears to negatively

regulate non-canonical wnt signalling (wnt 5b/11), which controls CE during gastrulation

[41]. Potentially, the Bmp gradient found across the dorsal-ventral axis may indirectly

regulate PCP signalling by regulating non-canonical Wnt signalling which in turn

maintains PCP. Recent evidence indicates that Bmp signalling also directly regulates

PCP signalling [42]. Smurf1/2, an E3 ubiquitin ligase and regulator of Bmp signalling

has been shown to regulate Pk stability in complex with Dsh and Par6 [42]. Asymmetric

localization of PCP components appears to be generated by targeted degradation. In lieu

of the RNF41 data, other proteins from the MYTH screen suggest that Vangl1/2 is

potentially ubiquitinated. Membrane proteins that are ubiquitinated are normally

endocytosed and delievered to the lysosome for degradation. Proteins such as Sorting

88

Nexin 9, Low-density-lipoprotein Receptor Related Protein 3 and lysosomal-associated

protein transmembrane 4α were all found to interact with Vangl1 suggesting

ubiquitination as a means to generate asymmetric localization of Vangl1/2. In summary,

there are many possible candidates that could act to establish PCP. Hopefully, with the

preliminary findings described herein, a contribution has been made to aid in the search.

4.4: References

[1] M.E. Hardy, L.V. Ross, and C. Chien, “Focal gene misexpression in zebrafish embryos induced by local heat shock using a modified soldering iron,” Developmental Dynamics: An Official Publication of the American Association of Anatomists, vol. 236, Nov. 2007, pp. 3071-3076.

[2] J.R. Jessen, J. Topczewski, S. Bingham, D.S. Sepich, F. Marlow, A. Chandrasekhar, and L. Solnica-Krezel, “Zebrafish trilobite identifies new roles for Strabismus in gastrulation and neuronal movements,” Nature Cell Biology, vol. 4, Aug. 2002, pp. 610-615.

[3] B. Ciruna, A. Jenny, D. Lee, M. Mlodzik, and A.F. Schier, “Planar cell polarity signalling couples cell division and morphogenesis during neurulation,” Nature, vol. 439, Jan. 2006, pp. 220-224.