REGULATION OF THE MECHANISM OF INTERFERENCE WITH …repositorio.ul.pt/bitstream/10451/6464/1/ulfc092821_tm_paulo... · REGULATION OF THE MECHANISM OF INTERFERENCE WITH QUORUM SENSING

UNIVERSIDADE DE LISBOA

FACULDADE DE CIÊNCIAS

DEPARTAMENTO DE BIOLOGIA VEGETAL

REGULATION OF THE MECHANISM OF

INTERFERENCE WITH QUORUM

SENSING IN ESCHERICHIA COLI

Paulo José Braz Correia

MESTRADO EM MICROBIOLOGIA APLICADA

2011

UNIVERSIDADE DE LISBOA

FACULDADE DE CIÊNCIAS

DEPARTAMENTO DE BIOLOGIA VEGETAL




Dissertação orientada por:

Doutora Karina Xavier (IGC) e Professor Doutor Mário Santos (FCUL)


MESTRADO EM MICROBIOLOGIA APLICADA

2011





MASTER THESIS

2011

This thesis was fully performed at the Bacterial Signaling Laboratory in

the Instituto Gulbenkian de Ciência under the direct supervision of

Dr. Karina Xavier.

Professor Mário Santos was the internal designated supervisor in the

scope of the Master in Applied Microbiology of the Faculty of Sciences of

the University of Lisbon.

iv

i

Acknowledgements

First and foremost I offer my sincerest gratitude to my supervisor, Dr. Karina Xavier, who

has supported me throughout my thesis with her knowledge and expertise. I could attribute

an important part of my Masters degree to her encouragement and guidance. One simply

could not wish for a better or friendlier supervisor.

I would also like to thank to Professor Mário Santos, my internal supervisor, for the

support and advice.

I would like to thank all the members of the group, the bacterial signaling group that

received me well in the group and helped me a lot during this journey. To Catarina, for all the

support, for the important advice and for helping me in conquering the PTS; To Rita, for

helping me in laboratory and for the profitable discussions about our work; to João, for his

knowledge and for his devotion to science and to Jess and Pol, for what they taught me, for

all their experience in science and for the endless laughs.

I would also like to thank my family:

A toda a minha família, em especial aos meus avós, pelo pensamento sempre presente e

por terem contribuído para o que sou e o que alcancei nesta vida.

Aos meus irmãos: ao Ricardo “Mourinho” pela boa disposição, confiança e pelos

jantarinhos que fez para mim durante o processo de concepção desta dissertação. Ao Pedro

“Armstrong”, pela experiência em mestrados, pelos treinos que me orientou e pelo discurso

motivacional importantíssimo nestas alturas.

Aos meus pais que fizeram deste “menino” aquilo que ele é. Ao meu pai, pela motivação

e apoio que me transmite e por me permitir pensar em momentos de desmotivação: “Mas

quem sou eu? Sou filho do Zé Correia, vou acabar esta tese de certeza!”; à minha mãe pelo

seu discurso tranquilizador, pelas energias positivas que me passa, pelo carinho, pelo apoio

e por tudo. Este “bambino” tem muito orgulho de ser vosso filho.

Ao meu amor, Joana Sousa, pela compreensão, pela motivação, pelo apoio, pelo amor,

pelo suporte emocional que me deu durante esta etapa da minha vida e por ser tão especial.

ii

Abstract

Quorum sensing is a cell-to-cell signaling mechanism in which bacteria collectively control

gene expression and therefore synchronize behaviors only productive at a high population

density. The autoinducer-2 (AI-2) signal is produced by many bacteria and enables inter-

species communication. In Escherichia coli, AI-2 is synthesized and secreted, accumulating

in the extracellular medium. AI-2 concentration rises as bacteria divide and decreases rapidly

in early stationary phase partially due to the expression of an ATP-binding cassette

transporter, named Lsr (for LuxS-regulated) and encoded by the lsrACDB operon, which

imports AI-2, removing it from the environment.

Recent work showed that the phosphoenolpyruvate-dependent phosphotransferase

system (PTS) plays an important role in the regulatory network of the Lsr transporter.

Specifically, mutants in the ptsI gene, encoding for Enzyme I (EI) of the PTS, do not

internalize extracellular AI-2 and do not activate the lsr operon. The present work showed

that phosphorylation of EI is important for enabling the recovery of the defect of the ptsI

mutation in AI-2 internalization but most likely not to phosphorylate AI-2 since LsrK kinase is

required for AI-2 processing.

In this study a genetic screen was performed to determine the molecular mechanism of

the regulation of AI-2 internalization via EI by identifying suppressors of the ptsI mutant that

can incorporate AI-2. A library of single-gene deletions of all non-essential genes in

Escherichia coli in a ptsI deletion background strain carrying a lsr-lacZ promoter fusion was

generated and screened for mutants with lsr-lacZ expression higher than the parent strain.

Suppressors of the ptsI mutant were identified and the most interesting mutants are currently

being analyzed to understand their role.

The Lsr regulation was also studied using a new tool: green fluorescent protein (gfp)

reporter fusions. These were compared with the commonly used promoter-lacZ fusions and

their benefits and drawbacks were accessed.

Understanding how the Lsr transport is dependent on the PTS, can reveal the molecular

mechanism through which information about the physiological state of bacteria and

regulation of AI-2 signal uptake is integrated.

Keywords: Quorum-sensing, AI-2, Lsr transporter, PTS

iii

Resumo

A detecção de quórum é um mecanismo de sinalização entre células, no qual as

bactérias colectivamente controlam a expressão de genes e desta forma sincronizam

comportamentos que apenas são eficientes a uma elevada densidade populacional. Este

processo é caracterizado pela produção, pela secreção e pela detecção de pequenas

moléculas de sinalização denominadas autoindutores. A concentração extracelular destes

indutores encontra-se directamente relacionada com o número de indivíduos na população.

Um desses indutores denomina-se autoindutor-2 (AI-2) que é um sinal produzido por

muitas bactérias e constitui a primeira molécula a ser identificada que promove a

comunicação célula-a-célula entre diferentes espécies bacterianas. Possibilita a

comunicação inter-espécies, regulando vários fenótipos como a bioluminescência e a

formação de biofilmes.

Nas bactérias Salmonella Typhimurium e Escherichia coli, o AI-2 é sintetizado e

secretado, acumulando-se no meio extracelular e a sua concentração aumenta à medida

que as bactérias se vão dividindo. A actividade extracelular do AI-2 é máxima durante a fase

exponencial tardia do crescimento bacteriano e decresce rapidamente durante a entrada na

fase estacionária. Esta rápida internalização do AI-2 deve-se à expressão de um

transportador do tipo ABC (do inglês “ATP-binding cassette”), denominado sistema de

transporte Lsr (de LuxS-regulated) e que é responsável pela incorporação daquele sinal,

possibilitando a sua fosforilação e processamento no interior da célula bacteriana. Este

transportador é codificado pelo operão lsrACDB.

Este sistema, o transportador Lsr, apresenta dois importantes reguladores: o LsrR, que é

o repressor transcricional do operão lsr e a LsrK, que é a cinase que fosforila o AI-2 que é

incorporado, a AI-2-fosfato (AI-2-P). Esta molécula activada liga-se ao regulador LsrR e a

repressão por si mediada é removida, permitindo a transcrição do operão lsr e a formação

do sistema de transporte Lsr. Estes reguladores são codificados pelos genes lsrR e lsrK,

respectivamente, localizados imediatamente a montante do operão lsr e divergentemente

transcritos na direcção oposta.

O modelo actual para a incorporação do AI-2 assume a premissa que a produção do

transportador Lsr se encontra reprimida pelo LsrR para evitar a expressão prematura do

mecanismo de incorporação do AI-2, permitindo a acumulação de AI-2 no meio extracelular.

Assim, se o LsrR se encontra a reprimir o operão lsr, não existe transcrição do transportador

Lsr e supostamente não há internalização de AI-2.

Contudo, na transição para a fase estacionária, a internalização do AI-2 inicia-se e para

começar este processo, a fosforilação do AI-2 intracelular é necessária para inactivar a

iv

repressão mediada pelo LsrR. Assim, isto só seria possível se existisse um outro

transportador de baixa afinidade que fosse capaz de incorporar o AI-2. O AI-2 seria

posteriormente fosforilado e iria desencadear o sistema, permitindo a indução da expressão

do transportador Lsr e que iria rapidamente incorporar o AI-2 presente no meio extracelular.

Estudos recentemente efectuados demonstraram que a enzima I (EI) do Sistema das

Fosfotransferases dependente do fosfoenolpiruvato (PTS) desempenha um papel importante

na rede regulatória do transportador Lsr. Concretamente, foi observado que mutantes no

gene ptsI, que codifica a EI, não internalizam o AI-2, nem activa a transcrição do operão lsr.

Este facto, envolvendo o PTS na incorporação do AI-2, enquadra-se perfeitamente na

observação de que mutantes no transportador Lsr apresentam uma incorporação lenta do

AI-2 e que esta não é abolida. Uma vez que o AI-2 não se difunde passivamente através da

membrana, um transportador desconhecido é capaz de importar este sinal. De acordo com

isto e com o que foi observado no mutante ptsI, é plausível que o PTS, um importante

sistema envolvido na incorporação de hidratos de carbono e na sua regulação, possa estar

envolvido na internalização do AI-2 ou na regulação deste processo. De facto, foi igualmente

demonstrado que a incapacidade do mutante ptsI para internalizar o AI-2 se deve,

efectivamente, à incapacidade do AI-2 para entrar na célula. Apesar disto, o mecanismo

dependente do PTS, que permite a incorporação de AI-2, é ainda desconhecido.

Neste trabalho a importância da actividade fosfotransferase da EI para a incorporação do

AI-2 e para a activação do operão lsr foi determinada. O mutante ptsI foi complementado

usando um plasmídio induzido por IPTG e que continha um gene mutante do ptsI que

codifica uma EI que não pode ser fosforilada (EIH189A), uma vez que se encontrava mutada

no local de fosforilação e, apesar disso, a internalização de AI-2 não se verificou. Por outro

lado, quando um alelo selvagem do gene ptsI é fornecido, a capacidade para incorporar AI-2

e a activação do operão lsr são repostas. Os resultados indicam que uma EI funcional, com

um local de fosforilação preservado, é necessário para a incorporação de AI-2 e para a

transcrição do operão lsr.

Assim, a internalização do AI-2 podia ser efectuada por uma das 20 permeases PTS,

específicas para cada hidrato de carbono ou por uma permease que não pertence à família

PTS mas que é regulada por componentes do PTS, onde a EI e a sua actividade de

fosfotransferase desempenharia um papel crucial neste processo.

Neste estudo foi efectuado um rastreio genético para determinar o mecanismo molecular

envolvido na regulação da internalização de AI-2 via EI, através da identificação de

supressores da mutação ptsI, capazes de incorporar AI-2. Para isto, foi gerada uma

biblioteca de delecções únicas de todos os genes não essenciais de Escherichia coli, num

mutante no gene ptsI, que possuía uma fusão lsr-lacZ e procuraram-se mutantes duplos

com uma expressão da fusão lsr-lacZ maior do que a estirpe parental. Este rastreio genético

v

provou ser bem sucedido na identificação de supressores do mutante ptsI e neste momento

os mutantes mais interessantes estão as ser estudados para compreender o seu papel na

interacção entre o Sistema das Fosfotransferases e o sistema Lsr.

Os genes que foram definidos como candidatos positivos no rastreio genético podem ser

classificados em várias classes: genes codificando componentes do PTS ou reguladores do

PTS; genes que codificam transportadores não PTS, como simportes, antiportes e

transportadores ABC; genes codificando reguladores de transcrição que se ligam ao DNA;

metiltransferases; genes com função desconhecida e genes com outras funções.

Para além do rastreio genético, neste trabalho de investigação, outro instrumento foi

implementado para o estudo da regulação do operão lsr, em vez das fusões com o gene

lacZ, normalmente usadas, e dos ensaios de actividade da enzima β-galactosidase.

Diferentes fusões repórter com o gene da proteína verde fluorescente foram construídas

para avaliar a expressão do operão em diferentes estirpes e para as comparar com as

fusões anteriores. O objectivo principal foi a implementação de novos métodos de estudo do

operão lsr e a sua regulação em Escherichia coli.

Em conjunto, os resultados obtidos neste trabalho de investigação mostram que o gene

lsrK é transcrito juntamente com o gene lsrR pelo promotor lsrR e encontra-se sujeito à sua

regulação. Como este promotor é mais forte do que o promotor do operão lsr, é menos

reprimido pelo LsrR e transcrito a baixos níveis, mesmo na ausência do AI-2. Esta

transcrição basal do promotor lsrR e desta forma dos genes lsrR e lsrK, antes da expressão

do sistema de transporte Lsr, possibilita a presença do repressor da transcrição para evitar a

indução prematura do sistema; e permite que a cinase LsrK fosforile o AI-2 que é primeiro

internalizado pelo transporte dependente do sistema PTS, produzindo AI-2-P que se liga ao

repressor LsrR, removendo a repressão por si mediada e promovendo a indução da

expressão do transportador Lsr que rapidamente incorporará o AI-2 do meio extracellular.

A compreensão do mecanismo de como o sistema de transporte Lsr se encontra

dependente do PTS, pode revelar o mecanismo molecular através do qual a informação

referente ao estado fisiológico das bactérias e a regulação da incorporação do AI-2 podem

ser integradas.

Palavras-chave: Quórum, AI-2, Transportador Lsr, PTS

Contents

Acknowledgements .............................................................................................................................i

Abstract .............................................................................................................................................. ii

Resumo ............................................................................................................................................. iii

1. Introduction ....................................................................................................................................1

1.1. Quorum sensing: bacterial communication...............................................................................1

1.2. Autoinducer-2 signal molecule: inter-species quorum sensing ..................................................3

1.3. AI-2-mediated regulation in Escherichia coli and Salmonella enterica Typhimurium..................6

1.4. The Phosphoenolpyruvate-dependent Phosphotransferase System (PTS) .................................9

2. Materials and Methods ................................................................................................................. 12

2.1. Bacterial strains and growth conditions .................................................................................. 12

2.2. β-galactosidase assays ............................................................................................................ 12

2.3. AI-2 activity assay ................................................................................................................... 12

2.4. Plasmid construction .............................................................................................................. 13

2.5. DNA manipulations ................................................................................................................ 13

2.6. Green fluorescent protein expression assay ........................................................................... 13

2.7. Construction of the strains carrying the lsrR-lacZ promoter fusion .......................................... 14

2.8. Screen for regulators of EI of the PTS and suppressors of the ptsI mutation ............................ 14

2.8.1. Preparation of P1 bacteriophage lysates in 96-well plates................................................ 15

2.8.2. P1 transduction in 96-well plates ..................................................................................... 15

2.8.3. Screening using MacConkey Lactose Agar plates .............................................................. 15

3. Results .......................................................................................................................................... 18

3.1. The role of EI of PTS in AI-2 internalization ............................................................................. 18

3.1.1. A functional EI is required for AI-2 incorporation and lsr operon expression .................... 18

3.1.2. Mlc, an important regulator of PTS, does not play a role in Lsr regulation ........................ 21

3.1.3. Screen for genes that suppress inhibition of AI-2 internalization in a ptsI mutant ............ 22

3.2. Studying regulation of the lsr operon using transcriptional fusions ......................................... 29

3.2.1. Studying regulation of lsrACDBFG operon using a gfp reporter fusion .............................. 29

3.2.2 Studying regulation of the lsrRK operon using gfp reporter fusions ................................... 31

3.2.3. Comparing the regulation of the lsrR and lsr promoters ................................................... 34

3.2.4. Regulation of the lsrK gene expression ............................................................................ 35

4. Discussion ..................................................................................................................................... 37

5. References .................................................................................................................................... 46

1

1. Introduction

1.1. Quorum sensing: bacterial communication

The conventional view of bacterial existence always considered bacteria as independent

individuals, living their sole lives and capable of reacting to changes in the environment but

not communicating directly with other microorganisms in the vicinity. This view persisted for

long but currently it is well established that bacteria have elaborated chemical signaling

systems that enable them to communicate within and between species through a mechanism

designated quorum sensing [1-3].

Quorum sensing is a cell-to-cell signaling mechanism in which bacteria collectively control

gene expression and therefore synchronize behaviors that are only productive at a high

population density. This process is characterized by the production, secretion and detection

of small signaling molecules named autoinducers. The extracellular concentration of the

autoinducers correlates directly with the number of individuals in the population. Thus, when

the autoinducer reaches a certain concentration in the extracelular medium, corresponding to

a quorum of bacteria, a signal cascade is triggered resulting in a coordinated modification of

the gene expression of the population allowing the bacteria to carry out behaviors collectively

or as a group. Some of these bacterial processes are formation of biofilms, secretion of

virulence factors, production of toxins, bioluminescence, competence for DNA uptake and

sporulation [1, 4, 5].

Most quorum sensing communication systems can be organized into two major classes

that differ according to the type of signaling molecules: the LuxI/LuxR-type systems using the

acyl-homoserine lactones (AHL) in the Gram-negative bacteria and the two-component

signaling circuits based on modified oligopeptides that are characteristic of the Gram-positive

bacteria. Both quorum sensing systems can be characterized by their high specificity and

function for intraspecies communication [1, 6]

The AHL autoinducer signals typically are species specific signals that enable intraspecies

cell-to-cell communication [7, 8]. These molecules are synthesized by the LuxI-type enzymes

which promote the ligation of an acyl moiety from a fatty acyl carrier protein, to the lactonized

methionine moiety of S-adenosylmethionine (SAM) [9, 10]. The AHL can present different

forms, but they are characterized by their common core, the homoserine lactone ring, which

carries distinct acyl side chains of C4 to C18 in length conferring specificity to the AHL

autoinducer [11]. The majority of the AHL crosses the cellular membranes freely by diffusion,

due to their size and polarity, but few AHL need to be actively transported [7]. As cells

proliferate AHL concentration increase and when it reaches a threshold concentration it is

detected in the cytoplasm by a LuxR-type protein, the response regulator, to which it binds.

These LuxR-AHL complexes recognize and bind specific consensus sequences of DNA

2

promoter elements and activate the transcription of quorum sensing controlled genes (Figure

1A) [1, 11]. This communication system, comprising the AHLs and the LuxI/LuxR signaling

mechanism, was initially discovered in the marine bacterium Vibrio fischeri where it controls

the expression of the luciferase operon and, therefore the production of bioluminescence [12-

14]. This LuxI/LuxR signaling mechanism is considered the paradigm for the control of gene

expression by quorum sensing in the Gram-negative bacteria and regulates virulence in

human pathogens such as Pseudomonas aeruginosa [15] and Vibrio cholerae [16].

In the Gram-positive bacteria, as stated above, the distinctive autoinducers are modified

oligopeptides that control the expression of the quorum sensing genes [17-19]. These

autoinducing peptides (AIPs), encoded in the bacterial genome, consist of 5-17 amino acids

and are highly species or even strain specific [20].

The AIPs are initially synthesized as large precursor peptides that undergo post-

translational modifications such as cyclization and processing, including the incorporation of

lactone and thiolactone rings, lanthionines and isoprenyl groups [21-25]. After these

modifications or in a concomitant manner, the AIPs are actively secreted out of the cell by

specialized transporters since the bacterial membranes are impermeable to them, not

allowing their simple diffusion. Once outside the cell, the concentration of the AIPs increases

as the cell density increases and the AIPs are recognized by external domains of membrane-

bound sensor histidine kinase which is part of a two-component system (Figure 1B).

Figure 1 – The two major species specific quorum sensing systems. A) Canonical Gram-negative

LuxI/LuxR quorum sensing system. Red pentagons represent the acyl-homoserine lactones. LuxI is

the autoinducer synthase and LuxR is the response regulator that binds AHL and activates the

transcription of quorum sensing genes B) Model for Gram-positive oligopeptides/two-component

system quorum sensing mechanism. Blue octagons are the autoinducing peptides after processing or

modification. The histidine kinase (H) undergoes autophosphorylation when the autoinducing peptide

binds. The phosphate is then transferred to a response regulator (D) that changes its DNA binding

activity and regulates the expression of quorum sensing target genes (figure from reference [1]).

A B

3

The sensor histidine kinase undergoes autophosphorylation when the AIP binds and

interacts with the response regulator, phosphorylating it. The activated response regulator,

the second protein of the two-component system, regulates the expression of quorum

sensing target genes [1, 6, 26]. This peptide signaling system plays a role in important

bacterial processes by regulating the development of bacterial competence in Bacillus

subtilis and Streptococcus pneumoniae, conjugation in Enterococcus faecalis and virulence

in Staphylococcus aureus [27, 28].

Although these mechanisms of bacterial communication used by Gram-negative and

Gram-positive bacteria are distinct considering the nature of the signaling molecules and the

proteins involved; they have similarities since both allow microorganisms to perceive and

monitor the environment, to coordinate their communities and behaviors as multicellular

organisms, to face the environmental challenges and to better adapt and grow in a certain

habitat. Furthermore, both foster the intra-species quorum sensing communication due to the

extreme specificity of the signaling molecules [1, 6, 29, 30].

However, beyond these autoinducers, that promote communication within each species;

there is one, which is so far the only signaling molecule identified that is shared by both

Gram-negative and Gram-positive and produced by a wide range of bacteria: autoinducer-2

(AI-2) [31, 32].

1.2. Autoinducer-2 signal molecule: inter-species quorum sensing

Autoinducer-2 (AI-2) is a low-weight signal molecule that is synthesized and recognized

by a wide variety of bacteria and constitutes the first identified molecule promoting cell-to-cell

communication between different bacterial species [6, 33-35]. AI-2 was first identified in the

marine bacterium Vibrio harveyi as part of a complex quorum sensing system responsible for

the regulation of bioluminescence [36]. To date, AI-2 or its synthase LuxS have already been

shown to regulate other important bacterial behaviors such as the formation of biofilms [37,

38] and the production of virulence factors [39, 40]. Moreover, the gene encoding the

synthase, luxS, has been identified in approximately half of the bacterial sequenced

genomes, supporting the idea that many bacteria produce and use AI-2 to communicate with

other bacterial species [31, 34].

The biosynthetic pathway of AI-2 is conserved amongst the bacteria that produce this

molecule and occurs through three enzymatic steps (Figure 2). AI-2 is synthesized by the

LuxS enzyme from S-adenosylmethionine (SAM). SAM is an important methyl donor used by

methyltransferases in vital cellular processes such as nucleic acid and protein methylation, in

a metabolic pathway know as the activated methyl cycle [41, 42]. During the transmethylation

reactions, SAM donates a methyl group being converted into the toxic metabolic intermediate

4

S-adenosylhomocysteine (SAH) and this nocuous intermediate must be eliminated by the

bacterial cell. SAH is hydrolyzed to S-ribosylhomocysteine (SRH) and adenine by the

nucleosidade enzyme Pfs. SRH is then cleaved to 4,5-dihydroxy-2,3-pentanedione (DPD)

and homocysteine by the LuxS enzyme [35, 41, 43]. In bacteria that do not possess LuxS or

in eukaryotes and archaea, SAH still needs to be detoxified. In these cases, it is hydrolysed

to adenosine and homocysteine in a reaction performed by SAH hydrolase, and DPD is not

produced [4, 41]. In both cases, the reactions yield homocysteine that then enters the

activated methyl cycle, restoring SAM.

Figure 2 – Three-step production of DPD from SAM. SAM donates a methyl group in

transmethylation reactions performed by methyltransferases, leading to the formation of the toxic

intermediate SAH. SAH is then converted to SRH and adenine by the Pfs enzyme and SRH is finally

converted to DPD and homocysteine by the LuxS enzyme (figure from reference [44]).

DPD is a very unstable and reactive molecule that cyclizes and, in solution, undergoes a

variety of spontaneous rearrangements giving rise to a group of chemical distinct molecular

forms or derivatives that exist in equilibrium [35, 43]. The set of different molecules resulting

from the precursor DPD are generically designated AI-2 [34, 41]. This distinctly rearranged

DPD forms are recognized by different microorganisms [35, 44].

So far, two different AI-2 conformations derived from DPD were identified (Figure 3) by

trapping the active molecules in their respective receptors. Vibrio harveyi recognizes an AI-2

conformation that requires an atom of boron to be bound to the rearranged DPD derivative to

be active. This form of AI-2 is a furanosyl borate diester which is called (2S,4S)-2-methyl-

2,3,3,4-tetrahydroxytetrahydrofuran-borate (S-THMF-borate) and it is recognized by the LuxP

receptor. In Salmonella Typhimurium a different AI-2 conformation, that does not require

boron, is recognized. It is designated (2R,4S)-2-methyl-2,3,3,4-tetrahydroxytetrahydrofuran

(R-THMF), presents a distinct stereochemistry and binds to the LsrB periplasmic receptor

[35, 44]. Recently, it was found that this last AI-2 form is also recognized by Sinorhizobium

meliloti via its LsrB periplasmic receptor [45].

5

Although the AI-2 forms, which are recognized by each of those receptors, present a

distinct conformation, they can interconvert spontaneously, in solution, enabling different

bacterial species to respond to their own and also to AI-2 produced by others [35, 44, 46].

Nevertheless, this interconversion and the availability of each form are highly dependent on

the environment and on the presence of borate, in case of the AI-2 recognized by Vibrio

harveyi [44].

Figure 3 – AI-2 is a family of interconverting molecules derived from DPD. In solution, DPD

undergoes spontaneous rearrangements and assumes the conformation of two different epimeric

furanoses: R-DHMF and S-DHMF [(2R,4S)- and (2S,4S)-2,4-dihydroxy-2-methyldihydrofuran-3-one,

respectively]. Hydration of R-DHMF and S-DHMF gives rise to R-THMF and S-THMF, respectively. In

the presence of borate, S-THMF yields S-THMF-borate which is the ligand of LuxP receptor from

Vibrio harveyi. R-THMF, that does not bind boron is recognized by LsrB from Salmonella Typhimurium

(figure from reference [47]).

Despite the diversity of behaviors regulated by AI-2 [38], the mechanisms and the

molecular details of AI-2 detection and signal transduction have only been determined in few

bacteria such as Vibrio harveyi [48] and Vibrio cholerae and in the bacteria Salmonella

Typhimurium, Escherichia coli [47, 49, 50] and Sinorhizobium meliloti [45].

In Salmonella Typhimurium, Escherichia coli and Sinorhizobium meliloti, AI-2 plays a

regulatory role by inducing the lsr operon (from luxS-regulated) that consists of the genes

responsible for encoding the components of the apparatus used for the import and

processing of AI-2. This transport system is so effective that AI-2 is almost completely

depleted from the extracellular medium [51].

This striking behavior led to the current idea that it represents a mechanism of

interference with AI-2-regulated quorum sensing, corroborating the function of AI-2 as an

universal language enabling inter-species bacterial communication [6, 35, 44, 46].

6

1.3. AI-2-mediated regulation in Escherichia coli and Salmonella enterica Typhimurium

In the enteric bacteria, Salmonella Typhimurium and Escherichia coli, as mentioned, AI-2

is synthesized and secreted, accumulating in the extracellular medium and its concentration

rises as bacteria divide. AI-2 extracellular activity peaks during the mid to late exponential

phase and rapidly decreases during entry into the stationary phase. This fast internalization

of AI-2 is due to the expression of an ATP-binding cassette (ABC) transporter (designated

Lsr from luxS-regulated) that carries out the uptake of this signal allowing its further

phosphorylation and processing inside the bacterial cell [49-52].

The Lsr transport system is constituted by proteins encoded by the genes lsrACDBFG

which constitute the lsr operon. This operon is regulated by cyclic AMP (cAMP) and by cAMP

receptor protein (CRP) and also by two proteins transcribed from lsrK and lsrR genes,

located immediately upstream of the lsr operon and that are divergently transcribed in the

opposite direction [52-54]. This observation came from the fact that in lsrK mutants, the Lsr

transporter expression is repressed and AI-2 remains in the extracellular milieu. On the other

hand, in lsrR mutants the Lsr transporter is constitutively expressed and the extracellular AI-2

is continuously imported into the cell [52]. LsrR is a transcriptional regulator which, in the

absence of AI-2, represses the lsr operon and AI-2 internalization. When extracellular

concentration of AI-2 increases, it is phosphorylated to AI-2-phosphate (AI-2-P) by the

cytoplasmic kinase, LsrK. This activated molecule binds LsrR, enabling the expression of the

lsr operon [50].

Specifically, the mechanism of AI-2 internalization (Figure 4) starts when AI-2 is first

recognized by the periplasmic protein, LsrB, and then imported through the two

transmembrane domains, LsrC and LsrD, into the bacterial cell. This transport is driven by

the energy provided by ATP hydrolysis catalyzed by the ATPase, LsrA. Upon internalization,

AI-2 is phosphorylated to AI-2-P by LsrK and sequestered in the cytoplasm where it binds the

transcriptional repressor, LsrR, inhibiting it and avoiding its binding to the lsrACDBFG

promoter, relieving the LsrR-mediated repression. As a consequence, the expression of the

genes encoding the Lsr transporter is induced and upregulated. The Lsr apparatus is

assembled and rapidly incorporates AI-2 from the extracellular milieu, causing a positive

feedback loop, responsible for AI-2 depletion from the medium before reaching the stationary

phase of growth [49-51].

In the cytoplasm, AI-2-P is further processed by the enzymes LsrG isomerase and LsrF,

encoded by the other genes of the lsr operon, lsrG and lsrF, respectively [47, 55, 56].

LsrG is responsible for carrying out the isomerization of AI-2-P to 3,4,4-trihydroxy-2-

pentanone-5-phosphate (P-TPO), which has an unknown function [56]. The role played by

LsrF in AI-2-P processing remains unclear, as well as its substrates and products but its

7

sequence resembles an aldolase enzyme [55]. Through the action of these enzymes on AI-2-

P processing occurs transcription termination of lsrACDB operon and the AI-2 signaling cycle

terminates [47].

Figure 4 – AI-2 incorporation and processing by the lsrACDBFG operon in enteric bacteria. AI-2

is synthesized by the LuxS enzyme and accumulates in the extracellular medium. When AI-2 reaches

a certain concentration, it binds to LsrB and is incorporated by the Lsr transport apparatus, transcribed

by the lsr promoter. Once inside the cell, AI-2 is phosphorylated by the kinase LsrK yielding AI-2-P.

This activated molecule binds to LsrR, the transcriptional regulator, transcribed by the lsrR promoter.

The repression mediated by LsrR is relieved and the expression of the Lsr transporter by the lsr

promoter is upregulated, resulting in a rapid uptake of extracellular AI-2. AI-2-P is further processed by

LsrG and LsrF giving rise to the product 3,4,4-trihydroxy-2-pentanone-5-phosphate (P-TPO). In this

mechanism, the promoter responsible for transcription of the lsrK gene is not determined yet (dashed

arrow) (modified from reference [28]).

The biologic function of this AI-2 incorporation system remains unrevealed. However, it

has been shown that the Lsr transport system of Escherichia coli interfere with AI-2

controlled behaviors of other bacterial species present in the same environment [46].

Interfering with quorum sensing pathways of bacteria that produce and detect AI-2 to

regulate the expression of important genes could confer an important advantage. As a matter

of fact, this was already observed when Vibrio harveyi and Escherichia coli were co-cultured

together [46]. It was shown that Escherichia coli uses its Lsr transporter to internalize

endogenously produced AI-2 as well as AI-2 produced by Vibrio harveyi, and the levels of

this molecule rapidly drop. As a consequence, the induction of AI-2-regulated genes and

behaviors in Vibrio harveyi, like bioluminescence, is prevented [46].

Evidences of this role of the Lsr transport system were also observed in Sinorhizobium

meliloti, a bacterial species that does not produce AI-2, since it does not have the luxS gene,

8

but, surprisingly, it eliminates the signal from the environment, using its own Lsr apparatus to

incorporate AI-2 [45]. In short, the Lsr transport system can be a mechanism of interfering

with AI-2-based quorum sensing processes of other species.

This model of AI-2 incorporation and processing, describes in an elegant manner the

mechanism of regulation mediated by AI-2 in enteric bacteria. However, there are some

questions that still remain to be addressed. According to this model of AI-2 internalization,

the transcription repressor LsrR must be repressing the lsr operon to avoid premature

induction of the expression of the transporter; otherwise the signal would not accumulate in

the environment. As a result, if LsrR is repressing the operon, there is no transcription of the

Lsr transporter and supposedly no AI-2 incorporation. Nevertheless, to start this process, it is

required that AI-2 is internalized and phosphorylated to derepress LsrR. This is possible if

another transporter of lower affinity is capable of importing AI-2, if so then uptake by this

other transporter would trigger the whole system. This is supported by the observation that

mutants defective for the Lsr transport system still incorporate AI-2, but at a lower rate [28].

In addition, in order to phosphorylate the AI-2 that is first internalized by the secondary

transporter, there must be a basal level of LsrK to produce AI-2-P that induces the system.

Previous work revealed that in a lsrK null background, the internalization of AI-2 is abolished

and there is no activation of the Lsr system. This means that no matter which transporter is

internalizing AI-2, LsrK is required to phosphorylate AI-2 and to sequester the signal inside

the cell. AI-P-2 produced induces the transcription of the Lsr apparatus, by relieving LsrR-

mediated repression [28].

Therefore, lsrK transcription and LsrK protein levels or activity must be somehow

controlled by a different regulatory mechanism than that of the Lsr transport component. One

possibility is that lsrK has its own, but weak, promoter, not dependent on LsrR neither on AI-

2-P, to ensure that the kinase is always present at low-levels to trigger the system once AI-2

is imported.

In order to address the questions regarding this process, recent work from our laboratory

has shown that the phosphoenolpyruvate-dependent phosphotransferase system (PTS)

plays an important role in the regulatory network of the Lsr transporter. A genetic screen

performed in Escherichia coli, revealed that mutants in the ptsI gene, encoding for enzyme I

(EI) of the PTS, do not internalize the extracellular AI-2 as well as do not activate the lsr

operon [28]. Thus, a new model for AI-2 incorporation and Lsr transporter activation was

proposed. Accordingly, it is now hypothesized that uptake of extracellular AI-2 by a

permease regulated by PTS is necessary to start AI-2 internalization and, that together with

expression of LsrK at a basal level enable production of AI-2-P, which in turn promotes the

relief of lsr operon repression and the expression of the Lsr transport system. [28]. In other

words, EI and the PTS, that are responsible for the uptake of a wide range of carbohydrates

9

to the cell, are certainly involved in the first AI-2 import, through an unknown low-affinity

permease. This permease is regulated by the PTS. However, most likely it is not a permease

from the PTS family, because single mutants on PTS permeases do not show impairment on

AI-2 incorporation comparable to EI mutants.

1.4. The Phosphoenolpyruvate-dependent Phosphotransferase System (PTS)

The phosphoenolpyruvate-dependent phosphotransferase system (PTS) is a mechanism

for the translocation through the bacterial cell membrane of numerous carbohydrates, like

monosaccharides, disaccharides, amino sugars, polyols and other sugar derivatives. This

transport is performed with concomitant phosphorylation and uses phosphoenolpyruvate

(PEP) as an energy source and phosphoryl donor [57, 58].

The PTS consists of two general cytoplasmic components, the Enzyme I (EI, encoded by

the ptsI gene) and the Histidine-containing protein (HPr, encoded by the ptsH gene), which

are common to all PTS carbohydrates. The specificity of each PTS is conferred by a wide

variety of distinct sugar-specific permeases, the Enzymes II (EII), which are composed of

one to four hydrophobic domains (domains A-D). Thus, these enzymes are responsible for

the transport of carbohydrate across the bacterial membrane and for its phosphorylation [57].

The most important representative and better studied is the glucose-specific PTS that

mediates the uptake and phosphorylation of this important sugar (Figure 5). The mechanism

begins with the transfer of a phosphoryl from PEP to EI, the PEP-dependent protein-kinase,

starting the phosphorylation cascade. This phosphate is subsequently transferred from EI-

phosphate to HPr, which becomes phosphorylated. HPr-phosphate, passes the phosphoryl

group to the soluble EIIAGlc (encoded by the crr gene, part of the ptsHIcrr operon) and, in the

final step, EIIAGlc-phosphate transfers the phosphoryl group to the glucose-specific

membrane permease, EIICBGlc, encoded by the ptsG gene, which incorporates and

phosphorylates glucose. These phosphotransfer reactions between PEP and EIIB domain of

any sugar-specific EII are reversible. On the contrary, the final transfer of the high-energy

phosphate group to the substrate is virtually irreversible [57, 59].

The PTS was initially associated with sugar transport and phosphorylation, controlling

preferential use of carbon sources and the uptake systems of these energetically preferred

sugars in bacteria, as explained above [57]. However, the PTS has been more recently

recognized as a global regulator of the bacterial behaviors and metabolic processes.

Previous works revealed that many metabolic and regulatory functions are assigned to the

components of the PTS. For instance, the regulation of flagellar motility or the movement

towards the carbon sources – chemotatic response to PTS sugars – by unphosphorylated EI;

the control of the net production of carbon and energy storage sources (glycogen [60] and

10

poly-β-hydroxybutyrate [61]); the transition between different metabolisms (fermentative and

respiratory); the growth in a biofilm by EI [62]; the transport of non-carbon-compounds [63,

64] and also the regulation of the transport of non-PTS sugars [65] as well as the utilization

of alternative carbon sources through the mechanisms of inducer exclusion and catabolite

repression by EIIAGlc [57, 66].

Figure 5 – The glucose phosphoenolpyruvate-dependent phosphotransferase system. The

Phosphoenolpyruvate (PEP) starts the phosphorylation cascade by transferring its phosphoryl group

to EI, which becomes phosphorylated (EI~P). EI~P passes its phosphate to HPr. HPr~P transfers the

phosphoryl group to EIIAGlc

, which becomes phosphorylated (EIIAGlc

~P). EIIAGlc

~P phosphorylates

EIIBGlc

. EIIBGlc

~P passes the phosphate to the incoming glucose, as the sugar passes through the

pore created by the EIIC domain (adapted from reference [67]).

Additionally, the EIIAGlc was identified as the central processing unit of carbon metabolism

in enteric bacteria, carrying out numerous regulatory functions. Specifically,

unphosphorylated EIIAGlc represses adenylate cyclase and interacts with several non-PTS

sugar permeases (lactose, maltose, melibiose), blocking the respective sugar incorporation

and also binds to glycerol kinase to inhibit its activity (reviewed in [57]).

Given that PTS presents these regulatory roles and are capable of phosphorylating and

interacting with numerous non-PTS proteins and thereby controlling their activity, it is not

completely surprising that this system might play a crucial role in AI-2 incorporation and in

Lsr transporter expression, as previously observed for mutants in the ptsI gene, that do not

internalize AI-2 and do not activate the expression of the lsr operon [28]. The fact that AI-2

internalization is dependent on the AI-2-induced Lsr transporter, as well as on the Enzyme I

11

of the PTS, suggests that the bacterial integrates the information about its physiological state

and according to that, regulates AI-2 signal incorporation.

Despite these new findings, regarding the involvement of PTS in AI-2 mediated regulation

through the Lsr transport system, the molecular mechanism enabling the PTS-regulated

transporter and thus the mechanisms linking the two systems are not understood.

In this work several questions related to PTS role in Lsr regulation were studied,

specifically, the importance of the characteristic phosphotransferase activity of EI of the PTS,

in the process of AI-2 incorporation and lsr operon activation was addressed. Another subject

that was under the scope of this study was the role played by an important regulator of the

PTS, the Mlc protein, in this mechanism of AI-2 internalization and in the expression of the

Lsr transport system.

Most importantly, to determine the molecular mechanism involved in the regulation of AI-2

incorporation by EI, a genetic screen was also performed. The most important objective of

this screen was the identification of suppressors of the ptsI mutation capable of internalizing

AI-2. This screen has proven to be useful in identifying suppressors of the ptsI mutant

phenotype because regulators of the system, previously identified, were scored as positive

hits. The other hits still need to be analyzed to confirm their phenotypes and to select the

most interesting mutants, for studying their role in the interaction between the PTS and the

Lsr system.

Furthermore, in this study, a new tool to investigate the Lsr regulation was implemented:

transcriptional fusions, of the lsr and lsrR promoters with the gene encoding for the green

fluorescent protein (gfp), were constructed and their expression determined in several

genetic backgrounds. These promoter-gfp fusions were compared with the commonly used

promoter-lacZ fusions and their benefits and drawbacks were accessed.

In summary, the main objective of this research work was to gain a deeper knowledge of

the AI-2/Lsr system, seeking to understand how the Lsr transporter is dependent on the PTS

and reveal the molecular mechanism through which information about the physiological state

of bacteria and regulation of AI-2 signal uptake is integrated.

12

2. Materials and Methods

2.1. Bacterial strains and growth conditions

The strains that were used in this research work are listed in Table 1. Wild-type (WT)

Escherichia coli K-12 strain MG1655 [68] was used as the parental strain for all the

subsequent genetic manipulations. The strains were grown with aeration at 37ºC, in Luria-

Bertani (LB) broth supplemented with 100 mM MOPS buffer pH7 (LB MOPS), except where

otherwise mentioned. When necessary, 1 μM of Isopropyl beta-D-1-thiogalactopyranoside

(IPTG) or different concentrations of synthetically produced AI-2 [69] were supplied to the

media at the time of inoculation. Where indicated below, medium was supplemented with

antibiotics at the following final concentrations: Chloramphenicol, 25 mg.L-1 and Kanamycin,

50 mg.L-1.

2.2. β-galactosidase assays

Overnight cultures of Escherichia coli strains diluted 1:100 into fresh LB MOPS medium

and grown with aeration at 37ºC to the OD600 indicated. Cells from 1 ml of culture were

harvested and resuspended in 1 ml of Z-Buffer 1X for determination of the β-galactosidase

activity as described previously [70]. β-galactosidase activity was calculated as follows

(OD420.min-1 x dilution factor)/OD600. All assays were performed in triplicate and were reported

as the mean β-galactosidase activity from triplicated data and error bars represent the

standard error.

2.3. AI-2 activity assay

To measure AI-2 extracellular activity in Escherichia coli cultures, overnight cultures were

diluted (1:100) into fresh LB MOPS medium in Erlenmeyer flasks and grown with aeration at

37ºC for the indicated time. Aliquots were collected at the times indicated and used to

analyze the optical density at 600 nm (OD600) and to prepare cell-free culture fluids. The AI-2

detection and quantification in the cell-free culture fluids was measured using a LuxP-

fluorescence resonance energy transfer (FRET) assay as previously described [71]. Cell-free

culture fluids were prepared by filtration of liquid cultures through 96-well filtration plates. For

the determination of AI-2 concentration, 2.5 μl of the cell-free fluid was added to 280 μl of

purified CLPY FRET protein to a final concentration of 0.0125 mg/ml diluted in phosphate

buffer. Results were compared to a calibration curve obtained from CLPY response to known

concentrations of synthetic AI-2 prepared dilutions. Each sample was assessed in triplicates.

13

2.4. Plasmid construction

The plasmids pPBC01, pPBC03 and pPBC06 were used to study the expression of

different promoters (lsrACDBFG promoter, lsrR promoter and the putative lsrK promoter)

using a reporter green fluorescent protein (GFP). For cloning purposes, the DNA fragment

containing the lsrACDBFG promoter, the DNA fragment containing the lsrR promoter and the

DNA fragment containing the putative lsrK promoter were amplified by polymerase chain

reaction (PCR) from the chromosome of Escherichia coli MG1655, respectively, using two

pairs of primers (lsr1-GFP; lsr2-GFP; lsrR1-GFP; lsrR2-GFP; lsrK1-GFP; lsrK2-GFP) and the

Bio-X-Act DNA polymerase (Bioline), to ensure great accuracy, during the amplification. The

products of PCR were then digested with SalI and SphI, and subsequently were ligated with

SalI and SphI-digested pCMW1 where the gfp transcriptional fusions were constructed. Each

transcriptional fusion was cloned into the plasmid pCMW1, upstream of the promoterless gfp

gene. The constructed plasmids were transformed into Escherichia coli MG1655. All plasmid

constructs were confirmed by DNA sequencing carried out by the IGC sequence facility. The

plasmids and the sequences of all primers used in this study are listed in Table 2 and Table 3,

respectively.

2.5. DNA manipulations

All DNA manipulation was performed using standard procedures. T4 DNA ligase and

restriction enzymes were obtained from New England Biolabs (NEB). The transformation of

Escherichia coli with the plasmids used in this study was performed in 0.2-cm electroporation

cuvettes, using a Bio-Rad Micro Pulser. The plasmids pQELL-EI and the plasmid pQELL-

EIH189A were introduced into the strain CSP108 and the pQE32-lacIq plasmid was introduced

into the strains CSP108 and AS8. Each of the plasmids pPBC01, pPBC03 and pPBC06 was

introduced into the following strains by electroporation: MG1655, KX1448, KX1228 and

AS13. The vector used for construction of all the promoter-gfp fusions was the plasmid

pCMW1. In the absence of insert DNA, the pCMW1 plasmid shows no detectable gfp

expression. All strains and plasmids used in this study are listed in Table 1 and Table 2,

respectively.

2.6. Green fluorescent protein expression assay

Cultures of the strains were grown overnight in Brain Heart Infusion (BHI) medium, diluted

1:100 into fresh BHI medium supplemented with chloramphenicol (25 mg.L-1) and grown at

37º C with aeration. At different time points after inoculation, culture samples of 500 μl were

collected for the determination of the OD600 and green fluorescent protein (GFP) expression.

14

The cells were harvested and resuspended in 500 μl of Phosphate Buffered Saline (PBS)

buffer 1X, to mitigate the fluorescence from the growth medium. GFP production of each

sample was measured in a black clear bottom plate using the Victor3 multilabel counter

(Wallac). Each sample was assessed in triplicates and the strain containing the promoterless

GFP plasmid pCMW1 was also measured to exclude the background fluorescence.

Fluorescence units produced by a strain were defined as [GFP fluorescence (strain)/OD

(strain)] – [GFP fluorescence (pCMW1)/OD (pCMW1)].

2.7. Construction of the strains carrying the lsrR-lacZ promoter fusion

To construct the strains carrying the lsrR-lacZ promoter fusion, we used the P1 vir lysate

from the strain KX1267 to transduce the lsrR-lacZ fusion, linked to a kanamycin resistance

cassette, into four strains with distinct genetic backgrounds MG1655 (WT), KX1448 (ΔlsrK),

KX1228 (ΔluxS) and AS13 (ΔlsrR) and selected for growth on LB agar supplemented with

kanamycin, 50 mg. L-1. Next, a ΔcyaA::Cm deletion was transduced to each the previous

strains. For that, we used a P1 vir lysate from AS2 (ΔcyaA::Cm) and the new transductants

were selected in LB agar supplement with kanamycin, 50 mg.L-1 and chloramphenicol, 25

mg.L-1. For the constructed strains to became insensitive to catabolite repression we

transduced a P1 bacteriophage lysate from the strain RD14 which contains a cyaA deletion

linked to kanamycin and the crp* encoding a derivative of catabolite activator protein (CAP)

that acts as a transcriptional activator in the absence of cyclic AMP (cAMP). Because a

ΔcyaA::Cm mutant cannot grow using glycerol, the crp* gain of function mutation was

selected by growth on M63 agar medium containing supplemented with glycerol.

2.8. Screen for regulators of EI of the PTS and suppressors of the ptsI mutation

To identify suppressors of the ptsI mutant strain, capable of internalizing AI-2 and

activating lsr operon expression, as well as regulators of EI of the PTS, a genetic screen was

performed. All the single-gene deletions of all nonessential genes in Escherichia coli present

in the Keio collection library (3985) were transduced to the strain CSP108 (lsr-lacZ, ΔcyaA,

crp*, ΔptsI) carrying a ptsI deletion and a lsr-lacZ reporter fusion. To identify target genes, we

screened the new transductants strains that showed lsr-lacZ expression higher than the

parent strain.

15

2.8.1. Preparation of P1 bacteriophage lysates in 96-well plates

Overnight cultures of the all the strains of the Keio collection were grown in 96-well plates

in LB at 30ºC with aeration. These overnight cultures were diluted into LB supplemented with

0,2% glucose and 5 mM CaCl2 and the 96-well plate was incubated at 37ºC during 1 hour

shaking. To each well, P1 bacteriophage lysate of the wild-type strain, MG1655, was added

and the plate was incubated for 4 hours, at 37ºC with shaking, until the cells lyse. The plate

was centrifuged and the supernatant was transferred to a new 96-well plate. In the final step,

chloroform was added to each well, to eliminate the remaining cells and for storage of the

lysates. The whole procedure was performed for all the 3985 single deletions of the Keio

collection library [72].

2.8.2. P1 transduction in 96-well plates

As mentioned above, all the single deletions of the Keio collection were transduce into the

ptsI deletion strain, CSP108 (lsr-lacZ, ΔcyaA, crp*, ΔptsI). First, overnight cultures of the

recipient strain were grown at 30ºC in LB supplemented with 10 mM MgSO4 and 5 mM

CaCl2. The 96-well plates were filled with overnight culture, the respective P1 bacteriophage

lysates were added to each well and the plates were incubated for 45 min at 37ºC without

shaking. LB supplemented with 50 mM Na Citrate was added to each well and the plates

were incubated for 2h30min, at 37ºC without shaking. Next, LB supplemented with

kanamycin, 100 mg.L-1, was supplied to each well and the plates were incubated overnight at

37ºC, with aeration. Next day, using a replica plater, a stamp of each 96-well plate,

containing the transductants, was done to LB agar plates supplemented with kanamycin 30

mg. liter-1 plus 30 mM Na Citrate.

2.8.3. Screening using MacConkey Lactose Agar plates

The obtained transductant strains were plated in MacConkey lactose agar plates, using a

replica plater. The plates were incubated at 37ºC and the phenotype of each transduction

was assessed. The results of the genetic screen were further processed and analysed.

16

Table 1 – Escherichia coli strains used in this study.

Strain Relevant genotype Source

AS4 lsr-lacZ, ΔcyaA, crp*, ΔluxS Lab collection

AS8 lsr-lacZ, ΔcyaA, crp* Lab collection

AS2 ΔcyaA::Cm Lab collection

AS13 ΔlsrR Lab collection

AS82 lsr-lacZ, ΔcyaA, crp*, ΔlsrK Lab collection

CSP108 lsr-lacZ, ΔcyaA, crp*, ΔptsI Lab collection

CSP370 lsr-lacZ, ΔcyaA, crp*, Δmlc::Kan Lab collection

KX1228 ΔluxS Lab collection

KX1267 lsrR-lacZ Lab collection

KX1448 ΔlsrK Lab collection

MG1655 Wild-type strain Lab collection

PBC02 MG1655 carrying the plasmid pPBC01 This study



PBC07 Strain CSP108 carrying the plasmid pQE32-lacIq This study

PBC09 Strain CSP108 carrying the plasmid pQELL-EI This study

PBC19 Strain AS8 carrying the plasmid pQE32-lacIq This study

PBC21 Strain KX1448 carrying the plasmid pPBC01 This study






PBC35 Strain CSP108 carrying the plasmid pQELL-EIH189A

This study

PBC41 Strain AS13 carrying the plasmid pPBC01 This study



PBC105 lsrR-lacZ, cyaA::Cm, crp* This study

PBC107 lsrR-lacZ, cyaA::Cm, crp*, ΔluxS This study

PBC109 lsrR-lacZ, cyaA::Cm, crp*, ΔlsrK This study

PBC125 lsrR-lacZ, cyaA::Cm, crp*, ΔlsrR This study

17

PBC148 lsr-lacZ, ΔcyaA, crp*, ΔptsI, Δmlc::Kan Lab collection

Table 2 – Plasmids used in this study.

Plasmid Relevant genotype or property Source

pPBC01 pCMW1 derivative, lsr promoter-GFP transcriptional fusion, CmR

and KanR

This study

pPBC03 pCMW1 derivative, lsrR promoter-GFP transcriptional fusion, CmR

and KanR

This study

pPBC06 pCMW1 derivative, lsrK promoter-GFP transcriptional fusion, CmR

and KanR

This study

pQE32-lacIq Vector [73]

pQELL-EI EI expression vector with IPTG inducible promoter [73]

pQELL-EIH189A

EIH189A

expression vector with IPTG inducible promoter [73]

Table 3 – Primers used in this study.

Primer name Oligonucleotide sequence (5’-3’)

lsr1-GFP ACGGCATGCGAGTTTCATATTCCAGACAGCCTTC

lsr2-GFP ACGGTCGACGAACTGGCGTTAATCTGACGTAG

lsrK1-GFP ACGGCATGCGAACTGGCGTTAATCTGACGTAG

lsrK2-GFP ACGGTCGACGAGTTTCATATTCCAGACAGCCTTC

lsrR1-GFP ACGGCATGCATGCTGGCGATTGGTTTTGGCGAG

lsrR2-GFP ACGGTCGACATGCCGCCACTCCGCCTGTCCCACT

18

3. Results

3.1. The role of EI of PTS in AI-2 internalization

The phosphoenolpyruvate-dependent phosphotransferase system (PTS) is a mechanism

responsible for the incorporation of a wide variety of carbohydrates through the bacterial cell

membrane. This process occurs with concomitant phosphorylation of the imported sugar and

uses phosphoenolpyruvate (PEP) as the donor of the phosphoryl group that will trigger the

phosphorylation cascade [57]. This is composed of several proteins that mediate the transfer

of the phosphate from PEP to the internalized sugar (Figure 5).

Although, the PTS is mainly associated with the incorporation and the phosphorylation of

different carbohydrate sources and with the control of the preferential use of these sugars

and their respective uptake systems [57]; several metabolic and regulatory functions were

attributed to the proteins that compose the PTS.

Previous results showed that the PTS plays an in important function in the AI-2 mediated

regulation in Escherichia coli. Specifically, it was shown that a deletion mutant in the gene

ptsI, that encodes for the EI of PTS, do not incorporate AI-2 neither activate the expression

of the lsr operon [28].

3.1.1. A functional EI is required for AI-2 incorporation and lsr operon expression

The capacity of the PTS to incorporate and concomitantly phosphorylate the internalized

sugars relies on the phosphotransferase activity of the several proteins that compose the

system. Specifically, the phosphotransferase activity of EI is crucial to remove the phosphoryl

group from PEP and to initiate the phosphorylation cascade that characterizes the PTS.

Furthermore, this phosphotransferase activity of EI is highly indispensable to accomplish the

several functions that are attributed to this enzyme but there are exceptions. Specifically,

phosphorylation of EI is not necessary for the activation of the regulator of the β-glucoside

utilization system in Escherichia coli [73].

As shown in previous studies [28], the PTS-dependent removal of AI-2 from the

extracellular medium still requires the LsrK kinase because in a lsrK mutant extracellular

levels of AI-2 are high and no internalization is observed. So, in this work it was determined

whether the characteristic phosphotransferase activity of the EI is crucial for AI-2

incorporation and for activation of the lsr operon expression.

To determine AI-2 internalization in different mutants, the extracellular AI-2 activity was

determined using the LuxP-fluorescence resonance energy transfer (FRET) assay [71] which

allows the quantification of AI-2 concentration in the culture fluids of the studied strains.

19

Furthermore, the respective expression of the lsr operon was determined by measuring the

transcription of a lsr-lacZ promoter fusion inserted at the lambda attachment site.

As already established and also shown in Figure 6A, the extracellular AI-2 activity in a

wild-type strain peaks as bacteria divide in exponential growth phase and rapidly declines

due to the expression of the Lsr transport system that incorporates AI-2. After 4 hours of

growth, corresponding to a certain AI-2 concentration in the medium and to a certain number

of bacterial cells; AI-2 is almost completely depleted from the extracellular medium. In

contrast, in the deletion mutant of the ptsI gene, encoding for EI of PTS, there is a normal

production of AI-2 and its concentration rises as bacteria grow but AI-2 is not incorporated

and the extracellular AI-2 activity continues to increase. Induction of the lsr operon reflects

the levels of AI-2 internalization observed for the transcription of the lsr-lacZ promoter fusion

(Figure 6B): the wild-type strain shows activation of lsr operon expression since AI-2 is being

internalized and thus induces transcription of the Lsr transporter, while the mutant in the ptsI

gene does not activate the expression of the lsr operon. These data show that EI is important

for Lsr regulation as stated in previous studies [28].

Figure 6 – EI from PTS and its phosphotransferase activity are required for AI-2 internalization

and lsr operon transcription. The extracelular AI-2 activity A) and transcription of the lsr operon at

OD600=4 B) were measured in the following strains: WT + vector [PBC19: lsr-lacZ, ΔcyaA, crp* +

pQE32-lacIq]; ptsI + vector [PBC07: lsr-lacZ, ΔcyaA, crp*, ΔptsI + pQE32-lacI

q]; ptsI + p(EI-WT)

[PBC09: lsr-lacZ, ΔcyaA, crp*, ΔptsI + pQELL-EI] and ptsI + p(EI-H189A) [PBC35: lsr-lacZ, ΔcyaA,

crp*, ΔptsI + pQELL-EIH189A

]. The lsr-lacZ transcription was measured at OD600=4 because it

corresponds to the maximum lsr activation in the wt strain. Error bars represent standard deviation of

triplicates.

A B

20

To address if the phosphotransferase activity of EI is required for AI-2 incorporation and

lsr operon expression, the mutant ptsI strain was tested for complementation with a wild-type

ptsI gene or with a ptsI mutant allele that encodes for an EI mutated in the phosphorylation

site (EI-H189A). Each gene was introduced into the ptsI mutant strain in a multicopy plasmid

and transcribed under control of an IPTG-inducible promoter. The extracellular AI-2 activity

and the expression of the lsr-lacZ promoter fusion were accessed for each strain.

As shown in Figure 6, when the wild-type allele of ptsI is provided to the ptsI mutant the

wild-type phenotype is recovered and the impairment in AI-2 internalization and lsr operon

transcription of the ptsI mutant is overcome (ptsI + p(EI-WT)). A slight delay in AI-2

incorporation is still observed but this is due to the intrinsic growth defect that the ptsI mutant

presents even when it is complemented with the wild-type ptsI allele (Figure 7).

On the other hand, when the ptsI mutant expresses the gene encoding EI, with the

mutated phosphorylation site, EI-H189A (the histidine residue has been replaced by an

alanine); no incorporation of AI-2 and no properly activation of the transcription of the lsr

operon were observed. Together, these data show that a functional EI, with preserved

phosphotransferase ability is required for AI-2 incorporation and to activate lsr operon

transcription.

Figure 7 – Growth curves of the different studied strain. OD600 was measured in the following

strains: WT + vector [PBC19: lsr-lacZ, ΔcyaA, crp* + pQE32-lacIq]; ptsI + vector [PBC07: lsr-lacZ,

ΔcyaA, crp*, ΔptsI + pQE32-lacIq]; ptsI + p(EI-WT) [PBC09: lsr-lacZ, ΔcyaA, crp*, ΔptsI + pQELL-EI]

and ptsI + p(EI-H189A) [PBC35: lsr-lacZ, ΔcyaA, crp*, ΔptsI + pQELL-EIH189A

].

21

3.1.2. Mlc, an important regulator of PTS, does not play a role in Lsr regulation

Mlc is a major regulator which plays an important function in PTS-dependent transport of

glucose. This regulator is responsible for repressing the expression of the ptsG gene that

encodes for the glucose-specific permease EIIBCGlc and also the gene ptsI and ptsH, that

encode for the general components of the PTS, designated EI and HPr, respectively.

In the absence of glucose, Mlc interacts with the unphosphorylated form of EIIBCGlc, which

sequesters that regulator preventing its mediated repression and as a consequence

transcription of the PTS components increases.

Mlc is also associated with the repression of the manXYZ genes that encode for the PTS

proteins for the transport of mannose and with the repression of the transcriptional activator

MalT for the mal regulon. By repressing MalT, Mlc indirectly represses the malEFG, malK,

lamB and malPQ operon, which encode genes responsible for the transport and catabolism

of maltose, a non-PTS sugar [57, 67, 74]. According to this, Mlc is responsible for repressing

the transcription of permeases that perform the transport of the PTS sugars, glucose and

mannose, as well as the expression of the transporter of non-PTS sugars, such as maltose.

Thus, here we tested if Mlc could play a direct function in AI-2 incorporation by regulating

one of the AI-2 permeases directly or indirectly via EI.

In order to address this hypothesis, the extracellular AI-2 activity and the expression of the

lsr-lacZ transcriptional fusion were determined in a mlc null background and also in a double

mutant in the genes ptsI and mlc (Figure 8).

Figure 8 – Mlc does not play a role in AI-2 incorporation and lsr operon transcription. The

extracelular AI-2 activity A) and transcription of the lsr operon at OD600=4 B) were measured in the

following strains: wt [AS8: lsr-lacZ, ΔcyaA, crp*]; lsrK [AS82: lsr-lacZ, ΔcyaA, crp*, ΔlsrK]; ptsI

[CSP108: lsr-lacZ, ΔcyaA, crp*, ΔptsI); mlc [CSP370: lsr-lacZ, ΔcyaA, crp*, Δmlc::Kan) and ptsI, mlc

[PBC148: lsr-lacZ, ΔcyaA, crp*, ΔptsI, Δmlc::Kan]. The lsr-lacZ transcription was measured at OD600=4

because it corresponds to the maximum lsr activation in the wt strain. Error bars represent standard

deviation of triplicates.

A B

22

The results show that the mlc single mutant presents an identical AI-2 incorporation when

compared to the wild-type strain and also a proper activation of the transcription of the lsr

operon. Similarly, when comparing the AI-2 internalization profiles of the ptsI single mutant

and the double mutant (ptsI, mlc), we found that a mlc mutation does not affect the

extracellular AI-2 activity of the ptsI mutant and, consequently, the absence of lsr operon

expression. These data suggest that Mlc, a major regulator of PTS, does not play a role in

Lsr regulation.

3.1.3. Screen for genes that suppress inhibition of AI-2 internalization in a ptsI mutant

In order to understand the mechanism involved in the regulation of the AI-2 internalization

through the EI of PTS, by the identification of new regulators of the Lsr transport system, a

genetic screen was performed (Figure 9). The main purpose of this genetic screen was to

find mutants that are able to reverse the characteristic phenotype observed in the ptsI single

mutant. As mentioned, mutants in the ptsI gene do not incorporate AI-2 neither are able to

activate the expression of the lsr operon.

To accomplish that, the Keio collection was used. This collection contains a library of

single-gene deletion mutants of all non-essential genes in Escherichia coli. The deletions

contain a kanamycin resistant gene and are stored in 96-well plates. The location of each

mutant is mapped. To perform the screen each KanR mutant was introduced into a ptsI

deletion background strain carrying a lsr-lacZ transcriptional fusion. Specifically, using a P1

bacteriophage, every mutation was transduced into the strain CSP108 (lsr-lacZ, ΔcyaA, crp*,

ΔptsI) and a library of 3895 double mutants was generated.

All the mutants of this library were tested for the expression of the lsr-lacZ transcriptional

fusion, using MacConkey lactose agar indicator plates, in order to identify mutants that

showed a higher lsr-lacZ transcription than the mutant in the ptsI strain. As already

mentioned, this strain does not incorporate AI-2 neither activates the expression of the lsr

operon. Thus, the ptsI mutant does not express the lsr-lacZ promoter fusion and then does

not produce the enzyme β-galactosidase. Consequently, lactose present in the MacConkey

plates is not metabolized by the ptsI single-mutant, yielding white colonies on the plates.

In contrast, suppressors of the ptsI phenotype should activate the transcription of the lsr-

lacZ promoter fusion, producing the β-galactosidase enzyme and metabolize lactose. This

degradation of lactose is detected on the MacConkey plates by the formation of colonies

presenting a red coloration. Mutants that showed these phenotypes were scored as positive

hits.

23

Figure 9 – Genetic Screen for genes that suppress inhibition of AI-2 internalization in a ptsI

mutant. Generation of bacteriophage P1 lysates of the Keio collection resistant to kanamycin (Kan) A)

P1 Transduction using the lysates previously generated in A) into the CSP108 (lsr-lacZ, ΔcyaA, crp*,

ΔptsI) acceptor strain, resulting in Kan resistant mutants that were replica plated to MacConkey plates

to determine their lsr-lacZ expression phenotypes B)

24

As a control for the recognition of the positive phenotype, a double mutant in the ptsI and

the lsrR genes was used. This lsrR mutation was previously identified as a suppressor of the

ptsI mutation and this double mutant presented activation of the lsr operon transcription as

well as proper incorporation of AI-2 [28]. So to test the protocol to construct the double

mutants and screening method, we started by transducing the bacteriophage containing the

lsrR mutant lysate. As expected the double mutant ptsI, lsrR was red in the MacConkey

medium confirming that screen was working as predicted.

As outcome of this screen, 300 genes were identified as positive hits. However, only 165

were selected as candidates and the other 135 were excluded. As mentioned, in this screen

every mutation was introduced in the ptsI mutant using the P1 bacteriophage. This virus

during the process of bacterial infection, transfers approximately 100 kilobases (kb) of DNA,

packaged inside its capsid, into the chromosome of the recipient bacteria [75]. Thus, during

transduction of each mutated gene linked to the kanamycin marker, the genes that are lying

in close proximity can be introduced into the recipient strain, when the incorporated DNA is

recombined with the bacterial genome. One of these undesired genes could be the wild-type

ptsI gene or the lacZ allele which are present in the strains in the Keio collection. The

replacement of the mutated ptsI by the wild-type gene as well as the introduction of the wild-

type lacZ allele would, respectively, reverse the ptsI phenotype or allow the production of the

β-galactosidase enzyme independently from the expression of the lacZ allele present in the

lsr-lacZ promoter fusion. These strains would be scored as positive hits since they would

form red colonies on MacConkey lactose agar plates.

Thus the location of all the mutants scored as red was determined and the genes which

fell within 100 kb of ptsI of lacZ were excluded from the candidate list. Out of 300, 135 were

excluded because they could have restored the wild-type ptsI gene or received other lacZ

allele upon the process of P1 bacteriophage transduction and then alter and influence the

expression of the lsr-lacZ fusion and the MacConkey agar phenotypes.

The 165 candidates which were left, were further analyzed and grouped into several

categories specifically: genes belonging to phosphotransferase system (PTS) or regulators of

the PTS; genes encoding non-PTS transport systems (antiporters, symporters, ABC

systems); DNA-binding transcriptional regulators; genes that encoded proteins with ATP-

binding activity as well as genes corresponding to methyltransferases; genes which their

function is not known yet and others (Table 4).

These 165 candidates, scored as hits, still need to be tested and confirmed to determine if

the ptsI mutant phenotype is, indeed, reversed, and if they are capable of internalizing AI-2

and, therefore, activating the transcription of the lsr operon, as expected by their lsr-lacZ

expression observed in the MacConkey lactose plates. The most interesting mutants will be

25

further studied to understand their role in the interaction between the PTS and the Lsr

system.

Category Function of the Gene

PTS transporters

agaB Enzyme IIC domain of a N-acetylgalactosamine-transporting PTS system

agaC Enzyme IIB domain of a N-acetylgalactosamine-transporting PTS system

bglF PTS Enzyme IIA, IIB and IIC domains of the cryptic aromatic β-glucoside PTS transporter

manZ PTS Enzyme IID from the system that takes up mannose, glucose, glucosamine, fructose

sgcA SgcA is homologous to the IIA domains of the fructose- and mannitol-specific PTS permeases

PTS-regulators

bglG Transcriptional antiterminator of the bgl operon

Non-PTS transport systems

artP Arginine transporter subunit; It has ATPase activity to allow the transport of L-arginine

btuC BtuC is the integral membrane component of BtuCD, an ABC type vitamin B12 uptake system

cadB CadB is a lysine:cadaverine antiporter and transports also cadaverine:H+ symporter

caiT Antiporter, exchanging L- or D- carnitine or carnitine utilization products

cycA D-alanine/D-serine/glycine transporter (proton symporter)

dcuB Transporter involved in uptake of C4-dicarboxylates such as fumarate /malate under anaerobic conditions

dgoT D-galactonate transporter (proton symporter)

fecA Ferric citrate outer membrane transporter

fecC Integral membrane protein subunit of the iron-dicitrate ABC transporter

fhuA FhuA is involved with the transport of ferrichrome across the outer membrane

fhuF Ferric iron reductase involved in ferric hydroximate transport

gntP GntP transport D-fructuronate/D-gluconate

kdpF K+ accessory transporter subunit, Component of: potassium ion P-type ATPase transporter

lamB Maltose outer membrane porin (maltoporin)

malE Periplasmic substrate-binding component of the maltose ABC transporter

malF MalF is an integral membrane component of the maltose ABC transporter

melB Melibiose-cation cotransport protein belonging to the Glycoside-Pentoside-Hexuronide:Cation Symporter

mgtA MgtA is a P-type ATPase involved in the uptake of magnesium ion

nikA NikA is the periplasmic binding component of the nickel ABC transporter

proP Osmoprotectant/proton symporter capable of transporting proline and glycine betaine

pstA ATP-dependent phosphate uptake system that is a member of ABC Superfamily of transporters

pstC ATP-dependent phosphate uptake system that is a member of ABC Superfamily of transporters

rbsC ATP-dependent ribose transporter (member of the ABC transporters (transmembrane constituent)

tbpA Thiamin ABC transporter subunit

tehA Potassium-tellurite ethidium & proflavin transporter

trkD Kup (TrkD) is involved in potassium ion uptake under hyper-osmotic stress at a low pH

yadH YadH is a membrane-spanning component of a predicted ABC superfamily efflux transporter

ydeE Uncharacterised member of the major facilitator superfamily (MFS) of transporters

ydjE Uncharacterised member of the major facilitator superfamily (MFS) of transporters

yliD Glutathione transporter is a member of the ABC superfamily of transporters (permease component)

yohM Membrane-bound efflux system for nickel and cobalt resistance

26

ytfF Inner membrane protein, DMT transporter family

zntA The product of the zntA gene is a P-type ATPase involved in the efflux of Pb(II), Cd(II), and Zn(II)

DNA-binding regulators

agaR DNA-binding transcriptional repressor of the aga gene cluster

ilvY DNA-binding transcriptional dual regulator

lsrR LsrR is the lsr operon transcriptional repressor

metR DNA-binding transcriptional activator: binds homocystein

mtlR The transcriptional activator MtlR controls the transcription of the operon involved in mannitol utilization

sdiA Quorum-sensing transcriptional activator

trpR DNA-binding transcriptional repressor, tryptophan-binding

ybiH Predicted DNA-binding transcriptional regulator

ycaN Predicted DNA-binding transcriptional regulator

Methyltransferase activity

dam DNA adenine methyltransferase (transfers a methyl group from S-adenosyl-L-methionine)

gidB Methyltransferase responsible for methylation of 16S rRNA at the N7 position of the G527 nucleotide

tehB S-adenosyl-L-methionine-dependent methyltransferase

yhiQ Predicted SAM-dependent methyltransferase

ATP-binding activity

atpH F1 sector of membrane-bound ATP synthase

clpB ATP-dependent protease, ATP-binding subunit; acts together with DnaK chaperone

fecE ATP binding component of the iron-dicitrate ABC transporter

lsrA LsrA is the ATP-binding component of the AI-2 ABC transporter

oppD ATP-binding component of the oligopeptide ABC transporter and the murein tripeptide ABC transporter

znuC Zinc transporter subunit: ATP-binding component of ABC superfamily

Unknown function

creD -

marC -

ybdH -

ybhL -

ybiW -

ycaJ -

ycbC -

ycbL -

ycbU -

ycdU -

ycfK -

yciI -

yciX -

ycgK -

ydhZ -

yeaL -

yedE -

yedY -

yegL -

yeiH -

27

ygdQ -

yggL -

yhiI -

yiaA -

yidD -

yidE -

yidQ -

yjdC -

yjeP -

yliF -

ymcB -

ymcE -

ymfO -

yoaE -

ypjD -

yqjD -

Others

aas Fused 2-acylglycerophospho-ethanolamine acyltransferase / acyl-ACP synthetase

agaS Tagatose-6-P ketose/aldolase isomerase involved in N-acetylgalactosamine and galactosamine use

alr Alanine racemase 1, PLP-binding, catalyzes the interconversion of D- and L-alanine

ampC Beta-lactamase/D-alanine carboxypeptidase

aspC Aspartate aminotransferase (synthesis of aspartate, phenylalanine, tyrosine and others)

atoA Acetyl-CoA:acetoacetyl-CoA transferase, beta subunit

avtA Valine-pyruvate aminotransferase 1 (converts α-keto-isovalerate to valine and alanine to pyruvate )

bglB Cryptic phospho-beta-glucosidase B

cls Cardiolipin synthase catalyzes the synthesis of cardiolipin one of the major membrane phospholipids

cpdB 2':3'-cyclic-nucleotide 2'-phosphodiesterase

cspG Cold shock protein

deoA Thymidine/uracil phosphorylase

dgt Deoxyguanosine triphosphate triphosphohydrolase thydrolyzes dGTP to deoxyguanosine

fdrA Acyl-CoA synthetase with NAD(P)-binding

fumA Fumarate hydratase (fumarase A), aerobic Class I

glf UDP-D-galactopyranose mutase

glpQ Glycerophosphodiester phosphodiesterase hydrolyzes phospholipids to alcohol + Glycerol-3-P

hflK Regulator of HflB protease

hokB Small toxic membrane polypeptide

hsdR HsdR is the restriction endonuclease R component of the EcoKI restriction-modification system

hypA Protein involved in nickel insertion into hydrogenases 3

iap Aminopeptidase in alkaline phosphatase isozyme conversion

ilvD Dihydroxy-acid dehydratase carries out the penultimate step in isoleucine & valine biosynthesis pathways

kbaY Tagatose 6-phosphate aldolase 1, kbaY subunit

kbaZ Tagatose 6-phosphate aldolase 1, kbaZ subunit

leuA 2-isopropylmalate synthase (LeuA) carries out the first step in leucine biosynthesis

lsrG LsrG is an enzyme involved in the degradation of the quorum-sensing regulator AI-2

lysU The lysine-tRNA synthetase LysU is a member of the family of aminoacyl tRNA synthetases

28

malS Degrades linear dextrins of at least three glucose residues

mltD Membrane-bound lytic murein transglycosylase

nadC Quinolinate phosphoribosyltransferase catalyzes the de novo biosynthesis of NAD from L-aspartate

nagB Glucosamine-6-phosphate deaminase

nagD Promiscuous ribo- and deoxyribonucleoside tri-, di-, and monophosphatase with a preference for purines

napH Ferredoxin for e- transfer (ubiquinol to periplasmic nitrate reductase)

narH Nitrate reductase 1 - beta subunit (electron transfer subunit containing the iron-sulfur clusters)

narV Nitrate reductase 2, γ subunit

norW Reductase enzyme which can convert oxidized flavorubredoxin to its reduced form

paaG Oxepin-CoA-forming ring 1,2-epoxyphenylacetyl-CoA isomerase involved in phenylacetate catabolism

pabB Aminodeoxychorismate synthase - catalyzes the formation of ADC by binding chorismate and ammonia

pflB Pyruvate formate lyase I inactive (binds SAM)

ppiC ppiC encodes a peptidyl-prolyl cis-trans isomerase, parvulin, which defines a new family of PPIases

prc ATP-independent periplasmic protease responsible for processing and degradation of a number of proteins

prfC Ribosome-dependent GTPase that stimulates the release of RF1 and RF2 from the ribosome

puuB γ-glutamylputrescine oxidase in a putrescine utilization pathway, FAD/NAD binding

rarD Chloramphenicol resistance permease

rbsK RbsK is a ribokinase that belongs to the ribokinase subfamily of sugar kinases

rluB RluB is the pseudouridine synthase that catalyzes formation of pseudouridine at position 2605 in 23S rRNA

rspA Bifunctional dehydratase that utilizes both D-mannonate and D-altronate as substrates

rsxA Electron transport complex protein required for SoxR reduction

sdhC SdhC is one of two membrane proteins in the four subunit succinate dehydrogenase enzyme

sdhD SdhD is one of two membrane proteins in the four subunit succinate dehydrogenase enzyme

sohA Antitoxin of the SohA-YhaV toxin-antitoxin system

ssnA Predicted chlorohydrolase/aminohydrolase

tdcE Pyruvate formate lyase inactive (uses S-adenosyl-L-methionine)

tnaA Tryptophanase/L-cysteine desulfhydrase, PLP-dependent

torY TMAO reductase III (TorYZ), cytochrome c-type subunit

ttdB L-tartrate dehydratase, beta subunit

wrbA NAD(P)H:quinone oxidoreductase

ybbN YbbN is a thioredoxin-like protein with chaperone and protein oxidoreductase activity

ycbB Murein L, D-transpeptidase

yeaB Nudix family of hydrolases and was predicted to have CoA pyrophosphohydrolase activity

yfaE Fe-2S cluster-containing protein involved in diferric-tyrosyl radical cofactor maintenance

yfbG Fused UDP-L-Ara4N formyltransferase/UDP-GlcA C-4'-decarboxylase

ygcL CRISP RNA (cascade antiviral complex protein)

ygeD Major facilitator superfamily (MFS) protein acts as a flippase for movement of lysophospholipids

yjhT N-acetylneuraminic acid mutarotase

yjiA P-loop guanosine triphosphatase

Table 4 – The selected candidates of the screen were grouped into different categories

displayed in this table.

29

3.2. Studying regulation of the lsr operon using transcriptional

fusions

As mentioned in the introduction and also as illustrated in the work with the ptsI mutants,

AI-2 internalization is regulated by other yet unidentified components. In this section, new

tools were constructed to enable studying lsr transcription (as a reporter for AI-2

internalization) that can be used for future genetic screens for lsr regulators and to study the

dynamics of lsr regulation and AI-2 internalization.

3.2.1. Studying regulation of lsrACDBFG operon using a gfp reporter fusion

To date, the main working tool to determine the transcription levels of the lsr operon is the

β-galactosidase enzyme assay, using lsr-lacZ promoter fusions to infer the expression of the

operon. Here, new fusions, using the green fluorescent protein (GFP) as a reporter, were

constructed to provide new tools to understand the regulation of this system. The use of GFP

fusions as opposed to lacZ has the advantage of enabling its measurement by fluorescence

of the cells without the need of making cell extracts and thus, enabling high-throughput

analysis.

In this research work, an lsr-gfp transcriptional fusion was constructed to determine its

expression in different strains carrying distinct genetic backgrounds. The lsr promoter region

was amplified by PCR from the wild-type Escherichia coli MG1655 with restriction sites of the

SalI and SphI endonucleases. The fragment was cloned into pCMW1, upstream of the

promoterless gfp gene, which resulted in plasmid pPBC01. The lsr-gfp promoter fusion in

pPBC01 was then inserted in a wild-type strain (MG1655), in lsrK, luxS and lsrR mutant

strains.

As shown in Figure 10, the luxS and the lsrK mutants present a similar fluorescence

expression profile, which remains at low-levels when compared with the wild-type strain. This

is in agreement with what is known from the β-galactosidase enzyme assays, in which both

the luxS and lsrK mutants do not activate the transcription of the lsr operon [28, 47].

Regarding the fluorescence expression in the lsrR null background, it is observed that the

transcription of the lsr-gfp promoter fusion is upregulated. Again, this agrees with the fact that

LsrR is the repressor of the system and when it is absent, the lsr operon is highly expressed

[49].

30

Figure 10 – Expression of a lsrACDBFG promoter-gfp fusion in Brain Heart Infusion broth.

Fluorescence was measured in the following strains: wt [PBC02: wild-type MG1655 strain + pPBC01];

lsrK [PBC21: ΔlsrK + pPBC01]; luxS [PBC27: ΔluxS + pPBC01] and lsrR [PBC41: ΔlsrR + pPBC01].

Cultures were diluted 1:100 into BHI with chloramphenicol 25 mg.L-1

at time 0, and aliquots were

removed for analysis at the specified times after inoculation.

However, when using the gfp reporter fusion low-levels of fluorescence were observed

due to the autofluorescence of growth medium. In this experiment, the strains were grown in

BHI medium, instead of the LB medium because when the experiment was performed using

LB, the cells had a very high background fluorescence, even after washing the cells with

buffer. So, BHI was used to avoid this problem. Still, the autofluorescence is included in the

expression levels of the lsr-gfp fusion but with a lower contribution than in LB. Even in BHI

autofluorescence is observed thus a negative control of cells with plasmid pCMW1 was

always used to subtract the autofluorescence.

The autofluorescence is an important drawback using GFP reporter fusions, because it

prevents the detection of low levels of induction. Accordingly, given that is difficult to

determine low expression levels; the difference between the luxS, which does not activate

the expression of the lsr operon, and the wild-type strain that properly expresses the operon

was much lower than with the lsr-lacZ fusion where induction is usually 5-fold higher.

Nonetheless, the transcription profiles of the lsr-gfp promoter fusion, measured in several

genetic backgrounds (Figure 10), behave in a similar manner when compared with the lsr-

lacZ fusion expression in the same mutant strains and thus, this fusion can be used for

genetic screens to identify novel regulators of lsr and AI-2 internalization.

31

3.2.2 Studying regulation of the lsrRK operon using gfp reporter fusions

In order to understand the regulation of the expression of the lsrRK operon, encoding the

kinase LsrK and the transcriptional repressor LsrR, which are important players of the Lsr

regulation; a lsrR-gfp promoter fusion was constructed. The lsrR promoter region was

amplified by PCR from the wild-type Escherichia coli MG1655 with restriction sites of the SalI

and SphI endonucleases. The fragment was cloned into pCMW1, upstream of the

promoterless gfp gene, which resulted in plasmid pPBC03. The plasmid carrying this reporter

fusion, pPBC03, was then inserted in the wild-type strain (MG1655), in lsrK, luxS and lsrR

mutant strains. The transcription of the lsrR-gfp promoter fusion was accessed by

determining the fluorescence levels of each studied strain.

As shown in Figure 11, the luxS mutant shows low fluorescence levels corresponding to a

low transcription of the lsrR promoter and in the lsrR mutant the lsrR-gfp fusion is highly

transcribed. These results reveal that the transcription of the lsrRK operon is regulated by the

LsrR repressor, as the lsrACDBFG operon, and in its absence, the LsrR-mediated repression

is relieved.

Figure 11 – Expression of a lsrR promoter-gfp fusion in different genetic backgrounds.

Fluorescence was measured in the following strains: wt [PBC03: wild-type strain + pPBC03]; lsrK

[PBC23: ΔlsrK + pPBC03]; luxS [PBC30: ΔluxS + pPBC03] and lsrR [PBC44: ΔlsrR + pPBC03].

Cultures were diluted 1:100 into BHI with chloramphenicol 25 mg.L-1

at time 0, and aliquots were

removed for analysis at the specified times after inoculation.

32

Surprisingly, the lsrK mutant and the wild-type strain showed similar gfp expression

profiles, presenting higher fluorescence levels than the luxS mutant but much lower than the

lsrR null strain. These result could suggest that the transcription of the lsrRK operon by the

lsrR promoter is not dependent on AI-2-P, as the lsr promoter is, because in the absence of

the kinase LsrK, which is responsible for phosphorylating AI-2; expression of the lsrR

promoter is still observed.

Given these results, the expression of the lsrRK operon by the lsrR promoter was further

studied using a lsrR-lacZ transcriptional fusion. The strains carrying this reporter fusion were

constructed by introducing the already available lsrR-lacZ fusion by P1 transduction into

different genetic backgrounds, namely into the wild-type strain, the lsrK, the luxS gene and

the lsrR mutants. The expression of the lsrR-lacZ fusion was determined by the β-

galactosidase enzyme assay.

As Figure 12 shows, the transcription of this fusion is also upregulated in a mutant in the

lsrR gene, when compared to the wild-type expression, supporting what was observed for

the lsrR-gfp reporter fusion. However, in the lsrK mutant, the expression profiles of both

fusions are not consistent: the transcription of the lsrR-gfp fusion in this mutant is similar to

the wild-type profile whereas the expression of the lsrR promoter using the lsrR-lacZ fusion is

very low and resembles the luxS mutant.

Figure 12 – Transcription of a lsrR-lacZ promoter fusion is distinct genetic backgrounds.

Expression of the lsrR promoter was measured in the following strains: wt [PBC105: lsrR-lacZ,

ΔcyaA::Cm, crp*]; lsrK [PBC109: lsrR-lacZ, ΔcyaA::Cm, crp*, ΔlsrK], luxS [PBC107: lsrR-lacZ,

ΔcyaA::Cm, crp*, ΔluxS]; and lsrR [PBC125: lsrR-lacZ, ΔcyaA::Cm, crp*, ΔlsrR]. The lsrR-lacZ

transcription was measured at different time of growth. Error bars represent standard deviation of

triplicates.

33

Comparing the expression of the lsrR promoter in those genetic backgrounds, using each

of the promoter fusions that were studied, both reveal that the lsrRK operon is regulated by

the LsrR transcriptional repressor because the expression of the fusions is upregulated in a

lsrR null background. The results also show that the transcription differences between the

strains are markedly higher in the lsrR-lacZ promoter fusion. However, the results concerning

to the expression of the lsrR promoter by both reporter fusions in a lsrK mutant are not

coherent.

This was clarified further by Northern blot analysis which supported the results obtained

using the lsrR-lacZ promoter fusion (Figure 13). Total RNA extracts of the strains that are

being studied (the wild-type strain, the lsrR, lsrK and luxS mutants) were obtained at different

hours of growth and then were tested using a hybridization probe complementary to the

messenger RNA of the lsrR gene.

The results showed that RNA levels of lsrR are higher in the wild-type when compared to

the mutants in the luxS or the lsrK genes, similarly to what was observed when using the

lsrR-lacZ reporter fusion. Moreover, the transcription of the lsrR gene in these two mutants is

quite similar and slightly higher than the negative control (in the lsrR null strain there is no

gene to produce its respective messenger RNA), suggesting that lsrR is transcribed at low

levels even in the absence of AI-2-P.

In conclusion, these results favor that the expression of the lsrR promoter is repressed by

the LsrR transcriptional repressor, as well as the lsrACDBFG promoter is, and regulated by

AI-2 via AI-2-P. Furthermore, given that the lsrR-gfp results were not consistent with the

results obtained by the other two approaches; we concluded that this fusion is not a good

tool to monitor this process.

Figure 13 – Northern Blot of total RNA extracts from a wild-type strain and different mutant

strains. A probe was used for identification of the mRNA of the lsrR gene (unpublished work

performed by Professor Sine Lo Svenningsen).

34

3.2.3. Comparing the regulation of the lsrR and lsr promoters

According to the current model of AI-2 incorporation and Lsr regulation (Figure 4), the

transcriptional repressor, the LsrR protein, must be repressing the lsrACDBFG operon to

avoid premature induction of its expression and prevent AI-2 internalization and signal

depletion from the medium too earlier, enabling extracellular AI-2 accumulation. Therefore,

there must be a basal-level expression of the lsrR promoter to maintain the repressor of the

lsr operon and the previous results support this premise.

To obtain further indication supporting this hypothesis, the expression of a lsrR-lacZ

promoter fusion was determined at different concentration of exogenously provided AI-2,

using the β-galactosidase enzyme assays and compared with the transcription of a lsr-lacZ,

in the same experimental settings. Both strains carrying each promoter fusion were also

mutants in the luxS gene, so that they do not synthesize their own AI-2.

As shown in Figure 14, when comparing the expression of both transcriptional fusions, we

observe that the lsrR-lacZ promoter fusion presents a higher sensitivity to the same

concentration of exogenously provided AI-2, than the lsr-lacZ reporter fusion. Moreover, even

in the absence of AI-2 in the medium, here represented by a highly diluted AI-2 (100-fold less

than the maximum accumulated by the wild-type cells); the transcription of the lsrR promoter

was observed and it was always higher than the expression of the lsr operon promoter.

Figure 14 – Expression of the lsrR-lacZ and lsr-lacZ transcriptional fusions at different DPD

concentrations. Expression of each promoter fusion was measured in its respective strain: lsrR-lacZ

[PBC107: lsr-lacZ, ΔcyaA::Cm, crp*, ΔluxS] and lsr-lacZ [AS4: lsr-lacZ, ΔcyaA, crp*, ΔluxS]

(unpublished work performed by Dr. João C. Marques).

35

The same result was not observed with the gfp reporter fusions; this could be explained

by the fact that the gfp promoter fusions are not that sensitive and also because the intrinsic

autofluorescence could reduce the probable minimal differences on fluorescence expression,

masking the slightly higher transcription of the lsrR promoter in a luxS mutant.

Overall, these data indicate that the lsrACDBFG operon repression by LsrR is stronger

than the repression of the lsrRK operon, in other words, the strength of the lsrR promoter is

higher than the lsrACDBFG promoter. This suggests that the lsrR promoter is transcribed at

a basal level, even in the absence of AI-2 or AI-2-P and this is in agreement with the model

of AI-2-mediated regulation in which a basal level of the LsrR regulator is necessary to

repress the transcription of the Lsr transporter before AI-2 reaches a certain concentration in

the extracellular medium and to avoid earlier induction of the Lsr system.

3.2.4. Regulation of the lsrK gene expression

As previously mentioned, in the current model of the regulation of AI-2 internalization it is

proposed that AI-2 is first internalized by a PTS-dependent permease. During this first stage

the Lsr transporter is repressed but because AI-2 phosphorylation is only accomplished by

LsrK there should be basal transcription levels of LsrK for sequestration to occur. Thus,

expression of LsrK must be regulated in a different manner than the genes lsrACDB.

One hypothesis is that lsrK is transcribed by its own weak promoter between lsrR and

lsrK, not dependent on LsrR neither on AI-2-P, to ensure that the kinase is always present at

low-levels to initialize the system of AI-2 import. The other possibility is that lsrK is being

transcribed by the lsrR promoter together with the lsrR gene.

To test these hypotheses, a transcriptional fusion of the putative lsrK promoter with the

green fluorescent protein (gfp) gene was constructed. The intergenic region between the lsrR

and lsrK genes was amplified by PCR and cloned into pCMW1 plasmid, upstream of the

promoterless gfp gene, which resulted in plasmid pPBC06. Expression of the resulting

plasmid was measured in several strains carrying distinct genetic backgrounds.

The pPBC06 plasmid was introduced in the wild-type strain (MG1655), in the lsrK mutant

and in the luxS and lsrR mutants and the gfp expression was accessed. As demonstrated in

Figure 15, none of the all the strains that were studied presented any expression of the lsrK-

gfp promoter fusion. Thus, these results do not favor that the promoter exist but it is possible

that it is a very weak promoter, which expression cannot be detected by this method.

36

Figure 15 – lsrK putative promoter-gfp transcriptional expression. Fluorescence was measured in

the following strains: wt [PBC06: wild-type strain + pPBC06]; lsrK [PBC25: ΔlsrK + pPBC06]; luxS

[PBC31: ΔluxS + pPBC06] and lsrR [PBC45: ΔlsrR + pPBC06]. Cultures were diluted 1:100 into BHI

with chloramphenicol 25 mg.l-1

at time 0, and aliquots were removed for analysis at the specified times

after inoculation.

On the other hand, the alternative hypothesis, which states that lsrK is transcribed by the

lsrR promoter, is supported by Northern blot analysis (Figure 16). Total RNA extracts of the

strains that are being studied (the wild-type strain, the lsrR, lsrK and luxS mutants) were

obtained at different hours of growth and then were tested using a hybridization probe

complementary to the messenger RNA of the lsrK gene. These data showed that the

expression of the lsrK gene is higher in a lsrR null background, when compared with the wild-

type. Moreover, a single band was identified with approximately the size corresponding to the

size of the lsrK and lsrR genes together (2,5 kb). This supports the hypothesis that the lsrK

gene is transcribed together with lsrR gene by the lsrR promoter and then subject to its

repression.

On the other hand, in a luxS mutant, that does not synthesize AI-2; the transcription of the

lsrK gene is observed. It is lower than in the wild-type strain but slightly higher than the

negative control (in the lsrK null strain there is no gene to produce its respective messenger

RNA).

37

Figure 16 – Northern Blot of total RNA extracts from a wild-type strain and different mutant

strains. A probe was used for identification of the mRNA of the lsrK gene (unpublished work

performed by Professor Sine Lo Svenningsen).

Overall, these results support the hypothesis that lsrK is transcribed together with the lsrR

gene by the lsrR promoter. As stated above, this promoter presents a higher strength than

the lsr promoter, being less repressed by LsrR and transcribed even in the absence of AI-2.

This basal transcription of the lsrR promoter allows the presence of the LsrR transcriptional

repressor to prevent the induction of the system and the presence of the LsrK kinase before

the expression of the Lsr transporter, to phosphorylate AI-2, which is first internalized by a

PTS-dependent transport, to AI-2-P and then bind the LsrR repressor, relieving its mediated

repression, promoting the expression of the Lsr transport system that will incorporate almost

all the AI-2 in the extracellular medium.

4. Discussion

The main purpose of this research work was to investigate the molecular mechanism of

the AI-2 internalization and subsequent activation of the lsr operon; as well as to understand

and to unravel several questions related to its regulation that still remain unsolved.

It is well known that, Escherichia coli synthesizes and secretes AI-2, that accumulates in

the extracellular medium and its concentration rises until the mid to late exponential phase of

bacterial growth. During the entry into the stationary phase, AI-2 is rapidly incorporated by

the action of the Lsr transporter, the main apparatus through which the signal is depleted

from the medium, enabling its phosphorylation and processing inside the cell. This AI-2

transporter is an ABC transport system composed by the products of the genes in the lsr

operon (Figure 4) [47, 49, 50].

The Lsr system presents two important regulators: the LsrR, which is the transcriptional

repressor of the lsr operon and LsrK, the kinase that phosphorylates the incorporated AI-2 to

AI-2-P that binds the LsrR regulator and the LsrR-mediated repression is relieved, enabling

38

the transcription of the lsr operon and further assembly of the Lsr transport system. These

regulators, LsrK and LsrR, are encoded by the lsrR and lsrK genes, located immediately

upstream of the lsr operon and divergently transcribed in the opposite direction [49, 54].

The current model for AI-2 internalization assumes the premise that the production of Lsr

transport system is being repressed by LsrR to prevent premature expression of the AI-2

incorporation mechanism, enabling accumulation of the extracellular AI-2. Therefore, if LsrR

is repressing the lsr operon, there is no transcription of the Lsr transporter and supposedly

no AI-2 incorporation. However, at transition to stationary phase AI-2 internalization starts

and to initiate this process, phosphorylation of intracellular AI-2 is required to derepress

LsrR. Thus, this is only possible if another transporter of lower affinity is capable of importing

AI-2, that would be phosphorylated and then it would trigger the whole system, allowing the

induction of the Lsr transporter expression that would rapidly incorporate the AI-2 present in

the extracellular medium.

Recently, it has been shown that the EI of the PTS plays an important function in the Lsr

regulation [28]. Specifically, it was observed that mutants in the ptsI gene, whose product is

EI, do not incorporate AI-2 neither activate the transcription of the lsr operon.

This finding, involving the PTS in AI-2 incorporation, fits with the previous noticed fact that

in Lsr transporter mutants, AI-2 internalization is slower but not completely abolished rate

[28]. Because AI-2 is not passively diffused through the membrane [76], an unknown

transporter is capable of importing the signal. Given this and what was observed in the ptsI

mutant, it is plausible that the PTS, a major system involved in sugar uptake and its

regulation, could be involved in the AI-2 internalization or in the regulation of this process.

Accordingly, the impairment in AI-2 internalization observed in the ptsI mutant was shown

to be, effectively, caused by the inability of AI-2 to enter the cell [28]. However, the PTS-

dependent mechanism enabling AI-2 internalization is still unknown.

EI, the product of the ptsI gene, is an important component of the PTS, which is involved

in the incorporation of several carbohydrates to the bacterial cell, concomitantly with their

phosphorylation and PTS relies on the phosphotransferase activity of its components to carry

out its function. The phosphoryl group is donated by PEP to the intermediates, EI, HPr and

EII, in this order, until the final phosphate transfer to the simultaneously imported sugar [58].

In this research work, the importance of this phosphotransferase activity of EI for AI-2

import and lsr operon transcription was accessed. When the ptsI mutant was tested for

complementation using an IPTG-inducible multicopy plasmid carrying a mutant allele of ptsI,

which encodes an EI that cannot be phosphorylated (EIH189A), since it is mutated in the

phosphorylation site (the histidine residue in position 189 is replaced by an alanine residue);

AI-2 internalization is still not observed. In contrast, when the wild-type allele of ptsI is

provided the ability to incorporate AI-2 and the activation of the lsr operon is restored (Figure

39

6). The results indicated that a functional EI, with a preserved phosphorylation site is required

for AI-2 import and for transcription of the lsr operon.

Accordingly, it could be hypothesized that the phosphorylated form of EI could promote

small-scale phosphorylation of AI-2 that would initially derepress the lsr operon but as stated

above, the phosphorylation of AI-2 and LsrR derepression is not dependent on the PTS and

requires LsrK [28]. Another hypothesis is that phosphorylated EI could play some regulatory

function that would allow the incorporation of AI-2 and not necessarily a role in AI-2

phosphorylation. This is quite plausible because PTS components were recognized as

important players in regulation of the several transporters including non-PTS transporters.

Thus, AI-2 internalization could be performed by one of the 20 carbohydrate-specific PTS

permeases or carried out by a permease that does not belong to the PTS family but is

regulated by the components of the PTS, where EI and its phosphotransferase activity would

play a crucial role in the process.

In order to unravel the process by which the PTS plays a role in AI-2 incorporation and to

understand how the EI mediates the regulation of the Lsr transport system; it was determined

whether the important regulator of the PTS sugar uptake system, the Mlc protein, influences

the mechanism of AI-2 import and activation of lsr operon transcription.

In Escherichia coli, the Mlc protein is a major regulator of the PTS-dependent transport of

glucose. This protein represses the expression of the glucose-specific permease EIIBCGlc as

well as the genes manXYZ, encoding three proteins of the mannose-specific PTS, including

also the permease. Similarly, Mlc represses the transcription of the genes encoding for the

general components of PTS, namely the ptsI (EI) and ptsH genes (HPr) [57, 77, 78].

In addition, Mlc is also responsible for the indirect repression of the genes encoding the

non-PTS sugar, maltose by repressing the transcription activator MalT, which activates the

expression of the malEFG, malK, lamB and malPQ operon [57, 67, 79].

Given that Mlc represses the transcription of permeases for transport of PTS sugars,

glucose and mannose, and also the expression of the maltose transporter, a non-PTS sugar;

it was possible that through an uncharacterized mechanism, in the absence of EI, the Mlc

regulator could be repressing the permease or the transport system responsible for the low-

affinity AI-2 incorporation. This hypothesis was not confirmed because the results revealed

that a mutant in the mlc gene presents an identical AI-2 incorporation profile when compared

to the wild-type strain despite of the slight delay in AI-2 internalization attributed to the growth

defect showed by the mlc null mutant (Figure 8). In a similar manner, when the AI-2

incorporation profiles of the ptsI single mutant and the double mutant (ptsI, mlc) were

compared, it was observed that the mlc mutation does not affect the characteristic phenotype

of the ptsI mutant, not restoring the ability to incorporate AI-2 neither to activate the

expression of the lsr operon.

40

In summary, the major mechanism known to be involved in mediating PTS regulation,

namely regulation of cAMP levels, inducer exclusion and Mlc, where shown not be involved

in regulating AI-2 internalization ([28] and this work) so here further work was performed to

identify new regulators of the Lsr system to understand how the entire mechanism works.

In order to achieve that, a genetic screen was performed to identify mutants of EI which

internalize AI-2 and are capable of activating the lsrACDBFG operon. Towards that aim,

every mutation from Keio collection, a set of single-deletion all nonessential genes in

Escherichia coli K-12 [72], was transduced using the P1 bacteriophage, into a ptsI mutant

carrying a lsr-lacZ promoter fusion and the expression of this transcriptional fusion was

accessed in every resulting transductant strain. The main purpose was to screen for double

mutants that showed lsr-lacZ expression higher than the single ptsI mutant, in other words, to

find mutants that reversed the ptsI phenotype for AI-2 incorporation and lsr operon

expression that was previously identified [28].

From the generated library of 3985 mutants that were analysed, 300 genes were identified

as positive hits because they revealed a higher lsr-lacZ expression on MacConkey lactose

agar plates (red colonies) than the transcription of the lsr-lacZ fusion in the ptsI mutant

(which results in white colonies). However, only 165 out of the 300 scored hits were selected

as candidates to be studied. As mentioned, the mutations from the Keio collection were

introduced in the ptsI mutant by transduction using the P1 bacteriophage. It is very well

established that this virus, during the process of bacterial infection, transfers approximately

100 kilobases (kb) of DNA, packaged inside its capsid, into the chromosome of the recipient

bacteria [75]. Given this, during the transduction of each mutated gene linked to the

selectable marker, using the P1 bacteriophage, some undesired genes could be transferred

to the recipient strain. Thus, in this case, when every mutation linked to a kanamycin

cassette, is transduced into the ptsI mutant, some of those mutant genes would lie in close

proximity (inside the 100 kb distance) to the ptsI gene. When these mutant genes are

introduced into the recipient strain, during the recombination of the incorporated DNA, the

ptsI mutant gene could be replaced by the wild-type allele and, therefore, reverse the ptsI

phenotype by restoring the ability to incorporate AI-2 and activate the lsr operon. This would

yield red colonies on the MacConkey lactose plates and would represent a false positive hit.

Additionally, the strains from the Keio collection carry a wild-type allele of the lacZ gene,

encoding a β-galactosidase, as opposed to the recipient strain, CSP108 (lsr-lacZ, ΔcyaA,

crp* ΔptsI), which does not have this gene and the only allele that it carries is that fused to

the lsr operon promoter. Thus, the other allele of the lacZ gene could be transferred in the P1

bacteriophage transduction to the ptsI mutant and then influence the MacConkey lactose

phenotypes, since WT lacZ is induced by lactose this would yield red colonies and hence

false positive hits. This constitutes another major drawback of this genetic screen.

41

In order to discard the genes that could be false positive hits due to its location, the

position of the ptsI and the lacZ genes in the genome of Escherichia coli was determined and

compared with the position of each of the 300 genes identified as positive hits in the screen.

So, if the region, comprising 100 kb upstream the beginning of and 100 kb downstream the

end of the gene, included the ptsI gene or the lacZ gene, this hit gene initially scored as

positive was excluded from the candidates.

As a result of this selection process, only 165 out of the 300 genes were selected as

candidates because the other 135 genes were lying in close proximity to the ptsI gene or to

the wild-type lacZ gene of the strain carrying the mutation to be inserted into the ptsI mutant.

According to this criterion, the 300 identified genes were classified as candidates and non-

candidates. However, the fact that the non-candidates have been excluded does not mean

that those genes cannot play an important role in Lsr regulation via the EI. It just means that

those cannot be evaluated in the present screen. As a matter of fact, this represents a major

drawback of this genetic screen.

In addition, there is another important disadvantage that consists of the fact that during

transduction of gene mutations located nearby the lsr-lacZ transcriptional fusion, carried by

the ptsI mutant, the lsr-lacZ reporter (inserted in the lambda attachment site) could be

removed upon recombination of the inserted DNA. Once the transcriptional fusion is not

present, there is no β-galactosidase production and, therefore, no lactose degradation and

the colonies are white, like in the ptsI single mutant, yielding potential false negatives. Thus,

genes in close proximity of the att site also cannot be studied by this method. Together these

drawbacks of the screen are important problems that could lead to the lost of several genes

that could be crucial in the Lsr regulation.

The number of genes that are lost could be reduced if the mutated ptsI gene, the lsr-lacZ

fusion and lacZ deletion, from the recipient strain, were linked to other selectable marker,

distinct from kanamycin that is the antibiotic cassette marker to which every gene mutation

from the Keio collection is linked. This could be a way to improve this genetic screen and

avoid false positive hits.

Nevertheless, this screen has proven to be successful in the identification of the known

Lsr regulator that suppresses the ptsI mutant characteristic phenotype. For instance, the

transcriptional repressor of the lsrACDBFG operon, the LsrR protein, was scored as a

positive hit. The double mutant in the ptsI and lsrR genes was used as positive control

because previous work has shown that lsrR, ptsI double mutant activated the transcription of

the lsr operon as well as incorporated the AI-2 from the extracellular medium [28]. Therefore,

a mutation in lsrR suppresses the ptsI mutant phenotype.

The genes that were defined as positive candidates in the screen can be classified into

several classes (i) genes encoding components of PTS or regulators of the PTS, (ii) genes

42

encoding non-PTS transport systems, such as symporters, antiporters or ABC systems, (iii)

genes that encoded for DNA-binding transcriptional regulators, (iv) genes whose products

present ATP-binding activity (v) methyltransferases (vi) genes with unknown function and

(vii) genes with other functions (Table 4).

According to the genes that were identified in the screen their possible role could be now

hypothesized. As observed in Table 4, the screen scored as positive hits mutations in genes

encoding for several components of different PTS. The PTS-dependent regulation of AI-2

incorporation could be related to a plausible uncharacterized mechanism of autoinducer

exclusion carried out by a protein, distinct from EIIAGlc, but homologous to it. As hypothesis,

in a ptsI mutant, this PTS protein homologous to EIIAGlc is in the unphosphorylated form and

could bind to the unknown AI-2 permease preventing the uptake of this signal.

Regarding the several genes encoding non-PTS transporters, as they influence the

uptake of nutrients to the cell, they could somehow affect the physiological status of the cell,

influencing directly the balance between the phosphorylated EI and the unphosphorylated EI.

The role of PTS in the transport of K+ was already observed. It was shown that the Nitrogen-

PTS plays an important function in maintaining K+ homeostasis. Thus, the transport of K+ is

linked to carbohydrate metabolism [80].

An intriguing finding was the identification of the sdiA gene since it is related to quorum

sensing and it encodes for an orphan AHL receptor that lacks its cognate LuxI AHL synthase

[81]. Additionally, lsrG was also identified as hit. As hypothesis, in the absence of LsrG, the

enzyme that processes AI-2-P, this activated molecule could accumulate inside the cell and

then activate the lsr operon.

Although the genetic screen provided the identification of a sort of interesting genes that

could, indeed, play a role in Lsr regulation via EI of the PTS, the genes identified as positive

candidates still must be analyzed, to confirm their genotypes and determine if they really

reversed the ptsI mutant phenotype, incorporating AI-2 and activating the lsr operon. Those

that are confirmed will be studied further to understand their role in the interaction between

the PTS and the Lsr system.

In addition to the genetic screen, in this research work, another tool was used to study the

regulation of the lsr operon, instead of the widely used β-galactosidase enzyme assay using

the lacZ transcriptional fusions. Different green fluorescent protein (gfp) reporter fusions were

constructed to evaluate the expression of the operon in several genetic backgrounds and to

compare them with the former fusions. The main purpose was the implementation of new

methods to the study of the lsr operon and its regulation in Escherichia coli.

Regarding the lsr-gfp fusion, it was observed that the luxS and the lsrK mutants present

low levels of fluorescence when compared to the wild-type strain. Moreover, in the lsrR

43

mutant, the reporter fusion is constitutively transcribed, showing that it is not being repressed

by the transcriptional regulator, LsrR, which is absent (Figure 10).

Comparing both promoter fusions, the results showed that the lsr-gfp fusion, measured in

distinct genetic backgrounds, presented similar results when compared with the lsr-lacZ

fusion expression in the same mutants. However, the differences in fluorescence expression

levels between the wild-type and the luxS and lsrK mutants are more pronounced in the lsr-

lacZ than in the lsr-gfp fusion. This could be due to the fact that the fluorescence levels

included the autofluorescence from the growth medium. In this experiment, a different growth

medium was used, namely the Brain Heart Infusion (BHI) broth because it has lower levels of

autofluorescence when compared to Luria-Bertani (LB). Still, even after harvesting the cells

and resuspending the cells, the autofluorescence levels influence the expression levels of

lsr-gfp fluorescence. This could be overcome if the cells were grown in minimal media, which

are known to contain lower autofluorescence. However, this would influence the normal

growth of the strains and, on the other hand; the regulation of the Lsr system is not well

established in cells growing in minimal media so that would prevent us to make comparisons

with the previous studies of a conventional lsr-lacZ promoter fusion.

Despite of this disadvantage, this lsr-gfp transcriptional fusion has proven to be successful

in reproducing with reliability the wild-type and the phenotypes of lsr operon expression in

important mutants involved in the system. Thus, this fusion can be used for genetic screens

to identify novel regulators of lsr and AI-2 internalization.

With respect to the lsrR-gfp reporter fusion (Figure 11), the results that were obtained

showed that the luxS mutant present a low expression of the lsrR promoter, whereas in the

lsrR mutant the transcription is very high, revealing that is regulated by the LsrR repressor.

Surprisingly, the lsrK mutant and the wild-type showed similar gfp expression profiles,

characterized by a fluorescence expression higher than the luxS mutant but much lower than

the lsrR mutant.

Comparing the expression of the lsrR-gfp fusion (Figure 11) with the lsrR-lacZ reporter

fusion (Figure 12) in the same genetic backgrounds, both indicate that the lsrRK operon is

regulated by the LsrR repressor, given that the fusions are constitutively expressed in a

mutant in the lsrR gene. However, the expression of both reporter fusions in a lsrK mutant is

not identical in both cases since using the lsrR-lacZ fusion, its transcription in the lsrK mutant

is very low and similar to the luxS mutant fluorescence whereas in the lsrR-gfp fusion, its

transcription in the lsrK mutant is higher than the luxS and quite similar to the wild-type

fluorescence. Importantly, Northern blot analysis supported the phenotypes observed using

the lsrR-lacZ reporter.

Similarly to what is observed for the lsr-gfp fusion, the transcription differences between

the strains are markedly higher in the lsrR-lacZ promoter fusion, possibly also due to the

44

autofluorescence that interferes with the fluorescence that is measured in each strain,

reducing the differences between them. According to this and to the fact that this fusion

produced incoherent results, the lsrR-gfp does not seem to be a good and reliable working

tool to study the Lsr regulation.

According to the present working model of AI-2 regulation (Figure 4), the lsr operon,

encoding the Lsr transporter to incorporate AI-2, must be initially repressed by the

transcriptional repressor LsrR to avoid premature induction of the system, prevent the early

depletion of the signal from medium and allow extracellular accumulation. To accomplish

that, it is thought that there must be a basal transcription of the lsrR gene to produce the

LsrR regulator that represses the whole system, before being triggered by the incorporation

and phosphorylation of AI-2.

This hypothesis is supported by the experimental results of this study, in which it was

determined that the strength of the lsrR promoter is higher than the lsr promoter (Figure 14).

In two luxS mutant strains, but one carrying the lsrR-lacZ and the other the lsr-lacZ promoter

fusion, it was observed that the expression of the lsrR-lacZ fusion is higher than the

transcription of the lsr-lacZ reporter, for all the concentration of AI-2 provided. In other words,

the transcription of the lsrR promoter is higher than the lsr promoter.

These results offer experimental evidence that there is always a basal level of LsrR, that

enables the repression of the Lsr system to avoid premature activation of the system before

AI-2 reaches a high concentration in the extracellular medium and starts to be internalized by

the unknown PTS-dependent transporter. Also according to the proposed model after AI-2

internalized by the unknown transporter AI-2 phosphorylation by LsrK is required to relief

LsrR-mediated repression of the lsr operon and quick start the feed-back loop that induces

Lsr dependent expression and fast removal of the AI-2. This is only possible again if there

are basal levels of LsrK kinase, already present in the cell to start the whole induction

process.

One possibility to enable the presence of LsrK basal levels is that transcription of the lsrK

gene is not dependent on LsrR neither on AI-2-P. For example the lsrK gene could have its

own, but weak, promoter that provide basal LsrK levels, necessary to phosphorylate AI-2 that

is first incorporated to initialize de-repression of LsrR and induction of the Lsr transport

system.

To address this possibility, a transcriptional fusion of the putative lsrK promoter, that is the

intergenic region between the lsrR and the lsrK genes; with the green fluorescent protein

gene was constructed and its expression was determined in the most important mutants of

the Lsr system. The results have shown that this promoter fusion was not expressed in none

of the strains that were studied (Figure 15). Therefore, this observation argues against the

45

proposed hypothesis. Nevertheless, the absence of lsrK-gfp expression could be related to

the fact that the putative promoter is very weak and the levels are so low, and its expression

cannot be detected by this fluorescence assay.

Another hypothesis is that the lsrK is transcribed together with the lsrR gene by the lsrR

promoter. It was shown that this activity of this promoter is always higher than the lsr

promoter responsible expression of lsrACDBFG. So if, the lsrK gene were transcribed

together with lsrR by this promoter, this would result in basal levels of lsrK that would

phosphorylate the first internalized AI-2 to start the Lsr induction.

This theory was supported by Northern blot analysis in which the transcription of the lsrK

gene was tested in different mutant strains, using a complementary probe for its messenger

RNA. The results have revealed that the expression of the lsrK gene is higher in mutant in

the lsrR gene than in the wild-type strain. The most striking observation is that a single band

was identified presenting approximately the corresponding size of the lsrK and lsrR genes

together (2,5 kb) (Figure 16). This is in agreement with the previous results considering that

lsrK does not have its own promoter.

In summary, these results along with data from previous works support the hypothesis

that the lsrK gene is transcribed together with the lsrR gene by the lsrR promoter and subject

to its regulation. As this promoter is stronger than the lsr promoter, it is less repressed by

LsrR and transcribed at low levels, even in the absence of AI-2. This basal transcription of

the lsrR promoter and thus of the lsrR and lsrK genes, before the expression of the Lsr

transporter, enables the presence of the LsrR transcriptional repressor to avoid the early

induction of the system as well as of the LsrK kinase to phosphorylate AI-2 that is first

internalized by a PTS-dependent transport, yielding AI-2-P that bind the LsrR repressor,

relieving its mediated repression and promoting the induction of the expression of the Lsr

transport system that will rapidly internalize the AI-2 from the extracellular medium (Figure

17).

46

Figure 17 – Proposed model for AI-2 incorporation and processing by the lsrACDBFG operon.

AI-2 is synthesized by the LuxS enzyme and accumulates in the extracellular medium. When AI-2

reaches a certain concentration, it is first incorporated through a PTS-dependent transport. In the

cytoplasm, AI-2 is phosphorylated by basal levels of LsrK, transcribed by the lsrR promoter. The AI-2-

P binds to LsrR inactivating its repression activity allowing transcription of the lsr operon and

production of the Lsr transporter that incorporates more AI-2 and starts a feedback loop with the

consequent fast removal of AI-2 from the extracellular medium (modified from reference [28]).

5. References

1. Ng, W.L. and B.L. Bassler, Bacterial quorum-sensing network architectures. Annu Rev Genet,

2009. 43: p. 197-222.

2. Reading, N.C. and V. Sperandio, Quorum sensing: the many languages of bacteria. FEMS

Microbiol Lett, 2006. 254(1): p. 1-11.

3. Fuqua, W.C., S.C. Winans, and E.P. Greenberg, Quorum sensing in bacteria: the LuxR-LuxI

family of cell density-responsive transcriptional regulators. J Bacteriol, 1994. 176(2): p. 269-

75.

4. Williams, P., et al., Look who's talking: communication and quorum sensing in the bacterial

world. Philos Trans R Soc Lond B Biol Sci, 2007. 362(1483): p. 1119-34.

5. Boyer, M. and F. Wisniewski-Dye, Cell-cell signalling in bacteria: not simply a matter of

quorum. FEMS Microbiol Ecol, 2009. 70(1): p. 1-19.

6. Waters, C.M. and B.L. Bassler, Quorum sensing: cell-to-cell communication in bacteria. Annu

Rev Cell Dev Biol, 2005. 21: p. 319-46.

7. Manefield, M. and A.S. Whiteley, Acylated homoserine lactones in the environment:

chameleons of bioactivity. Philos Trans R Soc Lond B Biol Sci, 2007. 362(1483): p. 1235-40.

47

8. Manefield, M. and S.L. Turner, Quorum sensing in context: out of molecular biology and into

microbial ecology. Microbiology, 2002. 148(Pt 12): p. 3762-4.

9. More, M.I., et al., Enzymatic synthesis of a quorum-sensing autoinducer through use of

defined substrates. Science, 1996. 272(5268): p. 1655-8.

10. Parsek, M.R., et al., Acyl homoserine-lactone quorum-sensing signal generation. Proc Natl

Acad Sci U S A, 1999. 96(8): p. 4360-5.

11. Fuqua, C., M.R. Parsek, and E.P. Greenberg, Regulation of gene expression by cell-to-cell

communication: acyl-homoserine lactone quorum sensing. Annu Rev Genet, 2001. 35: p. 439-

68.

12. Nealson, K.H. and J.W. Hastings, Bacterial bioluminescence: its control and ecological

significance. Microbiol Rev, 1979. 43(4): p. 496-518.

13. Stevens, A.M., K.M. Dolan, and E.P. Greenberg, Synergistic binding of the Vibrio fischeri LuxR

transcriptional activator domain and RNA polymerase to the lux promoter region. Proc Natl

Acad Sci U S A, 1994. 91(26): p. 12619-23.

14. Kempner, E.S. and F.E. Hanson, Aspects of light production by Photobacterium fischeri. J

Bacteriol, 1968. 95(3): p. 975-9.

15. Passador, L., et al., Expression of Pseudomonas aeruginosa virulence genes requires cell-to-

cell communication. Science, 1993. 260(5111): p. 1127-30.

16. Zhu, J., et al., Quorum-sensing regulators control virulence gene expression in Vibrio cholerae.

Proc Natl Acad Sci U S A, 2002. 99(5): p. 3129-34.

17. Havarstein, L.S., G. Coomaraswamy, and D.A. Morrison, An unmodified heptadecapeptide

pheromone induces competence for genetic transformation in Streptococcus pneumoniae.

Proc Natl Acad Sci U S A, 1995. 92(24): p. 11140-4.

18. Ji, G., R.C. Beavis, and R.P. Novick, Cell density control of staphylococcal virulence mediated

by an octapeptide pheromone. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12055-9.

19. Solomon, J.M., B.A. Lazazzera, and A.D. Grossman, Purification and characterization of an

extracellular peptide factor that affects two different developmental pathways in Bacillus

subtilis. Genes Dev, 1996. 10(16): p. 2014-24.

20. Camilli, A. and B.L. Bassler, Bacterial small-molecule signaling pathways. Science, 2006.

311(5764): p. 1113-6.

21. Ansaldi, M., et al., Specific activation of the Bacillus quorum-sensing systems by isoprenylated

pheromone variants. Mol Microbiol, 2002. 44(6): p. 1561-73.

22. Booth, M.C., et al., Structural analysis and proteolytic activation of Enterococcus faecalis

cytolysin, a novel lantibiotic. Mol Microbiol, 1996. 21(6): p. 1175-84.

23. Mayville, P., et al., Structure-activity analysis of synthetic autoinducing thiolactone peptides

from Staphylococcus aureus responsible for virulence. Proc Natl Acad Sci U S A, 1999. 96(4): p.

1218-23.

24. Nakayama, J., et al., Gelatinase biosynthesis-activating pheromone: a peptide lactone that

mediates a quorum sensing in Enterococcus faecalis. Mol Microbiol, 2001. 41(1): p. 145-54.

25. Ji, G., R. Beavis, and R.P. Novick, Bacterial interference caused by autoinducing peptide

variants. Science, 1997. 276(5321): p. 2027-30.

26. Hakenbeck, R. and J.B. Stock, Analysis of two-component signal transduction systems

involved in transcriptional regulation. Methods Enzymol, 1996. 273: p. 281-300.

48

27. Kleerebezem, M., et al., Quorum sensing by peptide pheromones and two-component signal-

transduction systems in Gram-positive bacteria. Mol Microbiol, 1997. 24(5): p. 895-904.

28. Pereira, C.S., Bacterial inter-species communication mediated by the autoinducer-2 signal.

2011, Universidade Nova de Lisboa: Lisboa. p. 186.

29. Bassler, B.L. and R. Losick, Bacterially speaking. Cell, 2006. 125(2): p. 237-46.

30. Jayaraman, A. and T.K. Wood, Bacterial quorum sensing: signals, circuits, and implications for

biofilms and disease. Annu Rev Biomed Eng, 2008. 10: p. 145-67.

31. Surette, M.G., M.B. Miller, and B.L. Bassler, Quorum sensing in Escherichia coli, Salmonella

typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer

production. Proc Natl Acad Sci U S A, 1999. 96(4): p. 1639-44.

32. Surette, M.G. and B.L. Bassler, Quorum sensing in Escherichia coli and Salmonella

typhimurium. Proc Natl Acad Sci U S A, 1998. 95(12): p. 7046-50.

33. Federle, M.J. and B.L. Bassler, Interspecies communication in bacteria. J Clin Invest, 2003.

112(9): p. 1291-9.

34. Xavier, K.B. and B.L. Bassler, LuxS quorum sensing: more than just a numbers game. Curr Opin

Microbiol, 2003. 6(2): p. 191-7.

35. Chen, X., et al., Structural identification of a bacterial quorum-sensing signal containing

boron. Nature, 2002. 415(6871): p. 545-9.

36. Bassler, B.L., et al., Intercellular signalling in Vibrio harveyi: sequence and function of genes

regulating expression of luminescence. Mol Microbiol, 1993. 9(4): p. 773-86.

37. Armbruster, C.E., et al., Indirect pathogenicity of Haemophilus influenzae and Moraxella

catarrhalis in polymicrobial otitis media occurs via interspecies quorum signaling. MBio,

2010. 1(3).

38. Hardie, K.R. and K. Heurlier, Establishing bacterial communities by 'word of mouth': LuxS and

autoinducer 2 in biofilm development. Nat Rev Microbiol, 2008. 6(8): p. 635-43.

39. Duan, K., et al., Modulation of Pseudomonas aeruginosa gene expression by host microflora

through interspecies communication. Mol Microbiol, 2003. 50(5): p. 1477-91.

40. Federle, M.J., Autoinducer-2-based chemical communication in bacteria: complexities of

interspecies signaling. Contrib Microbiol, 2009. 16: p. 18-32.

41. Schauder, S., et al., The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-

sensing signal molecule. Mol Microbiol, 2001. 41(2): p. 463-76.

42. Grillo, M.A. and S. Colombatto, S-adenosylmethionine and its products. Amino Acids, 2008.

34(2): p. 187-93.

43. Vendeville, A., et al., Making 'sense' of metabolism: autoinducer-2, LuxS and pathogenic

bacteria. Nat Rev Microbiol, 2005. 3(5): p. 383-96.

44. Miller, S.T., et al., Salmonella typhimurium recognizes a chemically distinct form of the

bacterial quorum-sensing signal AI-2. Mol Cell, 2004. 15(5): p. 677-87.

45. Pereira, C.S., et al., Sinorhizobium meliloti, a bacterium lacking the autoinducer-2 (AI-2)

synthase, responds to AI-2 supplied by other bacteria. Mol Microbiol, 2008. 70(5): p. 1223-35.

46. Xavier, K.B. and B.L. Bassler, Interference with AI-2-mediated bacterial cell-cell

communication. Nature, 2005. 437(7059): p. 750-3.

47. Xavier, K.B., et al., Phosphorylation and processing of the quorum-sensing molecule

autoinducer-2 in enteric bacteria. ACS Chem Biol, 2007. 2(2): p. 128-36.

49

48. Waters, C.M. and B.L. Bassler, The Vibrio harveyi quorum-sensing system uses shared

regulatory components to discriminate between multiple autoinducers. Genes Dev, 2006.

20(19): p. 2754-67.

49. Xavier, K.B. and B.L. Bassler, Regulation of uptake and processing of the quorum-sensing

autoinducer AI-2 in Escherichia coli. J Bacteriol, 2005. 187(1): p. 238-48.

50. Taga, M.E., S.T. Miller, and B.L. Bassler, Lsr-mediated transport and processing of AI-2 in

Salmonella typhimurium. Mol Microbiol, 2003. 50(4): p. 1411-27.

51. Taga, M.E., J.L. Semmelhack, and B.L. Bassler, The LuxS-dependent autoinducer AI-2 controls

the expression of an ABC transporter that functions in AI-2 uptake in Salmonella

typhimurium. Mol Microbiol, 2001. 42(3): p. 777-93.

52. Wang, L., et al., Cyclic AMP (cAMP) and cAMP receptor protein influence both synthesis and

uptake of extracellular autoinducer 2 in Escherichia coli. J Bacteriol, 2005. 187(6): p. 2066-76.

53. Wang, L., et al., luxS-dependent gene regulation in Escherichia coli K-12 revealed by genomic

expression profiling. J Bacteriol, 2005. 187(24): p. 8350-60.

54. Li, J., et al., Quorum sensing in Escherichia coli is signaled by AI-2/LsrR: effects on small RNA

and biofilm architecture. J Bacteriol, 2007. 189(16): p. 6011-20.

55. Diaz, Z., K.B. Xavier, and S.T. Miller, The crystal structure of the Escherichia coli autoinducer-2

processing protein LsrF. PLoS One, 2009. 4(8): p. e6820.

56. Marques, J.C., et al., Processing the interspecies quorum-sensing signal autoinducer-2 (AI-2):

characterization of phospho-(S)-4,5-dihydroxy-2,3-pentanedione isomerization by LsrG

protein. J Biol Chem, 2011. 286(20): p. 18331-43.

57. Deutscher, J., C. Francke, and P.W. Postma, How phosphotransferase system-related protein

phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev,

2006. 70(4): p. 939-1031.

58. Postma, P.W., J.W. Lengeler, and G.R. Jacobson, Phosphoenolpyruvate:carbohydrate

phosphotransferase systems of bacteria. Microbiol Rev, 1993. 57(3): p. 543-94.

59. Gabor, E., et al., The phosphoenolpyruvate-dependent glucose-phosphotransferase system

from Escherichia coli K-12 as the center of a network regulating carbohydrate flux in the cell.

Eur J Cell Biol, 2011. 90(9): p. 711-20.

60. Seok, Y.J., et al., High affinity binding and allosteric regulation of Escherichia coli glycogen

phosphorylase by the histidine phosphocarrier protein, HPr. J Biol Chem, 1997. 272(42): p.

26511-21.

61. Segura, D. and G. Espin, Mutational inactivation of a gene homologous to Escherichia coli

ptsP affects poly-beta-hydroxybutyrate accumulation and nitrogen fixation in Azotobacter

vinelandii. J Bacteriol, 1998. 180(18): p. 4790-8.

62. Houot, L. and P.I. Watnick, A novel role for enzyme I of the Vibrio cholerae

phosphoenolpyruvate phosphotransferase system in regulation of growth in a biofilm. J

Bacteriol, 2008. 190(1): p. 311-20.

63. Barabote, R.D. and M.H. Saier, Jr., Comparative genomic analyses of the bacterial

phosphotransferase system. Microbiol Mol Biol Rev, 2005. 69(4): p. 608-34.

64. Lengeler, J.W. and K. Jahreis, Bacterial PEP-dependent carbohydrate: phosphotransferase

systems couple sensing and global control mechanisms. Contrib Microbiol, 2009. 16: p. 65-87.

50

65. King, N.D. and M.R. O'Brian, Evidence for direct interaction between enzyme I(Ntr) and

aspartokinase to regulate bacterial oligopeptide transport. J Biol Chem, 2001. 276(24): p.

21311-6.

66. Deutscher, J., The mechanisms of carbon catabolite repression in bacteria. Curr Opin

Microbiol, 2008. 11(2): p. 87-93.

67. Plumbridge, J., Regulation of gene expression in the PTS in Escherichia coli: the role and

interactions of Mlc. Curr Opin Microbiol, 2002. 5(2): p. 187-93.

68. Blattner, F.R., et al., The complete genome sequence of Escherichia coli K-12. Science, 1997.

277(5331): p. 1453-62.

69. Semmelhack, M.F., et al., An expeditious synthesis of DPD and boron binding studies. Org

Lett, 2005. 7(4): p. 569-72.

70. Slauch, J.M. and T.J. Silhavy, Genetic fusions as experimental tools. Methods Enzymol, 1991.

204: p. 213-48.

71. Rajamani, S., et al., A LuxP-FRET-based reporter for the detection and quantification of AI-2

bacterial quorum-sensing signal compounds. Biochemistry, 2007. 46(13): p. 3990-7.

72. Baba, T., et al., Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants:

the Keio collection. Mol Syst Biol, 2006. 2: p. 2006 0008.

73. Raveh, H., et al., Modulation of transcription antitermination in the bgl operon of Escherichia

coli by the PTS. Proc Natl Acad Sci U S A, 2009. 106(32): p. 13523-8.

74. Seitz, S., et al., Analysis of the interaction between the global regulator Mlc and EIIBGlc of the

glucose-specific phosphotransferase system in Escherichia coli. J Biol Chem, 2003. 278(12): p.

10744-51.

75. Thomason, L.C., N. Costantino, and D.L. Court, E. coli genome manipulation by P1

transduction. Curr Protoc Mol Biol, 2007. Chapter 1: p. Unit 1 17.

76. Zhu, J. and D. Pei, A LuxP-based fluorescent sensor for bacterial autoinducer II. ACS Chem

Biol, 2008. 3(2): p. 110-9.

77. Plumbridge, J., Control of the expression of the manXYZ operon in Escherichia coli: Mlc is a

negative regulator of the mannose PTS. Mol Microbiol, 1998. 27(2): p. 369-80.

78. Plumbridge, J., Expression of the phosphotransferase system both mediates and is mediated

by Mlc regulation in Escherichia coli. Mol Microbiol, 1999. 33(2): p. 260-73.

79. Bohm, A. and W. Boos, Gene regulation in prokaryotes by subcellular relocalization of

transcription factors. Curr Opin Microbiol, 2004. 7(2): p. 151-6.

80. Lutteman, D., et al., Stimulation of the potassium sensor KdpD kinase activity by interaction

with the phosphotransferase protein IIANtr in Escherichia coli. Mol Microbio, 2009. 72(4):

p.978-994

81. Case, R.J., M. Labbate and S. Kjelleberg, AHL-driven quorum-sensing circuits: their frequency

and function among the Proteobacteria. ISME J 2:345-9

Documents

REGULATION OF THE MECHANISM OF INTERFERENCE WITH …repositorio.ul.pt/bitstream/10451/6464/1/ulfc092821_tm_paulo... · REGULATION OF THE MECHANISM OF INTERFERENCE WITH QUORUM SENSING