1

Regulation of DNA Replication Machinery by Mrc1 in Fission Yeast

Naoki Nitani*, Ken-ichi Nakamura*§,

Chie Nakagawa*, Hisao Masukata*§ and Takuro Nakagawa*

Department of Biological Science, Graduate School of Science*,

Graduate School of Frontier Biosciences§, Osaka University

Toyonaka, Osaka 560-0043, Japan

Genetics: Published Articles Ahead of Print, published on July 18, 2006 as 10.1534/genetics.106.060053

2

Running head:

Mrc1 negatively regulates Cdc45 and MCM

Key words:

DNA replication, Checkpoint, Fission yeast, Mrc1, Cdc45

Corresponding author:

Takuro Nakagawa

Department of Biological Science, Graduate School of Science, Osaka University

1-1 Machikaneyama, Toyonaka, Osaka 560-0043, Japan

Phone: +81-6-6850-5431

Fax: +81-6-6850-5440

Email: takuro4@bio.sci.osaka-u.ac.jp

3

ABSTRACT

Faithful replication of chromosomes is crucial to genome integrity. In yeast, ORC binds

replication origins throughout the cell cycle. However, Cdc45 binds these before S phase,

and during replication, it moves along the DNA with MCM helicase. When replication

progression is inhibited, checkpoint regulation is believed to stabilize the replication fork; the

detailed mechanism, however, remains unclear. To examine the relationship between

replication initiation and elongation defects and the response to replication elongation block,

we used fission yeast mutants of Orc1 and Cdc45—orp1-4 and sna41-928, respectively—at

their respective semipermissive temperatures with regard to BrdU incorporation. Both orp1

and sna41 cells exhibited HU hypersensitivity in the absence of Chk1, a DNA damage

checkpoint kinase, and were defective in full activation of Cds1, a replication checkpoint

kinase, indicating that normal replication is required for Cds1 activation. Mrc1 is required to

activate Cds1 and prevent the replication machinery uncoupling from DNA synthesis. We

observed that, while either the orp1 or sna41 mutation partially suppressed HU sensitivity of

cds1 cells, sna41 specifically suppressed that of mrc1 cells. Interestingly, sna41 alleviated

4

the defect in recovery from HU arrest without increasing Cds1 activity. In addition to sna41,

specific mutations of MCM suppressed the HU sensitivity of mrc1 cells. Thus, during

elongation, Mrc1 may negatively regulate Cdc45 and MCM helicase to render stalled forks

capable of resuming replication.

5

INTRODUCTION

During DNA replication, various kinds of intermediate DNA structures are formed,

including single-stranded, nicked, and Y-shaped DNA. These replication intermediates

appear to be unstable, especially when the progression of replication is hampered by dNTP

starvation, non-histone DNA-binding proteins, or DNA lesions (BRANZEI and FOIANI 2005;

IVESSA et al. 2003). The collapsed DNA structures resulting from stalled replication forks

are a great threat to genome integrity. Therefore, stalled replication forks must be processed

faithfully to prevent chromosomal aberrations that can cause cell death or cancer in

multicellular organisms.

DNA replication is initiated at specific chromosomal loci known as replication origins.

Origin recognition complexes (ORCs) bind the origin and serve as landing pads for other

replication factors (for reviews, see BELL and DUTTA 2002; LEI and TYE 2001; TYE 1999).

Prior to entry into the S phase, the minichromosome maintenance (MCM) complex is loaded

onto the origin via the function of Cdc18/Cdc6 and Cdt1. Several lines of evidence indicate

that the MCM complex is likely to be a replicative DNA helicase that functions with the aid

6

of other factors and protein modifications (APARICIO et al. 1997; CHONG et al. 2000; ISHIMI

1997; KELMAN et al. 1999; LABIB et al. 2000; YOU et al. 1999). Cdc45 appears to be an

essential accessory factor for the MCM helicase since Cdc45 is associated with the MCM

helicase only during the S phase and since DNA unwinding by the MCM helicase is

stimulated by the presence of Cdc45 (MASUDA et al. 2003; TERCERO et al. 2000; WALTER

and NEWPORT 2000; ZOU and STILLMAN 1998). In addition, Cdc45 as well as MCM moves

along the DNA, and the destruction of these factors prevents further replication following

replication initiation (APARICIO et al. 1997; LABIB et al. 2000; TERCERO et al. 2000).

Therefore, in contrast to the ORC, Cdc45 participates in both the initiation and elongation

phases of replication.

The progression of DNA replication is monitored by the checkpoint mechanism to ensure

that stalled replication forks are stabilized and mitosis occurs only after all the chromosomes

have completely replicated (for reviews, see CARR 2002; HARTWELL and WEINERT 1989;

NYBERG et al. 2002; ZHOU and BARTEK 2004). Most factors involved in the checkpoint have

been conserved from yeast to humans. In the fission yeast Schizosaccharomyces pombe,

7

Rad3 is the central player in the checkpoint mechanism and is required for the

phosphorylation and activation of the downstream kinases, Cds1 and Chk1 (LINDSAY et al.

1998; MURAKAMI and OKAYAMA 1995; WALWORTH and BERNARDS 1996). The

phosphorylation of Cds1 and Chk1 results in increased kinase activity (CAPASSO et al. 2002;

LINDSAY et al. 1998; LOPEZ-GIRONA et al. 2001). The activated kinases inhibit cell-cycle

dependent kinase (CDK) by phosphorylating CDK regulators (e.g., Wee1, Mik1, and Cdc25),

thus causing cell cycle arrest (FURNARI et al. 1999; RALEIGH and O'CONNELL 2000; RHIND et

al. 1997). In addition, Cds1 and Chk1 may contribute to DNA metabolism by regulating the

expression, localization and activity of a set of proteins that is involved in the repair of DNA

damage and/or in the processing of stalled replication forks (BODDY et al. 2000; BODDY et al.

2003; CASPARI et al. 2002; HUANG et al. 1998; KAI et al. 2005; SOGO et al. 2002). Although

Cds1 and Chk1 share many activation factors, including the Rad3-Rad26 complex (homolog

of the ATR-ATRIP complex in humans), they are activated in different situations (HARRIS et

al. 2003; LINDSAY et al. 1998; MARTINHO et al. 1998). Cds1 is activated when replication is

blocked during the S phase, while Chk1 is activated when DNA damage occurs either within

8

or outside the S phase. The activation of Cds1 specifically depends on Mrc1, while that of

Chk1 depends on Crb2/Rhp9 (ALCASABAS et al. 2001; SAKA et al. 1997; TANAKA and

RUSSELL 2001). In addition to its function in Cds1 activation, Mrc1 has been shown to

prevent the extensive uncoupling of the Cdc45-containing replication machinery from DNA

synthesis when replication is hindered by dNTP depletion (KATOU et al. 2003). Mrc1

associates with the replication fork, and preferentially binds branched DNA structures in

vitro (CALZADA et al. 2005; KATOU et al. 2003; NEDELCHEVA et al. 2005; ZHAO and

RUSSELL 2004). However, its mechanism of action in preventing the uncoupling of the

replication machinery from DNA synthesis remains unclear.

In this study, we used the fission yeast mutants of Orc1 (a subunit of the ORC) and

Cdc45—orp1-4 and sna41-928, respectively—and demonstrated that these mutants are

hypersensitive to hydroxyurea (HU) in the absence of Chk1, and partially defective in Cds1

activation at their respective semipermissive temperatures with regard to the ability to

incorporate a nucleoside analog, 5-bromodeoxyuridine (BrdU). These results are consistent

with the concept that normal replication is required for full activation of the replication

9

checkpoint. Interestingly, either the orp1 or sna41 mutation suppresses the HU sensitivity of

a cds1∆ mutant; however, only the sna41 mutation suppresses the HU sensitivity of an

mrc1∆ mutant. The sna41 mutation suppresses the defect in the recovery from HU arrest but

does not increase Cds1 activity in mrc1∆ cells. In addition to the sna41 mutation of Cdc45,

mutations of the MCM protein suppress the HU sensitivity of an mrc1∆ mutant in an

allele-dependent manner. These results suggest that Mrc1 negatively regulates Cdc45 and

MCM helicase to render the stalled replication forks capable of resuming replication.

10

MATERIALS AND METHODS

Fission yeast strains and media: The yeast strains used in this study are listed in Table 1.

Yeast media were prepared and standard genetic procedures were carried out as described

elsewhere (ALFA et al. 1993). HU (Sigma) was dissolved in water to 1 M, sterilized by

filtration, stored at –20°, and used at the indicated final concentrations. mrc1::kanMX6 and

cds1::kanMX6 strains were generated by transforming yeast cells with the PCR product

obtained using the pFA6a-kanMX6 plasmid (BAHLER et al. 1998) as a template. The primer

pair used for mrc1::kanMX6 comprised

5’-CTAAGGAGGACTAAGAGATGTATCGCGGCAAAGCAACTACCATTACTCGTTCA

ATAAGAGCTTTGTGGTGCTTAAATCTCGGATCCCCGGGTTAATTAA and

5’-GTTATGTAAATTATCAATACCTCATTCAAAAAAAACAAGTTTGACAAGTCCAG

CTCGTCAAATCCCCTTTCTTAGCCACGAATTCGAGCTCGTTTAAAC (The sequence

complementary to the mrc1+ flanking region is underlined), and that used for cds1::kanMX6

comprised

5’-TTGATCACTCATTTGCACGTTTATTTGTGTTTACTGATATACATGGTTAAAGAAT

11

TCATCCAGTTTTTCTGTTTTTAAGAATTCGAGCTCGTTTAAAC and

5’-CTATTTACAATATTATAAATTTGACGGTCTAAGTATAAAAATTAATTAATTATCAT

TTAGAATACTAAATATTAATAATCGGATCCCCGGGTTAATTAA (The sequence

complementary to the cds1+ flanking region is underlined). Yeast transformants were

selected on yeast extract (YE) plates containing 100 µg/ml of G418 disulfate (Nacalai

Tesque), and correct integration was confirmed by PCR using the primer pairs that

complemented the flanking regions of the integrated DNA (The primer sequences used are

available upon request). To obtain the adh1 promoter, a 0.8-kbp fragment was amplified

from yeast genomic DNA using the following primer pair:

5’-GCTCTAGATCGATGACATTCGAATGGCATGCCC and

5’-GGGGTACCATATGTATGTGGTTAGAAAAAAGAAAAGAC (The sequence

complementary to the adh1 promoter region is underlined). An ade6+:(adh1)p-hENT

construct was created to locate a 0.8-kbp XbaI-KpnI fragment in the adh1 promoter that is

followed by a 1.4-kbp KpnI-XbaI fragment containing the human equilibrative nucleoside

transporter (hENT) gene from pKS007 (KATOU et al. 2003), which is 70-bp downstream of

12

the ade6+ gene. A ura4+:(adh1)p-TK construct was created to locate a 0.8-kbp ClaI-NdeI

fragment in the adh1 promoter that is followed by a 1.3-kbp BamHI fragment containing the

thymidine kinase (TK) gene from pYK001 (KATOU et al. 2003), which is 440-bp downstream

of the ura4+ gene.

Incorporation of 5-bromodeoxyuridine: G2 cells from log-phase cultures in YE

medium were collected by elutriation with a Beckman J6-MC centrifuge and resuspended in

fresh medium at a concentration of 5 × 106 cells/ml. Next, 5-bromodeoxyuridine (BrdU) and

HU were added to a final concentration of 100 µM and 10 mM, respectively. After 3-h

incubation, approximately 4 × 108 cells were collected and washed with washing buffer [5

mM EDTA, 50 mM NaF], and DNA was prepared as described (BAHLER et al. 1998). The

DNA was fragmented to approximately 0.5-kbp by sonication with Sonifier 250 (Branson)

three times at a tune level of 2 for 10 s. Following ethanol precipitation, the DNA was

suspended in 1.7 ml of TEN buffer [10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 150 mM NaCl]

supplemented with cesium chloride (CsCl) at a final concentration of 1 g/ml, and the DNA

solution was centrifuged at 80,000 rpm for 14 h in Hitachi CS120 with a RP120VT rotor

13

(Hitachi). The DNA samples that were recovered from 14 fractions at the top of the

centrifuge tube were dialyzed against 10:1 TE [10 mM Tris-HCl (pH 7.4), 1 mM EDTA]

using the Gibco BRL microdialysis apparatus (Bethesda Research Laboratories). Following

heat denaturation (95° for 5 min), an equal volume of 20× SSC [0.3 M Na-citrate (pH 7.0), 3

M NaCl] was added to the DNA samples, and they were transferred to a Nytran nylon

membrane (Schleicher & Schuell) using SHM-48 Slot Blot Hybridization Manifold

(Scie-Plas). For Southern hybridization, a 3.2-kbp NotI-XbaI fragment that was prepared

from pXN289 (OKUNO et al. 1997) and a 1.0-kbp XbaI fragment from p2BN052-1 (OKUNO

et al. 1997) were labeled with 32P using the Megaprime DNA labeling system (Amersham)

and employed as the autonomous replication sequence (ARS) and non-ARS fragment probe,

respectively. Southern blot signals were detected using a Fuji BAS2500 phosphorimager and

were measured using the Image Gauge software (Fujifilm).

Preparation of cell extracts: Cells were washed with 1/2 culture volume of ice-cold

washing buffer [50 mM NaF, 5 mM EDTA], frozen in liquid nitrogen, and stored at –80°

before use. They were suspended in lysis buffer [50 mM HEPES (pH 7.4), 100 mM

14

K-acetate, 2 mM EDTA, 1 mM DTT, 0.1% NP-40, 10% glycerol, 50 mM NaF, 60 mM

ß-glycerophosphate, 1 mM Na-orthovanadate, 1 mM PMSF, 1 mM benzamidine, 1 µg/ml

leupeptin, 1 µg/ml pepstatin A] and disrupted using Bead-Beater (Biospec Products) after the

addition of 5 µl of protease inhibitor cocktail (Sigma) and glass beads; the beads were then

removed by centrifugation. After the addition of 20% Triton X-100 to a final concentration

of 1%, the cell lysate was incubated at 4° for 30 min with rotation of the tube. The protein

extract was cleared by centrifugation at 15,000 rpm for 10 min at 4°, and the protein

concentration was determined by the Bradford assay (Protein Assay, BioRad).

Cds1 kinase assays: Cds1 kinase assays were performed essentially as described

elsewhere (BODDY et al. 1998). In a total volume of 0.5 ml, 1.5 mg of cell extracts was

mixed with glutathione-Sepharose-bound GST-Wee170 in lysis buffer supplemented with 1%

Triton X-100. After rotation for 1.5 h at 4°, the Sepharose beads were washed with 0.3 ml of

the lysis buffer supplemented with 1% Triton X-100 and then with 0.3 ml of kinase buffer [50

mM Tris-HCl (pH 7.6), 10 mM MgCl2] three times each. The mixture of beads was then

incubated with 50 µl of kinase buffer containing 100 µM ATP (Pharmacia) and 0.25 µl of

15

[γ-32P]ATP (>4,000 Ci/mmol, ICN Biomedicals) at 30° for 30 min. The reaction was

terminated by the addition of 20 µl of Laemmli sample buffer (BioRad), followed by heat

denaturation. The Fuji BAS2500 phosphorimager was used to detect 32P-labeled proteins

that were then measured using the Image Gauge software (Fujifilm).

Flow cytometry analysis: The cells were fixed in 70% ethanol and stored at 4°. After

washing in 50 mM Na-citrate, they were suspended in 50 mM Na-citrate solution containing

100 µg/ml RNase and 500 ng/ml propidium iodide, incubated at 37° for 2 h, and then

subjected to sonication to resolve cell aggregation (Sonifier 250, Branson). The DNA

content of the cells was measured using the FACScan system with the CellQuest software

(Becton Dickinson).

16

RESULTS

At their respective semipermissive temperatures, the orp1-4 and sna41-928 mutants

exhibit HU hypersensitivity in the absence of Chk1, a DNA damage checkpoint kinase:

Orc1 is required solely for replication initiation, while Cdc45 is required for both initiation

and elongation. To examine the relationship between replication initiation and elongation

and the response to replication elongation block, we used the orc1/orp1-4 and

cdc45/sna41-928 mutants. To demonstrate that DNA synthesis is partially defective in these

mutants at their respective semipermissive temperatures, the TK and hENT genes were

integrated into the yeast genome, allowing the incorporation of a heavy thymidine analog,

BrdU, into the synthesized DNA. TK converts exogenous thymidine to thymidine

monoposphate, which then enters the yeast pathway of thymidine triphosphate formation

(HODSON et al. 2003; MCNEIL and FRIESEN 1981). hENT is a membrane protein that

facilitates the diffusion of nucleosides down their concentration gradients (GRIFFITHS et al.

1997). Synchronous cultures in the G2 phase were obtained by centrifugal elutriation and

divided into two equal aliquots. To ensure that DNA synthesis occurred only around the

17

origin, HU, which is a specific inhibitor of ribonucleotide reductase, was added to both

aliquots. BrdU was added to one aliquot to a final concentration of 100 µM. After 3-h

incubation in the presence of HU, DNA was extracted and separated on CsCl density

gradients. The fragment of interest in the gradients was determined by slot blot hybridization

using the ARS and non-ARS fragments as probes (Figure 1A). BrdU incorporation into the

ARS region was evident by its shift from the light to the heavy position (Figure 1B, upper

panel). As expected, the non-ARS region showed essentially the same profile in the presence

or absence of BrdU (Figure 1B, lower panel). At 28°, 47% and 29% of the ARS region

shifted to the heavy position in the wild-type and orp1 mutant strains, respectively (Figure

1C). At 30°, the efficiency of BrdU incorporation was reduced in the sna41 mutant

compared to that of the wild-type strain (Figure 1D). These results demonstrate that DNA

replication is partially defective in the orp1-4 and sna41-928 mutants at 28° and 30°,

respectively.

To study the effect of defective replication on the response to replication elongation block,

we examined the HU sensitivity of the orp1 and sna41 mutants by a serial dilution test with

18

logarithmically growing cells (Figure 2). Since DNA damage checkpoint pathway is

activated and functions as a backup system to maintain cell viability when the replication

fork that is stalled by HU treatment is collapsed (BODDY et al. 1998; LINDSAY et al. 1998),

we carried out the HU sensitivity test in the presence or absence of Chk1. Although the orp1

mutant exhibited similar sensitivity as the wild-type strain, the orp1 chk1∆ mutant exhibited

higher sensitivity than the chk1∆ mutant at 25° and 28° (Figure 2A). The sna41 mutant also

exhibited HU hypersensitivity at 30° in the absence of Chk1 (Figure 2B). The enhancement

of HU sensitivity by the elimination of Chk1 was observed in the cds1∆ mutant (Figure 2B),

suggesting that the orp1 and sna41 mutants have defects in the Cds1 pathway. The

temperature sensitivity of the orp1 and sna41 mutants was also enhanced by a chk1 deletion,

and this underlines the importance of Chk1 in replication-deficient cells (Figure 2, data not

shown).

Activation of Cds1, a replication checkpoint kinase, is partially defective in the

orp1-4 and sna41-928 mutants: To determine whether the orp1 and sna41 mutations, at

their respective semipermissive temperatures, affect the activation of the Cds1 pathway, we

19

examined the Cds1 kinase activity that is induced by HU treatment. Cell extracts of the

wild-type, orp1, and cds1∆ mutant strains were prepared before and after HU treatment at

28°, and an in vitro kinase assay was performed in the presence of [γ-32P]ATP and

bacteria-expressed GST-Wee170 as the substrate (Figure 3A & B). In the wild-type strain,

approximately 10-fold Wee1 phosphorylation induction was observed after HU treatment.

In the cds1∆ mutant, almost no Wee1 phosphorylation was observed (Figure 3A), indicating

that in this assay, Wee1 phosphorylation depends on Cds1. Wee1 phosphorylation in the

presence of HU was lower in the orp1 mutant than in the wild-type strain. Quantification of

the phosphorimager signal revealed that the Cds1 kinase activity was slightly but

significantly decreased in the orp1 mutant (Figure 3B). Further, Wee1 phosphorylation at

30° was also lower in the sna41 mutant than in the wild-type strain (Figure 3C & D). These

results are consistent with the notion that normal replication is required for full activation of

the replication checkpoint kinase (see DISCUSSION).

The HU sensitivity of the mrc1 mutant is suppressed by the sna41-928 mutation but

not by the orp1-4 mutation: To explore the genetic relationship between the orp1-4 and

20

sna41-928 mutations and the replication checkpoint mutations, a series of double mutants

were constructed and examined for their sensitivity to HU (Figure 4). We observed that both

the orp1 and the sna41 mutations suppressed the HU sensitivity of cds1∆ cells (Figure 4A &

B). It is possible that a reduction in the number of replication forks can partially alleviate the

problem that occurs in the absence of Cds1 (see Discussion).

In addition to its role in Cds1 activation, Mrc1 is required to prevent the uncoupling of the

replication machinery from DNA synthesis. Contrary to the case of cds1∆ cells, mrc1∆ cells

did not exhibit suppressed HU sensitivity due to the orp1 mutation (Figure 4A). However,

the sna41 mutation specifically suppressed the HU sensitivity of mrc1∆ cells (Figure 4B).

To confirm that the sna41 mutation is a bona fide cause of the HU sensitivity suppression in

mrc1∆ cells, we introduced an empty vector (p.vector) and a plasmid containing the sna41+

or the mrc1+ gene (p.sna41 and p.mrc1, respectively) into yeast cells, and examined the HU

sensitivity. Figure 4C shows that sna41 mrc1∆ cells harboring p.sna41 exhibit higher

sensitivity than those harboring p.vector or p.mrc1. Importantly, p.sna41 did not affect the

HU sensitivity of mrc1∆ cells as well as the wild-type and sna41 cells (Figure 4C, data not

21

shown). These results imply that a mutation of Cdc45 specifically suppresses the HU

sensitivity of the mrc1∆ mutant.

A time course analysis using an acute dose of HU revealed the efficient suppression of the

HU sensitivity of mrc1∆ cells by the sna41 mutation at 30°. Figure 5A shows that mrc1∆

cells are less sensitive than cds1∆ cells and that within the time course, the sensitivity of

mrc1∆ cells is almost entirely suppressed by the sna41 mutation. At the 6-h time point, the

relative viability of mrc1∆ cells was 2.6 ± 0.9%, while that of sna41 mrc1∆ cells was 118 ±

33%. Given the observation that the HU sensitivity of mrc1∆ cells was efficiently

suppressed by the sna41 mutation, it is possible that the sna41 mutation increases Cds1

activity in mrc1∆ cells. To test this, we performed an in vitro kinase assay to measure the

Cds1 activity in the mrc1∆, sna41 mrc1∆, and wild-type strains grown at 30° (Figure 5B &

C). We observed that the Cds1 kinase activity was equally low in mrc1∆ and sna41 mrc1∆

cells. Thus, it appears that the sna41 mutation suppresses the HU sensitivity but not the

defective Cds1 activation of mrc1∆ cells. It is also noted that there is a residual activation of

Cds1 kinase even in the absence of Mrc1, consistent with the different HU sensitivity in

22

mrc1∆ and cds1∆ cells (Figure 5A). These results suggest that there are Mrc1-dependent and

Mrc1-independent pathways for Cds1 activation.

The sna41-928 mutation alleviates the defect in recovery from replication block in the

mrc1 mutant: Mrc1 as well as Cds1 is required for recovery from the replication block that

is induced by HU treatment. To examine the recovery, logarithmically growing cells of the

wild-type, mrc1∆, sna41, and sna41 mrc1∆ strains were treated with an acute dose of HU for

3 h to block replication, washed with distilled water, and released into HU-free medium to

allow them to resume cell cycle progression; the DNA content of the cells was then

monitored by FACS analysis (Figure 6A). The wild-type and sna41 cells showed essentially

the same phenotype; the DNA content reached 2C from 1C by 60 min after release. In

contrast, the DNA content of mrc1∆ cells increased very slowly, indicating that Mrc1 is

required for recovery from replication block. However, the FACS profile of sna41 mrc1∆

cells was similar to those of the wild-type and sna41 cells than that of mrc1∆ cells (Figure 6A,

see 40 and 60 min). Recovery from the replication block was also examined by staining the

cells with DAPI and counting the number of binucleate cells (Figure 6B). With the wild-type

23

and sna41 strains, binucleate cells started accumulating at 80 min after release and reached a

peak at 100 min. With the mrc1∆ strain, no accumulation of binucleate cells was apparent.

However, with the sna41 mrc1∆ strain, binucleate cells were accumulated although later than

the wild-type and sna41 strains. In summary, these results show that the sna41 mutation

alleviates the defect in recovery from replication block in the mrc1∆ mutant.

Mutations in the MCM helicase can also suppress the HU sensitivity of the mrc1

mutant: Given that the MCM helicase as well as Cdc45 is essential for both initiation and

elongation phases of replication and that there are genetic and physical interactions between

them (MASUDA et al. 2003; MIYAKE and YAMASHITA 1998; YAMADA et al. 2004; ZOU and

STILLMAN 1998), mutations in MCM might also suppress the HU sensitivity of the mrc1∆

mutant. To test this possibility, we constructed a series of double mutants and examined their

sensitivity to HU (Figure 7). We first examined mutant alleles of the Mcm2 subunit of the

Mcm2-7 complex. A temperature-sensitive mutation of Mcm2, cdc19-P1 (FORSBURG and

NURSE 1994), suppressed the HU sensitivity of both mrc1∆ and cds1∆ cells at 25° (Figure

7A). However, a cold-sensitive mutation of Mcm2, nda1-367 (MIYAKE et al. 1993),

24

suppressed the HU sensitivity of cds1∆ but not mrc1∆ cells at 33°(Figure 7B). These results

demonstrate that the HU sensitivity of mrc1∆ cells is suppressed by a mutation of Mcm2 in

an allele-dependent manner.

Another subunit of the MCM complex, Mcm5, was examined. It was observed that a

cold-sensitive mutation of Mcm5, nda4-108 (MIYAKE et al. 1993), suppressed the HU

sensitivity of mrc1∆ as well as cds1∆ cells at 35° (Figure 7C). It was confirmed that the nda4

mutation is a bona fide cause of the suppression in mrc1∆ cells, by comparison of the HU

sensitivity of nda4 mrc1∆ transformants harboring an empty vector or the plasmid containing

the nda4+ gene (p.vector and p.nda4, respectively) (Figure 7D). As was seen in the case of

sna41-928 (Figure 5A), the nda4 mutation efficiently suppressed the HU sensitivity of

mrc1∆ cells in a time course analysis using an acute dose of HU (Figure 7E). Thus, it appears

that the HU sensitivity of mrc1∆ cells can be suppressed not only by a mutation of Cdc45 but

also by specific mutations of the MCM helicase.

25

DISCUSSION

Throughout the cell cycle, the ORC binds replication origins and is required exclusively

for replication initiation. In contrast, the Cdc45 protein is essential to both the initiation and

elongation phases of replication. To examine the relationship between initiation and

elongation defects and the response to replication elongation block, we used the

temperature-sensitive fission yeast mutants of Orc1 and Cdc45, i.e., orp1-4 and sna41-928,

respectively. We observed that at their respective semipermissive temperatures, the extent of

BrdU incorporation was lower in orp1 and sna41 cells than in the wild-type cells. At the

same temperatures, orp1 or sna41 cells exhibited HU hypersensitivity in the absence of Chk1

kinase and were partially defective in the HU-induced activation of Cds1 kinase. While the

HU sensitivity of the cds1∆ mutant was partially suppressed either by the orp1 or sna41

mutation, the sensitivity of the mrc1∆ mutant was specifically suppressed by the sna41

mutation.

Roles of Orc1 and Cdc45 in the activation of the replication checkpoint: To monitor

the replication efficiency of orp1-4 and sna41-928 cells at their respective semipermissive

26

temperatures, we examined the incorporation of the thymine analog BrdU into genomic

DNA, and observed that it was lower in the orp1 and sna41 cells than in the wild-type cells.

It is likely that the initiation of replication is defective in the orp1 mutant, while both

initiation and elongation are defective in the sna41 mutant. At the same temperatures, the

orp1 and sna41 cells exhibited HU hypersensitivity in the absence of Chk1. A synergetic

enhancement of HU sensitivity is observed between the cds1 and chk1 mutants (BODDY et al.

1998; this study). Cds1 and Chk1 checkpoint kinases are involved in the replication and

DNA damage checkpoint pathways, respectively. In the absence of Cds1, at least a fraction

of the stalled forks is converted into aberrant DNA structures (e.g., double-strand breaks) that

in turn induce the Chk1 pathway. Thus, the enhancement of HU sensitivity by a chk1

deletion that is observed in the orp1 and sna41 mutants suggests that these mutants have a

defect in the Cds1 pathway. In fact, the HU-induced activation of Cds1 kinase is partially

impaired in the orp1 and sna41 mutants. Since the orp1 and sna41 mutants show HU

hypersensitivity only in the absence of Chk1, the reduced activity of Cds1 kinase might be

slightly insufficient for all the replication forks, and/or it could not arrest cell-cycle

27

progression sufficiently without the aid of Chk1 kinase. These results are consistent with the

notion that normal replication is required for full activation of the replication checkpoint

mechanism. It is possible that the number of replication forks is reduced in the replication

mutant, and this accounts for the defect in checkpoint activation, as was proposed in budding

yeasts (LEE et al. 2003; SHIMADA et al. 2002; TERCERO et al. 2003). Recently, using

Xenopus egg extracts, it has been shown that even after DNA synthesis is inhibited, the

MCM helicase together with Cdc45 continues a certain extent of DNA unwinding to generate

single-stranded DNA, which is important for checkpoint activation (BYUN et al. 2005; ZOU

and ELLEDGE 2003). Thus, it is also possible that at its semipermissive temperature, the

replication elongation mutant is partially defective in the formation of a single-stranded

region that is sufficiently long for checkpoint activation. These two possibilities are not

mutually exclusive, and we consider that both hold true for the sna41 mutant, as discussed

below.

A mutation of either Orc1 or Cdc45 suppresses the HU sensitivity of the cds1 mutant:

The serial dilution test revealed that the sna41-928 mutation partially suppresses the HU

28

sensitivity of the cds1∆ mutant. Since the orp1-4 mutation also suppresses the HU

sensitivity of cds1∆, it appears that a decrease in the number of replication forks can alleviate

the defect in cds1∆. It is possible that the protein factor that is required for the stability of

stalled forks is limited in a cell, and its activation by Cds1 is essential for a number of stalled

forks in wild-type cells. Alternatively, Cds1 might be required for the coordinated

processing of neighboring forks, since a decrease in the number of replication forks can lead

to an increase in the distance between the forks. Further studies are required to address these

possibilities.

A mutation of Cdc45 but not Orc1 suppresses the HU sensitivity of the mrc1 mutant:

The HU sensitivity of the mrc1∆ mutant was suppressed by the sna41-928 mutation but not

by the orp1-4 mutation. This specific suppression by the sna41 mutation suggests that a

defect in the elongation phase of replication accounts for the suppression of HU sensitivity in

mrc1∆ cells. A time course experiment using an acute dose of HU revealed that mrc1∆ cells

are less sensitive than cds1∆ cells and that the sensitivity of mrc1∆ cells is almost entirely

suppressed by sna41. When replication is blocked by HU, Mrc1 is required to activate Cds1

29

and prevent the uncoupling of the replication machinery from DNA synthesis (KATOU et al.

2003; TANAKA and RUSSELL 2001). The Cds1 activation defect in mrc1∆ cells does not

appear to be suppressed by sna41 since the in vitro activity of Cds1 kinase was similarly low

in the mrc1∆ and sna41 mrc1∆ cells. However, the resumption of DNA synthesis and cell

cycle progression in mrc1∆ cells after release from HU arrest was facilitated by the sna41

mutation. Thus, it is likely that the role of Mrc1 in the prevention of uncoupling is related to

Cdc45.

Mutations in the MCM helicase suppress the HU sensitivity of the mrc1 mutant in an

allele-specific manner: We found that the HU sensitivity of mrc1∆ cells can be suppressed

not only by a mutation of Cdc45 but also by mutations of the MCM helicase. Mutations of

the Mcm2 subunit of MCM suppress the HU sensitivity of mrc1∆ cells in an allele-dependent

manner; the cdc19-P1 but not the nda1-376 mutation of Mcm2 suppresses the HU sensitivity

of mrc1∆ cells. However, at the same temperatures, the HU sensitivity of cds1∆ cells is

suppressed either by the cdc19 or the nda1 mutation, indicating that both mutations cause

some defect under the experimental conditions. It has been shown that the nda1 mutation

30

causes an accumulation of cells with a 1C DNA content at a restrictive temperature

(FORSBURG and NURSE 1994). Chromatin binding of MCM is impaired in nda1 as well as

orc1/orp1-4 cells at their restrictive temperatures (YAMADA et al. 2004), indicating that

replication initiation is defective in nda1 cells. The initiation defect in nda1 cells may

account for the HU sensitivity suppression of cds1∆ cells, as was discussed for the

orc1/orp1-4 case (see above). Inability of the nda1 mutation to suppress the HU sensitivity

of mrc1∆ cells suggests that some specific defect in the elongation may be required for the

suppression. Contrary to the nda1 mutation, the cdc19 mutation does not accumulate cells

with a 1C DNA content at a restrictive temperature (FORSBURG and NURSE 1994), suggesting

that cdc19 causes a defect in an elongation phase of replication. The cdc19 mutation

decreases expression levels of Mcm2 and impairs interaction between MCM subunits even at

a nonrestrictive temperature of 25° (SHERMAN et al. 1998), the temperature at which the HU

sensitivity of mrc1∆ cells is suppressed by cdc19 (this study). Thus, the unstable replication

machinery formed in cdc19 cells, that may cause defects in both initiation and elongation

phases of replication, could account for the suppression of both cds1∆ and mrc1∆ cells.

31

In addition to a mutation of Mcm2, we found that a mutation of Mcm5, nda4-108, also

suppresses the HU sensitivity of mrc1∆ and cds1∆ cells. Amino acid residues conserved

among the orthologs from different organisms are altered by sna41-928 (A410T), nda4-108

(R50C), cdc19-P1 (P257L and T272I) mutations (FORSBURG et al. 1997; YAMADA et al.

2004), suggesting that conserved functions of Cdc45 and MCM are affected by these

mutations. Interestingly, there is an intimate relationship between the nda4-108 and the

sna41-928 mutations. sna41-928 is originally identified as one of the Cdc45 mutations that

can suppress the cold-sensitive growth defect of nda4-108 cells (MIYAKE and YAMASHITA

1998; YAMADA et al. 2004). In both nda4 and sna41 cells at their restrictive temperatures,

association of Cdc45 to replication origins is severely impaired although MCM as well as

another replication factor, Sld3, is loaded and accumulated on the origin (YAMADA et al.

2004). In addition, in nda4 cells at a restrictive temperature, physical interaction between

MCM and Cdc45 proteins detected in wild-type cells is disrupted while the MCM complex

appears to be intact, and the cold-sensitivity of nda4 is partially alleviated by overexpression

of the wild-type sna41+ gene. Given these observations, it seems plausible that, even at the

32

semipermissive temperature, the association between Mcm5 and Cdc45 may be partially

impaired in nda4 and sna41 cells. Collectively, the MCM complex integrity and/or its

association to Cdc45 appear to be impaired in the mutants that can suppress the HU

sensitivity of mrc1∆ cells. Our findings provide genetic evidence for that Mrc1 negatively

regulates the replication machinery containing Cdc45 and the MCM helicase for the recovery

from replication block.

33

ACKNOWLEDGEMENTS

We are grateful to Drs. Mitsuhiro Yanagida, Paul Russell, Katsunori Tanaka, Paul Nurse,

Teresa Wang, Ayumu Yamamoto, Kunihiro Ohta, and Katsuhiko Shirahige for providing

strains, plasmids, and antibodies. We also thank Sanae Miyake and Shigeru Yamashita for

sharing their unpublished results, and the members of our laboratory for helpful discussions.

This work was supported by a Grant-in-Aid for Cancer Research from the Ministry of

Education, Science, Technology, Sports and Culture of Japan and by funding from the

Sumitomo Foundation and the Naito Foundation awarded to T.N.

34

LITERATURE CITED

ALCASABAS, A. A., A. J. OSBORN, J. BACHANT, F. HU, P. J. WERLER et al., 2001 Mrc1

transduces signals of DNA replication stress to activate Rad53. Nat. Cell Biol. 3:

958-965.

ALFA, C., P. FANTES, J. HYAMS, M. MCLEOD and E. WARBRICK, 1993 Experiments with

Fission Yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

APARICIO, O. M., D. M. WEINSTEIN and S. P. BELL, 1997 Components and dynamics of

DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and

Cdc45p during S phase. Cell 91: 59-69.

BAHLER, J., J. Q. WU, M. S. LONGTINE, N. G. SHAH, A. MCKENZIE, 3RD et al., 1998

Heterologous modules for efficient and versatile PCR-based gene targeting in

Schizosaccharomyces pombe. Yeast 14: 943-951.

BELL, S. P., and A. DUTTA, 2002 DNA replication in eukaryotic cells. Annu. Rev. Biochem.

71: 333-374.

35

BODDY, M. N., B. FURNARI, O. MONDESERT and P. RUSSELL, 1998 Replication checkpoint

enforced by kinases Cds1 and Chk1. Science 280: 909-912.

BODDY, M. N., A. LOPEZ-GIRONA, P. SHANAHAN, H. INTERTHAL, W. D. HEYER et al., 2000

Damage tolerance protein Mus81 associates with the FHA1 domain of checkpoint

kinase Cds1. Mol. Cell Biol. 20: 8758-8766.

BODDY, M. N., P. SHANAHAN, W. H. MCDONALD, A. LOPEZ-GIRONA, E. NOGUCHI et al.,

2003 Replication checkpoint kinase Cds1 regulates recombinational repair protein

Rad60. Mol. Cell Biol. 23: 5939-5946.

BRANZEI, D., and M. FOIANI, 2005 The DNA damage response during DNA replication. Curr.

Opin. Cell Biol. 17: 568-575.

BYUN, T. S., M. PACEK, M. C. YEE, J. C. WALTER and K. A. CIMPRICH, 2005 Functional

uncoupling of MCM helicase and DNA polymerase activities activates the

ATR-dependent checkpoint. Genes Dev. 19: 1040-1052.

36

CALZADA, A., B. HODGSON, M. KANEMAKI, A. BUENO and K. LABIB, 2005 Molecular

anatomy and regulation of a stable replisome at a paused eukaryotic DNA replication

fork. Genes Dev. 19: 1905-1919.

CAPASSO, H., C. PALERMO, S. WAN, H. RAO, U. P. JOHN et al., 2002 Phosphorylation

activates Chk1 and is required for checkpoint-mediated cell cycle arrest. J. Cell Sci.

115: 4555-4564.

CARR, A. M., 2002 DNA structure dependent checkpoints as regulators of DNA repair. DNA

Repair 1: 983-994.

CASPARI, T., J. M. MURRAY and A. M. CARR, 2002 Cdc2-cyclin B kinase activity links Crb2

and Rqh1-topoisomerase III. Genes Dev. 16: 1195-1208.

CHONG, J. P., M. K. HAYASHI, M. N. SIMON, R. M. XU and B. STILLMAN, 2000 A

double-hexamer archaeal minichromosome maintenance protein is an

ATP-dependent DNA helicase. Proc. Natl. Acad. Sci. USA 97: 1530-1535.

FORSBURG, S. L., and P. NURSE, 1994 The fission yeast cdc19+ gene encodes a member of

the MCM family of replication proteins. J. Cell Sci. 107: 2779-2788.

37

FORSBURG, S. L., D. A. SHERMAN, S. OTTILIE, J. R. YASUDA and J. A. HODSON, 1997

Mutational analysis of Cdc19p, a Schizosaccharomyces pombe MCM protein.

Genetics 147: 1025-1041.

FURNARI, B., A. BLASINA, M. N. BODDY, C. H. MCGOWAN and P. RUSSELL, 1999 Cdc25

inhibited in vivo and in vitro by checkpoint kinases Cds1 and Chk1. Mol. Biol. Cell

10: 833-845.

GRIFFITHS, M., N. BEAUMONT, S. Y. YAO, M. SUNDARAM, C. E. BOUMAH et al., 1997

Cloning of a human nucleoside transporter implicated in the cellular uptake of

adenosine and chemotherapeutic drugs. Nat. Med. 3: 89-93.

HARRIS, S., C. KEMPLEN, T. CASPARI, C. CHAN, H. D. LINDSAY et al., 2003 Delineating the

position of rad4+/cut5+ within the DNA-structure checkpoint pathways in

Schizosaccharomyces pombe. J. Cell Sci. 116: 3519-3529.

HARTWELL, L. H., and T. A. WEINERT, 1989 Checkpoints: controls that ensure the order of

cell cycle events. Science 246: 629-634.

38

HODSON, J. A., J. M. BAILIS and S. L. FORSBURG, 2003 Efficient labeling of fission yeast

Schizosaccharomyces pombe with thymidine and BUdR. Nucleic Acids Res. 31:

e134.

HUANG, M., Z. ZHOU and S. J. ELLEDGE, 1998 The DNA replication and damage checkpoint

pathways induce transcription by inhibition of the Crt1 repressor. Cell 94: 595-605.

ISHIMI, Y., 1997 A DNA helicase activity is associated with an MCM4, -6, and -7 protein

complex. J. Biol. Chem. 272: 24508-24513.

IVESSA, A. S., B. A. LENZMEIER, J. B. BESSLER, L. K. GOUDSOUZIAN, S. L. SCHNAKENBERG

et al., 2003 The Saccharomyces cerevisiae helicase Rrm3p facilitates replication past

nonhistone protein-DNA complexes. Mol. Cell 12: 1525-1536.

KAI, M., M. N. BODDY, P. RUSSELL and T. S. WANG, 2005 Replication checkpoint kinase

Cds1 regulates Mus81 to preserve genome integrity during replication stress. Genes

Dev. 19: 919-932.

39

KATOU, Y., Y. KANOH, M. BANDO, H. NOGUCHI, H. TANAKA et al., 2003 S-phase checkpoint

proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature 424:

1078-1083.

KELMAN, Z., J. K. LEE and J. HURWITZ, 1999 The single minichromosome maintenance

protein of Methanobacterium thermoautotrophicum ∆H contains DNA helicase

activity. Proc. Natl. Acad. Sci. USA 96: 14783-14788.

LABIB, K., J. A. TERCERO and J. F. DIFFLEY, 2000 Uninterrupted MCM2-7 function required

for DNA replication fork progression. Science 288: 1643-1647.

LEE, J., A. KUMAGAI and W. G. DUNPHY, 2003 Claspin, a Chk1-regulatory protein, monitors

DNA replication on chromatin independently of RPA, ATR, and Rad17. Mol. Cell

11: 329-340.

LEI, M., and B. K. TYE, 2001 Initiating DNA synthesis: from recruiting to activating the

MCM complex. J. Cell Sci. 114: 1447-1454.

40

LINDSAY, H. D., D. J. GRIFFITHS, R. J. EDWARDS, P. U. CHRISTENSEN, J. M. MURRAY et al.,

1998 S-phase-specific activation of Cds1 kinase defines a subpathway of the

checkpoint response in Schizosaccharomyces pombe. Genes Dev. 12: 382-395.

LOPEZ-GIRONA, A., K. TANAKA, X. B. CHEN, B. A. BABER, C. H. MCGOWAN et al., 2001

Serine-345 is required for Rad3-dependent phosphorylation and function of

checkpoint kinase Chk1 in fission yeast. Proc. Natl. Acad. Sci. USA 98:

11289-11294.

MARTINHO, R. G., H. D. LINDSAY, G. FLAGGS, A. J. DEMAGGIO, M. F. HOEKSTRA et al.,

1998 Analysis of Rad3 and Chk1 protein kinases defines different checkpoint

responses. EMBO J. 17: 7239-7249.

MASUDA, T., S. MIMURA and H. TAKISAWA, 2003 CDK- and Cdc45-dependent priming of

the MCM complex on chromatin during S-phase in Xenopus egg extracts: possible

activation of MCM helicase by association with Cdc45. Genes Cells 8: 145-161.

MCNEIL, J. B., and J. D. FRIESEN, 1981 Expression of the Herpes simplex virus thymidine

kinase gene in Saccharomyces cerevisiae. Mol. Gen. Genet. 184: 386-393.

41

MIYAKE, S., N. OKISHIO, I. SAMEJIMA, Y. HIRAOKA, T. TODA et al., 1993 Fission yeast genes

nda1+ and nda4+, mutations of which lead to S-phase block, chromatin alteration and

Ca2+ suppression, are members of the CDC46/MCM2 family. Mol. Biol. Cell 4:

1003-1015.

MIYAKE, S., and S. YAMASHITA, 1998 Identification of sna41 gene, which is the suppressor

of nda4 mutation and is involved in DNA replication in Schizosaccharomyces pombe.

Genes Cells 3: 157-166.

MURAKAMI, H., and H. OKAYAMA, 1995 A kinase from fission yeast responsible for

blocking mitosis in S phase. Nature 374: 817-819.

NEDELCHEVA, M. N., A. ROGUEV, L. B. DOLAPCHIEV, A. SHEVCHENKO, H. B. TASKOV et al.,

2005 Uncoupling of unwinding from DNA synthesis implies regulation of MCM

helicase by Tof1/Mrc1/Csm3 checkpoint complex. J. Mol. Biol. 347: 509-521.

NYBERG, K. A., R. J. MICHELSON, C. W. PUTNAM and T. A. WEINERT, 2002 TOWARD

MAINTAINING THE GENOME: DNA Damage and Replication Checkpoints.

Annu. Rev. Genet. 36: 617-656.

42

OKUNO, Y., T. OKAZAKI and H. MASUKATA, 1997 Identification of a predominant

replication origin in fission yeast. Nucleic Acids Res. 25: 530-537.

RALEIGH, J. M., and M. J. O'CONNELL, 2000 The G(2) DNA damage checkpoint targets both

Wee1 and Cdc25. J. Cell Sci. 113: 1727-1736.

RHIND, N., B. FURNARI and P. RUSSELL, 1997 Cdc2 tyrosine phosphorylation is required for

the DNA damage checkpoint in fission yeast. Genes Dev. 11: 504-511.

SAKA, Y., F. ESASHI, T. MATSUSAKA, S. MOCHIDA and M. YANAGIDA, 1997 Damage and

replication checkpoint control in fission yeast is ensured by interactions of Crb2, a

protein with BRCT motif, with Cut5 and Chk1. Genes Dev. 11: 3387-3400.

SHERMAN, D. A., S. G. PASION and S. L. FORSBURG, 1998 Multiple domains of fission yeast

Cdc19p (MCM2) are required for its association with the core MCM complex. Mol.

Biol. Cell 9: 1833-1845.

SHIMADA, K., P. PASERO and S. M. GASSER, 2002 ORC and the intra-S-phase checkpoint: a

threshold regulates Rad53p activation in S phase. Genes Dev. 16: 3236-3252.

43

SOGO, J. M., M. LOPES and M. FOIANI, 2002 Fork reversal and ssDNA accumulation at

stalled replication forks owing to checkpoint defects. Science 297: 599-602.

TANAKA, K., and P. RUSSELL, 2001 Mrc1 channels the DNA replication arrest signal to

checkpoint kinase Cds1. Nat. Cell Biol. 3: 966-972.

TERCERO, J. A., K. LABIB and J. F. DIFFLEY, 2000 DNA synthesis at individual replication

forks requires the essential initiation factor Cdc45p. EMBO J. 19: 2082-2093.

TERCERO, J. A., M. P. LONGHESE and J. F. DIFFLEY, 2003 A central role for DNA replication

forks in checkpoint activation and response. Mol. Cell 11: 1323-1336.

TYE, B. K., 1999 MCM proteins in DNA replication. Annu. Rev. Biochem. 68: 649-686.

WALTER, J., and J. NEWPORT, 2000 Initiation of eukaryotic DNA replication: origin

unwinding and sequential chromatin association of Cdc45, RPA, and DNA

polymerase α. Mol. Cell 5: 617-627.

WALWORTH, N. C., and R. BERNARDS, 1996 rad-dependent response of the chk1-encoded

protein kinase at the DNA damage checkpoint. Science 271: 353-356.

44

YAMADA, Y., T. NAKAGAWA and H. MASUKATA, 2004 A novel intermediate in initiation

complex assembly for fission yeast DNA replication. Mol. Biol. Cell 15: 3740-3750.

YOU, Z., Y. KOMAMURA and Y. ISHIMI, 1999 Biochemical analysis of the intrinsic

Mcm4-Mcm6-Mcm7 DNA helicase activity. Mol. Cell Biol. 19: 8003-8015.

ZHAO, H., and P. RUSSELL, 2004 DNA binding domain in the replication checkpoint protein

Mrc1 of Schizosaccharomyces pombe. J. Biol. Chem. 279: 53023-53027.

ZHOU, B. B., and J. BARTEK, 2004 Targeting the checkpoint kinases: chemosensitization

versus chemoprotection. Nat. Rev. Cancer 4: 216-225.

ZOU, L., and S. J. ELLEDGE, 2003 Sensing DNA damage through ATRIP recognition of

RPA-ssDNA complexes. Science 300: 1542-1548.

ZOU, L., and B. STILLMAN, 1998 Formation of a preinitiation complex by S-phase cyclin

CDK-dependent loading of Cdc45p onto chromatin. Science 280: 593-596.

45

TABLES

Table 1. Fission yeast strains used in this study.

Strain Genotype

TNF34 h-

TNF938 h-, orp1-4

HM328 h-, sna41-928

TNF344 h-, nda4-108

HM259 h-, nda1-376

TNF909 h-, cdc19-P1

HM350 h-, chk1::ura4+

TNF256 h-, cds1::kanMX6

TNF264 h-, mrc1::kanMX6

TNF1215 h-, orp1-4, chk1::ura4+

TNF947 h-, orp1-4, mrc1::kanMX6

TNF941 h-, orp1-4, cds1::kanMX6

TNF326 h-, sna41-928, chk1::ura4+

TNF293 h-, sna41-928, mrc1::kanMX6

TNF283 h-, sna41-928, cds1::kanMX6

TNF355 h-, nda4-108, mrc1::kanMX6

NNF103 h-, nda4-108, cds1::kanMX6

TNF912 h-, nda1-376, mrc1::kanMX6

TNF916 h-, nda1-376, cds1::kanMX6

TNF929 h-, cdc19-P1, mrc1::kanMX6

TNF899 h-, cdc19-P1, cds1::kanMX6

TNF351 h-, cds1::kanMX6, chk1::ura4+

TNF370 h-, mrc1::kanMX6, leu1-32

TNF1848 h-, sna41-928, mrc1::kanMX6, leu1-32

TNF374 h-, nda4-108, mrc1::kanMX6, leu1-32

TNF1055 h-, ade6+:(adh1)p-hENT, ura4+:(adh1)p-TK

TNF1079 h-, ade6+:(adh1)p-hENT, ura4+:(adh1)p-TK, orp1-4

TNF1065 h-, ade6+:(adh1)p-hENT, ura4+:(adh1)p-TK, sna41-928

46

FIGURE LEGENDS

FIGURE 1.–––BrdU incorporation in the orp1-4 and sna41-928 mutants. BrdU

incorporation followed by density gradient fractionation was carried out to measure the

replication efficiency. (A) Positions of the ars2004 and ars2005 replication origins on

chromosome II are indicated as open boxes. Positions of the ARS and non-ARS regions used

as hybridization probes are indicated as filled boxes. (B) Slot blot analysis to detect the ARS

(top panel) and non-ARS (bottom panel) region in the wild-type strain (TNF1055) at 28°.

The fraction number of the CsCl density gradient is indicated at the bottom of the lower panel.

(C) BrdU incorporation in the ARS region in wild-type and orp1 (TNF1079) cells at 28°. (D)

BrdU incorporation in the ARS region in wild-type and sna41 (TNF1065) cells at 30°. The

percentage of the total DNA in each fraction in the absence (–BrdU, open circles) or presence

(+BrdU, closed circles) of BrdU is indicated. The proportion of the dark gray area to the total

gray area (dark and light gray) is indicated. Essentially, no BrdU incorporation was observed

in the non-ARS region ((B), data not shown).

47

FIGURE 2.–––HU sensitivity of the orp1-4 and sna41-928 mutants. (A) Serial dilution

assay to examine the HU sensitivity of the wild-type (TNF34), chk1∆ (HM350), orp1

(TNF938), and orp1 chk1∆ (TNF1215) strains at 25° and 28°. (B) Serial dilution assay to

examine the HU sensitivity of the wild-type, chk1∆, sna41 (HM328), sna41 chk1∆ (TNF326),

cds1∆ (TNF256), and cds1∆ chk1∆ (TNF351) strains at 30°. Log-phase cultures in EMM

medium were serially diluted 10 fold with distilled water and plated onto YE medium

supplemented with 2 mM HU. The plates were incubated at the temperature indicated above

each panel.

FIGURE 3.–––Cds1 kinase activity in the orp1-4 and sna41-928 mutants. (A)

Exponentially growing wild-type (TNF34), orp1 (TNF938), and cds1∆ (TNF256) cells in

EMM medium were treated with 10 mM HU for 0, 3, or 4 h at 28°. GST-Wee170 was

expressed in E. coli and affinity purified using glutathione Sepharose 4B. Then, 1.5 mg of

the total extract prepared from yeast cells and GST-Wee170 beads were mixed and subjected

to kinase reactions with [γ-32P]ATP to probe the phosphorylated proteins (see Materials &

Methods). Reaction products were separated on 12% SDS-PAGE (29:1), the phosphorylated

48

proteins were detected using a phosphorimager (upper panel, 32P), and the GST-Wee170 was

visualized by Coomassie Brilliant Blue staining (lower panel, Coomassie). (B) Relative

amount of phosphorylated Wee1 in the wild-type, orp1, and cds1∆ cells at 28°. (C) Cds1

kinase activity was measured using wild-type, sna41 (HM328), and cds1∆ cells as in (A),

except the temperature used was 30°. (D) Relative amount of phosphorylated Wee1 in the

wild-type, sna41, and cds1∆ cells at 30°. The value is the mean of two independent

experiments, and the error bar shows the standard deviation.

FIGURE 4.–––Suppression of the HU sensitivity of the replication checkpoint mutants by

the orp1-4 or sna41-928 mutation. Effect of the orp1-4 (A) and sna41-928 (B) mutations on

the HU sensitivity of the mrc1∆ and cds1∆ mutants was examined. HU sensitivity of the

isogenic wild-type (TNF34), orp1 (TNF938), sna41 (HM328), mrc1∆ (TNF264), cds1∆

(TNF256), orp1 mrc1∆ (TNF947), orp1 cds1∆ (TNF941), sna41 mrc1∆ (TNF293), and

sna41 cds1∆ (TNF283) strains was examined by a 10-fold serial dilution assay. (C) The

mrc1∆ leu1 (TNF370) and sna41 mrc1∆ leu1 (TNF1848) transformants harboring the vector

plasmid (p.vector; p940XB), which comprised the LEU2 gene of S. cerevisiae and ars2004

49

(OKUNO et al. 1997), or the plasmid containing the sna41+ gene (p.sna41; pTN520) or the

mrc1+ gene (p.mrc1; pTN521) were grown to log phase in EMM, 10-fold serially diluted, and

spotted onto EMM plates supplemented with HU. The HU concentration and the incubation

temperature are indicated above each panel.

FIGURE 5.–––The sna41-928 mutation does not suppress the mrc1 defect in Cds1

activation. (A) Time course analysis of the HU sensitivity. Exponentially growing cells of

the wild-type (TNF34), sna41 (HM328), mrc1∆ (TNF264), cds1∆ (TNF256), sna41 mrc1∆

(TNF293), and sna41 cds1∆ (TNF283) strains that were grown at 30° in EMM medium were

treated with an acute dose of HU (10 mM). Aliquots of the cells were collected at the

indicated time point, appropriately diluted with distilled water, and plated on YE medium.

The viability corresponding to the 0-h time point is indicated. The value is the mean of three

independent experiments, and the error bar shows the standard deviation. (B) Exponentially

growing mrc1∆, sna41 mrc1∆, and cds1∆ cells in EMM medium were treated with 10 mM

HU for 0, 3, or 4 h at 30°. Using the cell extracts, phosphorylation of GST-Wee170 was

50

examined as depicted in Figure 3. (C) Relative amount of phosphorylated Wee1 in mrc1∆,

sna41 mrc1∆, and cds1∆ cells.

FIGURE 6.–––The sna41-928 mutation suppresses the defect in recovery from HU arrest

in the mrc1∆ mutant. Exponentially growing cells of the wild-type (TNF34), sna41

(HM328), mrc1∆ (TNF264), and sna41 mrc1∆ (TNF293) strains in EMM medium were

treated with 10 mM HU for 3 h at 30°, washed with distilled water, and then released into

HU-free YE medium. Culture aliquots of 1 ml were collected at the indicated time points and

stored at 4° in 70% ethanol. (A) Flow cytometry analysis of the DNA content of the cells

after release from HU arrest. Black histograms represent the DNA content at the indicated

time points, and gray histograms represent that at the 0-h time point. (B) Percentage of

binucleate cells indicative of passage through mitosis. At each time point, at least 200 cells

were examined by microscopy, and the cells containing two DAPI-stained bodies were

counted.

FIGURE 7.–––Mutations in the MCM helicase suppress the HU sensitivity of the

replication checkpoint mutants. (A) HU sensitivity of the isogenic wild-type (TNF34),

51

cdc19 (TNF909), mrc1∆ (TNF264), cds1∆ (TNF256), cdc19 mrc1∆ (TNF929), and cdc19

cds1∆ (TNF899) strains was examined by a 10-fold serial dilution test. (B) HU sensitivity of

the isogenic wild-type, nda1 (HM259), mrc1∆, cds1∆, nda1 mrc1∆ (TNF912), and nda1

cds1∆ (TNF916) strains was examined. (C) HU sensitivity of the isogenic wild-type, nda4

(TNF344), mrc1∆, cds1∆, nda4 mrc1∆ (TNF355), and nda4 cds1∆ (NNF103) strains was

examined. The HU concentration and the incubation temperature are indicated above each

panel. (D) The nda4 mrc1∆ leu1 (TNF374) transformants harboring the vector plasmid

(p.vector: pXN289) or the plasmid containing the nda4+ gene (p.nda4; pTN774) were grown

to log-phase in EMM at 35°, serially diluted 10 fold, and spotted onto EMM plates

supplemented with 6 mM HU. (E) Exponentially growing cells in EMM medium at 35° were

treated with an acute dose of HU (12.5 mM). Aliquots of cells were collected at the indicated

time points, appropriately diluted with distilled water, and plated on YE medium. The

viability corresponding to the 0-h time point is indicated. The value is the mean of three

independent experiments, and the error bar shows the standard deviation.