Upload
samuel-spencer
View
219
Download
1
Tags:
Embed Size (px)
Citation preview
Recognizing and Intervening with Recognizing and Intervening with Intimate Partner Violence Intimate Partner Violence
Patricia Janssen, BSN, MPH, PhD,
UBC Dept of Health Care and Epidemiology,
Child and Family Research Institute.
Intimate Partner Violence
Any act of violence that results in or is likely to result in physical, sexual or psychological harm or suffering, including threats of such acts, coercion or arbitrary deprivation of liberty, whether occurring in public or in private life.
United Nations 1993 Declaration on the Elimination of Violence
Measuring Violence against Women Statistics Canada, 2006• Women are more likely than men to be the victims of
the most severe forms of spousal assault, spousal homicide, sexual assault, and criminal harassment (stalking)
• Men are twice as likely to be charged with spousal homicide as women.
• Female victims of spousal violence are more likely than males to report being injured, experience multiple assaults, and fear for their lives.
• Among female victims of spousal assault, 40%, stated that their children witnessed the assault.
The Myth
Idyllic, tranquil and non-violent lifestyles
The Reality: Challenges in Rural Communities• Distant from traditional resources
• Fewer local resources (shelters, legal advocacy)
• Women require transportation to leave
• Alienation through membership in a minority group
• Lack of anonymity
Rural vs. Urban Provider PerceptionsEastman, J Interpersonal Violence 2007;22:465.
• Addressing multiple health and social issues
• Social and cultural barriers to accessing agency help
• Religious/cultural beliefs and family pressure promote staying in the relationship
• Access to employment, housing means leaving the area
• Lack of complimentary services
• Catchment area is too large
Providers also find that they are challenged to:
• Stay in touch with current literature on prevention and intervention
• Be aware of other innovative programs
• Stay safe
Prevalence, Impact, Prevalence, Impact, EtiologyEtiology
Prevalence of Intimate Partner AbusePrevalence of Intimate Partner Abuse
Setting (Author) Sample Acute Lifetime
US, 1995 (Abbot) 648 11.7% 54.2%
US, 1998 (Dearwater) 3455 2.2% 36.9%
UK, 2004 (Boyle) 256 1% 22.4%
UK, 2004 (Sethi) 198 1% 34.8%
Canada, 1996 (Hayden) 243 9% 45%
Canada, 2004 (Cox) 983 2% 51%
Australia, 1995, (Bates) 401 1.7% 25%
Australia, 1996 (Roberts) 1.223 2% 15.5%
Children who Witness
• Prevalence estimates range from 16-25%
• 20% meet criteria for PTSD ( Mertin et al, 2002)
• 60-75% are physically abused (Osofsky, review)
• Clinical behavioral problems more common in
26- 75% ( 8 studies)
Longitudinal Effect of Intimate Partner Abuse on High-Risk Behavior Among Adolescents (11-22 yrs) Roberts et al.Arch Pediatr Adolesc Med 2003
• IPV – 273/2236 males (12.2%) - 302/2206 females (13.7%)
• Abuse by an intimate partner precedes involvement in:– illicit substance use– antisocial behavior– violent behavior– suicidal behavior – depression
• Controlled for SES, # partners, baseline risk behavior, prior abuse.
Janssen et al, 2003
Adjusted RRs
Lipskey et al, 2003
Adj Odds Ratio
Kady et al, 2005
Adj Odds Ratio Antepartum Hemorrhage
3.79 (1.38-10.4)
1.8 (1.4-2.5)
Preterm Delivery
1.35 (0.67-2.56)
1.27 (0.48-3.37)
2.4 (1.8-3.3)
< 32 weeks 2.83 (0.94-8.50) IUGR 3.06 (1.02-9.14) Low birth weight
3.51 (1.27-9.72)
1.7 (1.5-1.9)
Perinatal Death
8.06 (1.42-45.63)
8.0 (4.6-14.3)
Neonatal Death
7.28 (1.28-42.3)
Physical Abuse and Adverse Fetal/Neonatal OutcomesPhysical Abuse and Adverse Fetal/Neonatal Outcomes
Why?
• Learned by witnessing violence
• Cultural belief in a status that is central and deserving. Without empathy
• Effective means of maintaining control
• Failure of the criminal justice system to make the perpetrator accountable by charging and prosecuting
• Genetics: Nr2e1, MaoA.
Genetics of Aggressive Behaviour: Monoamine System Analyses
James L. Kennedy MD FRCPCHead, Neurogenetics Section,
Centre for Addiction and Mental Health;I’Anson Professor of Psychiatry and Medical Science, University of Toronto
& J Beitchman, S Ehtesham, H Mik, D Bender, G Subramanian
Serotonin Transporter Gene Structure
5
VNTR
3AP1
SP1 AP1
SP1
AP2
TATA
Exon I XIV
44 bp
ins / del
aaaaaaagaataaaacatgcagcccccccagcatataaatgca
II
5HTTLPR
NB 5HTTLPR is functional: l/l assoc. with 2x expression than l/s or s/s
Level of Callous-Unemotional Traits in aggressive children vs 5HTT VNTR genotype
12/12 10/12 10/10
Sheard M, et al.
1976
Effect of Lithium on Aggressionin Prison Inmates
DrugFree
DrugFree
Medication
Months
Mea
n In
frac
t ions
Per
Mon
th
1 2 3 4 50.0
0.1
0.2
0.3
0.4
0.5
0.6
Risk Risk FactorsFactors
Perpetrator•Age (younger)•Less than high school education•Unemployed•Use of alcohol•Non visible minority•Non immigrant
Victim•Age (younger)•Non visible minority•Non immigrant •Aboriginal •Use of alcohol, tobacco, llicit drugs (consequence)
Presentation in the Emergency RoomPresentation in the Emergency Room
Characteristics of Visits
• Delay between time of injury and time of seeking help
• Injuries are inconsistent with explanation
• Repeat visits – frequency and severity increases
• Over protective partner, family or friend
• Explanation is changing, vague or non-specific
Presentation in the Emergency RoomPresentation in the Emergency Room
Characteristics of Injuries
• Often bilateral
• Patterned
• Proximal (abdomen, face upper torso)
• Multiple – in various stages of healing
• Defensive – hands, forearms
Chronic IllnessChronic Illness
• Frequent headaches, especially migraines
• Gastrointestinal symptoms
• Chest pain, heart palpitations
• Dizziness, numbness, tingling of extremities
• Gynecological disorders
• non-specific pain
• pelvic inflammatory disease
• sexually transmitted disease
• Pregnancy loss
BINDING
DISENGAGING
RECOVERING
ENDURING
Entrapment and Entrapment and RecoveryRecovery
AssessmentAssessmentAnd DocumentationAnd Documentation
Are people willing to be Are people willing to be asked?asked? Bacchus, BJOG 2002
• Yes, if safe, confidential, health professional is trained, empathic, and non-judgmental. (Qualitative design)
Rodriguez, J Fam Pract 2001
• Yes, if direct (qualitative)
Friedman, Arch Intern Med 1992• Routine inquiry favoured by 78% of primary care patients;
90% believed physician could help (Survey)
McNutt, L. JAMWA, 1999• 88% of shelter residents advocated routine screening
Will they act on offers of help?Will they act on offers of help?
Kresnoff, M. Injury Prevention, 2002• Among 528 women identified as intimate partner victims in emergency
departments, 84% agreed to see an advocate and 54% of those accepted case management. Among these, 50% remained free after 6 weeks.
For patient's nurse to complete prior to discharge. Please ask to spend a few minutes alone with your patient. If you need a translator, please do not use a family member.
Please see reverse for Chinese translation, Punjabi and Vietnamese versions are in the domestic violence binders in the modules.
Introduction:As health care providers we know that family violence affects women’s
health. Because of the widespread problem of family violence, it is routine in this hospital to ask everyone these questions.
Question:Since you've been pregnant, have you been hit, slapped, kicked or
otherwise physically hurt by an intimate partner? Yes ____ No ____
Have you been afraid of a current or former intimate partner during your pregnancy?
Yes ____ No ____
Prior to your pregnancy, was your partner hurting you ?Yes ____ No ____
making you afraid?Yes ____ No ____
*************************************************************1. Provide safety planning if any answer is "yes". 2. Refer to a social worker if women would like one. (Guidelines for
referral to social workers are located in the Domestic Violence Binder in every module.)
3. Offer her a community resources card. (in patient bathrooms, Chinese cards in Domestic Violence Binders).
4. Document above interventions(1- 3) in progress notes.
Asking and Responding:
• Gentle, directThe injuries you have suggest to me that someone has hit you. Did someone hit you?
• Non-blaming, non-judgmentalWe know that violence is common in the home; we ask everyone who comes here about it
• Don’t press for disclosure
• Express belief in what she is sayingI am sorry that happened to you
• SupportIt is not your faultNo one deserves abuseI know it takes a lot of courage to tell me this
• Empower Would you like help with this problem today
Documentation:
• Who was present during the interview or examination
• Presenting problem
• Details in patient’s words of how injuries occurred
• Injury – type, location, length width, shape, colour depth, degree of healing, swelling
• Psychological demeanor
• Body diagram
Documentation:
• Laboratory and diagnostic tests
• Clothing
• Medical treatment
• How physical evidence was collected and stored
• Photos – with permission (2 sets)•Use scale or ruler•Sign and date•Name and hospital ID number on picture
• Referrals and follow-up plans
Knowledge – Session IKnowledge – Session I
• Prevalence• Cycle of abuse• Myths and Facts• Stages of Leaving• Health Effects• Didactic, lecture style
Persuasion – Session IIPersuasion – Session II
• How to ask the question
• How to respond• Referrals and
resources• Small groups, video,
storytelling, disclosure
Classroom Training:
• Improves knowledge
• Changes attitudes
• Does not increase likelihood of assessment
• Does not increase documentation (Harwell, Am J Prev Med, 1998, Fenslow, Aust NZ J Public Health,
1999, Thompson, Am J Prev Med, 2000, Campbell, Academic Emerg
Med, 2001, McCauley, Academic Medicine, 2003, Gerber, BioMed
Central, 2003)
Janssen P, Landolt M, Grunfeld A. Assessing for Domestic Violence Exposure in Primary Care Settings: The Transition from Classroom to Clinical Practice. Journal of Interpersonal Violence, 2003;18:623-33.
“Domestic violence was unrelated to the chief complaint”
“Didn’t feel it was my role to discuss this issue with the patient”
“Did not have time to raise the issue”
“Did not feel that sufficient rapport with the patient had been established”
“Was unable to see the patient in privacy”
Model the changeModel the change
• Observing assessment
• Practicing with feedback
• Documentation of outcome
• Discussion with colleagues
Confirming Change:Confirming Change:
• Orientation for new staff• Competency assessment• Performance appraisal• Policy and Procedure• Support Systems in place for staff
Janssen P, Basso M, Costanzo R. Exposure to Domestic Violence among Obstetrical Nurses, Women’s Health Issues, 1998:8:317-323.
Presently or in the past, with current or previous partners:
1. emotional abuse2. physical force3. afraid of partner4. controlled by partner5. sexual activities you were uncomfortable with
38.1%38.1%
InterventionInterventionKeeping Keeping
Women SafeWomen Safe
A Little Contact Makes
A Big Difference
One night at a shelter significantly decreased abuse with or without 10-wk advocacy program.
Sullivan et al, 1999
Safety Planning
Help her make a plan for the next time:
•Who will she call?•Where can she go?•Emergency bag outside the house
• Cash, credit card, driver’s license, passports, birth certificate, immigration papers, care card, phone numbers, care keys and gas
• Copy of protective orders, custody papers
• Take the children•Stay between him and the door•Hide weapons
McFarlane et al. An Intervention to Increase Safety Behaviors of Abused Women Nurs Res 2002;51:347-345
DesignRCT SettingTexas, n = 150, women seeking protection orders
ProtocolSix 10 min phone sessions on safety planning vs. usual care. Menu of 15 safety behaviors discussed
Safety Behavior Adoption Over 8-wks
10.4
11.5
12.6
13.2
13.6 13.713.9
10
11
12
13
14
INTAK
E48
HR
1WK
2WK
3WK
5WK
8WK
SAFETY BEHAVIORS OVER 18-MONTHS
10.4
12.5
12 11.9 12
9.69.9
10.410.6 10.5
9
10
11
12
13
INTAK
E
3-M
OS
6-M
OS
12-M
OS
18-M
OS
NU
MB
ER
OF
BE
HA
VIO
RS
RX
NORX
McFarlane et al. Nursing Research, 2006
DesignRCT SettingTexas, N = 360, English and Spanish-speaking women attending primary care clinics
ProtocolNurse case manager: 20 minute session on safety behaviors, support, and listeningResource card vs. Screening and resource card
Results at six months
Safety behaviors Sig. more safety behaviors for case management group, p =.03
Threats and assault Lower for both groups, p<.001(10 threats less, 12 assaults less)
Danger for lethal assault Lower for both groups p<.001
Law Enforcement
• Restraining orders– Understudied– Gives responsibility to police– Women know how to reach police– Women can initiate
but– Attracts attention in a small community– 25-30% of victims report
Health Worker’s Role
• These are usually complex cases• There are no easy answers• Focus on safety• Be willing to talk about the relationship • Have low expectations for dramatic change• Urge small steps towards a healthier, more
balanced life
A successful intervention means you have
•Acknowledged the problem
•Validated the victim’s experience
•Stated that they are not to blame
•Assessed safety needs
•Asked about safety of children
•Offered help
•Documented
A small community:• Can bring people
together
• Make changes more
quickly
• Measure the problem
and evaluate change
• Address social norms
• Build cultural identity
• Target resources
Who can help with prevention ? The teacher
The veterinarianThe local newspaperThe dentistThe community centreThe churchThe neighbourThe taxi driverThe bus driverThe landlordThe social assistance
worker
In addition to the nurse, doctor and police officer,,,,
Formal Measures
1. Public awareness and leadership2. Education (especially youth):
• Conflict resolution• Substance abuse• Identity• Skill training
3. Health care• Assessment • Safety Planning and Referral
4. Law enforcement• Coordinate crisis intervention• Remove perpetrator
5. Municipal• Emergency/transition housing• Emergency transportation• Emergency funds