Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
1
RATIONAL DESIGN OF LIVE ATTENUATED
VACCINE BY SITE-DIRECTED MUTAGENESIS
AND DELETION IN THE 5’-NON CODING REGION
OF THE ENTEROVIRUS 71 (EV-A71) GENOME
ISABEL YEE PINN TSIN
B.Sc (Honours) (Biochemistry), National University of
Singapore
A THESIS SUBMITTED FOR THE MASTERS OF
SCIENCE IN LIFE SCIENCES
FACULTY OF SCIENCE AND TECHNOLOGY
SUNWAY UNIVERSITY
AUG, 2015
2
ORIGINAL LITERARY WORK DECLARATION
Name of candidate: Isabel Yee Pinn Tsin (I.C No: 810918-14-5858)
Name of Degree: Masters of Science in Life Sciences
Title of Project Paper/Research Report/Dissertation/Thesis (“this Work”):
Rational design of live attenuated vaccine by site-directed mutagenesis and deletion
in the 5’-non coding region of the Enterovirus 71 (EV-A71) genome.
Field of Study: Molecular Virology
I do solemnly and sincerely declare that:
(1) I am the sole author/writer of this Work;
(2) This Work is original;
(3) Any use of any work in which copyright exists was done by way of fair dealing and
for permitted purposes and any excerpt or extract from, or reference to or reproduction
of any copyright work has been disclosed expressly and sufficiently and the title of the
Work and its authorship have been acknowledged in this Work;
(4) I do not have any actual knowledge nor ought I reasonably to know that the making
of this work constitutes an infringement of any copyright work;
(5) I hereby assign all and every rights in the copyright to this Work to Sunway
University (SU), who henceforth shall be owner of the copyright in this Work and that
any reproduction or use in any form or by any means whatsoever is prohibited without
the written consent of SU having been first had and obtained;
(6) I am fully aware that if in the course of making this Work I have infringed any
copyright whether intentionally or otherwise, I may be subject to legal action or any
other action as may be determined by SU.
Candidate’s signature Date
Subscribed and solemnly declared before,
Witness’s Signature Date
Name:
Designation:
3
ABSTRACT
The Hand, Foot and Mouth Disease is caused by a group of Enteroviruses such
as Enterovirus 71 (EV-A71) and Coxsackievirus CV-A6, CV-A10, and CV-A16. Mild
symptoms of EV-A71 infection in children range from high fever, vomiting, rashes and
ulcers in mouth, commonly affecting children and infants. EV-A71 can produce more
severe symptoms such as brainstem and cerebellar encephalitis, leading up to
cardiopulmonary failure and death. The lack of vaccines and antiviral drugs against EV-
A71 highlights the urgency of developing preventive and treatment agents against EV-
A71 to prevent further fatalities. The molecular basis of virulence in EV-A71 is still
uncertain. It remains to be investigated if there is a universal molecular determinant
present in every EV-A71 fatal strain or whether every fatal strain differs in virulence
determinant depending on their sub-genotype. In this study, genetically modified EV-
A71 virus was constructed by substituting nucleotides at positions 158, 475, 486, and
487 based on the neurovirulence of poliovirus Sabin strains 1, 2 and 3. The single
nucleotide difference between the fatal strain 41 (5865/Sin/000009) and the non-fatal
strain (strain 10) was investigated to see if it is responsible for neurovirulence by
introducing a nucleotide substitution (Guanine) at position 5262 in the EV-A71 strain 41
genome. Another mutant strain was also constructed through partial deletion of the 5’-
NTR region in the EV-A71 genome. The virulence of the mutated EV-A71 strains were
evaluated in Rhabdomyosarcoma cell culture by plaque assays, tissue culture infectious
dose (TCID50) determinations, real time Reverse-Transcriptase Polymerase Chain
Reaction (RT-PCR) and production of VP1. It was observed that mutants 475 and the
partial deletant (deletion from nt. 475-485 in the 5’NTR) had minimal cytopathic effects
as compared to mutants 158, 486, and 5262 when transfected with RD cells. This was
4
consistent with the RT-PCR results that showed the viral RNA copy number for mutants
475, 487 and partial deletant (5’NTR) to be of lowest amount when RNA was extracted
from transfected RD cells. The partial deletant (PD) may be the most stable mutant
genetically as it demonstrated high immunogenicity (neutralizing titre of 1:32) and low
pathogenicity and hence, could be a good potential LAV candidate for further studies. In
addition, intraperitoneal administration of the heat-inactivated EV-A71 mutants 158,
475, 486, 487, 5262 and PD and the homologous EV-A71 whole virion in the murine
model triggered both cellular and humoral immune response.
The data collectively indicated that every fatal EV-A71 strain differs in virulence
determinant depending on their sub-genotype. Differences in nucleotide substitutions in
the various mutants were reflected in the differences observed in immunogenicity based
on the neutralizing titres of mice antisera. Hence, vaccines can be rationally designed to
treat different EV-A71 genotypes and sub-genotypes.
5
ACKNOWLEDGMENTS
I am extremely grateful to God for His strength and guidance amidst trials and
obstacles. I thank Him for helping me handle stressful situations and for multiplying my
time. He is always there beside me even when I am alone in the lab at nights, weekends
or public holidays.
I am truly indebted and express my most heartfelt gratitude to my honourable
supervisor, Prof Poh Chit Laa. Had it not been for her, I would never have embarked
on a Masters by Research. I am extremely appreciative of her wise advice, guidance and
most importantly, for granting me the privilege to be one of her postgraduate students.
She has truly inspired me to greater heights.
My grateful thanks to Dr. Jeff Tan who never fails to ask me about my progress
and imparting more challenging ideas about designing of the vaccine. He has assisted
me with his wise words during difficult times and for that, I am extremely grateful to
him. I have learnt a lot from his valuable constructive feedback and advice.
Special thanks goes to my wonderful husband and kids for their kind
understanding of my long hours spent in the lab, for not being able to spend as much
time at home with them, and for being supportive of my Masters endeavour. I am
grateful to a very hands-on husband who takes such good care of our children when I am
at work.
I am very appreciative of all research assistants and the post-doc for patiently
guiding and teaching me in my experimental work. Without them, I would be finding it
very difficult to complete my project. With their camaraderie and assistance in different
parts of my project, my postgraduate years in the lab have been made more memorable.
6
TABLE OF CONTENTS
Title page i
Original Literary Work Declaration ii
Abstract iii
Acknowledgements v
Table of Contents vi
List of Tables 10
List of Figures 11
Abbreviations 13
CHAPTER 1 LITERATURE REVIEW
1.1 INTRODUCTION
1.1.1 Development of vaccines against viral pathogens 15
1.2 Polio virus vaccines
1.2.1 Inactivated polio vaccine (IPV) 16
1.2.2 Oral polio virus vaccine (OPV) 18
1.2.3 Molecular Determinants of Neurovirulence 19
7
1.3 Enterovirus 71 as an etiological agent of hand, foot, mouth disease
1.3.1 Enterovirus 71 23
1.3.2 Distribution of Enterovirus 71 genotypes and sub-genotypes 30
1.3.3 Development of experimental EV-A71 Vaccines 35
1.3.4 Potential candidates for EV-A71 Vaccine 35
1.3.5 Inactivated EV-A71 Vaccines 49
1.3.6 Immunogenicity of vaccines 54
1.4 Aims of Study 55
CHAPTER 2 MATERIALS AND METHODS
2.1 Cell Culture 60
2.2 Viral infection 60
2.3 RNA Extraction and Reverse Transcription 60
2.4 Cloning of EV-A71 cDNA into pCR-XL-TOPO vector 61
2.5 Site-directed mutagenesis 61
2.6 Storage of transformed E. coli cells containing desired mutations 66
2.7 Partial-deletion in the 5’-NTR of EV-A71 genome 66
8
2.8 Plasmid isolation and purification 67
2.9 Restriction endonuclease digestion of DNA 67
2.10 Phenol-chloroform purification of DNA 67
2.11 Production of infectious EV-A71 RNA from cloned cDNA 68
2.12 Transfection of RD cells with in vitro RNA transcripts 69
2.13 Plaque Assay 69
2.14 Tissue Culture Infectious Dose 50 (TCID50) Assay 70
2.15 Real-Time RT-PCR 70
2.16 EV-A71 VPl Immunoblot 71
2.17 Immunization of mice 72
2.18 EV-A71 neutralization assay 72
2.19 IgG-subtying 73
2.20 Bioinformatics Analysis 73
2.21 Statistical Analysis 74
CHAPTER 3 RESULTS
3.1 Molecular Basis of Pathogenicity 75
3.2 Quantification of Viral RNA Copy Number 85
3.3 Quantitation of virus by tissue culture infectious dose (TCID50) 88
9
3.4 Quantification of virus by the plaque assay 92
3.5 Western Blotting 96
3.6 Neutralization Assay 99
3.7 IgG isotyping 108
CHAPTER 4 DISCUSSION 113
CHAPTER 5 CONCLUSION 122
REFERENCES 124
APPENDICES 137
PUBLICATIONS 148
10
LIST OF TABLES
TABLE 1.1 Clinical manifestations of enteroviruses.
TABLE 1.2 Distribution of EV-A71 genotypes throughout the world from 1997 to
2010.
TABLE 1.3 Five EV-A71 inactivated vaccines at different clinical phases of
development.
TABLE 1.4 Common genetic determinants between EV-A71 and Sabin polio strains.
TABLE 2.1 Primers used for site-directed mutagenesis.
TABLE 3.1 Tissue Culture Infectious Dose 50 (TCID50) Assay.
TABLE 3.2 Neutralizing antibody titers elicited by EV-A71 Mutants and heat
inactivated EV-A71 strain 41 in mice.
11
LIST OF FIGURES
FIG 1.1 Process overview for preparation of trivalent IPV
FIG 1.2 Structure and genome of Poliovirus
FIG 1.3 Three genotypes of Poliovirus Sabin vaccine strains
FIG 1.4 Structure and genome of Enterovirus 71
FIG 1.5 Vesicles on the foot, mouth and palm area of children infected with
hand, foot and mouth disease (HFMD).
FIG 1.6 Phylogenetic tree of the VP1 region of EV-A71 strains detected in
various countries, showing different genotypes and sub-genotypes of EV-
A71.
FIG 1.7 Differences of nucleotide between the B4 genotype fatal strain and the
non-fatal strain 10.
FIG 1.8 A single nucleotide change from Cytosine to Uridine at position 158 in
Stem Loop II of 5’-NTR contributes to virulence of EV-A71 in mice.
FIG 1.9 Predicted RNA secondary structure of EV-A71 strain 41 from nt. 474 to
541.
FIG 2.1 Schematic illustration of EV-A71 cDNA clone in pCR-XL-TOPO.
FIG 2.2 Schematic representation of the Site-Directed Mutagenesis (SDM) steps.
FIG 3.1 Cytopathic effects (CPE) caused by the mutant EV-A71 (A158T) in
Rhabdomyosarcoma (RD) cells in comparison with uninfected RD cells
(negative control using Opti-MEM) and EV-A71 strain 41 infected RD
cells (positive control).
FIG 3.2 Infection of RD cells by the mutant EV-A71 (C475T) in RD cells in
comparison with uninfected RD cells (negative control using Opti-MEM)
and EV-A71 strain 41 infected RD cells (positive control).
FIG 3.3 CPE caused by the mutant EV-A71 (A486G) in RD cells in comparison
with uninfected RD cells (negative control using Opti-MEM) and EV-
A71 strain 41 infected RD cells (positive control).
FIG 3.4 CPE caused by the mutant EV-A71 (G487A) in RD cells in comparison
with uninfected RD cells (negative control using Opti-MEM) and EV-
A71 strain 41 infected RD cells (positive control).
12
FIG 3.5 Infection of RD cells by the mutant EV-A71 (A5262G) in RD cells in
comparison with uninfected RD cells (negative control using Opti-MEM)
and EV-A71 strain 41 infected RD cells (positive control).
FIG 3.6 Infection of RD cells by the mutant EV-A71 (Partial Deletant 5’-NTR) in
RD cells in comparison with uninfected RD cells (negative control using
Opti-MEM) and EV-A71 strain 41 infected RD cells (positive control).
FIG 3.7 Quantification of Viral RNA Copy Number.
FIG 3.8 Schematic diagram of the TCID50 assay for enumerating EV-A71 viruses.
FIG 3.9 Quantification of plaque forming units by EV-A71 mutants and the wild
type EV-A71 strain 41
FIG 3.10 Plaque Forming Units by EV-A71 mutants and the wild type EV-A71
strain 41.
FIG 3.11 Western blot analysis using monoclonal antibody against VP1 as the
primary antibody.
FIG 3.12 In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with heat-inactivated EV-A71 strain 41.
FIG 3.13 In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with EV-A71 mutant A158T.
FIG 3.14 In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with EV-A71 mutant C475T.
FIG 3.15 In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with EV-A71 mutant A486G.
FIG 3.16 In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with EV-A71 mutant G487A.
FIG 3.17 In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with EV-A71 mutant A5262G
FIG 3.18 In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with EV-A71 mutant PD
FIG 3.19 IgG1 and igG2 responses elicited by EV-A71 Mutants and Controls.
FIG 3.20 IgG3, IgA and IgM responses elicited by EV-A71 Mutants and Controls.
13
ABBREVIATIONS
3D three-dimensional
Bp base pair
BSA bovine serum albumin
CVB Coxsackievirus B
cDNA complementary DNA
CV-A16 Coxsackie type A16
CPE cytopathic effect
DNA deoxyribonucleic acid
dNTP deoxynucleotide triphosphate
HFMD hand, foot, mouth disease
HIV Human Immunodeficiency virus
kb kilobase
kDa kilodaltons
Km kanamycin
LB Luria broth
NCBI National Center for Biotechnology Information
Nt nucleotide
NtAb neutralizing antibodies
NTR Non translated region
ORF open reading frame
14
OPV oral poliovirus vaccine
PAGE polyacrylamide gel electrophoresis
PCR polymerase chain reaction
PFU plaque forming unit
PV1 Poliovirus type 1
PSGL-1 P-selectin glycoprotein ligand-1
RNA ribonucleic acid
RDDP RNA-dependent DNA polymerase
RDRP RNA-dependent RNA polymerase
RNase ribonuclease
Rpm revolutions per minute
RT reverse transcription
SCARB2 scavenger receptor class B subfamily
SDM site-directed mutagenesis
SDS sodium dodecyl sulfate
TCID50 50% tissue culture infectious dose
UV ultraviolet
VDPVs vaccine-derived polioviruses
VLP virus-like particle
wt wild type
3DPol 3D Polymerase
15
CHAPTER 1
LITERATURE REVIEW
1.1 Introduction
1.1.1 Development of vaccines against viral pathogens
Vaccination for various viral diseases has markedly reduced mortality and
morbidity worldwide for more than 200 years. Indeed, the greatest public health success
can be attributed to vaccination. Nevertheless, the future is abound with challenges as
there remains many diseases that do not yet have effective vaccines such as HIV/AIDS,
Ebola, Hepatitis C, and the Hand, Foot, Mouth (HFMD) disease. Every year, two new
species of viruses are added into the list of approximately 200 different infectious
viruses (Small and Hildegund, 2012). In addition, some viruses particularly RNA viruses
can emerge as new pathogens as they have high mutation rates due to their error-prone
RNA dependent RNA polymerase. The existing viruses can evolve to become more
virulent through recombinations or mutations and the mutated strains also do not have
any effective vaccines against them.
Currently, there are only an estimated 15 vaccines to combat the 200 viruses
known to infect man (Small and Hildegund, 2012). Although there are more vaccines
undergoing clinical trials, it is worrying to note that humans remain vulnerable to the
existing 180 or so viruses that have no effective vaccines. Therefore, increased studies
are required in the development of new and better vaccines, whereby high efficacy,
long-lasting immunity, minimal risk in vaccinees, safe and easy production, low cost,
16
dispensing the need for refrigeration and convenient delivery are the major goals in their
design.
1.2 Polio virus vaccines
1.2.1 Inactivated polio vaccine
Poliovirus (PV) is the etiological agent of poliomyelitis and belongs to
Enterovirus species C within the Picornaviridae family. Poliomyelitis was a public
health scare in the 1950s, even in countries with the best health systems and hygiene
practises in place. This thereby led to the raising of funds to support research in the
development of a polio vaccine. The Inactivated Polio Vaccine (IPV) was the first
poliovirus vaccine to be licensed in 1955. IPV was developed in 1952 by Dr Jonas Salk
and was prepared by formalin-inactivation of three wild-type virulent strains which are
the Mahoney (type 1), MEF-1 (type 2) and Saukett (type 3) (Salk et al., 1954). The
United States started using the IPV that had such high efficacy that other countries
around the world started to follow suit. This initiated the global polio eradication
worldwide (Chumakov and Ehrenfeld, 2008).
Although IPV is considered safe, there is a risk of exposure to the wild type
strain during the manufacturing process. Figure 1.1 shows the manufacturing process for
the IPV. During monovalent bulk preparation, Vero cells were expanded using two pre-
culture steps and cell culture followed by virus culture. The PV was purified using
normal flow filtration for clarification, tangential flow filtration for concentration and
followed by two chromatography steps, involving size exclusion and ion exchange
chromatography. Purified virus was inactivated using formaldehyde.
17
Figure 1.1: Process overview for preparation of trivalent IPV. Monovalent bulks are
prepared for each poliovirus (type 1, 2 and 3) separately (Thomassen et al., 2013).
18
Subsequently, the IPVs were mixed to obtain trivalent bulk prior to formulation and
filling (Thomassen et al., 2013). Due to the need to cultivate large amounts of the live
polio virus which involved complex manufacturing and purification processes, exposure
of workers to the live virus must be safely guarded. At the Cutter Laboratories,
insufficient inactivation of the IPV led to paralysis in almost 200 vacinees and their
contacts (Offit, 2005).
This incident resulted in the temporary halt of the use of IPV and encouraged
research groups worldwide to produce a live attenuated polio vaccine. Although IPV has
an excellent track record on efficacy, it had poor induction of intestinal immunity,
required cold-chain, booster injections and had expensive and potentially dangerous
manufacturing processes with the wild type virulent virus. As such, large-scale clinical
trials were evaluated using several live attenuated PV strains (Melnick and Brennan,
1959).
1.2.2 Oral polio virus vaccine
The Oral Polio Vaccine (OPV) is an attenuated vaccine which has reduced
worldwide poliomyelitis caused by PV infection. The IPV was the only poliovirus
vaccine available until licensure of the Oral Poliovirus Vaccine (OPV) in 1961-1962
(Kew et al., 2005). There was a need for an OPV then as it is a live attenuated vaccine
which has long-lasting immune response and regular boosters are not needed. One time
oral administration of the OPV was found to provide lifelong protection against
poliomyelitis. Elimination of poliomyelitis in the developing world was achieved mainly
19
through mass vaccination with the OPV despite its ability to revert to the wild type in 1
out of 750,000 vacinees (Kowane et al., 1987).
The OPV was produced by micro-carrier technology and passaging the virus in
primary monkey kidney cells at sub-physiological temperatures generated spontaneous
mutations in the viral genome (Van Wezel, 1967). The mutated strains with low
virulence were selected and used as vaccines. The process was later scaled up by using
750-L bioreactors and replacing tertiary monkey kidney cells with Vero cells
(Thomassen et al., 2013). This has led to successful production of oral polio vaccines
(OPV) which have reduced worldwide poliomyelitis by the mid-1980s.
As such, the World Health Assembly declared in 1988 that polio should be
eradicated by the year 2000, aligned with the success of the small pox eradication
program. However, the eradication deadline was repeatedly postponed and has not been
met till today. This was because there were several countries where polio persistently
remained endemic such as Afghanistan and Pakistan whereby the population remained
resistant to polio immunization or India where OPV had low efficacies due to
overcrowding and poor sanitation (Grassly et al., 2006). Therefore, there is a need to
have a greater understanding of the molecular determinants of neurovirulence in PV to
develop new and better vaccines based on genetic manipulations to render the virus non-
pathogenic, yet containing similar antigenic structures to the wild type polio virus.
1.2.3 Molecular Determinants of Neurovirulence
The molecular determinants of neurovirulence in PV have been determined. The
poliovirus is an enterovirus from the Picornaviridae family. The PV has a 5’ non-
20
translated (NTR) cloverleaf structure and a 3’-poly (A) tail. Domain I is important for
virus replication and domains II-VI encompass the internal ribosome entry site (IRES)
that directs translation of mRNA by internal ribosome binding (Figure 1.2). If there are
mutations in the 5’-NTR, this decreases multiplication efficiency, alters cell tropism and
attenuates virulence (Kew et al., 2005).
There are three attenuated strains being used as OPV: Sabin 1 was derived from
the Mahoney strain, Sabin 2 was derived from the P172 strain and Sabin 3 was derived
from the Leon strain. Identification of the genetic determinants of attenuation of the
Sabin OPV strains has been comprehensively reviewed (Kew et al., 2005). The complete
sequences of the three poliovirus genomes and the development of infectious poliovirus
complementary Deoxyribonucleic Acid (cDNA) clones have led to the systematic
investigations of the critical mutations responsible for the attenuated phenotypes of the
Sabin OPV strains.
From the analysis of nucleotide (nt) sequences present in the three poliovirus
Sabin strains, nucleotide substitutions which were critical in attenuating mutations in the
virulent strains isolated from cerebrospinal fluid were identified. There are 57 nucleotide
substitutions distinguishing the Sabin 1 strain from its parent strain (Nomoto et al.,
1982). Among these nucleotide substitutions, the A480G in the IRES is the most
important determinant of the attenuated phenotype of Sabin 1 (Fig. 1.3). Their study
strongly suggested that nt. 480 influences the formation of a highly ordered structure in
the 5’-NTR that is responsible for neurovirulence (Kawamura et al., 1989). Four other
nucleotide substitutions contributing to the attenuated phenotype were mapped to the
capsid region. There was one in VP4, one in VP3 and two in VP1.
21
Figure 1.2: Structure and genome of Poliovirus. All structural proteins: VP1-VP4 are encoded by the P1 region of the
genome. The P2 and P3 genes encode for seven non-structural proteins: 2A-2C and 3A-3D (Kew, et al., 2005).
22
Figure 1.3: Three genotypes of Poliovirus Sabin vaccine strains. All contain a
determinant of attenuation in the 5’-NTR of ssRNA mutation that reduces viral
replication. They are nt. 480 in Sabin 1, nt. 481 in Sabin 2 and nt. 472 in Sabin 3
(Kawamura et al., 1989).
23
In addition, there was also one substitution that contributed to the temperature-sensitive
phenotype mapped to the 3DPol region (Bouchard & Lam, 1995; Paul et al., 2000).
However, there were only 2 nt. substitutions found in the Sabin 2 strain that
appeared at position 481 within the IRES region and position 2909 within VP1 (Figure
1.3). For Sabin 3, a total of 10 nt. substitutions were found to differ from its parent
strain, but only 3 substitutions appeared to be the main determinants for the attenuated
phenotype (C274U in IRES, C2034U in VP3, and U2493C in VP1) (Westrop et al.,
1989). Sabin 3 strain was also found to be the most genetically unstable of the three
Sabin strains. As a result of the analysis of the molecular determinants of attenuation, in
vitro construction of piconaviruses with reduced-virulence could be performed via the
introduction of mutations in the 5’-NTR to reduce the efficiency of viral replication.
1.3 Enterovirus 71 as an etiological agent of hand, foot, mouth disease
1.3.1 Enterovirus 71
The World Health Organization (WHO) and the scientific community have been
addressing challenges unprecedented in public health posed by Enteroviruses in the post-
poliovirus era. Enteroviruses such as Enterovirus 71 (EV-A71), Coxsackie type A16
(CV-A16) and other enteroviruses causing hand, foot and mouth disease (HFMD) have
led to over 7 million infections, including 2457 fatalities in China from 2008 to 2012
(Xing et al., 2014). However, due to increasing travels and rapid globalization,
outbreaks in other parts of the world have also appeared in other regions in cyclical
epidemics (Bible et al., 2007).
24
Within the family Picornaviridae, the genus Enterovirus comprises 12 species.
The species Enterovirus A consists of 25 serotypes and includes the enteroviruses that
can cause the HFMD are the EV-A71, CV-A16, CV-A5, CV-A6, CV-A8 and CV-A10
(Pallansch and Roos, 2001). Serotypes such as CV-A4 and CV-A5 are more often
associated with herpangina. Five years of virological surveillance in China (2008-2014)
showed that 43.73%, 22.04%, and 34.22% of HFMD cases were due to EV-A71, CV-
A16 and other enteroviruses, respectively (Liu et al., 2015). However, Coxsackie viruses
which are common etiological agents of HMFD do not generally cause neurological or
cardiopulmonary disease but EV-A71 is the main causative of fatal HFMD infections
(Ooi et al., 2010). Of particular interest in this study is EV-A71 as approximately 80-
85% of pathogens isolated from HFMD-related deaths were EV-A71 based on clinical
etiological data (Ho et al., 1999). Table 1.1 summarizes the various clinical symptoms
associated with enteroviral infections.
The EV-A71 virus is classified as Human enterovirus A (HEV-A) species,
belonging to the genus Enterovirus in the family Picornaviridae, together with some
Coxsackie A viruses (Brown, 1995). Surveillance data indicated that EV-A71 and CV-
A16 can co-circulate during HFMD outbreaks and such co-circulation may have
contributed to the genomic recombination between EV-A71 and CV-A16 (Yan et al.,
2012, Yip et al., 2013) which was believed to have led to the emergence of a
recombinant EV-A71 responsible for the large HFMD outbreak in China in 2008 (Zhang
et al., 2010). Phylogenetic analysis suggests that EV-A71 originated from CV-A16 from
as early as 1940 (Tee et al., 2010). EV-A71 isolates of sub-genotypes B3 and C4 had
high sequence homology to CV-A16 at P2 (≥ 81%) and P3 genomic regions (≥ 83%)
25
(Yoke-Fun and Abu Bakar, 2006). Hence, this corroborates surveillance data of possible
inter-typic recombination involving EV-A71 and CV-A16. These recombination events
could have played important roles in the emergence of the various EV-A71 sub-
genotypes.
The EV-A71 virus is a non-enveloped icosahedral viral particle that contains a
single-stranded, positive sense, polyadenylated viral Ribonucleic Acid (RNA) of
approximately 7.4kb (Figure 1.4). The capsid is made up of 60 protomers, each
consisting of 4 polypeptides that comprise the structural proteins, VP1, VP2, VP3 and
VP4. Of all the polypeptides, VP4 is located on the internal side of the capsid while
VP1, VP2 and VP3 are located on the external surface of the EV-A71 virus (SIB Swiss
Institute of Bioinformatics, 2014).
26
Table 1.1 Clinical manifestations of enteroviruses.
Each symptom may potentially be caused by more than one enterovirus (Melnick, 1997).
Enterovirus Serotypes Clinical
Manifestations
Poliovirus 1-3, Echovirus 4, 6, 9, 11, 30; Enterovirus 71
Paralysis
Poliovirus 1-3; CV A2, A4, A7, A9, A10, B1-B6;
Echovirus 1-11, 13 to 23, 25, 27, 28, 30, 31; Enterovirus 71
Aseptic Meningitis
Coxsackievirus A5, A8, A10, A16, Enterovirus 71 Hand, foot and
mouth disease
(HFMD)
Coxsackievirus A2 to A6, A8, A10 Herpangina
Coxsackievirus A24, Enterovirus 70 Acute hemorrhagic
conjunctivitis
Echovirus 2, 6, 9, 19 Encephalitis
Coxsackievirus B1-B5, Enterovirus 71 Meningoencephalitis
Coxsackievirus B3 Pericarditis,
myocarditis
27
Figure 1.4: Structure and genome of Enterovirus 71. The capsid consists of 60
protomers, each consisting of 4 polypeptides that comprise the structural proteins: VP1,
VP2, VP3, and VP4 are encoded by the P1 region of the genome. The P2 and P3 genes
encode for seven non-structural proteins: 2A-2C and 3A-3D. Reproduced from
ViralZone, with permission from Philippe Le Mercier, Swiss Institute of Bioinformatics
(SIB Swiss Institute of Bioinformatics, 2014)
28
The EV-A71 genome comprises a 5’ non-translated region (5’-NTR), a long
open reading frame (ORF) and a short 3’-NTR followed by a polyadenylated (poly A)
tail. The 5’-NTR contains an internal ribosome entry site (IRES) which allows viral
protein translation in a cap-independent manner (Belsham and Sonenberg, 1996). The
ORF is translated into a single large polyprotein of approximately 2100 amino acids (aa)
which is divided into three regions (P1-P3). The polyprotein undergoes a series of
processing events, culminating in the maturation cleavage of the polyprotein which
generates structural and non-structural viral proteins (Toyoda et al., 1986). The four
structural proteins, VP1, VP2, VP3 and VP4, are encoded by the P1 region which
constitutes the virus capsid. Proteins derived from the non-structural P2 (2Apro, 2B, 2BC,
2CATPase) and P3 (3A, 3AB, 3B, 3Cpro, 3CDpro, 3Dpol) regions are most directly involved
in virus replication, structural and biochemical changes which are observed within the
infected cell. (Shen et al., 2008). Non-structural proteins (2A and 3C proteinases) are
responsible for apoptosis of infected cells in vitro (Kuo et al., 2002; Li et al., 2002).
The EV-A71 virus commonly causes the hand, foot and mouth disease (HFMD)
in young children less than 6 years of age. Although EV-A71 started circulating as early
as 1963 in the Netherlands, EV-A71 was first reported to be isolated in 1969 from the
stool specimen of an infant with serious nervous system disease in California (Schmidt
et al., 1974). Mild symptoms of EV-A71 infection in children range from fever (≥
39oC), sore throat, loss of appetite and rash with vesicles on hands, foot and mouth area.
In addition, rupture of the vesicles would lead to ulcers in the throat, mouth and tongue
(Figure 1.5).
29
Figure 1.5: Vesicles on the foot, mouth and palm area of children infected
with hand, foot and mouth disease (HFMD). Adapted from the Dermatologic
Image Database, Department of Dermatology, University of Iowa College of
Medicine, USA, 1996 (Permission granted by University of Iowa).
30
EV-A71 can produce more severe symptoms such as aseptic meningitis, brain
stem encephalitis, acute flaccid paralysis, neurogenic pulmonary edema, delayed
neurodevelopment and reduced cognitive function (Ooi et al., 2010). In 1997, an
outbreak of EV-A71 caused 41 deaths in Sarawak, Malaysia. This was followed by a
large outbreak in Taiwan involving over 100,000 cases which led to 78 fatalities (Lin et
al., 2002). In more recent years, large outbreaks with high fatalities occurred across the
Asia Pacific in countries like Cambodia, Vietnam and China (Zhang, et al., 2009; Thoa,
et al., 2013). For example, 54 out of the 78 HFMD cases in a 2012 outbreak in
Cambodia were highly fatal.
Xing et al. (2014) discovered that between 2008 to 2012, there were 7, 200, 092
probable cases of HFMD reported. Approximately 82,486 patients developed
cardiopulmonary or neurological complications and 1,617 of laboratory confirmed
deaths were associated with EV-A71. In Vietnam, there were 13 deaths out of 49,317
cases of infection (WHO, 2014). Some of these young children died of complications
due to pulmonary edema, while others could not survive brain and spinal cord
inflammations due to virulent genotypes of EV-A71 (Zhang et al., 2010). The lack of
vaccines and antiviral drugs against EV-A71 highlights the urgency and significance of
developing preventive and treatment agents against EV-A71 to prevent further fatalities.
1.3.2 Distribution of EV-A71 genotypes and sub-genotypes worldwide
EV-A71 was found to evolve quickly in the past 15 years and many countries experience
cyclical epidemics (McMinn, 2002). To investigate the genetic variability of various
EV-A71 strains and their associations with outbreaks, the complete cDNA sequence
31
(891bp) encoding the VP1 capsid protein of EV-A71 strains isolated from various
countries over a 30-year period was analysed and the monophylogenetic serotype was
further divided into three distinct genotypes (A, B, C) and 11 sub-genotypes (A, B1-B5,
C1-C5) (Brown et al., 1999). This was reported by Brown and his colleagues (1999) in
the phylogenetic analysis of EV-A71 strains (Figure 1.6). In addition, a separate sub-
genotype B0 was proposed after analysing EV-A71 strains from the Netherlands from
1963 to 1967 (van der Sanden et al., 2009). A new sub-genotype B6 was isolated in
Columbia (AF135899), and another new sub-genotype B7 strain was isolated in Brazil
(AY278249) (Castro et al., 2005).
32
Fig. 1.6: Phylogenetic tree of the VP1 region of EV-A71 strains detected in various
countries, showing different genotypes and sub-genotypes of EV-A71. Eight hundred
and fifty-five nucleotide positions in each VP1 region were included in the analysis. The
tree was constructed by the neighbour joining method and bootstrap values calculated
from 1,000 trees. The scale bar indicates the estimated number of substitutions per 100
nucleotides. EV-A71 strains of potential novel genotype or sub-genotype were
highlighted in gray. GenBank accession numbers are indicated in parentheses (Brown et
al., 1999; Yip et al., 2013)
33
Genotype A contains a single member, the prototype EV-A71 strain BrCr while
genotype B has been expanded to include eight sub-genotypes (B0-B7) consisting of
thousands of strains isolated from 1972 to 2011 in the in the United States, Australia,
Bulgaria, Columbia, Hungary, Japan, Malaysia, Netherlands, Singapore, Taiwan and the
UK. Genotype C is made up of five sub-genotypes (C1-C5) which includes EV-A71
strains isolated from 1986 through to 2010 from Japan, United States, Australia, China,
Canada, Netherlands, France, Hong Kong, Singapore, Taiwan, Thailand, UK, Germany
and Malaysia. Two strains belonging to potential new sub-genotype C6 were isolated in
Taiwan (HM622391 and HM622392) (Figure 1.6). A strain belonging to a new genotype
D was isolated in India (AY179600) (Yip et al., 2013). Within the same sub-genotype,
EV-A71 strains share more than 92% nucleotide sequence identity whereas the
nucleotide sequence identity between the three genotypes ranges from 78% to 83%
(Brown et al., 1999). The EV-A71 strains had 46% amino acid identity with the
polioviral P1 capsid region and 55% with the entire polyprotein (Brown and Pallansch,
1995).
Lee and co-workers (2012) have established that the B and C genotypes were the
common ones circulating throughout the world from 1997 to 2012 (Table 1.2). For
example, EV-A71 outbreaks in Malaysia were caused by different predominant
genotypes occurring in 1998-2000 (C1 and B4), 2002–2003 (C1, B4 and B5) and 2005-
2006 (C1 and B5). In contrast, EV-A71 infections reported from Singapore have been
caused mainly by the B sub-genotypes: B3 (1997-1999), B4 (2000-2003) and B5 (2006-
2008) (Table 1.2) (Chan et al., 2003).
34
Table 1.2: Distribution of EV-A71 genotypes throughout the world from 1997 to 2012.
1997 1998
1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 ‘10 ‘11 ‘12
Malaysia C1,C2,
B3,B4
C1 C1, B4 B4,C1 C1, B4 B5,B4,
C1
B4,
B5
B5,C1 B5
Singapore B3,B4 B3,C1 B3 B4, B5 B4 B4,C1 B5 B5,
C2
Taiwan B3,C2,
C4
B4 B4 B4, C4 B4,C4 B4 C4 C4 C5 B5,C
5
B5,
C4,
C5
B5 C4 C4,
B5
B5
Japan C2,C4,
B3,B4
C2 C2 C2,B4 C2 B4,C2,C4 C4,C1,
B5,B4
C4 C4 C4
China C2 C4 B3,C1,
C4
C1,C4 B4,C4 C1,C2,C4 C2,C4 C4 C2,C4 C2,C4 C2,C
4
A,B5,
C2,
C4
C2,
C4
C2,
C4
C4 C4
Vietnam C1,C4,
C5
Australia C2 B3,C2 B4,C1 B4,C1 C1 C1 C4
Korea C3 C4 C2,
C4
Holland C1,C2 C2 C2 C1 C1, C2 C1,
C2
C1, C2 C1,
C2
C2 C2
United Kingdom
C2 C1, C2 C2 C1 C1 C1 C1 C1 C1,C2 C2 C2
35
However, there are some countries such as China whereby the sub-genotype C4
has been the predominant strain causing fatalities since 1998 based on phylogenetic
analysis. Hence, biopharmaceutical organisations in China have focused on developing
the inactivated vaccine to target the sub-genotype C4. In addition to China, the United
Kingdom (UK) has also experienced infections due to a consistent sub-genotype C1 that
was responsible for periodic outbreaks since 1998. It remains to be investigated if
pharmaceutical companies in the UK will be designing vaccines against sub-genotype
C1.
1.3.3 Development of Experimental EV-A71 Vaccines
There is currently no vaccine against EV-A71 that has been approved by the
United States Food and Drug Administration (FDA) or European Medicines Agency
(EMEA). Formalin-inactivated EV-A71 vaccines are currently being developed against
the C4 sub-genotype in China (Li et al., 2014). Although some research groups have
proposed that the sub-genotype C4 should be classified as genotype D (Chan et al.,
2010), there is increasing evidence that C4 should instead be further subdivided into C4a
and C4b (Xu, et al., 2013). Each genotype has approximately 15% genetic divergence
from each other, while each sub-genotype differs genetically from each other by
approximately 8% (Brown, et al., 1999).
Immunization with one sub-genotype could potentially cross-protect against all
other sub-genotypes. This was confirmed from a study by Chou et al. (2012) who
demonstrated that their inactivated EV-A71 vaccine based on the sub-genotype B4 could
elicit cross-neutralizing antibody responses against sub-genotypes B1, B5 and C4A.
36
However, the levels of neutralising antibody titers may not be high enough to be
protective against all the sub-genotypes. In addition, their vaccine was tested on a small
sample size of 60 adults. Further research could be carried out to target a larger sample
size consisting of young children and infants (Chou et al., 2012).
Huang et al. (2013) conducted studies with children to measure cross-reactive
neutralizing antibody titres against different EV-A71 genotypes. The serology data
showed that children infected with genotypes B and C had consistently lower
neutralizing antibody titres against genotype A (Huang et al., 2013). It could be possible
that immunization with a particular genotype could elicit higher cross-neutralizing
antibodies against that particular genotype. For example, a vaccine against genotype C
could cross-protect against sub-genotypes C1-C5. Zhang et al. (2014) analysed the
cross-reactive neutralizing antibodies (NtAb) in sera from EV-A71–infected and
children vaccinated with the inactivated vaccine. They showed that the NtAb titers in
children elicited by the EV-A71-C4a vaccine were higher against EV-A71-B4, B5, C1,
C2 and C4b than against other EV-A71 sub-genotypes. Surprisingly, the NtAb titre
against C4a was always lower than against all other genotypes and this indicated that the
current genotyping of EV-A71 may not reflect their antigenicity (Zhang et al., 2014).
1.3.4 Potential candidates for EV-A71 Vaccine
There is considerable interest in the development of EV-A71 vaccines as HFMD
has become a severe global and life-threatening disease in infants and young children. In
2014, China reported over 2.7 million cases of HFMD caused by EV-A71, CVA-16, and
other enteroviruses, that led to approximately 243 deaths (Western Pacific WHO, 2014).
37
Research groups have developed experimental inactivated vaccines (Liang et al., 2013),
recombinant VP1 vaccine (Wu et al., 2001), live attenuated vaccines (Arita et al., 2005,
Arita et al., 2007), virus-like particles (Li et al., 2013), synthetic peptide vaccine (Foo et
al., 2007, Kirk et al., 2012) and DNA vaccine (Tung et al., 2007).
Each type of vaccine has its own advantages and disadvantages. The inactivated
EV-A71 vaccine is considered the safest viral vaccine as there will be no reversion to the
infectious wild type strain. Reversion of the live attenuated poliovirus vaccine strains
generally happens in 1 out of 750, 000 vacinees, but this occurrence will not happen
with the inactivated poliovirus vaccine. Zhu and coworkers (2014) showed that the
inactivated EV-A71 vaccine was highly immunogenic and elicited antibodies in children
with a neutralizing titer of 1:16 and provided protection against mild to severe HFMD
for at least 1 year in children (Zhu et al., 2014).
Nevertheless, the inactivated vaccine has several major disadvantages as
immunogenicity is not long-lasting and requires multiple boosters. This is because
inactivated vaccines only initiate the humoral immunity and lacks cellular immunity
(CD8+ T cells) responses. In an inactivated vaccine, there is no viral replication and
hence, lower antigen content and less prolonged antigen persistence (Zhu et al., 2013).
As a result, inactivated vaccines elicit weaker and shorter antibody responses and no
long-term immune memory. This explains the need for multiple boosters after
administration of inactivated vaccines. Another disadvantage of the EV-A71 inactivated
vaccine would be their failure to prevent CV-A16 infections and that could compromise
the acceptability of inactivated monovalent EV-A71 vaccines. The study of Chong et al.
(2015) also concurred with the results that even though the efficacy of inactivated EV-
38
A71 vaccine was more than 90% against EV-A71-related HFMD, only >80% protection
against EV-71 associated serious diseases was reported (Chong et al., 2015).
Increasingly, there has been more research to develop recombinant VP1 vaccines
that contain VP1 as the major neutralizing antigen, harnessed into vaccine vectors. They
are advantageous as they are cost-effective immunogens when compared to the
inactivated vaccines and are safe. This was confirmed by Chen et al. (2006) who showed
that when transgenic tomatoes expressing the VP1 protein were fed to Balb/c mice as an
oral vaccine, the serum from the immunized mice showed IgG and IgA neutralizing
titers of 1:16. The vaccine had elicited both humoral and cellular immune responses
from the mice. The serum was also able to neutralize EV-A71 infection in
Rhabdomyosarcoma cells. This demonstrates the potential of recombinant VP1 vaccines
as good vaccine candidates (Chen et al., 2006).
However, recombinant VP1 vaccines produced lower levels of NtAb in vacinees.
This increases the risk of unwanted immune responses such as antibody-dependent
enhancement (ADE) (Han et al., 2011). ADE is a phenomenon whereby pre-existing
sub-neutralizing antibodies could not inhibit virus entry and replication. ADE has been
observed for EV-A71 (Han et al., 2011), poliovirus (Palmer et al., 2000), and CVB
(Girn et al., 2002). Han and colleagues (2011) demonstrated that previous exposure to
an avirulent strain of EV-A71 before another EV-A71 infection increased the risk factor
for developing severe neurological complications and deaths. They also concluded that
the presence of sub-neutralizing levels of antibodies exacerbated EV-A71 infection (Han
et al., 2011). The possible impact of ADE has to be taken into account when designing
vaccines to prevent unwanted induction of enhancing antibodies. Therefore, a better
39
alternative would be to use live attenuated vaccines that elicit the cellular immune
response, besides the humoral immunity.
The live attenuated vaccine (LAV) is cheaper to produce, induces excellent
immunogenicity and confers live-long immunity. LAV is preferred over the inactivated
EV-A71 vaccine as it can elicit both humoral and cellular immunity, alongside the
innate and adaptive immunity. There is an increasing body of research which indicates
that cellular immunity and not humoral immunity determines the clinical outcome of
EV-A71 infections. In the most severe cases with pulmonary edema, blood samples
showed lower levels of cellular cytokines and interferons (TNF-α, Th1 and IL-6), while
there was no difference in the level of NtAb titers between mild, severe and fatal cases.
Chang and co-workers (2006) also discovered that humoral immunity did not
affect the clinical outcome in severe cases of EV-A71 infection. This is possible because
a lower cellular immunity would delay viral killing, increase viral dissemination and
sustain a systemic inflammatory response that leads to disease severity. This also
explains why fatal HFMD infections generally afflict infants as they would have weaker
cellular immunity although they may have maternal EV-A71 NtAb. However, the low
NtAb levels would have no effect in neutralizing the high EV-A71 viral load (Chang et
al., 2006).
In addition, recent research demonstrated that the VP2 antigen subjugates the
IFN-ᵞ-secreting CD4+ T cell responses against EV-A71, compared with VP1, VP3 and
VP4 (Tan et al., 2013). This was in contrast to previous investigations on T cell
immunity that focused on the VP1 antigen as it is highly exposed on the structure of the
40
EV-A71 virus (Figure 1.4). For example, a previous study showed that VP1-145G/Q
was associated with milder disease, while VP1-145E was associated with disease
severity (Nishimura et al., 2013). Further research showed that VP1-145G/Q regulated
the binding of VP1-244K to sulfated Tyr residues at the P-selectin glycoprotein ligand-1
(PSGL-1) N-terminus on leukocytes (Lee et al., 2013). As PSGL-1 is involved in
leukocyte migration and cytokine production, EV-A71 interaction with PSGL-1 is vital
for dissemination within the host and regulation of antiviral host response. These
discoveries have led to an increased understanding about disease progression of EV-A71
post-infection, which range from an absence of symptoms (~71%) to fatality (~0.05%)
(Chang et al., 2002). Taken altogether, an effective LAV should carry both B and T cell
epitopes.
However, the disadvantage of LAVs is the possibility of genetic instability and
possible reversion to wild-type virulence. This phenomenon of reversion has been
observed in countries with extensive polio LAV programs (Kew et al., 2005). The
mutation rate of single-stranded RNA viruses is especially high when compared to DNA
viruses. RNA viruses have a mutability rate of 10-3 to 10-5 mutations per nucleotide
copied, per replication cycle (Holland et al., 1982). This could be due to the lower
fidelity of the wild-type RNA-dependent RNA polymerases. They are estimated to
misincorporate one or two bases in every genome copying event, which explains the
high mutation rate of RNA viruses (Hicks and Duffy, 2011).
In addition, as LAVs are excreted from vaccine recipients, they pose a risk to
immunocompromised individuals who have yet to be vaccinated. The excreted virus can
mutate to more virulent forms. As a result, regulatory bodies are duly concerned about
41
the safety of such vaccines as there is always a potential of viral escape or mutation to
revertants. Nevertheless, recent studies have shown that it is possible to generate LAVs
that have much lower risks of reversion. Meng and Kwang (2014) showed that
attenuated high-fidelity variants of EV-A71 with a single amino acid change, L123F in
its 3D Polymerase (3DPol) greatly reduced viral pathogenicity in vivo. These EV-A71
mutants have lower pathogenicity as they are unable to generate replication-efficient
mutations and have much lower genetic diversity to withstand a wide range of selective
pressures (Meng and Kwang, 2014). Hence, high-fidelity EV-A71 variants can reduce
mutation risk and increase stability of LAVs. With that, there is great potential in LAVs
and the past success of LAVs for diseases such as poliovirus, yellow fever, rubella,
measles, mumps, rabies, rotavirus, influenza and varicella zoster has proven that safe
and effective LAVs can be developed through optimization of immunogenicity and
genetic stability.
Since the same Type 1 IRES structure is present in both poliovirus and the EV-
A71 Genotype A (BrCr) genome, Arita and co-workers (2005) introduced 3 mutations at
nucleotides 485, 486 and 474 in the EV-A71 genome which corresponded to the
mutations present in Sabin 1, 2 and 3 strains, respectively. They constructed a LAV from
the BrCr strain (S1-3’) carrying the 3 mutations in the 5’-NTR, 2 mutations in the 3Dpol
and a single mutation in the 3’-NTR. Although there was reduced virulence, mild
neurological symptoms were still observed in the 3 cynomolgus monkeys immunized
with the EV-A71 (S1-3’) strain and the virus was still isolated from the spinal cord.
Hence, the plan to use this strain as a LAV was discontinued (Arita et al., 2005). The
42
LAV constructed was still able to multiply extensively in the neuronal cells and hence,
still caused tremors in the monkeys.
The molecular basis of virulence in EV-A71 is still uncertain. It remains to be
investigated if there is a universal molecular determinant present in every EV-A71 fatal
sub-genotype strain or whether every fatal sub-genotype strain differs in virulence
determinant. In a comparison of the amino acid sequence of the fatal (EV-A71 strain
5865/Sin/000009) and the non-fatal (EV-A71 strain 5666/Sin/002209) strain isolated
from the HFMD outbreak in Singapore, Singh and co-workers (2002) reported that a
nucleotide change at position 5262 in the 3A non-structural region could possibly
contribute to the virulence of EV-A71 strain 41. Comparative analysis revealed 99%
amino acid similarity except for the amino acid 1506. The fatal strain contains adenine at
position 5262 that encoded for threonine, while the non-fatal strain contains guanine that
encoded for alanine (Singh et al., 2002) (Figure 1.7).
Li et al. (2011) compared the sequences of virulent and non-virulent strains and
concluded that four amino acids at two positions (Gly/Gln/Arg in position 710 and Glu
in position 729) in the VP1, one (Lys in position 930) and four nucleotides at three
positions (G in position 272, U in position 488 and A/U in position 700) in the 5’-NTR
region are likely to contribute to the EV-A71 virulent phenotype (Li et al., 2011). In
another study, Yeh et al. (2011) reported that nucleotide 158 in the EV-A71 5’-NTR
contributed to the virulence of the virus belonging to the sub-genotype B1 (Figure 1.8).
43
Figure 1.7: Differences of nucleotide between the B4 genotype fatal strain
(GenBank: AF316321) and the non-fatal strain 10 (GenBank: AF352027). There is
99% nucleotide similarity, except at nucleotide 5262 in the 3A non-structural region
(Singh et al., 2002).
A5262G
44
Figure 1.8: A single nucleotide change from Cytosine to Uridine at position 158 in
Stem Loop II of 5’-NTR contributes to virulence of EV-A71 sub-genotype B1 in
mice. This nucleotide change led to reduced viral translation and virulence in mice (Yeh
et al., 2011).
45
A single nucleotide change from cytosine to uridine at position 158 caused an
alteration in the RNA secondary structure of stem loop II which led to reduced viral
translation and virulence in mice (Yeh et al., 2011). An earlier study published by Izuka
et al. (1989) demonstrated that deletion from nucleotides 564 to 726 in the 5’-NTR of
the poliovirus Mahoney genome was successfully expressed as a stable, less
neurovirulent phenotype. Mutant strains carrying long deletions maybe more stable and
safer than those carrying point mutations, short deletions or short insertions.
With the discovery of virulence determinants for some EV-A71 sub-genotypes,
rational design of a LAV based on site-directed mutagenesis of specific nucleotides
allows control of the primary structure of proteins. Therefore, it is of interest that by
changing the nucleotides in the virulence-associated positions of the viral genome,
neurovirulence can be reduced and genetic stability increased to reduce the possibility of
reversion to virulence. However, complete stability may be difficult to attain as there
may be other virulent determinants of attenuation that have yet to be discovered. In
addition, recombination between different group C enteroviruses occur so frequently in
humans that exchange of the attenuation region maybe inevitable, especially if there is
high circulation of viruses (Liu et al., 2014).
Recent research has also focused on virus-like particles (VLP) as good vaccine
candidates. VLPs resemble the authentic virus in terms of morphology, capsid proteins
and protein composition, but are devoid of genetic material. Hence, VLPs are not
infectious but can self-assemble in eukaryotic expression systems such as
Saccharomyces cerevisiae (Li et al., 2013) and Pichia pastoris (Cereghino and Cregg,
2000). More importantly, VLPs contain an arrangement of epitopes on its surface that
46
can elicit NtAb against that particular virus. Indeed, VLPs have been developed as
licensed vaccines for human papillomavirus (Paavonen, et al., 2007) and Hepatitis B
virus (Roldao et al., 2010). Therefore, there remains potential for VLPs to be an
excellent choice of vaccine for EV-A71. In a recent publication by Zhang et al. (2015),
high yield production of recombinant VLPs of EV-A71 (approximately 150 mgVLP/liter
of yeast culture) was achieved in Pichia pastoris. Maternal immunization with the VLP
co-expressing P1 and 3CD proteins of EV-A71 was able to protect neonatal mice in both
intraperitoneal and oral challenge against EV-A71. The transgenic Pichia pastoris
produced more VLPs than that reported for baculovirus/insect cell expression system as
the latter only produced 64.3 mg/L under optimized condition (Paavonen, et al., 2007).
The overall cost of insect cell culture is relatively high and there is a potential risk of
contamination with baculovirus particles. Recombinant virus-like particles produced
from baculovirus formulated with CFA/IFA adjuvants elicited a neutralization titer of
1/160 which was significantly lower than the neutralization titer (1/640) elicited by the
inactivated EV-A71 formulated in alum (Chou, et al., 2012).
In addition, there is an increasing trend to develop a bivalent VLP vaccine
against both EV-A71 and CAV 16 as both viruses tend to co-circulate in major HFMD
outbreaks. There has been a greater understanding of the crystal structure of the EV-A71
virus. Lyu et al., (2014) discovered that at least 18 residues from the N-terminus of VP1
BC loop are transiently externalized, making it suitable for foreign peptide insertion for
the generation of recombinant EV-A71 viruses. It was observed that such insertions did
not affect the capsid structural changes and virus uncoating process. This would provide
more insights into vaccine development against HFMD. In their more recent study, they
47
deduced that the crystal structures of EV-A71 VLP and chimeric EV-A71/CV-A16 VLP
contained major neutralization epitopes of EV-A71 that are mostly preserved in both
VLPs. The replacement of 4 amino acid residues in the VP1 GH loop of the SP70
epitope was able to change the chimeric VLP to elicit neutralization responses against
both EV-A71 and CV-A16. The mutated VP1 GH loop in the chimeric VLP was well
exposed on the particle surface and exhibited a surface charge potential different from
that contributed by the original VP1 GH loop in EV-A71 VLP (Lyu et al., 2015).
Xu and co-workers (2014) demonstrated that passive transfer of neutralizing
monoclonal antibody (nMAb) against the VP2 protein of EV-A71 protected BALB/c
mice against lethal EV-A71 infection. Interestingly, they showed that the cross-
neutralizing EV-A71 antibodies were induced using hepatitis B virus core protein (HBc)
as a carrier, and the VP2 epitope (amino acids 141-155) was able to elicit neutralizing
antibodies with a titer of 1/32 and conferred 100% in vivo passive protection (Xu et al.,
2014). Taken altogether, a broad-spectrum vaccine strategy targeting the high-affinity
epitopes of VP1 and VP2 may elicit effective immune responses against EV-A71
infection.
In exploring peptide vaccines, there are many benefits such as no risk of
reversion, increased stability and induction of specific NtAbs. Synthetic peptide
vaccines against HFMD contain EV-A71 neutralization B-cell epitope such as the SP70
from the VP1 protein of EV-A71 strain 41. This SP70 peptide was able to elicit NtAb
against different EV-A71 sub-genotypes. When anti-SP70 sera was passively
administered into suckling Balb/c mice, followed by lethal challenge with various EV-
A71 genotypes (B2, B5, C3, C4), neutralizing antibodies elicited by SP70 were able to
48
confer good passive protection (Foo et al., 2007). However, protection of mice was
found to be only at 80%. When compared to the inactivated and recombinant VP1
vaccines, immunogenicity of peptide vaccines is low (Chou et al., 2012). Low levels of
NtAb may also lead to unwanted side effects like ADE.
The immunogenicity of peptide vaccines can be further increased when they are
co-delivered with strong mucosal-immune adjuvants or nanoparticles (Gregory et al.,
2013). However, the usage of strong adjuvants such as complete Freund's adjuvant is not
acceptable for human use and even incomplete Freud's adjuvant is reactogenic and may
be responsible for cold abscesses. Currently, aluminium salts and MF59 are the only
vaccine adjuvants approved for human use. The low immunogenicity of peptide
vaccines could be due to structural and conformational differences between the peptide
that is synthesized in a recombinant protein expression system which differs from the
endogenous EV-A71 viral protein. More studies could be performed to identify
Enterovirus-specific and cross-genotype neutralization epitopes in VP1 that could
induce a protective immune response to ensure high levels of NtAb responses.
Recent investigations showed that peptide vaccines based on recombinant
multiple tandem linear neutralizing epitopes (mTLNE) have been constructed by linking
VP1-SP55, VP1-SP70 and VP2-SP28 with a Gly-Ser linker. It was demonstrated that
passive transfer of anti-mTLNE sera was able to confer full protection in neo-natal mice
against lethal EV-A71 challenge by inducing both the humoral and cellular immunity
(Li et al., 2014). In addition, a recent study was performed by Xu and co-workers (2014)
who also constructed a recombinant vaccine containing the epitope within the VP2 EF
loop. They discovered that passive transfer of anti-sera that was induced by the
49
recombinant VP2 vaccine were able to protect newborn mice against EV-A71 lethal
challenge with a cross-neutralizing titer of 1:32 (Xu et al., 2014)
DNA vaccines comprise of DNA coding for a particular antigen which can be
directly injected into the human muscle. The DNA antigen gene encoded by the DNA
vector would then manufacture that particular antigen in the host cells. The host immune
system would recognize the antigen as a foreign substance and hence, produce NtAbs
against it. DNA vaccines have many advantages as they are very stable and easy to
manufacture. However, no DNA vaccines have been found to elicit substantial immune
response that is needed to prevent an infection, which was a major disadvantage.
Nevertheless, Tung and co-workers (2007) managed to construct a DNA vaccine that
was able to elicit NtAb response in Balb/c mice. The anti-VP1 IgG in the mice that had
been immunized with the DNA vaccine exhibited neutralizing activity against EV-A71
(Tung et al., 2007). In another study, a DNA vaccine was able to induce cellular and
humoral immune responses which were capable of providing protection against
Chikungunya virus challenge in mice (Mallilankaraman et al., 2011). To date, no DNA
vaccines have been commercialized (Nakayama and Aruga, 2015).
1.3.5 Inactivated EV-A71 Vaccines
Up to date, five organizations have completed pre-clinical studies to develop an
inactivated vaccine which is at different phases of clinical trials. Three of the companies
are from mainland China while the other two are from Taiwan and Singapore. The three
China-based biopharmaceutical companies are Vigoo, Sinovac and Chinese Academy of
Medical Science (CAMS). They have all completed Phase III Clinical Trials in 2014 for
50
an inactivated EV-A71 vaccine against the sub-genotype C4 as it was the main sub-
genotype responsible for outbreaks in China (Table 1.3). The three companies conducted
randomized, double-blind, placebo-controlled, multicentre trials involving 10,007-
12,000 healthy children. Each vaccine candidate received two intramuscular doses of
vaccine or placebo within a span of 28 days apart (Liang and Wang, 2014).
Sinovac reported that their inactivated vaccine efficacy was 94.8% and anti-EV-
A71 immune response elicited by the two dose vaccines were found in 98.8% of
participants. In addition, the anti-EV-A71 neutralizing titre of 1:16 associated with
protection against EV-A71 was intended to last for at least 1 year. However, the NtAb
titre declined 50% after 6 months (Li et al., 2014). In addition, there were different NtAb
levels induced by the 3 vaccine strains although they were all from the sub-genotype
C4a strain.
The NtAb levels (VNA GMT) in children vaccinated with the inactivated
vaccines produced by Sinovac and CAMS were 191 and 170 at 1 year post-vaccination
and 4 weeks, respectively. The lowest VNA GMT was observed with the inactivated
EV-A71 vaccine from Vigoo at a VNA GMT of 92 at 1 year post-vaccination. This
could be due to the different manufacturing processes, cell substrates, culture systems
and vaccine doses used by the 3 companies (Chong et al., 2015). Mao et al. (2012) also
discovered that the aluminium hydroxide adjuvant used, though similar in concentration,
had differing immunological-enhancing effects. Compared with the vaccine strains
without the adjuvant, the differences in immunogenicity among the vaccine strains
absorbed with alum adjuvant produced by the three manufacturers were reduced,
especially at 14-day and 28-day after immunization.
51
Table 1.3: Five EV-A71 inactivated vaccines at different clinical phases of development.
Organizations
Cell lines&EV-A71
strain
Clinical trials
Dosage (µg of
EV-A71
antigen)
Population target Current status of
clinical trial
Adjuvant Technology for vaccine
production
NHRI (Taiwan)
Vero cell & EV-
A71
B4 (GMP-certified)
5 and 10 Young adults Phase 1 completed
Aluminium phosphate
Roller bottles
Sinovac (China)
Vero cell & EV-
A71
C4
1
Young adults,
young children
and infants
Phase III completed 1,
2 and 3 completed
Aluminium hydroxide
Cell factory
Beijing Vigoo
(China)
Vero cell & EV-
A71
C4
0.8
Young adults,
young children
and infants
Phase III completed
Phase 1, 2 and 3
completed
Aluminium hydroxide
Microcarrier bioreactors,
fermentation cylinder
CAMS (China)
Human diploid cell
KMB-17 & EV-A71
C4
0.25
Young adults,
young children
and infants
Phase III completed 1,
2 and 3 completed
Aluminium
hydroxide, glycine
Microcarrier bioreactors
Inviragen
(Singapore)
Vero cell &
EV-A71 B3 0.3 and 3 Young adults
Phase 1 completed
Phase 1
Completed
Aluminium hydroxide Cell factory
52
The inactivated vaccines containing aluminium adjuvants when used at the lowest dose
(162U) showed good protective effects in sucking mice against lethal challenge (90-
100% survival).
The inactivated vaccines should also be based on international manufacturing
process criteria, global vaccine standards and high regulation of quality. Currently, roller
bottles and cell factories are employed for upstream cell culture but they are labour
intensive. Chong et al. (2012) reported the feasibility of producing a C4-based protective
vaccine (0.25 µg) at US$0.1/dose using a 40-L pilot scale batch reactor. Upstream
manufacturing processes could be further improved with the use of bioreactors, micro-
carriers and perfusion technology. To lower the production cost, a simple and efficient
downstream chromatographic purification step will need to be incorporated (Chong et
al., 2012). To determine the potency and efficacy of inactivated vaccines produced by
different manufacturing processes, there is a need for standardization of the vaccine
strain, quality control reagents, immunoassays and animal models at the international
level. A global surveillance network for enterovirus outbreaks is needed to monitor
immune responses to the inactivated EV-A71 vaccine.
Prior to the release of the inactivated EV-A71 vaccine, there were a few studies
that are addressing whether the NtAb elicited by one EV-A71 sub-genotype could cross-
neutralize other sub-genotypes or confer protection across genotypes or sub-genotypes.
For example, it was reported that neutralizing antibodies elicited by 10 strains of the C4
genotype in rabbits had variable cross-neutralizing effects against different strains of the
same sub-genotype and the genotype A BrCr strain (Mao et al., 2012), while another
study demonstrated that mice challenged with lethal doses of B3 genotype survived due
53
to prior vaccination with a C4 genotype vaccine (Bek et al., 2011). In addition, Zhang et
al. (2014) showed that the titers of NtAb in children elicited by the EV-A71-C4a vaccine
were higher against EV-A71-B4, B5, C1, C2 and C4b than against other EV-A71 sub-
genotypes. Interestingly, the NtAb titers raised against the C4a sub-genotype used for
immunization was lower than those of all the other EV-A71 sub-genotypes and this
indicated that the current genotyping scheme may not truly reflect their antigenicity
(Zhang et al., 2014).
It is important to conduct studies with more antisera collected from future phase
III clinical trials to further evaluate the efficacy of cross-protection against all EV-A71
genotypes and sub-genotypes, determine the types of immune response and understand
immune correlates of protection. There is no data to show vaccine efficacy against
serious EV-A71-associated neurologic disease, such data might become available after
the vaccines are licensed and post marketing surveillance is undertaken. A global
surveillance network to monitor the emergence of new EV-A71 after the introduction of
the vaccine should be established. As the child needs to be immunized with the
commercial pentavalent vaccine, the EV-A71 vaccine could be included in the
Expanded Programme on Immunization Vaccines.
There also remains insufficient information on the inactivated EV-A71 vaccine-
induced immunity to ensure wide and safe use of the vaccine inside and outside of
China. Samples collected during Phase III Clinical Trials should be analyzed for
immune response types and immune correlates of protection (Lu, 2014). Also, as
Coxsackie type A16 (CV-A16) is also a leading cause of severe HFMD infections, there
54
should be more research into formulating a combined EV-A71-CA16 vaccine to
effectively prevent severe HFMD outbreaks.
1.3.5 Immunogenicity of vaccines
Vaccines against viral diseases could be potentially improved if the
immunogenicity of the vaccine could be enhanced. A major hurdle to the development
of LAVs is the difficulty in achieving a satisfactory level of attenuation without severely
compromising rate of replication and immunogenicity. Many factors such as safety have
to be taken into consideration during the development of live viruses as potential LAVs.
Bukreyev et al. (2002) have discovered that immunogenicity in primates of a
LAV for human parainfluenza virus type 3 (HPIV3) could be enhanced by expression of
granulocyte–macrophage colony-stimulating factor (GM-CSF) from an extra gene
inserted into the genome of a cDNA-derived virus. GM-CSF is a major cytokine vital in
the maturation and activation of dendritic cells and macrophages. Their recombinant
GM-CSF HPIV3 virus showed a decrease in viral replication by 40-fold when compared
to the wild type HPIV3. In addition, this attenuated vaccine virus expressing GM-CSF
displayed 3- to 6-fold higher NtAb levels than that induced by the non-attenuated wild
type virus (Bukreyev et al., 2002). As the NtAb titer is vital to confer life-long
protection against any virus, their LAV maybe a suitable candidate against the HPIV3 as
it has high immunogenicity and low pathogenicity.
Another major factor that should be taken into consideration when developing a
LAV strain would be the monitoring of antigenic variations of EV-A71. A study
conducted by Chia et al (2014) showed that rabbits immunized with genotype B and C
viruses consistently had lower NtAb titers against genotype A (≥ 8-fold difference) and
55
antigenic variations between genotype B and C viruses could be detected but did not
have a clear pattern. This was consistent with previous human studies (Huang et al.,
2010). A rabbit model was used as it was difficult to obtain large amounts of sera from
children for neutralization assays.
Interestingly, the authors deduced that sub-genotype B2 and B5 viruses were
highly immunogenic and could induce high NtAb titers against all genogroup B and C
viruses (Chia et al., 2014). This was consistent with serology data from Huang et al.
(2013) that showed children infected with genotypes B and C consistently have lower
NtAb titers against genotype A (4-fold difference). Sequence comparisons revealed that
five amino acid signatures (N143D in VP2; K18R, H116Y, D167E, and S275A in VP1)
were responsible for the antigenic variations in genotype A. This further corroborates the
idea that vaccine development should monitor the antigenic and genetic variations of
each EV-A71 genotype/sub-genotype.
1.4 Aims of Study
Arita et al. (2005) had attempted to develop a live-attenuated vaccine (LAV)
against EV-A71 by introducing 3 mutations at nucleotides 485, 486 and 475 in the EV-
A71 genotype A genome which corresponded to the mutations present in Sabin 1, 2 and
3, respectively. Although there was reduced virulence, mild neurological symptoms
were still observed in the 3 cynomolgus monkeys that received intravenous inoculation
with the EV-A71 (S1-3’) strain carrying mutations in the 5’NTR, 3Dpol and in the
3’NTR. However, the virus still caused tremors and was isolated from the spinal cord.
Hence, this strain did not meet the criteria to be used as a LAV.
56
The inactivated EV-A71 vaccine has been advanced to almost production level in
the next 12 months in China. However, the lack of long-term protection has necessitated
the search for other types of vaccines. LAVs have been the focus of current research and
development. This type of vaccine induces excellent immunogenicity, elicits humoral
and cellular immunity and thereby, confers live-long immunity. It can be introduced via
oral delivery like the OPV.
In this study, we are investigating if EV-A71 sub-genotype B4, strain 41
(5865/Sin/000009) has a different virulence determinant from the sub-genotype B1
(clinical isolate 237) reported by Yeh et al. (2011). The EV-A71 sub-genotype B4 virus
(accession number: AF316321) will be modified to carry a single mutation at nucleotide
position 158 by site-directed mutagenesis to assess if the nucleotide is a common
virulence determinant between sub-genotypes B4 and B1 (Fig. 1.9). An EV-A71 mutant
bearing a long deletion in the 5’-NTR of the genome will also be constructed. The
virulence of the various mutated EV-A71 strains will be evaluated in the
Rhabdomyosarcoma (RD) cell culture by plaque assays, viral infectivity by tissue
culture infectious dose (TCID50) determinations, real time Reverse-Transcriptase
Polymerase Chain Reaction (RT-PCR) and detection of VP1 by immunoblotting with
monoclonal antibody directed at VP1. RD cells are chosen as they were very efficient in
exhibiting cytopathic effect typically 7-10 days after inoculation (Pallansch and Ross,
2001).
Our first objective in this study is to genetically modify the EV-A71 strain 41
(sub-genotype B4) virus by substituting nucleotides at positions 158, 475, 486, and 487
based on the fact that these nucleotides are responsible for the neuro-virulence of
57
poliovirus Sabin strains 1, 2 and 3 (Table 1.4). The virulence determinants of poliovirus
and EV-A71 reported in previous studies served as references in this study to produce
EV-A71 viruses that are highly attenuated. Figure 1.9 illustrates the predicted RNA
secondary structure of EV-A71 strain 41 from nt. 474 to 541.
Table 1.4: Common genetic determinants between EV-A71 and Sabin polio strains.
Nucleotide Substitution Position in Sabin strains Position in EV-A71 strain
41
C to T 472 475
A to G 480 486
G to A 481 487
58
Figure 1.9: Predicted RNA secondary structure of EV-A71 strain 41 from nt. 474 to
541. Due to slight differences in the length of the 5’-NTR, nt. 480 in Sabin 1 is at the
equivalent position 486 (1) in this figure. Nt. 481 in Sabin 2 is at the equivalent position
487 (2), and nt. 472 in Sabin 3 is at the equivalent position 475 (3) of the EV-A71
genome (Yin Quan Tang, personal communication, 2014).
59
Our second aim for this study is to investigate if the single nt. difference (strain
41) between the fatal and the non-fatal strain (strain 10) is responsible for neuro-
virulence by introducing a nt. substitution at nt. position 5262 in the EV-A71 viral
genome. This is to be carried out with reference to a previous study conducted by Singh
et al. (2002). The nt. at position 5262 will be changed from A to G.
Our third objective is to construct a genetically stable and safe LAV through
partial deletion of the 5’-NTR region in the EV-A71 genome. This may reduce the
efficiency of viral replication as Izuka et al. (1989) was able to generate genetically
stable poliovirus. Deletion will be created from nt. positions 475 to 485. Our final
objective is to evaluate the virulence of the various EV-A71 mutants in vitro in RD cells
and the in vivo immunogenicity of the various mutants.
CHAPTER 2
MATERIALS AND METHODS
2.1 Cell Culture
Human Rhabdomyosarcoma cells (RD, ATCC # CCL-136) were cultured in
Dulbecco's modified Eagle's minimal medium/F-12 (DMEM/F-12, Invitrogen, USA),
supplemented with 10% foetal bovine serum (FBS) (Gibco, USA), 1%
penicillin/streptomycin, 1% L-glutamine and 1% essential amino acids. All cell lines
were grown at 37°C in 5% CO2 until 80-90% confluency.
2.2 Viral infection
60
RD cell monolayers in 75-cm2 flasks were inoculated with 100µL EV-A71 strain
5865/Sin/000009 (GenBank accession number AF316321). Infected cells were
incubated with 1 mL DMEM containing antibiotics but no serum at 37°C until the
complete cytopathic effect (CPE) was apparent. RD cells were frozen at −80°C and
thawed, three times, and cell debris was removed by centrifugation at 14,000 x g for 10
minutes at 4°C. Supernatants were used for harvesting the virus.
2.3 RNA Extraction and Reverse Transcription
Viral RNA was extracted from EV-A71 using the QIAmp® Viral RNA Mini Spin
Kit (Qiagen, Calif., USA). The kit was used according to the manufacturer’s
instructions. The purified RNA was reverse transcribed into cDNA by using the
SuperScript® III First Strand Synthesis SuperMix Kit (Invitrogen, Calif., USA). Each
cDNA synthesis mixture contained 10X annealing buffer, 25mM MgCl2, 0.1 M
oligo(dT), RNAseOUT/Superscript III RT and viral RNA as template.
2.4 Cloning of EV-A71 cDNA into the pCR-XL-TOPO vector
Full length cDNA of EV-A71 was amplified using polymerase chain reaction
(PCR). Each PCR reaction contained 5X Phusion HF buffer, 10mM dNTP, 0.1g of each
primer, 1 µg template cDNA and Phusion HSII DNA Polymerase. The following cycling
conditions were employed for the PCR reactions: 98oC for 30s, followed by 98oC for
10s, 64oC for 30s and 72oC for 5 min for 30 cycles. The cycles were terminated with a
30s extension at 68oC. The amplified cDNA was cloned into the pCR®-XL-TOPO®
vector (Invitrogen, Calif., USA).
61
Approximately 100 ng of the full length EV-A71 cDNA was ligated to 1µL
pCR®-XL-TOPO® vector according to the manufacturer’s protocol in the TOPO® XL
PCR Cloning Kit (Invitrogen, Calif., USA) (Figure 2.1). The ligation mixture was
incubated for 5 min at room temperature, then 1 µl of the 6x TOPO® Cloning stop
solution was added and the tubes were placed on ice. The recombinant EV-A71 pCR-
XL-TOPO vector (Fig.2.1) was stored at -20oC for further downstream processes.
2.5 Site-directed mutagenesis
The EV-A71 full genome in the pCR-XL-TOPO plasmid acted as the substrate for single
mutations using designed primers (Table 2.1) and the QuickChange Lightning Site-
Directed Mutagenesis Kit (Agilent Technologies, Calif., USA). EV-A71 mutants were
constructed by introducing site-directed mutations at nucleotide positions 158, 475, 486,
487, in the 5’-NTR and at position 5262 of the viral genome, respectively. In the 1st
stage of the reaction, PCR was carried out. The mixture contained 10x reaction buffer,
100ng/µl of each primer, 100ng ds DNA template, 1µL dNTP mix and 1µL QuikChange
Lightning Enzyme mix. The PCR mixture was added up to a total reaction volume of 50
µl. The PCR conditions were set up at 95°C for 2 min for initial denaturation, followed
by 18 cycles of 95°C for 20 sec, 60°C for 10 sec, 68°C for 5 min 30 sec. Final
elongation was carried out at 68°C for 5 min.
62
Figure 2.1: Schematic illustration of EV-A71 cDNA clone in pCR-XL-TOPO.
EV-A71 genomic cDNA was cloned downstream of a SP6 RNA polymerase promoter.
The in vitro transcribed positive-sense RNA carried an additional G residue at the 5’ end
and a poly(A)50 tail followed by additional CGGCC residues at the 3’ end. The arrow
indicates the transcription start site.
Table 2.1: Primers used for site-directed mutagenesis and partial-deletion in the 5’-
NTR of EV-A71 genome.
Name Sequence (5’-3’)
EV-5UTR-F(A486G) GCTAATCCTAACTGTGGGGCACATGCCTTCAATCC
63
EV-5UTR-R(A486G) GGATTGAAGGCATGTGCCCCACAGTTAGGATTAGC
EV-5UTR-F(G487A) GCTAATCCTAACTGTGGAACACATGCCTTCAATCCAG
EV-5UTR-R(G487A) CTGGATTGAAGGCATGTGTTCCACAGTTAGGATTAGC
EV-5UTR-F(C475T) CCCTGAATGCGGCTAATTCTAACTGTGGAGCACA
EV-5UTR-R(C475T) TGTGCTCCACAGTTAGAATTAGCCGCATTCAGGG
EV-5UTR-F(A5262G) GTCGTGCAATCCATCGCTACTGTGGTGGCAG
EV-5UTR-R(A5262G) CTGCCACCACAGTAGCGATGGATTGCACGAC
EV-5UTR-F(A158T) GGCGCACCAGCTTTGTCTTGATCAAG
EV-5UTR-R(A158T) CTTGATCAAGACAAAGCTGGTGCGCC
EV-UTR-F(∆11) AGCACATGCCTTCAATCCAGAGGG
EV-UTR-R(∆11) ATTAGCCGCATTCAGGGGCCGGAG
In the 2nd stage of mutagenesis, 2 µl of the Dpn I restriction enzyme was added
to the amplification product to digest the methylated and hemimethylated parental DNA.
The ligation mixture was incubated for 5 min at 37°C. In the 3rd stage, transformation
was performed using XL 10-Gold® Ultracompetent cells (Agilent Technologies, Calif.,
USA). The ligated mixture (2 µl) was added to the competent cells and incubated on ice
for 30 min. The cells were then subjected to heat shock at 42°C for 30 sec, and
64
immediately placed on ice for 2 min. An aliquot of the NZY+ broth (500 µl) was added
to the XL 10-Gold competent cell suspension, followed by shaking of the transformed
bacterial cells at 37°C for 1 hour.
After the 1 hour incubation, tubes were centrifuged at 13,000 x g for 1 min. Clear
supernatant was discarded and the cell pellet was resuspended in 500 µl of fresh NZY+
medium and an aliquot of 0.2 ml was plated on LB agar supplemented with 25 µg/ml
kanamycin sulphate (Invitrogen, Calif., USA). The E.coli cells were incubated overnight
for 16h at 37°C. Figure 2.2 shows a schematic representation of the site-directed
mutagenesis (SDM) steps. Nucleotide substitutions were confirmed by DNA sequence
analysis using nucleotide Basic Local Alignment Software (BLAST by NCIB).
65
Figure 2.2: Schematic representation of the Site-Directed Mutagenesis (SDM) steps.
The diagram was adapted with modifications from the instruction manual for the
QuikChange® II XL Site-Directed Mutagenesis Kit (Stratagene).
x – Indicates positions of the mutated nucleotides both within the mutagenic primers and
newly synthesised DNA.
66
2.6 Storage of transformed E. coli cells containing recombinant plasmid with
the desired mutations
For short term storage, E. coli cells carrying the recombinant plasmid on plates
were stored at 4oC for up to one month. For longer term storage, transformed bacteria
were maintained in LB broth supplemented with 20% glycerol (v/v) and stored at -80oC.
To revive the E. coli from the glycerol stock, a sterile wire loop was placed into the
glycerol stock and cells that were picked up were streaked onto a LB agar plate
containing 25 µg/ml kanamycin. The plate was incubated for 16h overnight at 37oC.
2.7 Partial-deletion in the 5’-NTR of EV-A71 genome
EV-A71 with a partial deletion from nucleotide positions 475 to 485 in the 5’-
NTR was constructed using two designed primers that were 24 nucleotides in length
[namely EV-UTR-F(∆11) and EV-UTR-R(∆11)] (Table 2.1) and the Q5® Site-Directed
Mutagenesis Kit (New England Biolabs, USA) (Chua et al., 2008). The melting
temperature of the primers were approximately 63oC, determined using the calculation
below:
Tm = 81.5 + (0.41)(%GC) - 675/N - % mismatch,
where N = primer length in bases, (%GC) and % mismatch = whole numbers
The EV-A71 deletion mutant was confirmed by DNA sequence analysis by
nucleotide Basic Local Alignment Software (BLAST by NCIB). Bacterial colonies that
carried the viral genome with the correct mutations were kept in 20% glycerol stock at -
80oC for long term storage.
67
2.8 Plasmid isolation and purification
The recombinant EV-A71 pCR®-XL-TOPO® plasmid was isolated from 5 ml of
overnight culture of E. coli with Endofree Plasmid Purification Kit (QIAGEN, Calif.,
USA) following the manufacturer's recommended protocol. Extracted plasmid was
eluted in 300 µl of TE Buffer and stored at -20°C.
2.9 Restriction endonuclease digestion of plasmid DNA
Plasmid DNA (30 µg) purified from the E.coli transformants was digested with
EagI (New England BioLabs, Massachusetts, USA). The reaction was incubated at 37oC
in a water bath for 2h. Screening of DNA fragments after digestion of the recombinant
pCR-XL-TOPO EV-A71 plasmid was carried out using DNA agarose gel
electrophoresis. The agarose gel was pre-stained with GelRed nucleic acid stain
(Biotium, USA) prepared in 0.5X TAE buffer. DNA products were mixed with gel
loading buffer and loaded into wells in the agarose gel. Electrophoresis was carried out
using 80V and DNA bands were illuminated with UV light. The size of the DNA
fragments were compared with a GeneRuler 1 kbp DNA ladder (Invitrogen, USA).
2.10 Phenol-chloroform purification and ethanol precipitation of DNA
The DNA solution was mixed with an equal volume of phenol-chloroform
(Amresco, Calif., USA) and vortexed for 1 min. The mixture was centrifuged at 15,000
x g for 10 min to separate the aqueous and solvent phases. The desired aqueous layer
was carefully removed and mixed with an equal volume of phenol-chloroform (1:1)
(Amresco, Calif., USA) and vortexed for 1 min. The mixture was again centrifuged at
68
15,000 x g for 10 min. The aqueous layer was removed and 1/10 volume of chilled 3M
sodium acetate (pH 5.2) and 1/10 volume of isopropanol were added to the DNA sample
and mixed well by inverting the tube multiple times.
Then, the sample was incubated at -20oC for 2h to precipitate the DNA. The
DNA was pelleted by centrifugation at 15,000 x g for 30 minutes at 4oC. The
supernatant was carefully removed and 1 ml of cold 70% ethanol was added to wash off
the remaining salts. The DNA pellet was allowed to air dry for 5 minutes with the lid
opened. The desired amount of TE buffer was added into the tube in order to dissolve
the DNA.
2.11 Production of infectious EV-A71 RNA from cloned cDNA
RNA transcription was carried out using RiboMAX™ Large Scale RNA
Production System-SP6 (Promega, Calif., USA). The reaction was set up in 20 µl of
reaction volume by following the recommended protocol. The reaction mixture was
subjected to incubation at 37°C for 4h and followed by DNase treatment for 30 minutes.
The DNase (Promega, Calif., USA) was added to the in vitro transcription reaction at a
final concentration of 1 U per µg of DNA template. The Linear Control DNA supplied
by RiboMAX™ Large Scale RNA Production System-SP6 was used as a template for
production of RNA transcripts of approximately 1.8 kb in length and served as a positive
control for the in vitro transcription reaction. The in vitro transcribed EV-A71 RNA was
visualized by agarose gel electrophoresis prior to being used in transfection of RD cells
(Han et al., 2010).
69
2.12 Transfection of RD cells with in vitro RNA transcripts
RD cells were seeded in a 24-well plate and incubated for 24 h. When the cell
confluence reached about 50%, transfection was performed following the manufacturer's
instructions with the use of Lipofectamine 2000 reagent (Invitrogen, Calif., USA) with a
multiplicity of infection (MOI) of 0.1. Unbound viruses were washed away 4h after
infection and cells were then cultured in fresh medium containing 10% fetal bovine
serum. Once cytophatic effects (CPE) were observed (round and shrunken cells), the
mutated viruses were harvested.
2.13 Plaque Assay
A 6-well plate with 6 X 105 RD cells/well was prepared and incubated overnight
at 37oC in 5% CO2. Prior to viral infection, the complete growth medium (DMEM
supplemented with 10% FBS) was removed and approximately 1 mL serial 10-fold
dilutions of virus inoculum was added to the cells for 1 h at room temperature with
gentle shaking to allow for virus attachment. After 1 h incubation, the inocula was
removed and replaced with 2 mL of 1.2% w/v carboxylmethylcellulose. After 72 h
incubation, the plaque medium was removed and the cells were fixed with 4%
formaldehyde and stained with 0.5% crystal violet. The plaques were visible against a
white background. The plaque forming unit per millilitre (PFU/ml) was calculated using
the formula:
PFU/ml = Number of plaques X Dilution factor
Volume of inoculum (mL)
70
2.14 Tissue Culture Infectious Dose (TCID50) Assay
The EV-A71 mutant virus titers were quantitatively determined by TCID50.
TCID50 refers to the quantity of a virus that will produce a cytopathic effect in 50% of
the cultures inoculated. The TCID50 assay was carried out in RD cells using the Reed
and Muench formula (Appendix VII). A monolayer of RD cells from a 75cm2 tissue
culture flask was harvested after trypsinization with 3 ml of trypsin-EDTA (Gibco,
Calif., USA) and the addition of MEM growth media to obtain a final concentration of 1
x 103 cells /μl.
To assay the number of infectious virions in a purified virus stock, serial 10-fold
dilutions of the stock virus suspension in quadruplicates, were carried out in a 96-well
microtiter plate using MEM growth media as diluent. The negative control wells
contained RD cells without any virus. The plate was incubated at 37oC and observed
daily for CPE up to 48h.
2.15 Real-Time RT-PCR
Total RNA was extracted from various EV-A71 mutant strains grown in RD
cells the inocula using the RNeasy extraction kit (Qiagen, USA). Quantitative real-time
PCR was performed using the Applied Biosystems 7500 Sequence Detection system
(Applied Biosystems, USA), with 4 μl of RNA template, 10 μl of 2x SensiFAST probe
No-ROX One Step Mix, 0.8uL Forward and Reverse primer (10uM), 0.2 µL probe
(10uM), 0.2 µl reverse transcriptase, and 0.4 µL RiboSafe RNase inhibitor (BioLine,
California, USA) contained in 20 μl of the final reaction mixture. The reaction was
71
performed for one cycle at 48oC for 10 min, 95°C for 2 min, followed by 40 cycles at
95°C for 5s and 60°C for 20s in a 96-well plate. Three independent experiments were
conducted for each sample. Threshold cycle value (Cq) data was determined using
default threshold settings, and the mean Cq was calculated from the duplicate PCRs. A
standard graph was plotted based on a series of standard solutions.
2.16 EV-A71 VPl Immunoblot
Total cellular proteins were extracted by incubating wild-type and EV-A71
mutant cells in lysis buffer (20 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 137 mM NaCl,
50 mM EDTA, protease inhibitor mixture and 1 mM phenylmethylsulfonyl fluoride).
After centrifugation at 14,000 x g for 10 min at 4°C, supernatants were transferred and
mixed with an equal amount of protein sample buffer (120 mM Tris-HCl, pH 8.0, 20%
glycerol, 4% SDS, 2.5% β-mercaptoethanol and 0.05% bromophenol blue). Lysates
were separated by SDS-PAGE and transferred to nitrocellulose membrane (Millipore,
Calif., USA) that had been blocked with 5% BSA in Tris-Buffered Saline and Tween 20
(TBST) buffer for 1 h at room temperature. The membrane was then incubated overnight
at 4°C with anti-enterovirus VP1 monoclonal antibody (LifeSpan BioSciences, Calif.,
USA) diluted in the blocking buffer. After hybridization with primary antibody, the
membrane was washed three times with TBST before hybridizing with anti-mouse HRP
secondary antibody (Sigma Aldrich, St Louis, USA) diluted in TBST. The blots were
then washed three times with TBST and detected by chemiluminescence using
ImageQuant (GE Healthcare Life Sciences, Calif., USA).
72
2.17 Immunization of mice
Inbred Balb/c mice were purchased from Monash University. All institutional guidelines
for animal care and use were strictly followed throughout this study. Heat inactivation of
EV-A71 virus was carried out for 30 min at 56oC and the PFU determined. Groups of 5
adult (6 weeks old) female Balb/c mice were intraperitoneally immunized with either
103 TCID50 of EV-A71 mutant strain or the positive control EV-A71 strain 41 (103
TCID50) in a 50% emulsion of Freund’s complete adjuvant (Sigma Aldrich, Calif.,
USA). Two booster doses in 50% emulsion with Freund’s incomplete adjuvant (Sigma
Aldrich, Calif., USA) were administered to the mice at 3 weeks intervals. The volume of
each vaccine suspension administered was 400 μl. The blood from the mice were
collected 7 days after the last immunization. To collect the immune sera, blood was
centrifuged at 6000 x g for 15 min to precipitate the blood cells. Sera containing EV-
A71-neutralizing antibodies were pooled and stored at -80oC until use.
2.18 EV-A71 neutralization assay.
The presence of neutralizing antibodies against EV-A71 was determined by an in vitro
microneutralization assay using RD cells, as described previously (Foo et al., 2007).
Murine antisera were first incubated at 56°C for 30 min to inactivate the complement
activity. Briefly, 25 µl of twofold serial dilutions of the heat-treated serum was
coincubated with an equal volume containing 103 50% tissue culture infective doses of
virus (TCID50) in a 96-well microtiter plate. Two hours later, 5 X 104 RD cells were
added to each well and incubated at 37°C for 48 h. The cells were examined for CPE
after 48h and the neutralizing antibody titer was defined as the highest dilution of serum
73
that inhibited virus growth by 100%, thereby preventing CPE. The assay was performed
three times independently.
2.19 IgG-subtying
The profiles of specific IgG subtypes in the mice hyperimmune sera were determined by
a commercially available mouse sub-type isotyping kit (Thermo Scientific., Rockford,
USA) according to the manufacturer’s instructions. Pouches of cassettes from the kit
were removed from refrigeration and equilibrated fully to room temperature. Mouse
serum was diluted 1:100 by adding 50 µL of serum to 450 µL of sample diluent and
vortexed to mix. The diluted sample (150µL) was added to the well of each cassette.
Red colour bands appeared after 5-10 minutes. In brief, the gold conjugates embedded in
the cassette form specific class- and subclass-soluble complexes with the antibodies in
the serum sample. These complexes travel the length of the membrane and are resolved
on the anti-isotype and class-specific antibody-impregnated membrane. Results are
displayed as a red band indicating the antibody isotype or subclass.
2.20 Bioinformatics Analysis
The protein sequence of EV-A71 viral proteins was analysed and alignment of the amino
acid sequences was undertaken by using the Clustal method of DNASTAR MegAlign.
Predictions of 5’NTR secondary structures of probable base pairs predictions, which
might include pseudoknots was conducted by using databases such as RNA Structure at
Rochester University: http://rna.urmc.rochester.edu/RNAstructureWeb/index.html and
the mfold Web Server at http://molbiol-tools.ca/RNA_analysis.htm.
74
2.21 Statistical Analysis
Means ± standard deviations were obtained from at least two independent biological
replicates. Statistical significance was calculated using the Mann-Whitney test. A P
value of < 0.05 was considered as statistically significant.
75
CHAPTER 3
RESULTS
3.1 Molecular Basis of Pathogenicity
It remains to be investigated if there is a universal molecular determinant present
in every EV-A71 fatal sub-genotype strain or whether every fatal sub-genotype strain
differs in virulence determinant. Yeh et al. (2011) reported that the virulence
determinant in an EV-A71 sub-genotype B1 (clinical isolate 237) was a single
nucleotide change from cytosine to uridine at position 158. The EV-A71 sub-genotype
B4 virus (accession number: AF316321) was genetically modified to carry a single
mutation at nucleotide position 158 by site-directed mutagenesis to assess if the
nucleotide is a common virulence determinant between sub-genotypes B4 and B1. The
effect of this change was evaluated by qualitative assays such as cytopathic effects
(CPE) in Rhabdomyosarcoma (RD) cells. Mutant EV-A71 158 (A158T) had minimal
CPE when transfected into RD cells with a MOI of 0.1 (Figure 3.1A) as compared to the
positive control (EV-A71 wild type strain 41) (Figure 3.1C). CPE was seen as round and
shrunken cells that floated on the surface and there was extensive CPE seen with the
EV-A71 wild type strain 41 cells. All experiments were repeated at least three times on
separate days.
76
(A)
(B) (C)
Figure 3.1: Cytopathic effects (CPE) caused by (A) the mutant EV-A71 158
(A158T) in Rhabdomyosarcoma (RD) cells in comparison with (B) uninfected RD
cells (negative control using Opti-MEM) and (C) EV-A71 wild type strain 41
infected RD cells (positive control). Transfection of infectious RNA into RD cells was
performed with the use of Lipofectamine 2000 reagent using EV-A71 mutants with a
MOI of 0.1. CPE was seen as round and shrunken cells that eventually dislodged from
the surface. Magnification used (X 100).
77
The EV-A71 strain 41 virus was also genetically modified by substituting
nucleotides at positions 475, 486, and 487 as these nucleotides were responsible for the
neuro-virulence of poliovirus Sabin strains 1, 2 and 3 (Table 1.4). The virulence
determinants of poliovirus and EV-A71 reported in previous studies served as references
in this study to produce EV-A71 viruses that might become highly attenuated. The
mutant EV-A71 475 (C475T) (Figure 3.2A) caused the lowest CPE in RD cells when
compared to mutants 486 (A486G) (Figure 3.3A) and 487 (G487A) (Figure 3.4A). Out
of the three mutants, A486G demonstrated the highest amount of CPE (Figure 3.3A) as
evident from the rounding and shrunken nature of many cells. EV-A71 mutant 487
(G487A) displayed intermediate CPE when transfected into RD cells with a MOI of 0.1
(Figure 3.4A).
78
(A)
(B) (C)
Figure 3.2: Infection of RD cells by (A) the mutant EV-A71 475 (C475T) in RD cells
in comparison with (B) uninfected RD cells (negative control using Opti-MEM) and
(C) EV-A71 wild type strain 41 infected RD cells (positive control). Transfection of
infectious RNA into RD cells was performed with the use of Lipofectamine 2000
reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as round and shrunken
cells that eventually dislodged from the surface. Magnification used (X 100).
79
(A)
(B) (C)
Figure 3.3: CPE caused by (A) the mutant EV-A71 486 (A486G) in RD cells in
comparison with (B) uninfected RD cells (negative control using Opti-MEM) and
(C) EV-A71 wild type strain 41 infected RD cells (positive control). Transfection of
infectious RNA into RD cells was performed with the use of Lipofectamine 2000
reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as round and shrunken
cells that eventually dislodged from the surface. Magnification used (X 100).
80
(A)
(B) (C)
Figure 3.4: CPE caused by (A) the mutant EV-A71 487 (G487A) in RD cells in
comparison with (B) uninfected RD cells (negative control using Opti-MEM) and
(C) EV-A71 wild type strain 41 infected RD cells (positive control). Transfection of
infectious RNA into RD cells was performed with the use of Lipofectamine 2000
reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as round and shrunken
cells that eventually dislodged from the surface. Magnification used (X 100).
81
Analysis of the genomic sequences of two EV-A71 strains, one isolated from a
non-fatal case and another isolated from a fatal case shows that the single nucleotide (nt)
difference between the fatal strain (EV-A71 strain 5865/Sin/000009, designated as strain
41), and the non-fatal strain (EV-A71 strain 5666/Sin/002209, designated as strain 10)
might be responsible for neuro-virulence. This is based on the previous study by Singh
et al. (2002) where they indicated the difference between the fatal and non-fatal strain is
at nucleotide (nt) position 5262. In the current investigation, the Adenine residue at
position 5262 present in the fatal strain (strain 41) was changed to the Guanine residue.
Based on the morphology as shown in Figure 3.5A, RD cells showed no CPE as cells
were relatively healthy when compared to the extensive lysis observed with the positive
wild type control (Figure 3.5C). There was hardly any floating cells observed and this is
similar to no CPE being observed with the negative control (without virus) (Figure
3.5B).
82
(A)
(B) (C)
Figure 3.5: Infection of RD cells by (A) the mutant EV-A71 5262 (A5262G) in RD
cells in comparison with (B) uninfected RD cells (negative control using Opti-
MEM) and (C) EV-A71 wild type strain 41 infected RD cells (positive control).
Transfection of infectious RNA into RD cells was performed with the use of
Lipofectamine 2000 reagent using EV-A71 mutant 5262 with a MOI of 0.1. CPE was
seen as round and shrunken cells that eventually dislodged from the surface (C).
Magnification used (X 100).
83
An EV-A71 mutant that carried a partial deletion in the 5’-NTR region in the
viral genome was also constructed. This was carried out to reduce the efficiency of viral
replication as Iizuka et al. (1989) had created a deletion in this region to generate
genetically stable poliovirus (Iizuka et al., 1989). In this study, deletion was created
from nt. positions 475 to 485 (∆11). The mutant EV-A71 PD (Partial Deletant 5’-NTR)
did not show any CPE (Figure 3.6A) and the microscopic image showed similarity with
the image taken from the uninfected RD cells that acted as a negative control (Figure
3.6B). These microscopic images are in direct contrast to the extensive CPE microscopic
image recorded for the EV-A71 wild type strain 41 (Figure 3.6 C).
84
(A)
(B) (C)
Figure 3.6: Infection of RD cells by (A) the mutant EV-A71 PD (Partial Deletant 5’-
NTR) in RD cells in comparison with (B) uninfected RD cells (negative control
using Opti-MEM) and (C) EV-A71 wild type strain 41 infected RD cells (positive
control). Transfection of infectious RNA into RD cells was performed with the use of
Lipofectamine 2000 reagent using EV-A71 mutants with a MOI of 0.1. CPE was seen as
round and shrunken cells that eventually dislodged from the surface (C). Magnification
used (X 100).
85
3.2 Quantification of Viral RNA Copy Number
Observation of CPE in Rhabdomyosarcoma (RD) cells is a qualitative indication
of the extent of infectivity of the various mutants in comparison with the EV-A71 wild
type strain 41. Approaches such as determination of the viral RNA copy number, plaque
forming units (PFU), 50% tissue culture infectious doses (TCID50) and amount of viral
capsid protein 1 (VP1) present in each strain will enable a better quantitative comparison
of attenuation of the various mutant strains. The viral RNA copy number of the various
EV-A71 mutant strains was evaluated after growing in the Rhabdomyosarcoma (RD)
cell culture for 24 hours.
RD cells infected with the wild type EV-A71 strain 41 gave the highest yield of
viral RNA copy number (5.5 X103). As for EV-A71 mutant 475 and PD, low copy
number was detected for both mutants at 1.02 X 102 and 1.05 X 102 viral RNA,
respectively. From Figure 3.7, there are a few positions that appear to attenuate the virus
when the mutated strains were evaluated in vitro. For example, EV-A71 mutant 158
mutated at position 158 (A158T) gave a yield of 2.0 X 103 RNA copy number which is
slightly less than that of the wild type RNA copy number. Amongst all the mutants
being evaluated, mutant 486 carrying SDM at position 486 (A486G) expressed the
highest viral RNA copy number of 4.2 X103 when compared to the wild type strain 41.
The mutant 487 carrying SDM at position 487 (G487A) produced a viral RNA copy
number of 2 X 102. The mutant 5262 with a SDM at position 5262 also showed much
reduced viral RNA copy number of 7 X 102. Attenuated strains with low viral RNA
copy number are possible good vaccine strains as they cannot replicate fast enough and
86
yield high viral load to cause destruction of the tissue cells. Slow replication could infer
that the cells could still carry enough antigens to stimulate an immune response.
Based on the viral RNA copy number, the mutations introduced at positions 486
and 158 have contributed to slight attenuation of the infectivity but both of the mutants
are not suitable to serve as live attenuated vaccine strain (LAV). The mutation
introduced at position 5262 had considerably reduced the viral RNA copy number to 10-
fold less when compared to the wild type copy number. Therefore, mutant 5262 will
need to be further evaluated on plaque forming units, TCID50 and the amount of VP1
formed. Minimal RNA copy number (1.2 X 10²) was expressed by mutants 487, 475 and
PD. These three mutants appear to hold promise and will be subjected to further
evaluation tests to assess whether they could serve as potential LAV strains.
87
Figure 3.7: Quantification of Viral RNA Copy Number.
The viral RNA copy number was quantified at 24h post-infection by TaqMan Real-Time
PCR. Viral RNA copy numbers are the average of three biological replicates; Error bars
represent the standard deviation of the mean.
88
3.3 Quantitation of virus by tissue culture infectious dose (TCID50)
The tissue culture infectious dose (TCID50) for the EV-A71 wild type strain 41
and mutant virus titers were quantitatively determined. TCID50 refers to the quantity of
virus that will produce a cytopathic effect in 50% of the cultures inoculated.
89
Neat -1 -2 -3 -4 -5 -6 -7 -8 (-)C
Fig. 3.8: Schematic diagram of the TCID50 assay for enumerating EV-A71 viruses. The virus samples were added to column 1 and serially diluted 1:10 across
the plate to column 9 (added directly to the cells). The negative control – (C) wells contained RD cells without any virus. The wells that have red spots indicate
cell death while red wells indicate healthy cells. The TCID50 assays were performed on monolayer RD cells incubated at 37oC and were repeated at least two
separate times.
Wt
()
A158T
A486G
A5262G
G487A
C475T
PD
90
Table 3.1: Tissue Culture Infectious Dose 50 (TCID50) of EV-A71 mutants in
comparison with EV-A71 strain 41 and the negative control.
The plate was incubated at 37oC and observed daily for CPE up to 48h. The TCID50
/ml
values are calculated using the Reed and Muench formula (Reed, and Muench, 1938)
determined from at least two independent experiments. The formula is presented in
Appendix VII.
EV-A71 Mutants TCID50
A158T 1.00 X 104
C475T 1.00 X 106
A486G 1.00 X 104
G487A 7.50 X 105
A5262G 3.41 X 105
Partial Deletant (PD) 5’-NTR 1.00 X 106
Positive Control (EV-A71 strain 41) 1.00 X 103
91
This study also further investigated whether the different EV-A71 mutants
exhibited reduced EV-A71 viral growth. As shown in Table 3.1, EV-A71 mutant 158 at
position 158 demonstrated a higher TCID50 of 1.00 X 104 when compared against the
positive control EV-A71 wild type strain 41 (TCID50 of 1.00 X 103). This indicates that
EV-A71 mutant 158 would require a higher quantity of virus (approximately 10 times)
to produce a cytopathic effect in 50% of the cultures inoculated (Figure 3.8).
In addition, the mutant 486 carrying SDM at position 486 also had 10 times
increased value of TCID50 value (1.00 X 104) when compared with the positive control
EV-A71wild type strain 41, suggesting that the mutant had decreased virulence. Both
mutants 5262 with a SDM at position 5262 and mutant 487 showed more than 100-fold
increase in TCID50 value when compared against the EV-A71 wild type strain 41.
Mutant 475 with SDM at position 475 and mutant PD both showed a significant 1000
fold increase in TCID50 to 1.00 X 106 (Table 3.1).
Analysis of the TCID50 values indicates that mutant 475 and the partial deletant
(PD) required higher doses of viruses to cause cytopathic effects in 50% of the tissue
culture. Thus, mutants 475 and PD may serve as potential LAV candidates for further
evaluations by other tests in vitro.
92
3.4 Quantification of virus by the plaque assay
The number of plaques produced by the various EV-A71 mutant strains was
evaluated in the Rhabdomyosarcoma (RD) cell culture by plaque assays. Our objective
is to evaluate the ability of the various mutants to form plaques. Prior to viral infection,
the complete growth medium was removed and 1 mL of 10-fold dilutions of virus
inoculum was added to the cells and incubated for 1 h at 37oC. After 1 h incubation, the
inoculum was removed and replaced with 3 mL of 1.2% w/v CMC. After 72 h
incubation, the plaque medium was removed and the cells were fixed with 4%
formaldehyde and stained with 0.5% crystal violet stain.
93
(a) EV-A71 (Strain 41) (158) (475) (486)
(5.0 x 107 PFU/mL) (20 x 104 PFU/ml) (7.0 x 104 PFU/mL) (35 x 104 PFU/ml)
Viral count: 5.0x107 2.0x105 7.0x104 3.5x105
(b) EV-A71 (487) (5262) (PD) Negative Control
(10 x104 PFU/mL) (18 x 104 PFU/mL) (9.0 x 104 PFU/mL) (0 PFU/mL)
Virus titer: 1.0x105 1.8x105 9.0x104 0
Figure 3.9: Quantification of plaque forming units by EV-A71 mutants and wild
type EV-A71 strain 41.
(a) Quantification of plaque forming units by the wild type EV-A71 strain 41, mutants
158, 475, and 486.
(b) Quantification of plaque forming units by the EV-A71 mutants 487, 5262, partial
deletant 5’-NTR (PD) and the negative control (uninfected RD cells). The plaque assays
were performed on monolayer RD cells incubated at 37oC and were repeated at least two
separate times.
94
Figure 3.10: Plaque Forming Units by EV-A71 mutants and the wild type EV-A71
strain 41.
RD cells were transfected with EV-A71 mutants and the wild type EV-A71 strain 41 at a
MOI of 0.1. Plaque formation was observed 72 hours post-infection. PFU numbers are
the average of two biological replicates; Error bars represent the standard deviation of
the mean.
158 475 486 487 5262 PD (-) C (+) C
95
RD cells infected with the wild type EV-A71 strain 41 gave the highest number
of plaques (5.0 x 107 PFU/mL). The least number of viral plaques were formed by the
mutant 475 carrying SDM at position 475 (7.0 x 104 PFU/mL) and the partial deletant
(PD) in the 5’-NTR (9.0 x 104 PFU/mL) (Figure 3.10).
From analysis of the data presented in Figure 3.10, there are a few positions in
the viral genome that are likely to attenuate the virus. The EV-A71 mutant 158 (SDM at
position 158) gave a yield of 2.0 x 105 PFU/ml and the mutant 486 also had reduced
plaque number (3.5 x 105 PFU/ml) when compared to the positive control (EV-A71wild
type strain 41), albeit at a much higher copy number than the mutant 487 carrying SDM
at position 487 (1.0 x105 PFU/mL). The mutant 5262 with a SDM at position 5262 also
showed much reduced plaque number (1.8 x 105 PFU/mL). As the ability to form
plaques is reduced for certain mutant strains, viral growth is lower. This would mean
that viraemia caused by a lower number of viruses will be milder as viral load would
affect pathogenicity.
96
3.5 Western Blotting
The ability of the various mutated EV-A71 strains to produce viral particles
could be evaluated by detection of VP1 by immunoblotting with the monoclonal
antibody directed at VP1. Supernatant derived from transfected RD cells was processed
and subjected to electrophoresis to separate the EV-A71 total proteins. The amount of
VP1 present in each mutant was assessed by the Western blot analysis. A single band
was revealed at an approximate molecular weight (MW) of 32kDa (Figure 3.10). This
band corresponds to the VP1 monomer with an apparent MW of 32.7kDa.
97
M 1 2 3 4 5 6 7 8
Figure 3.11: Western blot analysis using monoclonal antibody against VP1 as the
primary antibody.
The amount of EV-A71 total proteins and β-actin loaded in each lane was 5 μg. The
lanes are as follows: lane M, molecular weight marker (from 10 - 250 kilodaltons), lane
1, EV-A71 Mutant 158; lane 2, EV-A71 Mutant 475; lane 3, EV-A71 Mutant 486; lane
4, EV-A71 Mutant 487; lane 5, EV-A71 Mutant 5262; lane 6, EV-A71 Mutant Partial
Deletant (PD) 5’-NTR; lane 7, Positive control (EV-A71 Virus); lane 8, Negative
control (RD cells). The molecular weights of the EV-A71 protein and β-actin are 36 kDa
and 32.7 kDa, respectively. Arrow indicates the presence of VP1 in respective lanes.
β-actin
42 k
70
35
98
RD cells infected with the wild type EV-A71 strain 41 (Lane 7) demonstrated the
largest amount of VP1 protein (32.7 kDa) detected in Western blot analysis. Minimal
amount of VP1 was detected in the mutant strain 475 carrying the site specific mutation
at position 475 (Lane 2) and the partial deletant (PD) in the 5’-NTR (Lane 6). This was
consistent with results from plaque assays, TCID50, and RT-PCR. From Figure 3.10,
there are a few nucleotide (nt) positions in the viral genome that are likely to attenuate
the virus as we can observe the amount of viral capsid VP1 being formed are less than
the amount of VP1 being formed by the wild type strain 41. For example, EV-A71
mutant 158 at position 158 (Lane 1) and mutant 5262 (Lane 5) showed much reduced
amounts of viral VP1 protein when compared to the wild type EV-A71 (Lane 7).
99
3.6 Determination of neutralizing antibody titer elicited by the EV-A71 wild
type strain 41 in comparison with the various EV-A71 mutants.
Eight groups of 5 female Balb/c mice were immunized intraperitoneally with
either the heat-inactivated EV-A71 mutants 158, 475, 486, 487, 5262, PD, and the EV-
A71 strain 41 or PBS which represented positive and negative controls, respectively.
The neutralizing activities of individual antisera obtained from the same group of mice
were determined by an in vitro microneutralization assay. The infectivity of the various
EV-A71 mutants and the EV-A71 wild type strain 41 was observed in RD cells over a
period of 48 hours.
The anti-EV-A71 wild type immune serum allowed complete protection from
cytopathic effect (CPE) of the RD cells at serum dilutions up to 1:32 (Figure 3.12).
Complete protection of RD cells from CPE was also observed with serum dilutions
ranging from neat to 1:32 for antisera obtained from mice immunized with the EV-A71
mutants 5262 (A5262G) (Figure 3.17) and PD (Figure 3.18). In contrast, the neutralizing
activity of antisera from mice immunized with the EV-A71 mutant 158 (A158T) against
the EV-A71 wild type strain 41 was significantly lower with a neutralizing antibody titer
of 1:8 (Figure 3.13). However, the pooled antisera from mutants 475 (C475T) (Figure
3.14), 486 (A486G) (Figure 3.15), and 487 (G487A)-immunized mice (Figure 3.16),
displayed similar neutralizing activity with each other and with a neutralizing antibody
titer 1:16. These data demonstrate that the neutralizing levels of the immune sera
obtained from the mutants 5262 (A5262G) (Figure 3.17) and PD-immunized mice
(Figure 3.18) were as good as those elicited by the wild type strain 41. Mice immunized
with the mutants 475 (C475T), 486 (A486G) and 487 (G487A) contained 2-fold less
100
neutralizing antibodies than the levels observed with those elicited by the wild-type
strain 41, mutants 5262 and the PD (Table 3.2).
Table 3.2: Neutralizing antibody titers elicited by heat-inactivated EV-A71 mutants
and EV-A71 strain 41 in mice.
Two-fold serial dilutions of heat-inactivated serum were co-incubated with 103 TCID50
in a 96-well plate. Two hours later, 5 X 104 RD cells were added to each well and
incubated at 37°C. The cells were examined for CPE after 48h.
Immunogen Neutralizing Antibody Titer
Positive Control (EV-A71 strain 41) 1:32
A158T 1:8
C475T 1:16
A486G 1: 16
G487A 1: 16
A5262G 1:32
Partial Deletant(PD)5’-NTR 1:32
101
(A) Neat (B) 1:8
(C) 1:16 (D) 1:32
(E) 1:64
Figure 3.12: In vitro microneutralization assay using pooled antisera from mice
(n=5) immunized with the heat-inactivated EV-A71 wild type strain 41. RD cells
were infected with 103 TCID50 EV-A71 pre-incubated with various dilutions of anti-EV-
A71 immune serum. Survival of RD cells was observed with the neat serum (A);
antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); antiserum dilution of 1:32
(D); but not with antiserum dilution of 1:64 (E).
102
(A) Neat (B) 1:8
(C) 1:16
Figure 3.13: In vitro microneutralization assay using pooled antisera from mice
(n=5) immunized with the heat-inactivated EV-A71 mutant 158 (A158T). RD cells
were infected with 103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-
EV-A71 mutant 158 (A158T) immune serum. Survival of RD cells was observed with
the neat antiserum (A); antiserum dilution of 1:8 (B); but not with antiserum dilution of
1:16 (C).
103
(A) Neat (B) 1:8
(C) 1:16 (D) 1:32
Figure 3.14: In vitro microneutralization assay using pooled antisera from mice
(n=5) immunized with the heat-inactivated EV-A71 mutant 475 (C475T). RD cells
were infected with 103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-
EV-A71 mutant 475 (C475T) immune serum. Survival of RD cells was observed with
the neat antiserum (A); antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); but
not with antiserum dilution of 1:32 (D).
104
(A) Neat (B) 1:8
(C) 1:16 (D) 1:32
Figure 3.15: In vitro microneutralization assay using pooled antisera from mice
(n=5) immunized with the EV-A71 mutant 486 (A486G). RD cells were infected with
103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-EV-A71 mutant
486 (A486G) immune serum. Survival of RD cells was observed with the neat antiserum
(A); antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); but not with antiserum
dilution of 1:32 (D).
105
(A) Neat (B) 1:8
(C) 1:16 (D) 1:32
Figure 3.16: In vitro microneutralization assay using pooled antisera from mice
(n=5) immunized with the EV-A71 mutant 487 (G487A). RD cells were infected with
103 TCID50 EV-A71 pre-incubated with various dilutions of the anti-EV-A71 mutant
487 (G487A) immune serum. Survival of RD cells was observed with the neat antiserum
(A); antiserum dilution of 1:8 (B); antiserum dilution of 1:16 (C); but not with antiserum
dilution of 1:32 (D).
106
(A) Neat (B) 1:8
(C) 1:16 (D) 1:32
(E) 1:64
Figure 3.17: In vitro microneutralization assay using pooled antisera from mice
(n=5) immunized with the EV-A71 mutant 5262 (A5262G). Survival of RD cells was
observed with the neat antiserum (A); antiserum dilution of 1:8 (B); antiserum dilution
of 1:16 (C); antiserum dilution of 1:32 (D); but not with antiserum dilution of 1:64 (E).
107
(A) Neat (B) 1:8
(C) 1:16 (D) 1:32
(E) 1:64
Figure 3.18: In vitro microneutralization assay using pooled antisera from mice (n=5)
immunized with the heat-inactivated EV-A71 mutant PD (deletant in the 5’NTR). Survival
of RD cells was observed with the neat antiserum (A); antiserum dilution of 1:8 (B) antiserum
dilution of 1:16 (C); antiserum dilution of 1:32 (D); but not with antiserum dilution of 1:64 (E).
108
3.7 Analysis of IgG responses elicited by EV-A71 Mutants
One of the goals for vaccination is to induce a strong and long memory humoral
and cellular immune response and protect against the targeted infectious agent. A good
vaccine should contain epitopes that can induce both B-cell and T-cell immune
responses. Besides induction of either B-cell or cytotoxic T-cell (CD8+) responses, the
induction of helper T-cells (CD4+) is essential as it mediates the immune responses. For
example, helper T cells help to activate cytotoxic T cells. Helper T cells can be divided
into two subsets of effector cells based on their functional capabilities and the cytokines
produced. The Th1 subset of CD4+ T helper cells secretes cytokines such as IFN-γ, IL-2
and TNF-β and induces cell mediated immunity. The Th-2 cells produce cytokines such
as IL-4 and IL-5 and help B cells to proliferate and stimulate a humoral response. The
Th-1 cells promote the production of immunoglobulin IgG2a in mice and CD8+
cytotoxic T cells. To clear viruses from the infected cells, cytotoxic T cells (CD8+) seek
out the infected cells and killing them. The Th-2 cells promote the production of IgG1 in
mice.
An ideal live attenuated vaccine is expected to be safe and provide protective
immunity by inducing both humoral and cellular immunity. Protective immunity against
viruses conferred by the LAV can be mediated by the secretion of neutralizing
antibodies and the production of cytotoxic CD8+ cells. In this study, the isotypic
distributions of IgG antibodies elicited by the mutant strains of EV-A71 (mutants 158,
475, 486, 487, 5262 and PD) in response to immunization in mice were analysed.
109
(a) EV-A71 (158) (475) (486) (487)
(b) EV-A71 (5262) (PD) Negative Control Strain 41
Figure 3.19: IgG1 and IgG2 responses elicited by EV-A71 Mutants and Controls.
(a) Red bands correspond to IgG2a and IgG2b for EV-A71 mutants 158, 475, 486 and
487. (b) EV-A71 mutants 5262, partial deletant 5’-NTR, negative control and wild type
EV-A71. The IgG isotyping assays were repeated at least two separate times.
110
(a) EV-A71 (158) (475) (486) (487)
(b) EV-A71 (5262) (PD) Negative Control Strain 41
Figure 3.20: IgG3, IgA and IgM responses elicited by EV-A71 Mutants and
Controls.
(a) Red bands correspond to IgG3, IgA and IgM for EV-A71 mutants 158, 475, 486 and
487. (b) EV-A71 mutants 5262, partial deletant 5’-NTR, negative control and wild type
EV-A71. The IgG isotyping assays were repeated at least two separate times.
111
Examination of the profiles of specific IgG subtypes in the mice antisera
revealed that IgM, IgA, IgG2a and IgG2b antibodies were predominantly produced in
pooled immune sera raised against the six EV-A71 mutants, and at levels comparable to
that measured in the pooled immune sera obtained from mice immunized with the heat-
inactivated homologous EV-A71 whole virion. It was based on the observation of red
bands from the mouse sub-type isotyping kit that showed red bands corresponded to
isotypes IgM, IgA, IgG2a and IgG2b. This was consistent with previous studies that
showed mouse infection with various viruses triggered an antiviral antibody response
that was largely restricted to the IgG2a isotype (Coutelier et al., 1987). In addition,
among the four antibodies (IgG1, IgG2a, IgG2b, IgG3), it was reported that IgG2a
delayed the onset and progression of lactate dehydrogenase-elevating virus (LDV)
induced polio-encephalomyelitis more than the other subtypes. This suggested that the
IgG2a predominance observed in many IgG antibody responses elicited by live viruses
may potentially correspond to the selection of the best protection for the infected host
(Markine-Goriaynoff and Coutelier, 2002).
In contrast, the levels of IgG1 and IgG3 measured in pooled immune sera from
mice immunized with the EV-A71 mutants were not significantly different from the
levels measured in the negative control mice while those measured in the pooled
immune sera from mice immunized with the heat-inactivated EV-A71 whole virion
showed significantly more intense red bands corresponding to the IgG isotypes,
respectively. The presence of the IgA in the antisera indicates the induction of mucosal
immunity. Generally, IgG1 in mice is associated with a Th2 profile and IgM, IgA, IgG2
and IgG3 are mainly associated with a Th1 profile (Banerjee et al., 2010). Altogether,
these data indicate that the intraperitoneal administration of heat-inactivated EV-A71
112
mutants 158, 475, 486, 487, 5262 and PD and the homologous EV-A71 whole virion
triggered a stronger Th1 response which is cell mediated immunity.
113
CHAPTER 4
DISCUSSION
Previous studies by Arita et al. (2005) showed that cynomolgus monkeys
immunized with an EV-A71 (S1-3’) mutant strain still developed mild neurological
symptoms, although there was reduced virulence. They had attempted to develop a live-
attenuated vaccine (LAV) against EV-A71 by introducing 3 mutations at nucleotides
485, 486 and 475 in the EV-A71 genotype A genome which corresponded to the
mutations present in Sabin 1, 2 and 3, respectively. However, the virus still caused
tremors and was isolated from the spinal cord. Hence, this strain did not meet the criteria
to be used as a LAV.
Therefore, we examined EV-A71 sub-genotype B4, strain 41 (5865/Sin/000009)
to generate attenuated EV-A71 strains. We genetically modified the EV-A71 virus by
substituting nucleotides at positions 475, 486, and 487 based on the fact that these
nucleotides are responsible for the neurovirulence of poliovirus Sabin strains 1, 2 and 3
(Table 1.4). The virulence determinants of poliovirus and EV-A71 reported in previous
studies served as references in this study to produce EV-A71 viruses that are highly
attenuated. In addition, we also investigated if EV-A71 sub-genotype B4 has a different
virulence determinant from the sub-genotype B1 (clinical isolate 237) (Yeh et al., 2011).
The EV-A71 sub-genotype B4 virus was modified to carry a mutation at nucleotide
position 158 to assess if the nucleotide is a common virulence determinant between the
sub-genotypes B4 and B1 (Fig. 1.9).
114
Liu et al. (2014) found that there were nine amino acid substitutions (H22Q,
P27S, N31S/D, E98K, E145G/Q, D164E, T240A/S, V249I, A289T) that were detected
after aligning the VP1 sequences of fatal and mild EV-A71 strains of sub-genotype C4
(Liu et al., 2014). As such, these residues maybe potential virulence determinants in
VP1 and could convert mild EV-A71 cases into severe cases. The study was consistent
with previous investigations by Chang et al. (2012) who observed that the E145Q
substitution at the 5’-NTR was a common difference in the EV-A71 genome of mild and
fatal cases of HFMD. Additionally, they also discovered that strains isolated from
patients with fatal outcomes had greater substitutions in the 5’-NTR and IRES regions
(Chang et al., 2012). This is to be expected as these regions were responsible for
receptor binding and cap-independent translation of viral proteins. The position of a
certain specific amino acid in the genome may have a profound significance on
virulence. For example, it was reported that the presence of Asn at position 165 of VP2
in Coxsackievirus B3 was responsible for a cardio virulent phenotype (Knowlton et al.,
1996).
It remains to be investigated if there is a universal molecular determinant present
in every EV-A71 fatal strain or whether every fatal strain differs in virulence
determinant depending on their sub-genotype. An EV-A71 mutant bearing a long
deletion in the 5’-NTR of the genome was also constructed. In addition, the single nt.
difference between the fatal (strain 41) and non-fatal strain (strain 10) of EV-A71 (sub-
genotype B4) is examined for neuro-virulence by changing the nt. substitution at
position 5262 in the EV-A71 viral genome (Singh et al., 2002). However, as exemplified
by the human immunodeficiency virus, laboratory strains are sometimes so
115
phenotypically and genotypically distinct from those found in infected individuals that
therapeutic or preventative measures effective against these laboratory strains do not
always correlate with naturally circulating strains (Mascola et al., 1996).
The virulence of the various mutated EV-A71 strains was evaluated in the
Rhabdomyosarcoma (RD) cell culture by plaque assays, viral infectivity by tissue
culture infectious dose (TCID50) determinations, real time Reverse-Transcriptase
Polymerase Chain Reaction (RT-PCR) and detection of VP1 by immunoblotting as well
as in vivo studies. The TCID50 for the EV-A71 wild type strain 41 and mutant virus titers
were quantitatively determined. The lower the virulence of a mutant strain, the higher
the TCID50 value. Analysis of the TCID50 values indicated that mutants 475 and strain
PD required higher doses of viruses to cause cytopathic effects in 50% of the tissue
culture. Thus, mutants 475, and PD may serve as potential LAV candidates for further
evaluation by other tests in vitro.
Subsequently, the number of plaques produced by the various EV-A71 mutant
strains was evaluated in the RD cell culture by plaque assays. If the ability to form
plaques is reduced, this would mean that viral growth is slower, thereby producing a
lower PFU/ml value. For example, the mutant 487 (10 x104 PFU/mL) and mutant 5262
showed a much reduced plaque number (1.8 x 105 PFU/mL) when compared to the
positive control (EV-A71 wild type strain 41) with 5.0 x 107 PFU/mL. The least number
of viral plaques were formed by the mutant 475 carrying SDM at position 475 (7.0 x 104
PFU/mL) and the partial deletant (PD) (9.0 x 104 PFU/mL).
116
The ability of the various mutated EV-A71 strains to produce viral particles
could be evaluated by detection of VP1 by immunoblotting with the monoclonal
antibody directed against VP1. RD cells infected with the wild type EV-A71 strain 41
demonstrated the largest amount of the VP1 protein detected as evident from a thick,
single band with molecular weight (MW) of 32kDa. This band corresponds to the VP1
monomer with an apparent MW of 32.7kDa. Minimal amount of VP1 was detected in
the mutant strain carrying the site specific mutation at position 475 and the partial
deletant (PD) in the 5’-NTR.
An additional approach such as determination of the viral RNA copy number
would enable a better quantitative comparison of attenuation of the various mutant
strains. The viral RNA copy number of the various EV-A71 mutant strains was
evaluated after growing in the RD cell culture for 24 hours. RD cells infected with the
wild type EV-A71 strain 41 gave the highest yield of viral RNA copy number (5.5 X
103). As for EV-A71 mutant 475 and PD, minimal RNA copy no. was detected for both
mutants at 1.02 X 102 and 1.05 X 102 viral RNA, respectively. This was consistent with
results from plaque assays, TCID50, and immunoblotting. These two mutants appear to
hold promise and will be subjected to further evaluation tests to assess whether they
could serve as potential LAV strains. Amongst all the mutants being evaluated, mutant
486 carrying SDM at position 486 (A486G) expressed the highest viral RNA copy
number of 3.2 X 103 when compared to the wild type strain 41. Attenuated strains with
low viral RNA copy number are possible good vaccine strains as they cannot replicate
fast enough to yield high viral load and cause destruction of the tissue cells. Slow
replication could infer that the cells could carry enough antigens to stimulate an immune
response.
117
Previous studies have shown that the VP1 capsid protein of EV-A71 constitutes a
potential subunit vaccine candidate by triggering the production of protective anti-EV-
A71 neutralizing antibodies in a murine model of infection (Chen et al., 2006; Chiu; et
al., 2006). Chang and co-workers (2015) discovered that a single amino acid variation
in VP1 could lead to significant differences in the sensitivity of EV-A71 to neutralizing
antibody responses. They also identified EV-A71 strains that could induce potent
immunogenic and cross-neutralizing antibody responses against diverse EV-A71 strains.
Furthermore, these neutralizing antibodies could protect neonatal mice from lethal dose
challenge with various circulating EV-A71 viruses (Chang et al., 2015).
In this study, two EV-A71 mutants, PD and 5262, successfully elicited high titers
of neutralizing antibodies (1:32) against EV-A71. To a lesser extent, the 475, 486 and
487-immunized mice produced neutralizing antibodies against the EV-A71 strain 41
with a neutralizing antibody titer of 1:16 (Table 3.2). The levels of neutralizing
antibodies obtained by the EV-A71 mutants were lower than the levels obtained by
Chou et al. (2012) (1:640). This could be due to alum being as an adjuvant in their
studies while Freund’s complete adjuvant was used in our investigation. In addition, an
anti-EV-A71 neutralizing titre of 1:16 or higher is able to confer protection against
HFMD (Zhu et al., 2014). As EV-A71 mutants PD (1:32) and 475 (1:16) had high
neutralizing titers, they are potential LAVs to be developed further as they have low
pathogenicity and high immunogenicity. As neutralizing response plays a protective role
against viral infectivity, EV-A71-neutralizing antibodies elicited by EV-A71 mutants
PD and 475 should be characterized based on their specificities and functional roles in
the neutralization process. In addition, the immunogenicity studies could be repeated
118
with a different adjuvant and the genetic stability of these mutants has to be further
investigated.
An ideal LAV should be able to induce a protective antibody response as well as
a cytotoxic T-cell response important for killing infected host cells. Such knowledge on
the immune response to EV-A71 infection is crucial to the development of the LAV and
special vaccination challenges presented by this virus. A previous study by Lidbury et
al. (2000) showed that the antibody responses of irradiated virus-erythrocyte complex
(IV-EC) and live virus-erythrocyte complex (LV-EC) vaccinated mice showed
significantly elevated lung and serum IgG2a levels post live virus challenge, with no
comparable increases in IgG1 levels compared to controls. Their results suggested that
protection from live influenza (H3N2) challenge after IV-EC or LV-EC vaccination was
due to an IFN-mediated IgG2a response.
This was consistent with our results as the IgG subtype analysis of EV-A71
mutants 158, 475, 486, 487, 5262 and PD antisera demonstrated strong IgA, IgM, IgG2a
and IgG2b specific antibody response and low IgG1 and IgG3 antibody responses which
indicates a skewed Th1 immune response. There has been support in alternative vaccine
approaches that induce a more Th1 skewed response. IgG titres detected by the antigen
ELISA were lower than neutralization titres and this could possibly be due to high assay
background and low sensitivity of the assay (Bielinska et al., 2008; Wille-Reece et al.,
2015). Bek and co-workers (2011) also surmised that the dosage of vaccine suspension
administered and the type of adjuvant used could also account for the differing
neutralizing and IgG titres.
The results in a study by Visciano et al. (2012) showed that adjuvants are able to
skew the immune response of HIV-VLPs toward a Th1 profile. Additionally, the role of
119
the adjuvant in the vaccine formulation may influence the IgG profile and this should
not be discounted. Nevertheless, the results are desirable as an effective LAV should
trigger both the humoral and cellular immune response. These observations suggest that
EV-A71 mutants 158, 475, 486, 487, 5262 and PD contained B cell epitopes and the
neutralizing antibodies elicited by these mutants belong to the IgM subtype. Production
of large amounts of IgG2a and IgG2b by all the mutants and the wild type indicates
good cellular immune responses and the presence of IgA points to a good mucosal
response as well.
Although a number of EV-A71 mutants with good in vivo passive protective
potential have been identified, further studies could be performed to assess the genetic
stability of the mutant strains. Reversion of the mutant strains will indicate if it is
genetically stable or it will revert to the original nt. This can be performed by serial
passaging and recovering the viral strain after a series of passaging. If the mutant
reverts, this will be picked up during serial passages by sequencing of the whole viral
genome. In addition, better attenuated mutants could be constructed by introducing
multiple mutations into the attenuated EV-A71 mutant 475 or PD. With advances in
molecular biology, novel approaches to viral attenuation can be further studied such as
altered replication fidelity, codon deoptimization and microRNA-controlled LAVs. As
high mutation rates often hinder the effectiveness of a LAV, altering the replication
fidelity can attenuate the entire virus population, leading to population collapse without
mutation of key immunogenic epitopes. miRNAs can be used to control the replication
of RNA viruses, respectively. By controlling viral replication temporally, a strong,
natural immune response can be elicited before the virus is eliminated (Lauring et al.,
2010).
120
As for codon deoptimization, synonymous codons can be substituted throughout
a viral genome, hence preventing loss of immunogenicity and little risk of reversion to
wild type. Studies on codon bias for viral replication and pathogenicity of poliovirus
(PV) have been reported. Burns et al., (2006) replaced half of the total codons in the
capsid region of Sabin type 2 oral polio vaccine strain with non-preferred synonymous
codons. They discovered that synthesis and processing of viral proteins were unaffected
but viral fitness was significantly reduced (Burns et al., 2006). In a later study (2009),
they replaced natural capsid region codons with synonymous codons that had increased
frequencies of CpG and UpA dinucleotides. They produced codon-deoptimised PVs that
had significantly lower overall fitness as indicated by lower viral plaque number and
virus yields (Burns et al., 2009). Also working with codon-deoptimized PVs, Mueller et
al., (2006) used gene synthesis technology to introduce the largest possible number of
rarely used synonymous codons in the capsid region of PV type 1 Mahoney. They found
a significant decrease in replicative fitness and number of infectious viral progeny.
There was also reduction of genome translation and virus-particle infectivity of up to
1,000-fold as compared to the wild type (Mueller et al., 2006). Interestingly, both Burns
et al., (2006) and Mueller et al., (2006) discovered that the deoptimised viruses
remained attenuated after repeated cell passages and hence, were genetically stable with
minimal risk of reversion.
It is well known that some virulent strains of EV-A71 are capable of causing
paralytic disease indistinguishable from poliomyelitis caused by the poliovirus. Virulent
strains of EV-A71 are referred to as the new polio as it is neurotropic. The EV-A71
strains had 46% amino acid identity with the polioviral P1 capsid region and 55% with
the entire polyprotein (Brown and Pallansch, 1995). In addition, EV-A71 and PV share
121
high sequence homology especially in the 5’-NTR region hence, the codon
deoptimisation research on PV reported in previous studies could serve as references to
produce EV-A71 viruses that are highly attenuated.
122
CHAPTER 5
CONCLUSION
The Hand, Foot and Mouth Disease is caused by a group of Enteroviruses such
as Enterovirus 71 (EV-A71) and Coxsackievirus CVA5, CVA6, CVA10, and CV-A16.
Mild symptoms of EV-A71 infection in children range from high fever, vomiting, rashes
and ulcers in the mouth, commonly affecting children and infants. EV-A71 can produce
more severe symptoms such as brainstem and cerebellar encephalitis, leading up to
cardiopulmonary failure and death. The lack of vaccines and antiviral drugs against EV-
A71 highlights the urgency of developing vaccines to prevent and antiviral agents to
treat EV-A71 infections.
The molecular basis of virulence in EV-A71 is still uncertain. It remains to be
investigated if there is a universal molecular determinant present in every EV-A71 fatal
strain or whether every fatal strain differs in virulence determinant depending on their
sub-genotype. In this study, the EV-A71 virus was genetically modified by substituting
nucleotides at positions 158, 475, 486, and 487 based on the neuro-virulence of
poliovirus Sabin strains 1, 2 and 3. We also investigated if the single nucleotide
difference in strain 41 (5865/Sin/000009) between the fatal and the non-fatal strain
(strain 10) was responsible for neurovirulence by introducing a nucleotide substitution at
position 5262 in the EV-A71 genome. Another mutant strain was also constructed
through partial deletion of the 5’-NTR region in the EV-A71 genome.
In conclusion, EV-A71 mutant 158 was not the most attenuated as it still
produced more RNA, plaques and VP1 than mutants 5262, 487, 475 and the partial
123
deletant PD. Therefore, it is not the single neuro-virulence determinant for strain 41
which belongs to genotype B4 when compared to EV-A71 genotype B1 studied by Yeh
et al. (2011). Results support the hypothesis that every EV-A71 genotype or sub-
genotype carries a different virulence determinant. The single site mutation created by
introducing a nt. change at position 5262 did not completely eliminate the ability to
replicate and form plaques. There was some attenuation by SDM at this site but the
effect of attenuation at this site was less than the effects brought about by introducing
SDM into sites 475, 487 and the partial deletion. The partial deletant may be the most
stable mutant genetically as it demonstrated high immunogenicity (neutralizing titre of
1:32) and low pathogenicity and hence, could be a good potential LAV candidate for
further studies. In addition, intraperitoneal administration of the heat-inactivated EV-
A71 mutants 158, 475, 486, 487, 5262 and PD and the homologous EV-A71 whole
virion triggered a skewed Th1 response.
Further studies should be conducted to investigate the stability of the mutations
created by SDM in each mutant. A strain that is genetically highly stable and does not
revert easily would thereby make a better LAV for EV-A71. Compared to conventional
vaccines, the LAV is cheaper to produce, induces excellent immunogenicity and confers
live-long immunity. LAV is preferred over the inactivated EV-A71 vaccine as it can
elicit both humoral and cellular immunity, alongside the innate and adaptive immunity.
In view of the rising concerns over EV-A71 infections with resulting fatalities in the
large scale outbreaks in the Asia Pacific region, the results obtained in this study
demonstrated potential LAV candidates against EV-A71 infections.
124
REFERENCES
Arita M, Shimizu H, Nagata N, Ami Y, Suzaki Y, Sata T, Iwasaki T, Miyamura T.
(2005). Temperature-sensitive mutants of enterovirus 71 show attenuation in
cynomolgus monkeys. Journal of General Virology. 86:1391-1401.
Arita M, Nagata N, Iwata N et al. (2007). An attenuated strain of enterovirus 71
belonging to genotype A showed a broad spectrum of antigenicity with attenuated
neurovirulence in cynomolgus monkeys. Journal of Virology. 81:9386–9395.
Banerjee K, Klasse PJ, Sanders RW, Pereyra F, Michael E, Lu M, et al. (2010). IgG
subclass profiles in infected HIV type 1 controllers and chronic progressors and in
uninfected recipients of Env vaccines. AIDS Research Human Retroviruses. 26:445-458.
Bek EJ, Hussain KM, Phuektes P, Kok CC, Gao Q, Cai F, Gao Z, MP. (2011). Formalin-
inactivated vaccine provokes cross-protective immunity in a mouse model of human
enterovirus 71 infection. Vaccine. 29:4829–4838.
Belsham, GJ and Sonenberg, N (1996). RNA-protein interactions in regulation of
picornavirus RNA translation. Microbiological Reviews. 60:499-511.
Bible JM, Pantelidis P, Chan PK, Tong CY. (2007). Genetic evolution of enterovirus 71:
epidemiological and pathological implications. Reviews in Medical Virology 17:371-
379.
Bielinska AU, Janczak KW, Landers JJ, Markovitz DM, Montefiori DC, Baker JR Jr
(2008). Nasal immunization with a recombinant HIV gp120 and nanoemulsion adjuvant
produces Th1 polarized responses and neutralizing antibodies to primary HIV type 1
isolates. AIDS Research on Human Retroviruses. 24:271-281.
Bouchard MJ, Lam DH, Racaniello V. (1995). Determinants of attenuation and
temperature sensitivity in the type 1 poliovirus Sabin vaccine. Journal of Virology
69:4972–4978.
Brown BA, P. M. (1995). Complete nucleotide sequence of enterovirus 71 is distinct
from poliovirus. Virus Research. 39:195–205.
Brown, B. A., Oberste, M. S., Alexander, J. P., & Kennett, ML. (1999). Molecular
Epidemiology and Evolution of Enterovirus 71 Strains Isolated from 1970 to 1998.
Journal of Virology. 73:9969–9975.
Bukreyev A, Skiadopoulos MH, McAuliffe J, Murphy BR, Collins PL, Schmidt AC.
(2002). More antibody with less antigen: Can immunogenicity of attenuated live virus
vaccines be improved? Proceedings of the National Academy of Sciences. 99:16987–
16991.
125
Burns, C. C., Shaw, J., Campagnoli, R., Jorba, J., Vincent, A., Quay, J., & Kew, O.
(2006). Modulation of Poliovirus Replicative Fitness in HeLa Cells by Deoptimization
of Synonymous Codon Usage in the Capsid Region. Journal of Virology. 80:3259-3272.
Burns, C. C., Campagnoli, R., Shaw, J., Vincent, A., Jorba, J., & Kew, O. (2009).
Genetic Inactivation of Poliovirus Infectivity by Increasing the Frequencies of CpG and
UpA Dinucleotides within and across Synonymous Capsid Region Codons. Journal of
Virology. 83:9957-9969.
Castro CM, Cruz AC, Silva EE, Gomes Mde L. (2005). Molecular and
seroepidemiologic studies of enterovirus 71 infection in the state of Para, Brazil. Review
of the Institute of Tropical Medicine Sao Paulo. 47:65-71.
Cereghino JL, and Cregg JM. (2000). Heterologous protein expression in the
methylotrophic yeast Pichia pastoris. FEMS Microbiological Reviews. 24:45-66.
Chan KP, Goh KT, Chong CY, Teo ES, Lau G, Ling AE. (2003). Epidemic hand, foot
and mouth disease caused by human enterovirus 71, Singapore. Emerging Infectious
Diseases. 9:78-85.
Chan YF, Sam IC, Abu Bakar S. (2010). Phylogenetic designation of enterovirus 71
genotypes using complete genome sequences. Infection, Genetics and Evolution.
10:404-412.
Chang LY, King CC, Hsu KH, Ning HC, Tsao KC, Li CC, Lin TY. (2002). Risk Factors
of Enterovirus 71 Infection and Associated Hand, Foot, and Mouth Disease/Herpangina
in Children During an Epidemic in Taiwan. Pediatrics. 109:88.
Chang LY, Hsiung C, Lu CY, Lin TY, Huang FY, Lai YH, Huang LM. (2006). Status of
cellular rather than humoral immunity is correlated with clinical outcome of enterovirus
71. Pediatrics Research 60:466–471.
Chang SC, Li WC, Chen GW, Tsao KC, Huang CG, Huang YC, Chiu CH, et al. (2012).
Genetic Characterization of enterovirus 71 isolated from patients with severe disease by
comparative analysis of complete genomes. Journal of Medical Virology. 84:931-939.
Chang JL, Li JL, Wei W, Liu X, et al. (2015). Determinants of EV-A71
immunogenicity and protection against lethal challenge in a mouse model.
Immunology Research. 62:306-315.
Chen HF, Chang MH, Chiang BL, Jeng ST. (2006). Oral immunization of mice using
transgenic tomato fruit expressing VP1 protein from enterovirus 71. Vaccine. 24: 2944–
2951.
126
Chia MY, Chung WY, Chiang PS, Chien YS, Ho MS, et al. (2014) Monitoring
Antigenic Variations of Enterovirus 71: Implications for Virus Surveillance and Vaccine
Development. PLoS Neglected Tropical Diseases 8:e3044.
Chiu CH, Chu C, He CC, Lin TY. (2006). Protection of neonatal mice from lethal
enterovirus 71 infection by maternal immunization with attenuated Salmonella enterica
serovar Typhimurium expressing VP1 of enterovirus 71. Microbes and Infection.
8:1671-1678.
Chong P, Hsieh SY, Liu CC et al. (2012). Production of EV-A71 vaccine candidates.
Human Vaccines and Immunotherapeutics 8:1-9.
Chong P, Liu CC, Chow YH, Chou AH, Klein M. (2015). Review of enterovirus 71
vaccines. Clinical Infectious Diseases. 60:797-803.
Chou Ai-Hsiang, Chia-Chyi Liu, Jui-Yuan Chang, Shu-Pei Lien, Meng-Shin Guo, Hau-
Pong Tasi, et al. (2012). Immunological Evaluation and Comparison of Different EV-
A71 Vaccine Candidates. Clin Dev Immunol. Article ID 831282.
Chou AH, Liu CC, Chang JY et al. (2013). Formalin-inactivated EV-A71 vaccine
candidate induced cross-neutralizing antibody against sub-genotypes B1, B4, B5 and
C4A in adult volunteers. PLoS One 8: e79783.
Chua BH, Phuektes P, Sanders SA, Nicholls PK, McMinn PC. (2008). The molecular
basis of mouse adaptation by human enterovirus 71. Journal of General Virology.
89:1622–1632.
Chumakov K, Ehrenfeld E. (2008). New Generation of Inactivated Poliovirus Vaccines
for Universal Immunization after Eradication of Poliomyelitis. Vaccine. 47: 1587-1592.
Coutelier JP, van der Log JT, Heessen FW, Warnier G, Van Snick J. (1987). IgG2a
restriction of murine antibodies elicited by viral infections. The Journal of Experimental
Medicine 165:64–69.
Ding FX, Wang F, Lu YM, Li K, Wang KH, He XW, Sun SH. (2009). Multiepitope
peptide-loaded virus-like particles as a vaccine against hepatitis B virus-related
hepatocellular carcinoma. Hepatology. 49:1492-1502.
Fitzpatrick M. (2006). The Cutter Incident: How America’s First Polio Vaccine led to a
Growing Vaccine Crisis. Journal of the Royal Society of Medicine. 99:156.
Foo DG, Alonso S, Chow VT, Poh CL. (2007). Passive protection against lethal
enterovirus 71 infection in newborn mice by neutralizing antibodies elicited by a
synthetic peptide. Microbes Infections. 9:1299–1306.
127
Foo DGW, Alonso S, Phoon MC, Ramachandran NP, Chow VTK, Poh CL. (2007).
Identification of neutralizing linear epitopes from the VP1 capsid protein of enterovirus
71 using synthetic peptides. Virus Research. 125: 61-68.
Girn J, Kavoosi M, Chantler J. (2002). Enhancement of coxsackievirus B3 infection by
antibody to a different coxsackievirus strain. Journal of General Virology 83:351–358.
Grassly NC, Wenger J, et al (2006). New strategies for the elimination of polio from
India. Science 314: 1150-1153.
Gregory AE, Titball R, Williamson D. (2013). Vaccine delivery using nanoparticles.
Cellular and Infection Microbiology. 3:1-13.
Han JF, Cao RY, Deng YQ, Tian X, Jiang T, Qin ED, Qin CF. (2011). Antibody
dependent enhancement infection of enterovirus 71 in vitro and in vivo. Virology
Journal. 8:106-112.
Han JF, Cao RY, Tian X, Yu M, Qin ED, Qin CF. (2010). Producing infectious
enterovirus type 71 in a rapid strategy. Journal of Virology 7:116-120.
Hicks AL, Duffy S. (2011). Genus-specific substitution rate variability among
Picornaviruses. Journal of Virology. 85:7942-7947.
Ho M, Chen ER, Hsu KH, Twu SJ, Chen KT, Tsai SF, Wang JR, Shih SR. (1999). An
Epidemic of Enterovirus 71 Infection in Taiwan. New England Journal of Medicine.
341:929–935.
Holland J, Spindler K, Horodyski F, Grabau E, Nichol S, VandePol S. (1982). Rapid
evolution of RNA genomes. Science. 215:1577–1585.
Huang YP, Lin TL, Hsu LC, Chen YJ, Tseng YH, et al. (2010) Genetic diversity and
C2-like subgenogroup strains of enterovirus 71, Taiwan, 2008. Virology Journal. 7:277-
287.
Huang ML, Chiang PS, Chia MY, Luo ST, Chang LY, Lin TY, et al. (2013). Cross-
reactive neutralizing antibody responses to enterovirus 71 infections in young children:
implications for vaccine development. PLoS Neglected Tropical Diseases. 7:e2067.
Iizuka N, Kohara M, Hagino-Yamagishi K, Abe S, Komatsu T, Tago K, et al. (1989).
Construction of less neurovirulent polioviruses by introducing deletions into the 5'
noncoding sequence of the genome. Journal of Virology. 63:5354-5363.
Kawamura N, Kohara M, Abe S, Komatsu T, Tago K, Arita M, Nomoto A. (1989).
Determinants in the 5’ noncoding region of poliovirus Sabin 1 RNA that influence the
attenuation phenotype. Journal of Virology. 63:1302–1309.
128
Kew OM, Sutter RW, de Gourville EM, Dowdle WR, Pallansch M. (2005). Vaccine-
derived polioviruses and the endgame strategy for global polio eradication. Annual
Reviews in Microbiology. 59:587–635.
Kirk K, Poh CL, Fecondo J, Pourianfar H, Shaw J, Grollo L. (2012) Cross-reactive
neutralizing antibody epitopes against Enterovirus 71 identified by an in silico approach.
Vaccine. 30:7105-7110.
Knowlton KU, Jeon E, Berkley N, Wessely R, Huber S. (1996). A mutation in the puff
region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the
Woodruff variant of coxsackievirus B3. Journal of Virology. 70:7811–7818.
Kowane B, Wassilak S, Orenstein W, Bart K, et al. (1987) Vaccine-associated paralytic
poliomyelitis United States: 1973 through 1984. Journal of American Medical
Association. 257:1335-1340.
Kung YA, Hung CT, Liu YC, Shih SR. (2014). Update on the development of
enterovirus 71 vaccines. Expert Opinion on Biological Therapy. 14:1455–1464.
Kuo RL, Kung SH, Hsu YY, Liu WT. (2002). Infection with enterovirus 71 or
expression of its 2A proteases induces apoptotic cell death. Journal of General
Virology. 83:1367–1376.
Kuo RL, Shih SR. (2013). Strategies to develop antivirals against enterovirus 71.
Virology Journal. 10:28-35.
Lauring AS, Jones JO, Andino R. (2010). Rationalizing the development of live
attenuated virus vaccines. Natural Biotechnology. 28:573-579.
Lee H, Cifuente JO, Ashley RE et al. (2013) A strain-specific epitope of enterovirus 71
identified by cryo-electron microscopy of the complex with Fab from neutralizing
antibody. Journal of Virology. 87:11363-11370.
Lee MS, Tseng FC, Wang JR, Chi CY, Chong P, Su IJ. (2012). Challenges to licensure
of enterovirus 71 vaccines. PLoS Neglected Tropical Diseases. 6:e1737.
Liang ZL, Wang JZ. (2014). EV-A71 vaccine, an invaluable gift for children. Journal of
Clinical and Translational Immunology. 3:e28.
Li M-L, Hsu T-A, Chen T-C, Chang S-C, Lee J-C, Chen C-C, Stollar V, Shih S-R.
(2002). The 3C Protease Activity of Enterovirus 71 Induces Human Neural Cell
Apoptosis. Virology. 293:386-395.
Li, Z., Yi, Y., Yin, X., Zhang, Z., & Liu, J. (2008). Expression of foot-and-mouth
disease virus capsid proteins in silkworm-baculovirus expression system and its
utilization as a subunit vaccine. PloS One. 3:e2273.
129
Li R, Zou Q, Chen L, Zhang H, WY. (2011). Molecular analysis of virulent
determinants of enterovirus. PLoS One. 71:e26237.
Li, H.-Y., Han, J.-F., Qin, C.-F., & Chen, R. (2013). Virus-like particles for enterovirus
71 produced from Saccharomyces cerevisiae potently elicits protective immune
responses in mice. Vaccine. 31:3281–7.
Li, Y.-X., Zhao, H., Cao, R.-Y., Deng, Y.-Q., Han, J.-F., Zhu, S.-Y., Qin, C.-F. (2014).
Recombinant tandem multi-linear neutralizing epitopes of human enterovirus 71 elicited
protective immunity in mice. Virology Journal. 11:79.
Liang ZL, Mao QY, Wang YP, Zhu FC, Li JX, Yao X, Gao F, Wu X, Xu M, WJ.
(2013). Progress on the research and development of inactivated EV-A71 whole-virus
vaccines. Hum Vaccin Immunother. 9:1701-1705.
Liang Z, Wang J. (2014). EV-A71 vaccine, an invaluable gift for children. Journal of
Clinical and Translational Immunology. 3:e28.
Lin TY, Chang LY, Hsia SH, et al. (2002). The 1998 Enterovirus 71 outbreak in
Taiwan: pathogenesis and management. Clinical Infectious Diseases. 34:52-57.
Lin KH, Hwang KP, Ke GM, Wang CF, Ke LY, Hsu YT, et al. (2006). Evolution of
EV-A71 genogroup in Taiwan from 1998 to 2005: an emerging of subgenogroup C4 of
EV-A71. Journal of Medical Virology. 78: 254-262.
Lidbury BA, Grissell TV, Sizer PJ, Clancy R, Cripps AW. (2000). Studies on the IgA-
independent immunological responses in mice to influenza virus challenge after oral
vaccination with irradiated whole virus and an erythrocyte complex. Immunology and
Cell Biology. 78: 149–155.
Liu HM, Zheng DP, Oberste MS, Kew OM, Pallansch MA. (2003). Serial recombination
during circulation of type 1 wild-vaccine recombinant polioviruses in China. Journal of
Virology. 77:10994–11005.
Liu Y, Fu C, Wu S, Chen X, et al. (2014). A novel finding for enterovirus virulence
from the capsid protein VP1 of EV-A71 circulating in mainland China. Virus Genes.
48:260-272.
Liu W, Wu S, Xiong Y et al. (2014). Co-circulation and genomic recombination of
coxsackievirus A16 and enterovirus 71 during a large outbreak of hand, foot and mouth
disease in central China. PLoS One. 9:e96051.
130
Liu SL, Pan H, Liu P et al. (2015). Comparative epidemiology and virology of fatal and
nonfatal cases of hand, foot and mouth disease in mainland China from 2008 to 2014.
Reviews in Medical Virology. 25:115-128.
Lu Shan. (2014). EV-A71 vaccines: a milestone in the history of global vaccine
development. Emerging Microbes and Infections. 3:e27.
Lyu K, Wang GC, He YL, Han JF, Ye Q, Qin CF, Chen R. (2014). Crystal structures of
Enterovirus 71 (EV-A71) recombinant virus particles provide insights into vaccine
design. Journal of Biological Chemistry. 290:3198-3208.
Lyu K, He Y-L, Li H-Y, Chen R. (2015). Crystal structures of yeast-produced
enterovirus 71 and enterovirus 71/coxsackievirus A16 chimeric virus-like particles
provide structural basis for novel vaccine design against hand-foot-and-mouth disease.
Journal of Virology doi:10.1128/jvi.00422-15.
Ma JH, Yang FR, Yu H, Zhou YJ, Li GX, Huang M, Tong G. (2013). An M2e-based
synthetic peptide vaccine for influenza A virus confers heterosubtypic protection from
lethal virus challenge. Virology Journal. 10:227-232.
Mallilankaraman K, Shedlock DJ, Bao H, Kawalekar OU, Fagone P, et al. (2011) A
DNA Vaccine against Chikungunya Virus Is Protective in Mice and Induces
Neutralizing Antibodies in Mice and Nonhuman Primates. PLoS Neglected Tropical
Diseases 5:e928.
Mao Q, Li N, Yu X, Yao X, Li F, Lu F, et al. (2012). Antigenicity, animal protective
effect and genetic characteristics of candidate vaccine strains of enterovirus 71. Archives
in Virology. 157:37–41.
Mao Q, Dong C, Li X, Gao Q, Guo Z, Yao X, Wang J. (2012). Comparative analysis of
the immunogenicity and protective effects of inactivated EV-A71 vaccines in mice. PloS
One. 7:e46043.
Markine-Goriaynoff and Coutelier JP. (2002). Increased Efficacy of the
Immunoglobulin G2a Subclass in Antibody-Mediated Protection against Lactate
Dehydrogenase-Elevating Virus-Induced Polioencephalomyelitis revealed with Switch
Mutants. Journal of Virology. 76:1432-1435.
Mascola JR, Snyder SW, Weislow OS., et al. (1996). Immunization with envelope
subunit vaccine products elicits neutralizing antibodies against laboratory-adapted but
not primary isolates of human immunodeficiency virus type 1. Journal of Infectious
Diseases. 173:340–348.
McMinn PC. (2002). An overview of the evolution of enterovirus 71 and its clinical and
public health significance. FEMS Microbiology Reviews. 26:91-107.
131
Melnick JL, Brennan JC (1959). Monkey neurovirulence of attenuated poliovirus
vaccines being used in field trials. In: Live polio virus vaccines. Washington DC: Pan
American Health Organization. 65-101.
Melnick JL. (1984). Enterovirus type 71 infections: a varied clinical pattern sometimes
mimicking paralytic poliomyelitis. Review of Infectious Diseases. 6:387–389.
Melnick J.L. (1997) Poliovirus and other enteroviruses. In Evans AS and Kaslow RA
eds. Viral infections of humans: epidemiology and control. Plenum Publishing
Corporation, 4th edition: 583-663.
Meng T, Kwang J. (2014). Attenuation of human enterovirus 71 high-replication-fidelity
variants in AG129 mice. Journal of Virology. 88:5803–5815.
Mueller, S., Papamichail, D., Coleman, J. R., Skiena, S., & Wimmer, E. (2006).
Reduction of the Rate of Poliovirus Protein Synthesis through Large-Scale Codon
Deoptimization Causes Attenuation of Viral Virulence by Lowering Specific Infectivity.
Journal of Virology. 80:9687-9696.
Nakayama Y, Aruga A. (2015). Comparison of current regulatory status for gene-based
vaccines in the US, Europe and Japan. Vaccines. 3:186-202.
Nishimura Y, Lee H , Hafenstein S, Kataoka C, Wakita T, Bergelson JM, Shimizu H.
(2013). Enterovirus 71 binding to PSGL-1 on leukocytes: VP1-145 acts as a molecular
switch to control receptor interaction. PLoS Pathogens. 9:e1003511.
Nomoto A, Omata T, Toyoda H, et al. (1982). Complete nucleotide sequence of the
attenuated poliovirus Sabin 1 strain genome. Proceedings of the National Academy of
Sciences USA. 79:5793–5797.
Ooi MH, Wong SC, Lewthwaite P, Cardosa MJ, Solomon T. (2010). Clinical features,
diagnosis, and management of enterovirus 71. Lancet Neurology. 9:1097-1105.
Paavonen J, Jenkins D, Bosch FX, et al. (2007). Efficacy of a prophylactic adjuvanted
bivalent L1 virus-like-particle vaccine against infection with human papillomavirus
types 16 and 18 in young women: an interim analysis of a phase III double-blind,
randomised controlled trial. Lancet. 369:2161-7210.
Pallansch MA, Roos R. Enteroviruses: polioviruses, coxsackieviruses, echoviruses and
newer enteroviruses. (2006). In Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin
MA, Roizman B, Strauss SE editors. Fields Virology Fifth Edition. Philadelphia:
Lippincott Williams & Wilkins. 1:839-893.
132
Palmer P, Charley B, Rombaut B, Daëron M, Lebon P. (2000). Antibody-dependent
induction of type I interferons by poliovirus in human mononuclear blood cells requires
the type II fcgamma receptor (CD32). Virology. 278:86–94.
Paul AV, Mugavero J, Yin J, Hobson S, Schultz S, van Boom JH, et al. (2000). Studies
on the attenuation phenotype of polio vaccines: poliovirus RNA polymerase derived
from Sabin type 1 sequence is temperature sensitive in the uridylylation of VPg.
Virology. 272:72–84.
Philippe Le Mercier, SIB Swiss Institute of Bioinformatics, ViralZone. Available from
http://viralzone.expasy.org/all_by_species/33.html
Racaniello VR, Meriam C. (1986) Poliovirus temperature-sensitive mutant containing a
single nucleotide deletion in the 5'-noncoding region of the viral RNA. Virology.
155:498-507.
Reed LJ, Muench H. (1938). A simple method of estimating fifty per cent endpoints.
American Journal of Hygiene. 27:493–497.
Roldao A, Mellado MC, Castilho LR. (2010). Corrondo MJ, Alves PM. Virus-like
particles in vaccine development. Expert Review of Vaccines. 9:1149-1176.
Salk JE, Krech U, Younger JS, Bennett BL, Lewis LJ, Bazeley PL. (1954)
Formaldehyde treatment and safety testing of experimental poliomyelitis vaccines.
American Journal of Public Health and the Nation’s Health. 44:563-570.
Schmidt NJ, Lennette EH, Ho HH. (1974). An apparently new enterovirus isolated from
patients with disease of the central nervous system. Journal of Infectious Diseases.
129:304–309.
Siegrist, C. (2012). Vaccine immunology.United Kingdom:Elsevier. 2:17-36.
Singh S, Poh CL, Chow VT. (2002). Complete sequence analyses of enterovirus 71
strains from fatal and non-fatal cases of the hand, foot and mouth disease outbreak in
Singapore (2000). Microbiology and Immunology. 46:801-808.
Shen M, Reitman ZJ, Zhao Y, Moustafa I, Wang Q, Arnold JJ, et al. (2008).
Picornavirus genome replication. Identification of the surface of the poliovirus (PV) 3C
dimer that interacts with PV 3Dpol during VPg uridylylation and construction of a
structural model for the PV 3C2-3Dpol complex. Journal of Biological Chemistry.
283:875-888.
Solomon T, Lewthwaite P, Perera D, Cardosa MJ, McMinn P, Ooi MH. (2010).
Virology, epidemiology, pathogenesis, and control of enterovirus 71. Lancet Infectious
Diseases. 10:778–790.
133
Small, J. C., & Ertl, H. C. (2011). Viruses - from pathogens to vaccine carriers. Current
Opinion in Virology. 1: 241-245.
Tan CW, Chan YF, Sim KM, Tan EL, Poh CL. (2012). Inhibition of enterovirus 71 (EV-
71) infections by a novel antiviral peptide derived from EV-71 capsid protein VP1. PloS
One. 7:e34589.
Tan S, Tan X, Sun X, Lu G, Chen CC, Yan J, Gao GF. (2013). VP2 dominated CD4+ T
cell responses against enterovirus 71 and cross-reactivity against coxsackievirus A16
and polioviruses in a healthy population. Journal of Immunology. 191:1637–1647.
Tee KK, Lam TT, ChanYF, Bible JM, Kamarulzaman A, Tong CYW, Pybus OG.
(2010). Evolutionary Genetics of Human Enterovirus 71 : Origin, Population Dynamics,
Natural Selection, and Seasonal Periodicity of the VP1 Gene. Journal of Virology
84:3339–3350.
The College of Physicians of Philadelphia. (2014). The Future of Immunization.
Retrieved November 11, 2014, from
http://www.historyofvaccines.org/content/articles/future-immunization.
Thoa Le PK, Chiang PS, Khanh TH, Luo ST, Dan TN, Wang YF, et al. (2013). Genetic
and antigenic characterization of enterovirus 71 in Ho Chi Minh city, Vietnam, 2011.
PLoS ONE. 8:e69895.
Thomassen YE, van’t Oever AG, van Oijen MG, Wijffels RH, van der Pol LA, et al.
(2013). Next Generation Inactivated Polio Vaccine Manufacturing to Support Post
Polio-Eradication Biosafety Goals. PLoS One. 8:e83374.
Toyoda H, Nicklin MJ, Murray MG, Anderson CW, Dunn JJ, Studier FW, Wimmer, E.
(1986). A second virus-encoded proteinase involved in proteolytic processing of
poliovirus polyprotein. Cell. 45:761-770.
Tseng FC, Huang HC, Chi CY, Lin TL, Liu CC et al. (2007). Epidemiological survey of
enterovirus infections occuring in Taiwan between 2000 and 2005: analysis of sentinel
physician surveillance data. Journal of Medical Virology. 79:1850-1860.
Tung WS, Bakar SA, Sekawi Z, Rosli R. (2007). DNA vaccine constructs against
enterovirus 71 elicit immune response in mice. Genetic Vaccines and Therapy. 19:6-18.
Van der Sanden S, Koopmans M, Uslu G, van der Avoort H. (2009). Epidemiology of
enterovirus 71 in the Netherlands, 1963 to 2008. Journal of Clinical Microbiology.
47:2826–2833.
Van Wezel AL (1967) Growth of cell-strains and primary cells on microcarriers in
homogeneous culture. Nature. 216:64-65.
134
Visciano ML, Tagliamonte M, Tornesello ML, Buonaguro FM, Buonaguro L. (2012).
Effects of adjuvants on IgG subclasses elicited by virus-like particles. Journal of
Translational Medicine. 10:4-11.
Westrop GD, Wareham KA, Evans DM, Dunn G, Minor PD, Magrath DI, et al. (1989).
Genetic basis of attenuation of the Sabin type 3 oral poliovirus vaccine. Journal of
Virology. 63:1338–1344.
WHO (2002) Recommendations for the production and control of poliomyelitis vaccine
(Inactivated). Technical Report Series No. 910 World Health Organization.
WHO (2004) Guidelines for the safe production and quality control of inactivated
poliomyelitis vaccine manufactured from wild polioviruses Addendum, 2003, to the
Recommendations for the Production and Quality Control of Poliomyelitis Vaccine
(Inactivated). Technical Report Series No.926 World Health Organization.
WHO (2009) WHO global action plan to minimize poliovirus facility associated risk
after eradication of wild polioviruses and cessation of routine OPV use (Draft 2009).
Available: www.polioeradication.org.
WHO (2011) Sabin-IPV Development in IMB, CAMS, China. Available:
http://www.who.int/immunization_standards/vaccine_quality/11_liq_sabin_ipv_devt.pdf
WHO. WPRO Hand, foot and mouth disease situation Update, 29 Jan 2014 [cited 29 Jan
2014]. http://www.wpro.who.int/emerging_diseases/HFMD/en/index.html
Wille-Reece U, Wu CY, Flynn BJ, Kedl RM, Seder RA. (2005). Immunization with
HIV-1 Gag protein conjugated to a TLR7/8 agonist results in the generation of HIV-1
Gag-specific Th1 and CD8+ T cell responses. Journal of Immunology. 174:7676-7683.
Wu CN, Lin YC, Fann C, Liao NS, Shih SR, HM. (2001). Protection against lethal
enterovirus 71 infection in newborn mice by passive immunization with subunit VP1
vaccines and inactivated virus. Vaccine. 20:895–904.
Xing W, Liao Q, Viboud C et al. (2014). Hand, foot and mouth disease in China, 2008-
12: an epidemiological study. Lancet Infectious Disease. 14:308-318.
Xu L, He D, Li Z, et al. (2014). Protection against lethal enterovirus 71 challenge in
mice by a recombinant vaccine candidate containing a broadly cross-neutralizing epitope
within the VP2 EF loop. Theranostics. 4:498–513.
Xu M, Su L, Cao L, Zhong H, Dong N, Xu J. (2013). Enterovirus genotypes causing
hand, foot and mouth disease in Shanghai, China: a molecular epidemiological analysis.
BMC Infectious Diseases. 13:489-497.
135
Yan XF, Gao S, Xia JF, Ye R, Yu H, et al. (2012) Epidemic characteristics of hand, foot,
and mouth disease in Shanghai from 2009 to 2010: Enterovirus 71 subgenotype C4 as
the primary causative agent and a high incidence of mixed infections with
coxsackievirus A16. Scandinavian Journal of Infectious Diseases. 44:297–305.
Yeh MT, Wang SW, Yu CK, Lin KH, Lei HY, Su IJ, W. J. (2011). A single nucleotide
in stem loop II of 5’-untranslated region contributes to virulence of enterovirus 71 in
mice. PLoS One. 6:e27082.
Yin QT, personal communication, 2014.
Yip CCY Lau SKP, Zhou B, Zhang MX, Tsoi HW, Chan KH, Yuen KY. (2010).
Emergence of enterovirus 71 “double-recombinant” strains belonging to a novel
genotype D originating from southern China: first evidence for combination of intratypic
and intertypic recombination events in EV-A71. Archives of Virology. 155:1413–1424.
Yip CCY, Lau SKY, Woo PCY, Yuen KY. (2013). Human enterovirus 71 epidemics:
what’s next? Emerging Health Threats Journal. 6:10.3402.
Yoke-Fun, C., and Abu Bakar, S. (2006). Phylogenetic evidence for inter-typic
recombination in the emergence of human enterovirus 71 subgenotypes. BMC
Microbiology. 6: 74-84.
Zhang Y, Tan XJ, Wang HY, Yan DM, Zhu SL, Wang DY, et al. (2009). An outbreak of
hand, foot, and mouth disease associated with sub-genotype c4 of human enterovirus 71
in Shandong, China. Journal of Clinical Virology. 44:262–267.
Zhang YC, Li XW, Zhu XD et al. (2010). Clinical characteristics and treatment of sever
encephalitis associated with neurogenic pulmonary edema caused by enterovirus 71in
China. World Journal of Emergency Medicine. 1:108-113.
Zhang Y, Zhu Z, Yang W, Ren J, Tan X, Wang Y, et al. (2010). An emerging
recombinant human enterovirus 71 responsible for the 2008 outbreak of hand foot and
mouth disease in Fuyang city of China. Virology Journal. 7:94-102.
Zhang H, An D, Liu W, Mao Q, Jin J, Xu L, Jiang C. (2014). Analysis of cross-reactive
neutralizing antibodies in human HFMD serum with an EV-A71 pseudovirus-based
assay. PloS One. 9:e100545.
Zhang C, Ku Z, Liu Q, Wang X, Chen T, Ye X, Li D, Jin X, Huang Z. (2015). High-
yield production of recombinant virus-like particles of enterovirus 71 in Pichia pastoris
and their protective efficacy against oral viral challenge in mice. Vaccine. 33:2335-2341.
136
Zhu F, Meng FY, Li JX, Li XL, Mao QY, Tao H, et al. (2013). Efficacy, safety, and
immunology of an inactivated alum-adjuvant enterovirus 71 vaccine in children in
China: a multicentre, randomised, double-blind, placebo-controlled, phase III trial.
Lancet. 38: 2024-2032.
Zhu F, Xu W, Xia J, Liang Z, Liu Y, Zhang X, Wang N. (2014). Efficacy, safety, and
immunogenicity of an enterovirus 71 vaccine in China. New England Journal of
Medicine. 370:818–828.
137
APPENDICES
Appendix I Reagents for growth media
DMEM growth medium
2X DMEM 500 ml
FBS 100 ml
Penicillin/streptomycin 10 ml
NEAA 10 ml
L-glutamine 10 ml
MiliQ H2O 370 ml
The media was stored at 4°C until use.
DMEM maintenance medium
2X DMEM 500 ml
FBS 20 ml
Penicillin/streptomycin 10 ml
NEAA 10 ml
L-glutamine 10 ml
MiliQ H2O 450 ml
The media was stored at 4°C until use.
Plaque medium (1.2% w/v carboxymethylcellulose)
2X DMEM 500 ml
FBS 20 ml
Penicillin/streptomycin 10 ml
NEAA 10 ml
L-glutamine 10 ml
MiliQ H2O 450 ml
138
Carboxymethylcellulose 12 g
The media was stored at 4°C until use.
MEM Freezing Media
1x MEM 89.5 ml
1x Penicillin/Streptomycin 1.0 ml
Fetal Calf Serum (FCS) 5.0 ml
1.0 M HEPES Buffer 2.0 ml
7% Sodium Bicarbonate 1.5 ml
Dimethyl sulphoxide (DMSO) 1.0 ml
The media was prepared fresh before carrying out the procedure for cell freezing.
DMSO was protected from light and stored at room temperature.
Media for Bacterial Culture
LB (Luria-Bertani) Medium, per liter (Miller, 1972)
NaCl 10 g
Trytone 10 g
Yeast extract 5 g
139
Appendix II Sequencing Results
Mutant A158T
Mutant C475T
140
Mutant A486G
141
Mutant G487A
142
Mutant A5262G
143
5’-NTR Partial Deletant Mutant (475-485)
144
Appendix III Real Time RT-PCR
Standard Curve for Interpolation of Unknown RNA Copy Number
Standards: RNA of different concentrations from 10-1 to 10-6 uM.
Calculations of viral RNA copy number were based on interpolation of the standard
curve.
Log Concentration
Cycle
No
145
Appendix IV Materials for SDS-PAGE
6x SDS Gel Loading Dye
Tris-HCl 0.35 M
SDS 10.28 %
Glycerol 36.0 %
Dithiothreitol (DTT) 0.6 M
Bromophenol Blue 0.012 %
The pH was adjusted to 6.8 and stored at -20oC until used.
SDS Running Buffer
Tris-BASE 25 mM
Glycine 192 mM
SDS 0.1 %
The pH was adjusted to 8.3 and the volume was prepared up to 10 L with distilled water.
SDS Staining Solution
Ethanol 40 %
Acetic acid 10 %
Coomassie Brilliant Blue 0.1 %
Distilled water 50 %
The mixture was stored at 4oC until used.
SDS Destaining Solution
Ethanol 40 %
Acetic acid 10 %
Distilled water 50 %
The mixture was stored at 4oC until used.
146
Appendix V Materials for Western Blot
Western Transfer Buffer
Tris-HCL 3.03 g
Glycine 1.44 g
Methanol 200 ml
The volume was prepared up to 1 L with distilled water and stored at 4oC until used.
Western Blocking Buffer
Tris-HCL 20 mM
NaCl 150 mM
Tween 20 0.05 %
Bovine Serum Albumin 1 %
Western Washing Buffer
Tris-HCL 20 mM
NaCl 150 mM
Tween 20 0.05 %
147
APPENDIX VI TCID50 Assay
Determination of infective dose (TCID50)
TCID50 was calculated using the Reed and Muench formula.
1. The cumulative number of infected wells was obtained by adding all the wells which
showed CPE at every dilution. (E.g. at dilution 10-5, 2 wells showed CPE. At dilution 10-
4, 3 wells showed CPE. Hence, the total number of wells which showed CPE up to
dilution factor 10-4 was 2 + 3 = 5)
2. The cumulative number of wells which were not infected with the virus was obtained
by subtracting the number of wells which showed CPE from the number of wells
inoculated. (E.g. at dilution 10-4, 1 well did not show CPE. At dilution 10-5, 2 wells did
not show CPE. Hence, the total number of wells which did not show CPE up to the
dilution factor 10-5 was 1 + 2 = 3).
3. The percentage of infectivity was calculated by dividing the total sum of the wells
which showed CPE and those did not show CPE by the cumulative number of wells
which showed CPE. (E.g. at dilution 10-4, 5/5+1 = 0.83 = 83%).
4. TCID50 end point calculation: The negative logarithm of the dilution factor which was
the closest to 50% was -4. Hence, the TCID50 end point = -4.0 + (0.7) = -4.7. Therefore,
the log of TCID50 end point or titer = 10 X 104.7 =
5. TCID50 = (% wells infected at dilution next above 50%) – (50%)
(% wells infected at dilution next above 50%) – (% wells infected at dilution next below 50%)
Whereby h = dilution factor
Dilution of original suspension that is equal to the TCID50 = 10 (log dilution next above 50%) – (I x
log h)
Since the wells were inoculated with 100uL virus suspension, 1mL of the virus
suspension will contain ten times the reciprocal of the calculated dilution above.
148
PUBLICATIONS
Review Articles
Yee PTI and Poh CL. (2016). The Final Stage of Developing Genetically Modified
Inactivated Sabin vaccine for the Eradication of Poliovirus. Austin J Microbiol. 1:1009-
1013.
Yee, PTI, Poh, C.L. (2016). Development of Novel Vaccines against Enterovirus-71.
Viruses. 8:1-13.
Book Chapters
Isabel Yee PT, Chit Laa Poh (2015). Attenuation of Virulence as antimicrobial strategy.
In A. Méndez-Vilas (Ed.), The Battle against Microbial Pathogens: Basic Science,
Technological Advances and Educational Programs (pp 886-894). Spain: Formatex
Research Center.
Conferences
Isabel Yee PT, Kuan Onn Tan, Chit Laa Poh. Rational design of live attenuated vaccine
by site-directed mutagenesis and deletion in the 5’- non coding region of the Enterovirus
71 (EV-A71) genome. Presented in European Academy of Allergy and Clinical
Immunology Congress. 6th-10th June 2015.
Chit Laa Poh, Isabel Yee PT. Enterovirus 71: Candidates for vaccines and antivirals.
World Congress and Expo on Microbiology, Frankfurt, Germany. 18-20th August, 2015.
Abstract also appears in Journal of Microbial & Biochemical Technology. 7(4). ISSN:
1948-5948.