Mol Diagn 2004; 8 (2): 101-105ORIGINAL RESEARCH ARTICLE 1084-8592/04/0002-0101/$31.00/0

© 2004 Adis Data Information BV. All rights reserved.

Rapid Detection of Common CARD15 Variants inPatients with Inflammatory Bowel DiseaseRebecca L. Roberts,1 Richard B. Gearry,2 Murray L. Barclay2 and Martin A. Kennedy1

1 Department of Pathology, Christchurch School of Medicine and Health Sciences, University of Otago, Christchurch,New Zealand

2 Department of Medicine, Christchurch School of Medicine and Health Sciences, University of Otago, Christchurch,New Zealand

Background: Three mutations (R702W, G908R, and 1007fs) within the CARD15 gene have been identified asAbstractindependent risk factors for the development of Crohn’s disease (CD). Virtually all studies investigating theoccurrence of these mutations in patients with CD have used separate PCR-based methods to screen patientDNA, here we describe a novel multiplex amplification refractory mutation system (ARMS) assay that allowsthe simultaneous detection of R702W, G908R, and 1007fs, and a fourth CARD15 variant, P268S, at a fraction ofthe cost of the pre-existing genotyping assays.Methods: Allele-specific primer sets were designed for each CARD15 variant, optimized separately forannealing temperature and MgCl2 and then multiplexed. The mutant- and wild-type-specific primers were splitacross two tubes so that each multiplex reaction was internally controlled for amplification failure. An additionalprimer pair specific to β2-microglobulin was included as an independent control for DNA quality. Thespecificity of each primer set was tested using positive controls that had been validated by sequencing, and therobustness of the final ARMS assay was assessed by genotyping 111 Caucasian patients with inflammatorybowel disease (IBD).Results: The specificity of each primer set was confirmed using a sequence validated positive control for each ofthe four CARD15 variants. Of the 111 DNA samples screened with our ARMS assay, a clear CARD15 genotypewas obtained for 109 patients.Discussion and conclusions: Given the potential predictive value of R702W, G980R, and 1007fs, a robustgenotyping method for these variants would be of considerable value both in diagnostic and research settings.Our ARMS assay only takes 3–4 hours to perform once DNA has been extracted and requires only 1U of TaqDNA polymerase, making it a rapid, reliable, and cost-effective alternative to current CARD15 genotypingmethods.

Crohn’s disease (CD) is a chronic idiopathic inflammatory apoptosis and nuclear factor (NF)-κB signaling pathways.[15]

CARD15 is composed of two NH2-terminal caspase recruitmentbowel disease that may affect any part of the gastrointestinaldomains, a nucleotide-binding domain (NBD), and 10 COOH-tract.[1] In addition to environmental risk factors, such as cigaretteterminal leucine-rich repeats (LRR) that interact with bacterialsmoking[2-6] and alterations in microbial flora,[7-9] twin studiesmuramyl dipeptide.[16,17]have shown that genetic factors play a significant role in determin-

ing an individual’s susceptibility to CD.[10-12] One such genetic To date, three single nucleotide mutations occurring within, orfactor is variability within the CARD15 gene (previously known as near, the LRR region of CARD15 have been shown to be indepen-NOD2 or BLAU) which encodes the cytosolic caspase recruitment dent risk factors for CD. It is hypothesized that 2104C>Tdomain-containing (CARD) protein 15.[13,14] This protein is prima- (R702W), 2722G>C (G908R) and 3020insC (1007fs) reduce therily expressed in monocytes, where it is believed to act as an ability of the LRR domain to recognize bacterial muramyl dipep-intracellular receptor for bacterial products thereby inducing tide, thereby triggering an exaggerated immune response.[13,14] It is

102 Roberts et al.

estimated that carriers of one variant CARD15 allele have a 1.5- to gene. To further ensure specificity, all allele-specific primers were4-fold increase risk of developing CD, whereas the presence of 30 bases and contained a 3′penultimate mismatch.two mutations further elevates the disease risk to between 10- and Each primer set was optimized separately for annealing temper-40-fold.[18] The frequency of R702W, G908R, and 1007fs vary ature and MgCl2, and then multiplexed. The mutant- and wild-considerably between races,[19,20] and, consequently, the contribu- type-specific primers were split across the two tubes so that eachtion of CARD15 variability to CD susceptibility also varies. In multiplex reaction was internally controlled for amplification fail-Caucasians, up to 50% of CD patients carry one variant allele, and ure (table I). An additional primer pair (β2Mf and β2Mr) specific3–15% are homozygous or compound heterozygotes for variant to a β2-microglobulin (β2M) sequence was included as an inde-CARD15 alleles.[18] In contrast, the frequency of all three CARD15 pendent control for DNA quality. Although not strictly necessary,variants is very low in Asians, and has not been demonstrated to be this PCR is important for distinguishing between 1007fs homozy-associated with CD incidence in Japanese patients.[21] gotes and PCR failure if a laboratory chooses not to include the

P268S variant in the assay.A large number of studies have investigated the prevalence ofR702W, G908R, and 1007fs, and the ability of these CARD15 The optimal conditions for the multiplexed ARMS assay are asvariants to predict the site and clinical course of CD.[22-30] Almost follows: two reactions (ARMS1 and ARMS2) containing a mix-all the studies to date have screened their sample populations for ture of CARD15 wild-type-specific and mutation-specific primers,these variants using a separate PCR-restriction fragment length and the β2M control primers, were performed on genomic DNApolymorphism (RFLP), Taqman PCR, or amplification refractory (table I). Reactions consisted of a total volume of 10μL containingmutation system (ARMS) assay for each variant. Here we present 200μM dNTP, 0.2μM of each primer, 3.0mM MgCl2, 0.5U Plati-a multiplex ARMS assay that simultaneously detects R702W, num® Taq DNA polymerase (Invitrogen Corp., Carlsbad, CA,G908R, and 1007fs, and a fourth nonsynonymous CARD15 vari- USA) and ~100ng genomic DNA. Temperature cycles (30 in total)ant, P268S (802C>T). Our assay significantly reduces the cost of were as follows: 94°C for 2 minutes, followed by 30 cycles ofscreening patients for the common CARD15 variants, by abolish- 94°C for 30 seconds, 68°C for 30 seconds, 72°C for 90 seconds,ing the need for expensive restriction enzymes, and by reducing and a final extension of 72°C for 10 minutes. 5μL of each reactionthe experiment time and quantity of reagent used. was resolved on 3% LE agarose and sized with a 25 bp DNA

molecular ladder (Invitrogen Corp., Carlsbad, CA, USA) [figure1b].

Materials and Methods

ResultsPeripheral blood was collected from 111 patients with inflam-matory bowel disease (IBD) who were in the care of gastroenterol-ogists in the Canterbury region of New Zealand. Forty-eight of In the first instance the specificity of each primer set used in thethese patients were participants in an earlier study that investigated ARMS assay was confirmed using a panel of samples that con-the occurrence of thiopurine-induced adverse reactions,[31] and 63 tained a positive control for each CARD15 variant (figure 1b).patients were recruited as part of a larger prospective study into the Direct sequencing with the ARMS common primers was used toetiology of IBD. Ethical approval for this study was obtained from validate each positive control sample. To assess the robustness ofthe Canterbury Ethics Committee, and all patients gave informed our ARMS assay, 111 genomic DNA samples from patients withconsent. Genomic DNA was extracted from 5mL peripheral blood IBD were genotyped. This sample consisted of 73 patients withsamples using the method of Ciulla et al.,[32] resuspended in water CD, 31 patients with ulcerative colitis (UC), and 5 patients withand stored at –20°C. indeterminate colitis. All patients in this sample were Caucasian.

The CARD15 gene is located on chromosome 16q12 and con- A clear genotype was obtained for 109 of the samples using oursists of 12 exons[14,22,24-27] (figure 1a). For ease of resolution, ARMS assay. The remaining two samples failed to amplify withcommon primers (268C, 702C, 908C, 1007C) were positioned so any of the ARMS primers. The three CD-associated mutationsthat all the PCR products were between 144 bp and 569 bp and R702W, G908R, and 1007fs, occurred at frequencies of 9.5%,differed in size by at least 99 bp. All primers were designed using 5.0%, and 5.0%, respectively, in the CD patients. Neither G908RDNAMAN primer software (DNAMAN Version 5.2.2, Lynnon nor the 1007fs variant was detected in any of the UC patients,Corp., Vaudreuil-Dorion, Quebec, Canada), and a subsequent however R702W occurred at a frequency of 5% in this subset ofBLAT search (http://genome.ucsc.edu/) of each oligonucleotide IBD patients. A fourth non-synonymous variant, P268S, was alsosequence ensured all primer pairs were specific to the CARD15 detected by our ARMS assay. This variant is always seen in

© 2004 Adis Data Information BV. All rights reserved. Mol Diagn 2004; 8 (2)

CARD15 ARMS Assay 103

1 2 3 4 5 6 7 8 9 10 11 12

702W/M 1007W/M

268C 702C 908W/M

250bp

a

bp

500

125

M 1 2 3 4 5

bp

569 (β2M)

458 (R702W)

352 (1007fs)

253 (G908R)

144 (P268S)

b

1007C

268W/M 908C

Fig. 1. Detection of common CARD15 variants. (a) Schematic diagram of the CARD15 gene. Exons (represented as rectangles) but not introns are shownto scale. The open reading frame is shown as shaded rectangles and the 3′-untranslated terminal repeat (UTR) is unshaded. The relative positions of thecommon (C) and allele-specific (W/M) PCR primers used in the ARMS assay are indicated by horizontal arrows. (b) Representative CARD15 genotypinggel. 5μL of ARMS1 (left lane) and ARMS2 (right lane) were resolved on 3% LE agarose with a 25 bp DNA ladder (M) for each sample. Sample 1: wild-type;sample 2: P268S heterozygote; sample 3: R702W heterozygote; sample 4: G908R heterozygote; and sample 5: 1007fs heterozygote. The R702W,G908R, and 1007fs variants all occur against a P268S background, consequently the positive controls for the Crohn’s disease-associated mutations arealso positive for the P268S variant.[14,18] The 569 bp band is an independent control for DNA integrity derived from the β2M gene.

haplotypes containing R702W, G908R, and 1007fs, but is also Discussion and Conclusions

found in the absence of these other mutations[14,18] (figure 1b). Over the last few years a variety of genotyping methods haveIn our sample we found 54 P268S variants, of which 31 were appeared in the CARD15 literature for the detection of R702W,

G908R, and 1007fs. To our knowledge, none of these genotypingfound in association with one of the other three CARD15 muta-strategies utilize a multiplex allele-specific PCR format. Althoughtions and 23 tested negative for R702W, G908R, and 1007fs.Ogura et al.[13] described a single tube allele-specific assay, this

Although this fourth mutation is not considered an independent approach only detected the frameshift mutation 1007fs. Similarly,risk factor for CD, Sugimura et al.[33] identified a new CD- Brant et al.[23] designed separate two-tube ARMS assays for

R702W and G908R. A number of separate PCR-RFLP as-associated haplotype in Ashkenazi Jews that contained P268S. It issays,[22,28] as well as Taqman PCR,[27] and pyrosequencing[34]

conceivable that other, yet to be identified, CD-associated muta-approaches have also been described for the detection of CD-

tions may also segregate with this fourth variant. Consequently,associated mutations. In contrast to these genotyping methods, our

because of its potential utility in identifying mutations relevant to ARMS assay enables the simultaneous detection of P268S,IBD, we have included detection of P268S in our assay. R702W, G908R, and 1007fs using two PCRs and two lanes of an

© 2004 Adis Data Information BV. All rights reserved. Mol Diagn 2004; 8 (2)

104 Roberts et al.

Table I. PCR primers used in the CARD15 amplification refractory mutation system (ARMS) assay

Primer Sequence (5′ to 3′)ab ARMS reaction

CD268WTf AGGTCTGGGCAGATGTGGGCATGGCTGGTC 2

CD268MUf AGGTCTGGGCAGATGTGGGCATGGCTGGTT 1

CD268Cr TCTTGCCACTGCCCGCCTCACCCACCACCA 1, 2

CD702WTf AGTGCCAGACATCTGAGAAGGCCCTGCTGC 1

CD702MUf AGTGCCAGACATCTGAGAAGGCCCTGCTGT 2

CD702Cr AGCTCGGTGCTCCCACACTTAGCCTTGATG 1, 2

CD908Cf TGTAATGTAAAGCCACTGAAAACTCTTGGG 1, 2

CD908WTr CTGGGCCCCCTCGTCACCCACTCTGTTGGC 1

CD908MUr CTGGGCCCCCTCGTCACCCACTCTGTTGGG 2

CD1007WTf CCTAGGGGCAGAAGCCCTCCTGCAGGCCGT 2

CD1007MUf CCTAGGGGCAGAAGCCCTCCTGCAGGCCGC 1

CD1007Cr TTCAACCACATCCCCATTCCTACACTATCT 1, 2

β2Mf TGTAAACACTTGGTGCCTGATATAGCTTGA 1, 2

β2Mr CATCAGTATCTCAGCAGGTGCCACTAATCT 1, 2

a 3′penultimate mismatches are in bold italics.

b Allele-specific mismatches are shown in bold.

2. Rubin DT, Hanauer SB. Smoking and inflammatory bowel disease. Eur J Gas-agarose gel. Furthermore, the entire assay, allowing for PCR set-troenterol Hepatol 2000; 12 (8): 855-62

up and run time, can be performed within 3–4 hours once genomic 3. Somerville KW, Logan RF, Edmond M, et al. Smoking and Crohn’s disease. BMJ(Clin Res Ed) 1984; 289 (6450): 954-6DNA has been extracted and requires only 1U of Platinum® Taq

4. Corrao G, Tragnone A, Caprilli R, et al. Risk of inflammatory bowel diseaseDNA polymerase.attributable to smoking, oral contraception and breastfeeding in Italy: a nation-

Multiple studies have now established an association between wide case-control study. Cooperative Investigators of the Italian Group for theStudy of the Colon and the Rectum (GISC). Int J Epidemiol 1998; 27 (3):R702W, G908R, and 1007fs, and CD. Although there are current-397-404ly no clinical indications for CARD15 genotyping, further research

5. Card T, Logan RF, Rodrigues LC, et al. Antibiotic use and the development ofis underway to determine if CARD15 mutations have a role in Crohn’s disease. Gut 2004; 53 (2): 246-50

6. Ekbom A, Montgomery SM. Environmental risk factors (excluding tobacco anddetermining prognosis, response to treatment, and, perhaps,microorganisms): critical analysis of old and new hypotheses. Best Pract Resscreening of unaffected relatives.[35] Given the potential predictiveClin Gastroenterol 2004; 18 (3): 497-508

nature of these CARD15 mutations, a robust genotyping method 7. Feeney MA, Murphy F, Clegg AJ, et al. A case-control study of childhoodenvironmental risk factors for the development of inflammatory bowel disease.for these functional variants would be of considerable value, bothEur J Gastroenterol Hepatol 2002; 14 (5): 529-34in the clinic and studies investigating the etiology of IBD. Our

8. el-Omar E, Penman I, Cruikshank G, et al. Low prevalence of Helicobacter pyloriARMS assay provides a rapid, reliable, and inexpensive alterna- in inflammatory bowel disease: association with sulphasalazine. Gut 1994; 35

(10): 1385-8tive to current CARD15 genotyping methods.9. Parente F, Molteni P, Bollani S, et al. Prevalence of Helicobacter pylori infection

and related upper gastrointestinal lesions in patients with inflammatory bowelAcknowledgmentsdiseases: a cross-sectional study with matching. Scand J Gastroenterol 1997; 32(11): 1140-6We wish to thank Professor Kimmo Kontula at the Helsinki University

10. Orholm M, Binder V, Sorensen TI, et al. Concordance of inflammatory bowelCentral Hospital, Finland, for providing positive controls for R702W, G908R,disease among Danish twins: results of a nationwide study. Scand J Gas-

and 1007fs. troenterol 2000; 35 (10): 1075-81Dr Roberts is the recipient of Health Sciences Career Development Pro- 11. Thompson NP, Driscoll R, Pounder RE, et al. Genetics versus environment in

gramme Award from the University of Otago, and Dr Gearry is a Canterbury inflammatory bowel disease: results of a British twin study. BMJ 1996; 312(7023): 95-6Medical Research Foundation Fellow. This work was funded by the Canter-

12. Tysk C, Lindberg E, Jarnerot G, et al. Ulcerative colitis and Crohn’s disease in anbury Medical Research Foundation, Lottery Grants Health Board (New Zea-unselected population of monozygotic and dizygotic twins: a study of heritabili-land), and the Health Research Council of New Zealand. None of the authorsty and the influence of smoking. Gut 1988; 29 (7): 990-6have any conflicts of interest directly relevant to this study.

13. Ogura Y, Bonen DK, Inohara N, et al. A frameshift mutation in NOD2 associatedwith susceptibility to Crohn’s disease. Nature 2001; 411 (6837): 603-6

References 14. Hugot JP, Chamaillard M, Zouali H, et al. Association of NOD2 leucine-rich repeat1. Podolsky DK. The current future understanding of inflammatory bowel disease. variants with susceptibility to Crohn’s disease. Nature 2001; 411 (6837):

Best Pract Res Clin Gastroenterol 2002; 16 (6): 933-43 599-603

© 2004 Adis Data Information BV. All rights reserved. Mol Diagn 2004; 8 (2)

CARD15 ARMS Assay 105

15. Ogura Y, Inohara N, Benito A, et al. Nod2, a Nod1/Apaf-1 family member that is 27. Hampe J, Grebe J, Nikolaus S, et al. Association of NOD2 (CARD 15) genotyperestricted to monocytes and activates NF-kappaB. J Biol Chem 2001; 276 (7): with clinical course of Crohn’s disease: a cohort study. Lancet 2002; 3594812-8 (9318): 1661-5

16. Inohara N, Nunez G. NODs: intracellular proteins involved in inflammation and 28. Helio T, Halme L, Lappalainen M, et al. CARD15/NOD2 gene variants areapoptosis. Nat Rev Immunol 2003; 3 (5): 371-82 associated with familiarly occurring and complicated forms of Crohn’s disease.

Gut 2003; 52 (4): 558-6217. Girardin SE, Boneca IG, Viala J, et al. Nod2 is a general sensor of peptidoglycanthrough muramyl dipeptide (MDP) detection. J Biol Chem 2003; 278 (11): 29. Linde K, Boor PP, Houwing-Duistermaat JJ, et al. Card15 and Crohn’s disease:8869-72 healthy homozygous carriers of the 3020insC frameshift mutation. Am J

18. Lesage S, Zouali H, Cezard JP, et al. CARD15/NOD2 mutational analysis and Gastroenterol 2003; 98 (3): 613-7genotype-phenotype correlation in 612 patients with inflammatory bowel dis- 30. Vermeire S, Wild G, Kocher K, et al. CARD15 genetic variation in a Quebecease. Am J Hum Genet 2002; 70 (4): 845-57 population: prevalence, genotype-phenotype relationship, and haplotype struc-

19. Yang SK, Loftus EV, Sandborn WJ. Epidemiology of inflammatory bowel disease ture. Am J Hum Genet 2002; 71 (1): 74-83in Asia. Inflamm Bowel Dis 2001; 7 (3): 260-70

31. Gearry RB, Barclay ML, Burt MJ, et al. Thiopurine S-methyltransferase (TPMT)20. Sonnenberg A, Wasserman IH. Epidemiology of inflammatory bowel disease genotype does not predict adverse drug reactions to thiopurine drugs in patients

among US military veterans. Gastroenterology 1991; 101 (1): 122-30 with inflammatory bowel disease. Aliment Pharmacol Ther 2003; 18 (4):21. Inoue N, Tamura K, Kinouchi Y, et al. Lack of common NOD2 variants in 395-400

Japanese patients with Crohn’s disease. Gastroenterology 2002; 123 (1): 86-91 32. Ciulla TA, Sklar RM, Hauser SL. A simple method for DNA purification from22. Cavanaugh JA, Adams KE, Quak EJ, et al. CARD15/NOD2 risk alleles in the peripheral blood. Anal Biochem 1988; 174 (2): 485-8

development of Crohn’s disease in the Australian population. Ann Hum Genet33. Sugimura K, Taylor KD, Lin YC, et al. A novel NOD2/CARD15 haplotype

2003; 67 (Pt 1): 35-41conferring risk for Crohn disease in Ashkenazi Jews. Am J Hum Genet 2003; 72

23. Brant SR, Picco MF, Achkar JP, et al. Defining complex contributions of NOD2/ (3): 509-18CARD15 gene mutations, age at onset, and tobacco use on Crohn’s disease

34. Palmieri O, Toth S, Ferraris A, et al. CARD15 genotyping in inflammatory bowelphenotypes. Inflamm Bowel Dis 2003; 9 (5): 281-9disease patients by multiplex pyrosequencing. Clin Chem 2003; 49 (10): 1675-9

24. Buning C, Genschel J, Buhner S, et al. Mutations in the NOD2/CARD15 gene in35. Vermeire S. NOD2/CARD15: relevance in clinical practice. Best Pract Res ClinCrohn’s disease are associated with ileocecal resection and are a risk factor for

Gastroenterol 2004; 18 (3): 569-75reoperation. Aliment Pharmacol Ther 2004; 19 (10): 1073-8

25. Guo QS, Xia B, Jiang Y, et al. NOD2 3020insC frameshift mutation is notassociated with inflammatory bowel disease in Chinese patients of Han nation-

Correspondence and offprints: Dr Rebecca L. Roberts, Department of Pathol-ality. World J Gastroenterol 2004; 10 (7): 1069-71ogy, Christchurch School of Medicine & Health Sciences, University of26. Hampe J, Cuthbert A, Croucher PJ, et al. Association between insertion mutation inOtago, PO Box 4345, Christchurch, New Zealand.NOD2 gene and Crohn’s disease in German and British populations. Lancet

2001; 357 (9272): 1925-8 E-mail: rebecca.roberts@chmeds.ac.nz

© 2004 Adis Data Information BV. All rights reserved. Mol Diagn 2004; 8 (2)