Rapid cloning of HLA class I cDNAs by locus specific PCR

Ž .Journal of Immunological Methods 233 2000 119–129www.elsevier.nlrlocaterjim

Recombinant Technology

Rapid cloning of HLA class I cDNAs by locus specific PCR

David R. Johnson ), Barbara C. Biedermann, Barry Mook-KanamoriDepartment of Pathology and the Molecular Cardiobiology Program, 454 Boyer Center for Molecular Medicine, Yale UniÕersity School of

Medicine, 295 Congress AÕenue, New HaÕen, CT 06536, USA

Received 10 March 1999; received in revised form 2 August 1999; accepted 16 August 1999

Abstract

Ž . Ž .The human major histocompatibility complex MHC class I loci, human leukocyte antigen HLA -A, -B, -C, encodehighly polymorphic molecules that mediate immune recognition of infectious pathogens and can initiate the rapid rejectionof transplanted tissue. Cloning of HLA class I alleles is complicated by polymorphism as well as interlocus homology. Here,HLA class I cDNAs are amplified by PCR using one common primer with one of three locus specific primers whose 3X endsmap to conserved, locus specific nucleotides. Using these primers, HLA-A, -B, and -C alleles were cloned from a number ofcell lines and two different HLA-B alleles were cloned from a single, heterozygous cell line. The amplified products encodethe entire extracellular portion of the class I molecules. An amplified HLA-A allele was cloned into an expression vector andthe protein product was detected on the surface of a transfected cell. A premature termination codon was engineered into theHLA-A allele by site directed mutagenesis and the soluble protein product was detected in the culture medium of transfectedcells. Therefore, these primers can be used to rapidly clone, alter, and express HLA class I molecules. This method mayexpedite the generation of reagents for testing the antigen specificity of antibodies, natural killer cells, or T cells. q 2000Elsevier Science B.V. All rights reserved.

Keywords: HLA class I; RT-PCR

1. Introduction

Ž .Human leukocyte antigen HLA class I moleculesare composed of a polymorphic transmembrane heavyŽ .45 kDa chain and a monomorphic, water soluble

Ž . Žlight 12 kDa chain called b microglobulin Tus-2

AbbreÕiations: HIV, human immunodeficiency virus; HLA,human leukocyte antigen; mHLA, membrane bound HLA; sHLA,secreted HLA; MHC, major histocompatibility complex; UTR,untranslated region

) Corresponding author. Tel.: q1-203-737-2298; fax: q1-203-737-2293; e-mail: [email protected]

.sey and McMichael, 1995 . HLA class I moleculesare expressed on the surface of nearly all nucleatedcells and mediate interactions with T lymphocytes,which recognize peptides bound to class I molecules,and natural killer cells, which recognize particularallelic forms of class I molecules. Allelic forms ofHLA class I molecules influence the course of HIV-1

Ž .infection Kaslow et al., 1996 , malaria infectionŽ .Hill et al., 1992 and certain autoimmune diseasesŽ .Jurewicz et al., 1998 . Allelic differences betweenorgan or bone marrow transplant donors and recipi-

Ž .ents underlie graft rejection Takemoto et al., 1993Žand graft-versus-host disease Santamaria et al.,

.1994 .

0022-1759r00r$ - see front matter q 2000 Elsevier Science B.V. All rights reserved.Ž .PII: S0022-1759 99 00121-0

( )D.R. Johnson et al.rJournal of Immunological Methods 233 2000 119–129120

The genes encoding the histocompatibilitymolecules are the most polymorphic in the humangenome with 124 HLA-A, 258 HLA-B and 74 HLA-

ŽC class I alleles currently assigned Bodmer et al.,.1999 . Several ‘‘non-classical’’ HLA class I genes,

HLA-E, -F, and -G, are expressed at lower levels ina narrower range of tissues. Additional HLA class I

Žpseudogenes, named HLA-H, -J, -K, and -L Bodmer.et al., 1999 , may serve as templates for gene con-

Ž .version Kuhner et al., 1991 or may simply repre-Ž .sent non-functional ‘‘dead’’ genes Nei et al., 1997 .

Reverse transcription followed by polymeraseŽ .chain reaction RT-PCR detects only mature,

polyadenylated mRNA, thereby avoiding untran-scribed pseudogenes. To date, however, RT-PCR ofHLA class I mRNA has been reported only follow-ing reverse transcription with gene specific primersand multiple PCRs and sequencing reactions for each

Ž .locus Santamaria et al., 1993 . Here, primers aredescribed that amplify nearly full-length HLA-A, -B,

Žand -C in three PCRs with cDNA from single oligo-.dT primed reverse transcription reactions. More-

over, these primers can be used to rapidly clone andexpress allelic forms of HLA class I molecules.

2. Materials and methods

2.1. Cells

Human umbilical cord blood B cells were pre-pared and transformed with Epstein Barr virus as

Ž .described previously Biedermann and Pober, 1998 .These B cells, K562 human myeloid leukemia cellsŽobtained from the American Type Culture Collec-

.tion, ATCC, Rockville, MD , and JY human BŽlymphoblastoid cells gift of P. Cresswell, Yale Med-

.ical School, New Haven, CT were cultured in RPMI1640 medium supplemented with 10% fetal calf

Ž .serum FCS , 2 mM L-glutamine, 100 Urml peni-Žcillin and 100 mgrml streptomycin sulfate all from

.Life Technologies, Grand Island, NY . A portion ofthe cord blood mononuclear cells was used for sero-

Žlogical tissue typing courtesy of the Yale Tissue.Typing Laboratory, M.I. Lorber, director . HeLa cer-

Žvical carcinoma cells gift of R. Flavell, Yale Medi-. Žcal School and Jar trophoblast cells gift of J.

.Peyman, Yale Medical School were cultured inŽDulbecco’s modified Eagle medium Life Technolo-

.gies , 10% FCS, L-glutamine, penicillin and strepto-mycin sulfate.

2.2. RNA and cDNA preparation

ŽRNA was prepared using a kit RNAeasy, Qia-.gen, Hilden, Germany , which isolates RNA

molecules longer than 200 nucleotides following celllysis in guanidinium isothiocyanate salts and purifi-cation over a silica gel column. cDNA was generatedin a reaction containing 2 mg RNA, 0.2 mM dNTPŽ .each , 0.33 mg oligo dT , 0.25 ml ribonuclease15

Ž .inhibitor RNasin, 10 U, Promega, Madison, WI ,Ž0.5 ml 0.1 M DTT, 0.25 ml reverse transcriptase 50

.U, Superscript II, BRL, Gaithersburg, MD in bufferŽ .BRL, total volume10 ml . Reverse transcription re-actions were incubated at 228C for 10 min, 438C for

Ž1 h, and 658C for 10 min. RNaseH was added 0.5.ml, 1.6 U, BRL and the reaction incubated for 30

Žmin at 378C. Finally, 40 ml TE buffer 10 mM Tris.pH 7.5, 1 mM EDTA were added and the cDNA

stored at 48C. These cDNAs are stable for at least 4months.

2.3. Primer selection

A common 5X primer was selected from the con-X Ž .sensus 5 untranslated regions UTRs of HLA class

Ž .I genes obtained from Genbank Fig. 1A . TheABC01 primer exactly matches the 7 HLA-A and 18HLA-C 5X UTRs available in Genbank. HLA-B UTRsdiffer. All 34 HLA-B alleles in Genbank are missingthe nucleotide shown between the ABC01 primerand the initiating methionine codon. Nine HLA-B

Ž . Ž .alleles have guanosine G at position y18 y18G ,2 are y6A, and 2 are y3A.

Locus specific 3X primers were selected by com-Žparing the sequences of identified HLA alleles Fig.

. X1B . In each case, the 3 end of the primer maps toan invariant and locus specific nucleotide. The A01primer overlaps the splice junction between exons 6and 7. The B01 primer maps to the middle of exon 5,which encodes the transmembrane region. The C01primer is entirely within exon 7. These sequences are

Ž .invariant among the respective alleles Fig. 1B .

( )D.R. Johnson et al.rJournal of Immunological Methods 233 2000 119–129 121

Fig. 1. Primer selection for PCR of HLA class I cDNA. One common and three gene-specific PCR primers were selected based onŽ . X Ž .published sequences. A The consensus sequence from the 5 untranslated regions UTRs was derived from HLA alleles available from

Ž .Genbank. The initiating methionine codon is underlined. B The nucleotide sequences of HLA class I alleles from each locus werecompared and scored as follows: WsArT, SsGrC, YsTrC, RsArG, KsGrT, MsArC, VsArCrG, HsArCrT, Bs

Ž . UCrGrT, DsArGrT. Sequences from the HLArImmunogenetics database version 1.1 April 1999 , excluding alleles A 0105N,U U U U U Ž .A 0215N, A 0303N, A 2409N, B 5111N, or B 7301. The locus-specific primers are the reverse compliments of the boxed sequences. C

Diagram of PCR primer locations on HLA cDNA. The location of the sequencing primer ABC02 is also shown.

2.4. PCR and analysis

PCRs contained 1 ml template, 0.2 mM dNTPsŽ .each , 0.25 mM each primer, 0.25 U Taq poly-

Ž .merase Boehringer Mannheim, Indianapolis, IN orŽ .Stoffel fragment Perkin-Elmer, Foster City, CA in

Ž .buffer total volume, 10 ml . The primers used inthis study, listed in Table 1, were synthesized at theKeck Biotechnology Center, Yale Medical School.Reactions were incubated at 948C for 1 min, then

Ž .cycled 30 times at 948C — 30 s denature , 608C —Ž .30 s anneal or 428C — 30 s for b-actin, 728C, 1Ž .min extend , then incubated at 728C for 10 min to

Žcomplete extensions 9600 thermal cycler, Perkin-

.Elmer . Prior to sequencing, primers were removedŽ .by a PCR product clean-up kit Qiagen . Taqrdye-

Table 1Primers used for PCR and sequencing

X XŽ .Name Gene Sequence 5 –3

ABC01 HLA-A,B,C GATTCTCCCCAGACGCCGAGA01 HLA-A CCTGGGCACTGTCACTGCTTB01 HLA-B GGACAGCCAGACCAGCAACAC01 HLA-C TCAGAGCCCTGGGCACTGTTABC02 HLA-A,B,C CTGCCAGGTCAGTGTGATCTA2.33 HLA-A2 TCATCTCAGGGTGAGGGGCTTGBA.51 b-actin GTGGGGCGCCCCAGGCACCABA.31 b-actin CTCCTTAATGTCACGCACGATTTC



terminator cycle sequencing was performed by theŽ .Keck Biotechnology Center Yale Medical School

using the primer ABC02 or the M13rpUC forwardŽor reverse primers catalog numbers 1211 and 1201,

.New England Biolabs, Beverly, MA .

2.5. cDNA cloning and subcloning

HLA-A, -B, or -C cDNAs were PCR amplifiedwith Taq polymerase and the primers ABC01 andA01, B01, or C01 and then cloned into the EcoRV

Ž .site of Litmus28 New England Biolabs . The JYŽ .HLA-A PCR product HLA-A2 and the product of a

second PCR with the primers ABC01 and A2.33,which yields a truncated product and replaces amembrane proximal tryptophan codon with a stop

Žcodon, were TrA cloned into pCR2.1 Invitrogen,.Carlsbad, CA . The orientation was determined by

digestion with SacI. The HindIII–XbaI fragmentswere then cloned behind the cytomegalovirus pro-

Žmoter in the pCDNA3.1-expression vector Invitro-.gen .

(2.6. Transfection and analysis flow cytometry and)immunoblot

K562 cells were transfected by electroporationwith 10 mg of the expression vectors RSV5.HLA-A1

Žor RSV5.HLA-B8 generously provided by Dr. W..Biddison, NIH . RNA was isolated after 72 h. One

microgram of RNA was analyzed by RT-PCR asdescribed above.

HeLa cells were transfected by calcium phosphatecoprecipitation with 3 mg of DNA encoding the

Ž .membrane bound form of HLA-A2 mHLA-A2 orŽ .the secreted form sHLA-A2 . Cell surface expres-

sion was analyzed at 72 h by flow cytometry andculture supernatant and cell lysates were harvested at96 h and analyzed by immunoblotting as described

Fig. 3. Specific amplification of HLA-A or -B cDNA. TheHLA-A,B negative cell line K562 was transfected with expression

Ž . Žvectors encoding HLA-A1 lanes 2, 6, 9 or HLA-B8 lanes 3, 7,.10 . cDNA was prepared and PCR amplified with primers for

Ž . Ž . Ž .b-actin lanes 1–4 , HLA-A lanes 5–7 or HLA-B lanes 8–10 .As a control for genomic DNA template, one reaction contained

Ž .RNA that was not reverse transcribed no RT, lane 4 . A represen-tative gel of the reaction products is shown.

Ž . 4previously Ma et al., 1997 . Briefly, 5=10 cellswere stained with a monoclonal antibody specific for

Ž . ŽHLA-A2 BB7.2, ATCC or pan HLA W6r32,. ŽATCC and fluoresceinated secondary antibody goat

.anti-mouse, Boehringer Mannheim . Five thousandŽviable cells were analyzed FACScan, Becton-Dick-

.inson . For immunoblotting, two hundred thousandŽcells were lysed 200 ml, 1% NP40, 137 mM NaCl,

.20 mM Tris pH 7.4, 1 mM CaCl , 1 mM MgCl2 2

and 7.5 ml of the clarified lysate or culture mediumwere diluted 1r2 in reducing sample buffer and

Žresolved along with protein size standards Rainbow,.Amersham, Arlington Heights, IL on a SDS 10%

Žpolyacrylamide gel and blotted Immobilon-P, Milli-.pore, Bedford, MA . The blot was stained with a

monoclonal antibody specific for the HLA heavyŽ .chain 171.4, ATCC , followed by biotinylated sec-

Ž .ondary antibody Sigma, St. Louis, MO thenŽhorseradish peroxidase conjugated avidin Vector

.Laboratories, Burlingame, CA , and detected by

Ž . Ž . ŽFig. 2. Specific PCR amplification of HLA-A and HLA-B DNA in vitro. A The DNA polymerases Taq lanes 1–6 and Stoffel lanes. Ž .7–12 were compared in reactions containing the HLA-A primer pair ABC01–A01, lanes 1–3 and 7–9 or HLA-B primer pair

Ž .ABC01–B01, lanes 4–6 and 10–12 with expression vector DNA encoding HLA-A1 or HLA-B8 as templates. Products were resolved byŽ .agarose gel electrophoresis. Products are generated only in reactions containing HLA-A primers and HLA-A template lanes 1, 2, 7, 8 or

Ž . Ž .HLA-B primers and HLA-B template lanes 4, 5, 11, 12 . B Restriction endonuclease sites used for analytical digestions of the HLA-A, -BŽ .and -C PCR products. The sites with gray text are found in a subset of alleles. C Restriction enzyme analysis of HLA-A and -B PCR

Ž . Ž .products. The products shown above panel a, lanes 1, 2, 5–8, 11, 12 were incubated with no enzyme none or with StuI or PÕuII and thenresolved on a 1.5% agarose gel.


Žchemiluminescence Kirkegaard and Perry Laborato-.ries, Gaithersburg, MD .

3. Results

3.1. Testing primer specificity

The ability of the selected PCR primers to am-plify HLA class I genes specifically was tested invitro using plasmids encoding HLA-A1 or HLA-B8.Taq DNA polymerase and the Stoffel fragment of

ŽTaq, which may have a lower mutation rate Lawyer.et al., 1993 , were tested. Both enzymes produce

discrete products only with the appropriate tem-

Ž .platerprimer combinations Fig. 2A . That is, theHLA-A primers generate a product with the HLA-A

Ž .template lanes 1, 2, 7 and 8 but not the HLA-BŽ .template lanes 3 and 9 and the HLA-B primers

Žgenerate a product with the HLA-B template lanes. Ž5, 6, 11 and 12 but not the HLA-A template lanes 4

. Žand 10 . A third polymerase, Vent New England.Biolabs , produced additional, nonspecific products

with the HLA-B primer pair and was not testedŽ .further data not shown .

A combination of three different restriction en-donucleases can be used to quickly identify HLA-A,

Ž .-B or -C cDNAs Fig. 2B . StuI cleaves all knownHLA-A alleles at position 774 but not HLA-B orHLA-C alleles. Similarly, BglII cleaves nearly all

Ž .Fig. 4. Amplification of Endogenous HLA-A, -B, -C cDNAs. A PCR amplification of cDNA from Jar and HeLa cells using HLA-A, -B,Ž .or -C primers. Products are generated in reactions with cDNA from HeLa cells but not Jar cells. B Restriction enzyme analysis of PCR

Ž . Ž . Ž .products. Products of HLA-A, -B and -C PCRs with cDNA from HeLa cells were treated with no enzyme y or with StuI S , BglII B ,Ž .or PÕuII P .


HLA-B alleles at position 268 but not HLA-A or -Calleles. PÕuII cuts both HLA-C and -B at position806 and also at position 535 in a subset of B alleles,as represented by gray text. Thus, by analyzingdigestion of PCR products by these enzymes, theamplified HLA locus often can be determined.

The identity of the HLA PCR products was testedby digestion with restriction endonucleases. Theproduct of the amplification with HLA-A primers is

Žcut with A-specific StuI but not PÕuII Fig. 2C,.lanes 1–3 . This is true even when HLA-B template

Ž .is included in the reaction lanes 4–6 , suggestingthat hybrid ArB molecules are not formed duringthe reaction. Similarly, the products of amplificationwith HLA-B primers are cut only by PÕuII and not

Ž .by StuI lanes 7–9 , even when the reaction includesŽ .HLA-A template lanes 10–12 . The yields of both

Taq and Stoffel polymerases were nearly indistin-guishable and neither generated hybrids so analysiswas continued with Taq alone.

3.2. Amplification of transfected HLA class I cDNAs

Primer specificity was further tested by amplify-ing cDNA. mRNA encoding HLA-A or -B wasgenerated in vivo by transfecting K562 myeloidleukemia cells, which are reported to be HLA class I

Ž .negative Cereb and Yang, 1996 , with expressionconstructs encoding HLA-A1 or HLA-B8. RNA wasprepared, reverse transcribed, and tested in amplifi-cations with primers specific for HLA-A, HLA-B or

Žb-actin as a control. All cells express b-actin Fig. 3,.lanes 1–3 . Any contaminating genomic DNA does

not serve as template, since the product depends onŽ .reverse transcription lane 4 . Only K562 cells trans-

Ž .fected with HLA-A1 contain HLA-A mRNA lane 6and only the cells transfected with HLA-B8 contain

Ž .HLA-B mRNA lane 10 . This experiment demon-strates that these primers are specific for the HLAgenes following RNA preparation, reverse transcrip-tion, and PCR.

3.3. Amplification of endogenous HLA class I cDNAs

Amplification of endogenous HLA class I alleleswas tested. RNA was prepared from HeLa cells andJar trophoblast cells and RT-PCR was performed asdescribed above. Control b-actin cDNA can be am-

Ž .plified from both cell lines not shown while HLA-A, -B, and -C cDNAs can be amplified from HeLa

Ž .cells but not Jar cells Fig. 4A . The PCR productsfrom HeLa cells were identified by restriction en-zyme digestion and gel electrophoresis. The HLA-Aprimer products are cut with StuI but not BglII orPÕuII, the HLA-B primer products are cut withBglII and PÕuII but not StuI, and the HLA-C primer

Fig. 5. Cloned HLA-B alleles are non-chimeric. Alignment of theHLA-B alleles is shown. Nucleotide sequences of HLA-BU 0702Ž . U Ž .upper and -B 4402 lower were aligned by ClustalV. Nu-

ŽU .cleotide identities are indicated by a star and differences areindicated by a gap. There are 54 differences in the first 650nucleotides that are shown; there are only four differences in theremaining ;450 nucleotides. Cloned alleles matched eitherBU 0702 or BU4402 alleles throughout this region.


products are cut with PÕuII but not StuI or BglIIŽ .Fig. 4B . Therefore, HLA class I locus cDNAs arespecifically amplified by these primer combinations.

3.4. Cloning of HLA-A, -B, and -C alleles

The ability to rapidly clone HLA class I alleleswas tested next. RT-PCR was performed as de-

scribed above with RNA prepared from a serologi-Žcally typed, EBV transformed B cell line Bieder-

.mann and Pober, 1998 . The PCR products werecloned, sequenced, and the sequences were com-

Žpared to the HLA class I database Robinson et al.,.1999 . The cloned HLA-A allele perfectly matches

the AU 02011 allele through all 1043 nucleotides,consistent with the serological type A2. The cloned

Fig. 6. Expression of cloned HLA-A2 cDNA in membrane-bound and secreted forms. HLA-A2 was cloned in a longer form that includesŽ . Ž . Ž .the transmembrane domain membrane, mHLA and a shorter form that terminates before the transmembrane domain secreted, sHLA . A

Ž .Fluorescent flow cytometry of cells transfected with control pUC19 DNA or mHLA-A2 lower panels . The control antibody plot is scaledto 200 maximum; the other plots are scaled to 120. HLA-A2 is specifically detected on the surface of mHLA-A2-transfected, but not control

Ž .transfected, cells. B Immunoblot of lysates from cells transfected with control pUC19, mHLA-A2 or sHLA-A2. Cells transfected withŽ .mHLA-A2 express more HLA heavy chain protein of nearly full size lane 2, filled triangle , while cells transfected with sHLA-A2 express

Ž . Ž .a shorter form of the HLA heavy chain lane 3, open triangle . C Immunoblot of culture medium from cells transfected with control pUCŽor sHLA-A2. More of a shorter form of HLA heavy chain is detected in the medium of cells transfected with sHLA-A2 lane 2, open

.triangle .


HLA-B allele closely matches the BU4404 alleleŽeight nucleotide differences out of 932 compared,

.99% identity , consistent with the serological typeB44. Every alternative nucleotide is found in otherHLA-B alleles, suggesting that the mismatches arenot due simply to sequencing error. The clonedHLA-C allele closely matches the CwU12042 alleleŽ .99% identity through 1053 nucleotides .

It has been reported that PCR amplification ofHLA class I molecules from heterozygous cell linesmay, under some conditions, generate chimericmolecules containing crossovers between the two

Ž .alleles Ennis et al., 1990 . To investigate the genera-tion of chimeric molecules under these PCR condi-tions, HLA-B alleles were cloned from a B cell linethat was serologically typed as HLA-B7,44. Thesealleles can be distinguished by restriction enzymeanalysis because HLA-B44 but not HLA-B7 containsthe Pst I restriction site at position 611. The PCRproduct contained both alleles because only a frac-

Žtion of the product was cut with PstI data not.shown . Clones were tentatively identified as B7 or

B44 by digestion with Pst I. Two B7 clones and oneB44 clone were sequenced and compared to theBU 0702 and BU4402 alleles. These alleles differ at54 nucleotides that are distributed over the first 650

Ž .nucleotides Fig. 5 . Examining this region, the twoB7 clones match BU 0702 and the B44 clone matches

U Ž .B 4402 without any crossovers data not shown .This suggests that these PCR conditions tend togenerate non-chimeric products.

3.5. Expression of membrane and soluble forms ofHLA alleles

RT-PCR amplification and cloning could acceler-ate the expression of new and different forms ofHLA class I molecules. To test this application, theHLA-A2 product from JY lymphoblastoid cells wascloned into an expression vector. A truncated form,in which a termination codon is placed before thetransmembrane region, was also generated and clonedinto an expression vector.

HeLa cells transfected with an expression vectorencoding the full length HLA-A2 PCR productŽ . ŽmHLA-A2 express HLA-A2 on their surface Fig.

.6A . Lysates from these cells also contain more HLA

Žheavy chain of nearly full length Fig. 6B, lane 2,.closed triangle . HeLa cells transfected with the trun-

Ž .cated PCR product sHLA-A2 do not express HLA-Ž .A2 on their surface not shown and their lysates

Žcontain a smaller class I heavy chain Fig. 6B, lane.3, open triangle . The smaller product of the sHLA

vector is secreted and accumulates in the cultureŽ .medium Fig. 6C, lane 2, open triangle . The slightly

smaller band detected in the control transfected cellŽ .lysate lane 1 might be the product of alternatively

Ž .spliced HLA mRNA Krangel, 1986 . Therefore, thePCR product can be used to quickly clone andexpress different forms of HLA class I molecules.

4. Discussion

The highly polymorphic HLA class I genes com-bine to produce a pattern of expression that is uniquefor nearly every human. The extreme polymorphismcomplicates cloning and analysis of HLA class Igenes. Here, HLA class I cDNAs are specifically

Ž 2 6PCR amplified by exploiting the strong 10 –10 -.fold bias of Taq DNA polymerase toward extending

X Žprimers whose 3 ends match the template Newton.et al., 1989; Wu et al., 1989; Huang et al., 1992 .

Locus-specific primers were designed whose 3X

Ž .ends match conserved nucleotides Fig. 1 . For ex-ample, primer HLA-A01 perfectly matches the or-

Žthologous A loci from rhesus monkeys Macaca. Ž .mulatta , common chimpanzees Pan troglodytes ,

Ž .Wild Pygmy Chimpanzees Pan paniscus ,Ž . Žorangutans Pongo pygmaeus , gorillas Gorilla go-

. Ž .rilla , gibbons Hylobates lar , and even sheep andŽ .cattle Bota MHC class I genes. HLA-B01 and -C01

also match B and C loci, respectively, from differentspecies. This suggests that all human class I loci canbe specifically amplified by the HLA-A01, -B01,and -C01 primers.

The HLA-C primer C01 also matches the class Ipseudogene HLA-H, which contains a prematuretermination codon in exon 4. The common upstreamprimer, ABC01, matches the putative 5X UTR ofHLA-H. Furthermore, low levels of HLA-H tran-

Žscripts have been detected in transfected cells Chor-.ney et al., 1990 and are therefore potential targets of


amplification with HLA-C primers. Amplification ofHLA-H does not occur in the samples used in thisstudy, however, because the cloned HLA-C PCRproducts do not include HLA-H sequences and theHLA-C PCR products are not digested with BglIIŽ .Fig. 4B , which digests HLA-H cDNA. The poten-tial for amplification of HLA-H transcripts by theseHLA-C primers should be considered for each celltype.

Previous studies have described similar methodsor reagents. Primers matching consensus 5X and 3X

UTRs were used to amplify all HLA class I cDNAsŽ .Ennis et al., 1990 . However, this primer combina-tion generated cross-locus hybrids. To reduce cross-locus hybrid formation, locus specific primers weredesigned that map to the 3X UTRs of the HLA genesŽ . XZemmour et al., 1992 . Few 3 UTRs are se-quenced, however, so the robustness of amplificationcannot be predicted. Similarly, locus-specificamplification of genomic DNA has been reportedwith primers that map to the first and third intronsŽ .Cereb et al., 1995 but relatively few HLA class Iintrons have been sequenced. A panel of 13 primershave also been used to amplify and sequence HLA

Ž .class I cDNAs Santamaria et al., 1993 . In contrast,the system described here uses just four primersfrom well-studied regions of the HLA class I genesand the PCR products are nearly full length.

Allelic forms of HLA class I molecules haveseveral applications. Transfected HLA class I geneshelp define the specificity of antibodies, cytotoxic T

Žcells, and NK cells Shimizu and DeMars, 1989;.Malnati et al., 1995; Cereb and Yang, 1996 . HLA

class I molecules have been loaded with peptide,multimerized, and used as probes for detecting HIV

Ž .specific T cells Altman et al., 1996 . Such HLAtetramers have become the ‘‘gold standard’’ for

Ž .quantifying specific CD8q T cells Doherty, 1998 .Soluble MHC class I molecules have also beenshown to reduce rejection of allogeneic transplanted

Ž .tissue in rats Geissler et al., 1997 . Therefore, bothresearch and clinical applications may benefit fromthe rapid cloning and expression of HLA class Imolecules.

In summary, the primers described here can beused to rapidly PCR amplify and clone HLA class Ialleles. These PCR products encode nearly full-lengthmolecules and can be easily modified. The proce-

dures are inexpensive and require only standard tech-nical skills, thereby allowing more investigators toutilize the tremendous polymorphism of this geneticsystem.

Acknowledgements

We thank Dr. Sherman Weissman for his criticalreading of the manuscript. We thank GwendolynDavis and Louise Benson for expert assistance incell culture. This work was supported by the NIHŽ .R29-AI35099 and R01-HL43364 .

References

Altman, J., Moss, P., Goulder, P., Barouch, D., McHeyzer-Wil-liams, M., Bell, J., McMichael, A., Davis, M., 1996. Pheno-typic analysis of antigen-specific T lymphocytes. Science 274,94.

Biedermann, B.C., Pober, J.S., 1998. Human endothelial cellsinduce and regulate cytolytic T cell differentiation. J. Im-munol. 161, 4679.

Bodmer, J.G., Marsh, S.G., Albert, E.D., Bodmer, W.F., Bontrop,R.E., Dupont, B., Erlich, H.A., Hansen, J.A., Mach, B., Mayr,W.R., Parham, P., Petersdorf, E.W., Sasazuki, T., Schreuder,G.M., Strominger, J.L., Svejgaard, A., Terasaki, P.I., 1999.Nomenclature for factors of the HLA system, 1998. HumanImmunol. 60, 361.

Cereb, N., Yang, S., 1996. Induction of microvariant-specific CTLlines reactive to a single amino acid mismatch in bulk culturesusing a transfectant expressing a single HLA class I molecule.J. Immunol. 156, 18.

Cereb, N., Maye, P., Lee, S., Kong, Y., Yang, S.Y., 1995.Locus-specific amplification of HLA class I genes from ge-nomic DNA: locus-specific sequences in the first and thirdintrons of HLA-A, -B, and -C alleles. Tissue Antigens 45, 1.

Chorney, M.J., Sawada, I., Gillespie, G.A., Srivastava, R., Pan, J.,Weissman, S.M., 1990. Transcription analysis, physical map-ping, and molecular characterization of a nonclassical humanleukocyte antigen class I gene. Mol. Cell Biol. 10, 243.

Doherty, P.C., 1998. The numbers game for virus-specific CD8qT cells. Science 280, 227.

Ennis, P.D., Zemmour, J., Salter, R.D., Parham, P., 1990. Rapidcloning of HLA-A,B cDNA by using the polymerase chainreaction: frequency and nature of errors produced in amplifica-tion. Proc. Natl. Acad. Sci. USA 87, 2833.

Geissler, E., Korzun, W., Graeb, C., 1997. Secreted donor-MHCclass I antigen prolongs liver allograft survival and inhibitsrecipient anti-donor cytotoxic T lymphocyte responses. Trans-plantation 64, 782.

Hill, A., Elvin, J., Willis, A., Aidoo, M., Allsopp, C., Gotch, F.,


Goa, X., Takiguchi, M., Greenwood, B., Townsend, A.,McMichael, A., Whittle, H., 1992. Molecular analysis of theassociation of HLA-B53 and resistance to severe malaria.Nature 360, 434.

Huang, M.-M., Arnheim, N., Goodman, M., 1992. Extension ofbase mispairs by Taq DNA polymerase: implications for sin-gle nucleotide discrimination in PCR. Nucleic Acids Res. 20,4567.

Jurewicz, A., Biddison, W.E., Antel, J.P., 1998. MHC classI-restricted lysis of human oligodendrocytes by myelin basicprotein peptide-specific CD8 T lymphocytes. J. Immunol. 160,3056.

Kaslow, R., Carrington, M., Apple, R., Park, L., Munoz, A., Saah,˜A., Goedert, J., Winkler, C., O’Brien, S., Rinaldo, C., Detels,R., Blattner, W., Phair, J., Erlich, H., Mann, D., 1996. Influ-ence of combinations of human major histocompatibility com-plex genes on the course of HIV-1 infection. Nat. Med. 2, 405.

Krangel, M., 1986. Secretion of HLA-A and -B antigens via analternative RNA splicing pathway. J. Exp. Med. 163, 1173.

Kuhner, M.K., Lawlor, D.A., Ennis, P.D., Parham, P., 1991. Geneconversion in the evolution of the human and chimpanzeeMHC class I loci. Tissue Antigens 38, 152.

Lawyer, F., Stoffel, S., Saiki, R., Chang, S., Landre, P., Abram-son, R., Gelfand, D., 1993. High-level expression, purification,and enzymatic characterization of full-length Thermus aquati-cus DNA polymerase and a truncated form deficient in 5X to 3X

exonuclease activity. PCR Methods Appl. 2, 275.Ma, W.-L., Lehner, P., Cresswell, P., Pober, J., Johnson, D.,

Ž .1997. Interferon-g rapidly increases peptide transporter TAPsubunit expression and peptide transport capacity in endothe-lial cells. J. Biol. Chem. 272, 16585.

Malnati, M.S., Peruzzi, M., Parker, K.C., Biddison, W.E., Cic-cone, E., Moretta, A., Long, E.O., 1995. Peptide specificity inthe recognition of MHC class I by natural killer cell clones.Science 267, 1016.

Nei, M., Gu, X., Sitnikova, T., 1997. Evolution by the birth-and-

death process in multigene families of the vertebrate immunesystem. Proc. Natl. Acad. Sci. USA 94, 7799.

Newton, C., Graham, A., Heptinstall, L., Powell, S., Summers, C.,Kalsheker, N., Smith, J., Markham, A., 1989. Analysis of anypoint mutation in DNA. The amplification refractory mutation

Ž .system ARMS . Nucleic Acids Res. 17, 2503.Robinson, J., Bodmer, J.G., Malik, A., Marsh, S.G.E., 1999.

IMGTrHLA Database, Version 1.1. http:rrwww.ebi.ac.ukrimgtrhlar, update April 9, 1999.

Santamaria, P., Lindstrom, A., Boyce-Jacino, M., Myster, S.,Barbosa, J., Faras, A., Rich, S., 1993. HLA class I sequence-based typing. Hum. Immunol. 37, 39.

Santamaria, P., Reinsmoen, N.L., Lindstrom, A.L., Boyce-Jacino,M.T., Barbosa, J.J., Faras, A.J., McGlave, P.B., Rich, S.S.,1994. Frequent HLA class I and DP sequence mismatches in

Ž .serologically HLA-A, HLA-B, HLA-DR and molecularlyŽ .HLA-DRB1, HLA-DQA1, HLA-DQB1 HLA-identical unre-lated bone marrow transplant pairs. Blood 83, 280.

Shimizu, Y., DeMars, R., 1989. Production of human cells ex-pressing individual transferred HLA-A,-B,-C genes using anHLA-A,-B,-C null human cell line. J. Immunol. 142, 3320.

Takemoto, S., Cecka, J.M., Gjertson, D., Terasaki, P., 1993.Six-antigen-matched transplants. Causes of failure. Transplan-tation 55, 1005.

Tussey, L., McMichael, A., 1995. General introduction to theŽ .MHC. In: Blair, G.E., Pringle, C.R., Maudsley, D.J. Eds. ,

Modulation of MHC antigen expression and disease. Cam-bridge Univ. Press, Cambridge, p. 1.

Wu, D.Y., Ugozzoli, L., Pal, B.K., Wallace, R.B., 1989. Allele-specific enzymatic amplification of beta-globin genomic DNAfor diagnosis of sickle cell anemia. Proc. Natl. Acad. Sci. USA86, 2757.

Zemmour, J., Little, A.-M., Schendel, D., Parham, P., 1992. TheHLA-A,B ‘‘negative’’ mutant cell line C1R expresses a novelHLA-B35 allele, which also has a point mutation in thetranslation initiation codon. J. Immunol. 148, 1941.

Documents

Rapid cloning of HLA class I cDNAs by locus specific PCR