Original Articles

Quantitative Analysis of Antibody to Hepatitis C VirusEnvelope 2 Glycoprotein in Patients With Chronic

Hepatitis C Virus Infection

NOBUKAZU YUKI, NORIO HAYASHI, AKINORI KASAHARA, HIDEKI HAGIWARA, EIJI MITA, KAZUYOSHI OHKAWA,KAZUHIRO KATAYAMA, HIDEYUKI FUSAMOTO, AND TAKENOBU KAMADA

The significance of circulating antibody to hepatitis C HCV E1 corresponds to the pestiviral gp33/gp25 enve-virus (HCV) envelope glycoprotein 2 (E2)/nonstructural lope glycoprotein and the flaviviral envelope proteinprotein 1 (NS1) glycoprotein was studied in 83 patients (M/E), whereas E2/NS1 corresponds to the pestiviralwith chronic HCV infection diagnosed by polymerase gp53/gp55 envelope glycoprotein and the flaviviralchain reaction (PCR). E2/NS1 antibody was quantita- NS1.1 Based on the greater homology between HCVtively examined by a passive hemagglutination test us-

and the pestiviruses1,4-6 and the absence of HCV E2/ing recombinant E2/NS1 glycoprotein encompassingNS1 secretion into the medium by transfected mamma-amino acids 388 to 664 of the HCV-H strain. The resultslian Chinese hamster ovary cells, it has been proposedwere correlated with clinical and virological features

such as genotypes and viremic levels assessed by a com- that E2/NS1 more likely represents a virion envelopepetitive reverse-transcription PCR assay. E2/NS1 anti- glycoprotein than the secreted NS1 of the flaviviruses.body was found in 73 patients (88%), and its occurrence Both the pestiviral gp53/gp55 and flaviviral NS1 glyco-was related to viremic levels. E2/NS1 antibody titers proteins are known to elicit protective antibodies inwere low in asymptomatic HCV carriers with low levels hosts.7,8 HCV envelope glycoproteins can be consideredof viral replication; 9 of 17 such patients tested positive

possible candidates for vaccination against HCV infec-for E2/NS1 antibody (53%), compared with 64 of 66tion.9 However, the implications of the E2/NS1 anti-chronic hepatitis C patients (97%) (Põ .01). A significant

direct relationship was observed between viremic levels body response in chronic HCV infection are not fullyand E2/NS1 antibody titers (r Å .52, P õ .01). Of the 13 understood.patients with low viremic levels ofõ106 copies/mL, only Previous reports showed that the E2/NS1 antibody5 tested positive for E2/NS1 antibody (38%), whereas 68 response can occur in patients with chronic HCV infec-of the 70 patients with viremic levels of ¢106 copies/mL tion.10-15 The prevalence, however, differs considerablyhad it (97%) (P õ .01). As for the relation to HCV geno-

among studies. This may be attributable to differencestypes, no difference was seen in E2/NS1 antibody titersin antigens and assay systems used. E2/NS1 antibodyamong genotypes examined (1b, 2a, and 2b). These find-

ings suggest that the E2/NS1 antibody tested exhibits no may not be detected with synthetic peptides or recombi-neutralizing activity in chronic HCV infection but may nant polypeptides expressed in yeast or Escherichiaserve as a serological indicator of active virus replica- coli that are nonglycosylated and differ from native E2/tion. (HEPATOLOGY 1996;23:947-952.) NS1 glycoprotein. Moreover, the antigens are dena-

tured in Western blot analysis.Hepatitis C virus (HCV) is distantly related to pesti-The coexistence of E2/NS1 antibody and viremia in-viruses and flaviviruses,1 and putative HCV envelope

glycoprotein 1 (E1) and envelope glycoprotein 2 (E2)/ dicates that this antibody is unlikely to have neutraliz-nonstructural protein 1 (NS1) have been identified.2,3 ing activity in chronic HCV infection. However, no

quantitative analysis has been performed to investi-gate the relation of the E2/NS1 antibody response toAbbreviations: HCV, hepatitis C virus; E1, envelope glycoprotein 1; E2,HCV replicative levels. Furthermore, it remains uncer-envelope glycoprotein 2; NS1, nonstructural protein 1; PCR, polymerase chain

reaction. tain whether E2/NS1 antibody response levels haveFrom the First Department of Medicine, Osaka University Medical School, any relevance to HCV genotypes. Sequence diversities

Suita 565, Japan. have been shown to be distributed along the wholeReceived July 12, 1995; December 12, 1995.HCV genome except for the conserved 5*-noncoding re-Supported by a Grant-in-Aid from the Ministry of Education, Science and

Culture, Japan. gion. In particular, E2/NS1 as well as E1 regions showAddress reprint requests to: Norio Hayashi, M.D., First Department of especially marked sequence diversity16 and may cause

Medicine, Osaka University Medical School, Yamadaoka 2-2 Suita 565, Japan. different antibody responses among genotypes. Thus,Copyright q 1996 by the American Association for the Study of Liver

the virological implications of E2/NS1 antibody inDiseases.0270-9139/96/2305-0001$3.00/0 chronic HCV infection remain to be worked out.

947

5p0d$$0023 04-19-96 18:49:51 hepa WBS: Hepatology

948 YUKI ET AL. HEPATOLOGY May 1996

of approximately 62 to 72 kd on sodiumdodecyl sulfate poly-In this study, we quantitatively investigated the oc-acrylamide gel electrophoresis. A similar heterogenous bandcurrence of antibody to properly glycosylated recombi-was confirmed to be E2/NS1 by radioimmunoprecipitationnant E2/NS1 protein in various stages of chronic HCVanalysis using rabbit and human antisera specific for E2/NS1infection. Then, we correlated the results with HCVand 35S-labeled Chinese hamster ovary lysates. Preliminaryreplicative levels assessed by the concentration of se- experiments demonstrated the E2/NS1 protein to be glycosyl-rum HCV RNA and HCV genotypes. ated, as evidenced by the reduction in size from a 62- to 72-kd heterogenous band to a distinct 32-kd protein band afterPATIENTS AND METHODStreatment with endoglycosidase H.

The E2/NS1 antibody assay is similar to a second-genera-Patients. The subjects were 83 Japanese patients who hadchronic HCV infection and were positive for serum HCV RNA tion HCV passive hemagglutination test for detecting anti-

bodies to structural and nonstructural HCV proteins (Abbottaccording to testing by polymerase chain reaction (PCR).They were 50 men and 33 women, ranging in age from 21 to Laboratories), except that the erythrocytes are coated with

purified E2/NS1 glycoprotein. Sera dissolved in a sample dil-79 years. All patients were negative for the hepatitis B sur-face antigen and showed no evidence of alcoholic, autoim- uent (1:32) were mixed with equal volume of an E2/NS1-

coated erythrocyte solution. The mixtures were incubated atmune, or drug-induced liver disease. Sixty-six patients wereconsecutive serum HCV RNA–positive chronic hepatitis C room temperature for 2 hours, and the results were consid-

ered positive if hemagglutination was observed. The E2/NS1patients with elevated serum alanine aminotransferase lev-els for more than 6 months. The remaining 17 patients were antibody specificity of positive sera was confirmed by a com-

petitive inhibition assay. Serum samples were preincubatedconsecutive asymptomatic blood donors positive for serumHCV RNA and had normal serum alanine aminotransferase with a specimen diluent containing HCV E2/NS1 glycopro-

tein followed by addition of E2/NS1-coated erythrocytes. Thelevels. Liver histology was available for 55 of the 66 chronichepatitis C patients, showing chronic persistent hepatitis in specificity was confirmed by inhibition of hemagglutination

compared with the sample not preincubated with HCV E2/22 (33%), chronic active hepatitis in 10 (15%), and cirrhosisin 23 (35%). The remaining 11 patients had cirrhosis and NS1 glycoprotein. For quantitative analysis of E2/NS1 anti-

body, positive sera were diluted twofold with the sample dilu-hepatocellular carcinoma (17%), which was diagnosed by im-aging procedures. Of these 83 patients, 19 chronic hepatitis C ent. Absolute E2/NS1 antibody titers were estimated by the

highest twofold dilution of the test serum showing positivepatients had received transfusions of blood products derivedfrom volunteer Japanese blood donors 5 to 34 years earlier. results. The titers were expressed as log2 (endpoint dilution)

with dilution in the basal assay set arbitrarily at the 21 level.Serum samples drawn from each patient were stored at0807C without thawing and tested for antibody to HCV E2/ The titers of samples that were negative for E2/NS1 antibody

in the basal assay were evaluated as 0. All assays for E2/NS1 glycoprotein, HCV-RNA levels, and HCV genotypes.Serological Testing. Hepatitis B surface antigen was de- NS1 antibody were performed in duplicate. We further vali-

dated the accuracy of antibody titers by repeating the assay.termined using a commercially available radioimmunoassay(Abbott Laboratories, North Chicago, IL). Serum antibody to Detection and Quantification of Serum HCV RNA. HCV

RNA was extracted from 100 mL of serum samples, copiedHCV E2/NS1 was tested with a passive hemagglutinationtest using recombinant E2/NS1 glycoprotein (Abbott Labora- into complementary DNA by reverse transcription, and am-

plified by PCR as described elsewhere.17 Primers were de-tories). The E2/NS1 antigen used spanned residues 388 to664 with residue 1 as the N-terminus of the putative full- rived from the 5*-noncoding region of the published se-

quence,18 which is highly conserved among HCV clones:length HCV polyprotein of the HCV-H strain (genotype 1a).16

Thus, this antigen did not contain the C-terminal region of antisense primer 5*ATGGTGCACGGTCTACGAGACCTCC3*and sense primer 5*CACTCCCCTGTGAGGAACTACTG-E2/NS1 protein. C-terminal truncation of E2/NS1 protein at

amino acid 664 allowed us to express and secrete this glyco- TC3*. The PCR mixtures were amplified in a DNA thermalcycler (Perkin-Elmer Cetus, Norwalk, CT) for 40 cycles (947Cprotein into the extracellular media of transfected Chinese

hamster ovary cells. The truncated E2/NS1 sequence was for 0.5 minutes; 557C for 1 minute; 727C for 1 minute), fol-lowed by a 10-minute final extension at 727C. A portion ofobtained using PCR amplification, and E2/NS1 complemen-

tary DNA was inserted into a plasmid vector downstream the PCR products was fractionated by agarose gel electropho-resis, transferred onto a nylon membrane, hybridized to aof both a rabbit heavy-chain signal sequence and a human

prourokinase N-terminal sequence to enhance signal prote- 32P-labeled HCV complementary DNA between the two prim-ers, and autoradiographed. Because of the extreme sensitiv-ase processing, efficient secretion, and final-product stability

in cell culture fluids. Expression of E2/NS1 and a mouse dihy- ity of PCR, great care was taken to prevent false-positivePCR results, and the contamination avoidance measures ofdrofolate reductase gene (for selection and amplification)

were under the control of a simian virus 40T antigen pro- Kwok and Higuchi19 were strictly applied throughout thisstudy. In each assay, we included nine test samples, twomoter. Chinese hamster ovary cells (dihydrofolate reductase–

negative) were transfected with the HCV E2/NS1 plasmid, negative control sera from healthy individuals without riskfactors for HCV infection, and one sample of distilled waterand stable cell lines were obtained after several rounds of

methotrexate selection. Expression of E2/NS1 was detected to prevent false-positive results. Furthermore, the assay wasrepeated at least twice for each sample, and the reproducibil-by immunofluorescent staining using polyclonal rabbit sera

from animals immunized with an E2/NS1 region synthetic ity of the results was confirmed. The sensitivity of HCV-RNAPCR was also investigated with synthetic mutant HCV RNApeptide (amino acids 509-551). Media containing secreted E2/

NS1 were collected and purified. Purification of E2/NS1 was described below. We could constantly detect 30 copies of HCVRNA per sample and 5 copies under optimal conditions.achieved by first concentrating the cell supernatants 50-fold,

followed by successive chromatography on S-Sepharose, To quantify serum HCV RNA in positive samples, a com-petitive reverse-transcription PCR assay was performed asDEAE-Sepharose, and wheat germ agglutinin–Sepharose

6MB. Purified antigen was dialyzed versus phosphate-buf- described elsewhere.17 Mutant HCV RNA was produced froman HCV complementary DNA (M642) to have a novel EcoRIfered saline. The purified E2/NS1 ran as a heterogenous band

5p0d$$0023 04-19-96 18:49:51 hepa WBS: Hepatology

HEPATOLOGY Vol. 23, No. 5, 1996 YUKI ET AL. 949

TABLE 1. E2/NS1 Antibody Response and Virological Features in Various Stages of Chronic HCV Infection

No. of HCV-RNA Titers (copies/mL serum) HCV GenotypeSubjects E2/NS1Positive Antibody log10

for E2/NS1 Titers (HCV RNA) DoubleSubjects Antibody (mean { SD) õ106 ¢106 (mean { SD) 1b 2a 2b Infection Unclassified

ASC (n Å 17) 9 (53%) 4.4 { 4.5 8 (47%) 9 (53%) 6.4 { 1.9 5 (29%) 3 (18%) 1 (6%) 0 8 (47%)CPH (n Å 22) 22 (100%)*† 9.8 { 2.1* 5 (23%) 17 (77%) 6.9 { 1.1 17 (77%)* 3 (14%) 1 (5%) 1 (5%) 0*CAH (n Å 10) 10 (100%)* 9.9 { 2.1* 0* 10 (100%) 8.2 { 0.3‡§\ 8 (80%)§ 1 (10%) 0 1 (10%) 0*Cirrhosis (n Å 23) 23 (100%)*† 9.0 { 2.6* 0*Ø 23 (100%) 7.6 { 0.7Ø 18 (78%)* 3 (13%) 1 (4%) 1 (4%) 0*Cirrhosis HCC (n 9 (82%) 0* 11 (100%) 7.6 { 0.9 9 (82%)* 2 (18%) 0 0 0*Å 11) 7.1 { 4.0

Total (n Å 83) 73 (88%) 8.1 { 3.7 13 (16%) 70 (84%) 7.2 { 1.3 57 (69%) 12 (14%) 3 (4%) 3 (4%) 8 (10%)

NOTE. The data on E2/NS1 antibody titers and log10 (HCV RNA) are mean { SD.Abbreviations: ASC, asymptomatic carrier; CPH, chronic persistent hepatitis; CAH, chronic active hepatitis; HCC, hepatocellular carcinoma.* P õ .01 vs. ASC.† P õ .05 vs. cirrhosis / HCC.‡ P õ .05 vs. cirrhosis.§ P õ .05 vs. ASC.\ P õ .01 vs. CPH.Ø P õ .05 vs. CPH.

site after amplification by PCR. Reverse-transcription PCR in the 17 asymptomatic HCV carriers (4.4 { 4.5) thanwas performed on serum samples in the presence of serial in the 66 chronic hepatitis C patients (9.1 { 2.8) (P100.5-fold amounts of mutant HCV RNA. Portions of the PCR õ .01).products were fractionated by agarose gel electrophoresis The concentration of serum HCV RNA varied fromafter digestion with EcoRI, transferred onto a nylon mem- 104 to 109 copies/mL in the study population. Eight ofbrane, hybridized to a 32P-labeled HCV complementary DNA,

the 17 asymptomatic HCV carriers had viremic levelsand autoradiographed. Serum HCV-RNA amounts were esti-of õ106 copies/mL (47%), compared with only 5 of themated from the equilibrium of the signal intensity of a 306-66 chronic hepatitis C patients (8%) (P õ .01). Serumbp undigested DNA fragment derived from serum HCV RNAHCV-RNA levels expressed as log10 (copy numbers ofand that of a 108-bp EcoRI-digested DNA fragment derived

from defined amounts of mutant HCV RNA. HCV RNA per mL serum) tended to be low in theTyping Hepatitis C Virus. HCV RNA–positive serum sam- asymptomatic HCV carrier group (6.4{ 1.9), compared

ples were further subjected to genotype analysis according to with the chronic hepatitis C group (7.4 { 1.0) (not sig-the method described previously.20 HCV was classified into nificant). In this study, 57 patients were infected withfour genotypes (1a, 1b, 2a, and 2b) based on variation in HCV of genotype 1b (69%). Genotypes 2a and 2b werenucleotide sequence within restricted regions in the putative

identified in 12 (14%) and 3 (4%) patients, respectively.HCV core gene. Briefly, a core region was amplified by PCRThree patients had double infection (4%) (1b / 2a in 2using a universal primer pair, and then selective amplifica-cases and 1b / 2b in 1). HCV genotype(s) could not betion of the first-stage PCR products was performed using aidentified in the remaining 8 cases (10%), who werenested pair of a genotype-specific antisense primer and a

universal sense primer. The genotype-specific primers were asymptomatic HCV carriers with low viremic levels ofchosen to amplify a different size sequence for each genotype. 104 to 105.5 copies/mL. Thus, the prevalence of patientsThe product of the second-stage PCR was electrophoresed in with unclassified genotype(s) was high in the asymp-agarose, and HCV genotypes were identified by the length of tomatic HCV carrier group (47%).the amplified sequence. Clinical and virological features of the study popula-Statistical Analysis. Statistical analysis for group compar-

tion were further analyzed in relation to the occurrenceisons was performed by the x2 method and the Wilcoxon non-of E2/NS1 antibody (Table 2). Patients with E2/NS1parametric test. A value of P õ .05 (two-tailed) was consid-antibody were older and had higher serum alanineered to indicate significance.transaminase levels than those without it (P õ .01).

RESULTS No significant differences were found in sex and inci-dence of previous blood transfusions between E2/NS1Of the 83 patients with chronic HCV infection, anti-antibody-positive and -negative groups. A significantbody to HCV E2/NS1 glycoprotein could be detected incorrelation was observed between the E2/NS1 antibody73 patients (88%). Table 1 shows the E2/NS1 antibodyresponse and HCV replicative states as assessed byresponse and virological characteristics in variousserum HCV-RNA levels. Sixty-eight of the 73 patientsstages of chronic HCV infection. E2/NS1 antibody waspositive for E2/NS1 antibody had serum HCV-RNA lev-detected frequently in 64 of the 66 chronic hepatitis Cels of ¢106 copies/mL (93%). In contrast, only 2 of thepatients (97%), and only 2 patients with cirrhosis and10 patients negative for E2/NS1 antibody had such lev-hepatocellular carcinoma tested negative for it. In con-els of serum HCV RNA (20%), and the remaining 8trast, E2/NS1 antibody was found in 9 (53%) of the 17were low viremic patients (80%) (P õ .01). Conversely,asymptomatic HCV carriers with normal serum ALT

levels (Põ .01). E2/NS1 antibody titers were also lower 8 of the 13 patients with low viremia of õ106 copies/

5p0d$$0023 04-19-96 18:49:51 hepa WBS: Hepatology

950 YUKI ET AL. HEPATOLOGY May 1996

TABLE 2. Clinical and Virological Data in Patients coding for a polyprotein that is divided into core andWith Chronic HCV Infection Relative to the Presence envelope proteins and nonstructural proteins.2 Al-

of E2/NS1 Antibody though HCV E2/NS1 glycoprotein is considered to be aE2/NS1 E2/NS1 second envelope component, its biological significance

Antibody Antibody in HCV propagation remains uncertain. HCV E2/NS1Positive Negative glycoprotein corresponds to the pestiviral gp53/gp55Characteristics (n Å 73) (N Å 10) P

envelope glycoprotein and the flaviviral NS1 glycopro-Age (yr) 52.3 { 12.2 40.8 { 15.3 õ.01 tein, both of which elicit antibodies with neutralizingSex (M/F) 45/28 5/5 NS activity.7,8 Our study suggests that the response ofHistory of blood transfusion 19 (26%) 0 NS HCV E2/NS1 antibody depends on serum HCV-RNAALT (U/L) 88.4 { 71.0 29.9 { 39.8 õ.01 levels and does not exhibit any neutralizing activity,HCV-RNA titers (copies/mL

thus indicating distinct virological implications of theserum)immune response to HCV E2/NS1 and those to pestivi-õ106 5 (7%) 8 (80%) õ.01 ral gp53/gp55 and flaviviral NS1.¢106 68 (93%) 2 (20%)

log10 (HCV RNA) 7.5 { 1.0 5.3 { 1.5 õ.01 E2/NS1 antibody has been shown to be induced inHCV genotype patients with chronic HCV infection, but the preva-

1b 55 (75%) 2 (20%) lence varies markedly among reports. In previous stud-2a 12 (16%) 0 ies, E2/NS1 antibody was detected using nonglycosyl-2b 3 (4%) 0 õ.01 ated E2/NS1 protein and sodium dodecylsulfate–Double infection 3 (4%) 0 denatured E2/NS1 protein in Western blots, and theUnclassified 0 8 (80%) prevalence was estimated to be very low at 10 to 17%NOTE. Quantitative data expressed as mean { SD. in chronic HCV infection.10-12 In our study, we investi-Abbreviations: NSÅ not significant (Pú .05); ALT, alanine trans- gated the antibody response to glycosylated and unde-

aminase. natured E2/NS1 protein and found that E2/NS1 anti-body coexists with viremia in 88% of chronic HCV

mL in this study tested negative for E2/NS1 antibody carriers. This is compatible with a few recent studies(62%), compared with 2 of the 70 patients with high using native E2/NS1 glycoprotein.13-15

viremia of¢106 copies/mL (3%). Serum HCV-RNA lev- In previous studies, the E2/NS1 antibody responseels expressed as log10 (copy numbers of HCV RNA per was not quantitatively evaluated in relation to HCVmL serum) were significantly higher in E2/NS1 anti- replicative levels. The data obtained revealed that E2/body-positive patients (7.5 { 1.0) than in negative pa- NS1 antibody was induced in association with high lev-tients (5.3 { 1.5) (P õ .01). With respect to HCV geno- els of HCV replication. The prevalence of E2/NS1 anti-types in each group, patients with unclassifiedgenotype(s) were prevalent in the low viremic E2/NS1antibody-negative group. HCV genotype(s) could not beidentified in 8 of the 10 patients in the E2/NS1 anti-body-negative group (80%), compared with 0 of the 73in the E2/NS1 antibody-positive group (P õ .01).

Thus, the occurrence of the E2/NS1 antibody re-sponse was related to HCV replicative states as as-sessed by viremic levels. We further performed quanti-tative analysis on the relation of the E2/NS1 antibodyresponse to HCV replicative states. A significant, directcorrelation was found between E2/NS1 antibody titersand serum HCV-RNA levels (r Å .52, P õ .01) (Fig. 1).Patients with high titers of E2/NS1 antibody tendedto show high levels of HCV replication. When E2/NS1antibody titers were correlated with HCV genotypes,E2/NS1 antibody titers were 9.2 { 2.9 for the 57 pa-tients with genotype 1b, 8.0 { 2.3 for the 12 patientswith genotype 2a, and 9.0 { 1.0 for the 3 with genotype2b, with no significant differences among these values.Thus, no relation was evident between the E2/NS1 an-tibody response and HCV genotypes. Moreover, no sig-nificant differences were observed in serum HCV-RNAlevels among patients with genotype 1b (7.5 { 0.9),genotype 2a (7.5 { 1.0), and genotype 2b (6.8 { 1.6). FIG. 1. Relationship between E2/NS1 antibody titers and serum

HCV-RNA titers in patients with chronic HCV infection (r Å .52; PDISCUSSIONõ .01). j Å patients with genotype 1b; h Å patients with genotype

Since the recent cloning of the HCV genome, HCV 2a; s Å patients with genotype 2b; m Å patients with double infec-tion; n Å patients with unknown genotype(s).was shown to have a single, long open reading frame

5p0d$$0023 04-19-96 18:49:51 hepa WBS: Hepatology

HEPATOLOGY Vol. 23, No. 5, 1996 YUKI ET AL. 951

body in chronic HCV infection was much lower in low the case for the nonstructural protein 4 (5-1-1) anti-body. Moreover, the exclusion of extremely low viremicviremic (õ106 copies/mL) patients showing low disease

activity (38%) than in those with viremic levels of¢106 cases may avoid poor antibody responses due to a lowviral load, which enables us to study the E2/NS1 anti-copies/mL (97%). A positive correlation was further

seen between viremic levels and E2/NS1 antibody ti- genicity relative to HCV genotypes more clearly.Thus, the E2/NS1 antibody that we detected in seraters. These findings shed further light on the virological

implications of E2/NS1 antibody in chronic HCV carri- from chronic HCV carriers seems to recognize conser-vative epitope(s) on E2/NS1 glycoprotein, although fur-ers, which differ from those of neutralizing antibody.

HCV replicative states assessed by serum HCV-RNA ther studies are necessary to conclude that the E2/NS1antibody response is similar among various HCV geno-levels have been shown to have various clinical implica-

tions. Measuring serum HCV-RNA levels enables pre- types. This antibody did not exhibit even partial neu-tralizing activity in the quantitative analysis. In thisdiction of a sustained response to interferon in chronic

HCV infection.17,21 HCV viremic levels also show a rela- study, however, we studied the E2/NS1 antibody re-sponse to one particular glycoprotein. We must stresstion to transmission of the disease. One report sug-

gested that the risk of HCV transmission from mothers the possibility that, with other antigens, a differentresult may be obtained. Our data do not eliminate theto infants is correlated with serum HCV-RNA levels in

the mother.22 In hepatitis B virus infection, serological possibility that neutralizing E2/NS1 antibody is pro-duced in chronic HCV infection. Indeed, strain-specificmarkers such as hepatitis B e antigen and antibody to

hepatitis B e antigen are widely used to predict hepati- neutralizing E2/NS1 antibody seems to be induced to-ward possible neutralizing epitopes within the E2/NS1tis B virus replicative states. However, no such marker

is currently available for HCV infection. The present hypervariable regions,25,26 although the evolution of es-cape mutants masks the presence of such neutralizingstudy suggests that the E2/NS1 antibody response may

serve as a serological marker of active HCV replication antibody and makes the vaccination strategy very diffi-cult.in chronic HCV carriers.

In the HCV polyprotein, the E2/NS1 region shows Finally, the present study showed the virological im-plications of E2/NS1 antibody in chronic HCV carriers.marked sequence diversity.16 There are also hypervari-

able regions at the N-terminus of the E2/NS1 re- The antibody response to the HCV E2/NS1 glycoproteinused does not have any neutralizing activity in chronicgion,23,24 which show especially marked sequence diver-

sity and are thought to bear possible strain-specific HCV infection but is correlated with HCV replicationirrespective of genotype. Testing for E2/NS1 antibodyneutralizing epitope(s).25,26 In the present study, the

response of E2/NS1 antibody was further correlated may be useful for assessing HCV replicative states andthus may have clinical implications. A few studies havewith HCV genotypes. Antibody to E2/NS1 glycoprotein

derived from the HCV-H strain of genotype 1a was suggested that E2/NS1 antibody may be useful as asensitive serological marker of HCV infection, and in-frequently found in patients with genotypes 1b, 2a, and

2b, and antibody titers as well as HCV. Viremic levels corporation of E2/NS1 antibody may improve the sensi-tivity of currently available HCV antibody assays usingwere also found to be similar among genotypes. In this

study, there were low viremic cases that could not be structural (core) and nonstructural HCV proteins.13-15

However, our data indicate that while highly viremicgenotyped. An explanation for such cases is infectionwith a unique viral genotype. However, HCV carriers carriers can be efficiently screened by the detection

of E2/NS1 antibody, a considerable proportion of lowin Japan are infected almost exclusively with genotype1b, 2a, or 2b, and patients with other rare genotypes viremic carriers may not show the E2/NS1 antibody

response.often have a history of transfusion of imported bloodproducts or are emigrants from other countries. Our

Acknowledgment: We are indebted to Tohru Ya-study population does not include such cases. Takenmada, Kazushige Iinuma, Takahiko Tsuchida, Nobu-together, infection with a unique viral genotype is un-naga Hirose, Akio Myoga, and Robert C. Doss fromlikely in a small number of our patients, and failure inDainabot Co., Ltd., for their technical assistance.HCV genotyping is more likely to be attributable to a

low viral load. Although PCR genotyping within theREFERENCEScore region or the nonstructural protein 5 region is

routinely used in Japan and is shown to be equally 1. Choo Q-L, Richman KH, Han JH, Berger K, Lee C, Dong C,Gallegos C, et al. Genetic organization and diversity of the hepa-efficient, both methods are not efficient enough in lowtitis C virus. Proc Natl Acad Sci U S A 1991;88:2451-2455.viremic cases. Under these circumstances, the relation

2. Houghton M, Weiner A, Han J, Kuo G, Choo Q-L. Molecularbetween the E2/NS1 antibody response and HCV geno-biology of the hepatitis C viruses: implications for diagnosis,types 1b, 2a, and 2b was studied in relatively highly development and control of viral disease. HEPATOLOGY 1991;14:

viremic cases that could be genotyped. We consider that 381-388.3. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Shimotohno K.our data support the absence of genotype dependence

Gene mapping of the putative structural region of the hepatitis Cof the E2/NS1 antibody response. If the antigenicity ofvirus genome by in vitro processing analysis. Proc Natl Acad SciE2/NS1 glycoprotein differed among genotypes exam- U S A 1991;88:5547-5551.

ined, differences in the E2/NS1 antibody response 4. Miller RH, Purcell RH. Hepatitis C virus shares amino acid se-quence similarity with pestiviruses and flaviviruses as well aswould be observed even in highly viremic cases, as is

5p0d$$0023 04-19-96 18:49:51 hepa WBS: Hepatology

952 YUKI ET AL. HEPATOLOGY May 1996

members of two plant virus supergroups. Proc Natl Acad Sci T, Saito I. Establishment of a cell line constitutively expressingE2 glycoprotein of hepatitis C virus and humoral response ofU S A 1990;87:2057-2061.

5. Takeuchi K, Kubo Y, Boonmar S, Watanabe Y, Katayama T, hepatitis C patients to the expressed protein. J Gen Virol 1995;76:1223-1231.Choo Q-L, Kuo G, et al. The putative nucleocapsid and envelope

protein genes of hepatitis C virus determined by comparison of 16. Inchauspe G, Zebedee S, Lee D-H, Sugitani M, Nasoff M, PrinceAM. Genomic structure of the human prototype strain H of hepa-the nucleotide sequences of two isolates derived from an experi-

mentally infected chimpanzee and healthy human carriers. J titis C virus: comparison with American and Japanese isolates.Proc Natl Acad Sci U S A 1991;88:10292-10296.Gen Virol 1990;71:3027-3033.

6. Han JH, Shyamala V, Richman KH, Brauer MJ, Irvine B, Urdea 17. Hagiwara H, Hayashi N, Mita E, Takehara T, Kasahara A, Fusa-moto H, Kamada T. Quantitative analysis of hepatitis C virusMS, Tekamp-Olson P, et al. Characterization of the terminal

regions of hepatitis C viral RNA: identification of conserved se- RNA in serum during interferon alfa therapy. Gastroenterology1993;104:877-883.quences in the 5* untranslated region and poly(A) tails at the 3*

end. Proc Natl Acad Sci U S A 1991;88:1711-1715. 18. Takamizawa A, Mori C, Fuke I, Manabe S, Murakami S, FujitaJ, Onishi E, et al. Structure and organization of the hepatitis C7. Schlesinger JJ, Brandriss MW, Cropp CB, Monath TP. Protec-

tion against yellow fever in monkeys by immunization with yel- virus genome isolated from human carriers. J Virol 1991;65:1105-1113.low fever virus nonstructural protein NS1. J Virol 1986;60:1153-

1155. 19. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature1989;339:237-238.8. Rumenapf T, Stark R, Meyers G, Thiel H-J. Structural proteins

of hog cholera virus expressed by vaccinia virus: further charac- 20. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, SugaiY, Tanaka T, et al. Typing hepatitis C virus by polymerase chainterization and induction of protective immunity. J Virol 1991;

65:589-597. reaction with type-specific primers: application to clinical sur-veys and tracing infectious sources. J Gen Virol 1992;73:673-9. Choo Q-L, Kuo G, Ralston R, Weiner A, Chien D, Van Nest G,

Han J, et al. Vaccination of chimpanzees against infection by 679.21. Lau JYN, Davis GL, Kniffen J, Qian K-P, Urdea MS, Chan CS,the hepatitis C virus. Proc Natl Acad Sci U S A 1994;91:1294-

1298. Mizokami M, et al. Significance of serum hepatitis C virus RNAlevels in chronic hepatitis C. Lancet 1993;341:1501-1504.10. Inoue Y, Suzuki R, Matsuura Y, Harada S, Chiba J, Watanabe

Y, Saito I, et al. Expression of the amino-terminal half of the 22. Ohto H, Terazawa S, Sasaki N, Sasaki N, Hino K, Ishiwata C,Kako M, et al. Transmission of hepatitis C virus from mothersNS1 region of the hepatitis C virus genome and detection of an

antibody to the expressed protein in patients with liver diseases. to infants. N Engl J Med 1994;330:744-750.23. Weiner AJ, Braver MJ, Rosenblatt J, Richman KH, Tung J,J Gen Virol 1992;73:2151-2154.

11. Mita E, Hayashi N, Ueda K, Kasahara A, Fusamoto H, Takami- Crawford K, Bonino F, et al. Variable and hypervariable domainsare found in the regions of HCV corresponding to the flaviviruszawa A, Matsubara K, et al. Expression of MBP-HCV NS1/E2

fusion protein in E. coli and detection of anti-NS1/E2 antibody envelope and NS1 proteins and the pestivirus envelope glycopro-teins. Virology 1991;180:842-848.in type C chronic liver disease. Biochem Biophys Res Commun

1992;183:925-930. 24. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Ohkoshi S,Shimotohno K. Hypervariable regions in the putative glycopro-12. Hsu HH, Donets M, Greenberg HB, Feinstone SM. Characteriza-

tion of hepatitis C virus structural proteins with a recombinant tein of hepatitis C virus. Biochem Biophys Res Commun 1991;175:220-228.baculovirus expression system. HEPATOLOGY 1993;17:763-771.

13. Zaaijer HL, Vallari DS, Cunningham M, Lesniewski R, Reesink 25. Weiner AJ, Geysen HM, Christopherson C, Hall JE, Mason TJ,Saracco G, Bonino F, et al. Evidence for immune selection ofHW, van der Poel CL, Lelie PN. E2 and NS5: new antigens for

detection of hepatitis C virus antibodies. J Med Virol 1994;44: hepatitis C virus (HCV) putative envelope glycoprotein variants:potential role in chronic HCV infections. Proc Natl Acad Sci395-397.

14. Lesniewski R, Okasinski G, Carrick R, Van Sant C, Desai S, U S A 1992;89:3468-3472.26. Kato N, Sekiya H, Ootsuyama Y, Nakazawa T, Hijikata M, Oh-Johnson R, Scheffel J, et al. Antibody to hepatitis C virus second

envelope (HCV-E2) glycoprotein: a new marker of HCV infection koshi S, Shimotohno K. Humoral immune response to hypervari-able region 1 of the putative envelope glycoprotein (gp70) of hep-closely associated with viremia. J Med Virol 1995;45:415-422.

15. Harada S, Suzuki R, Ando A, Watanabe Y, Yagi S, Miyamura atitis C virus. J Virol 1993;67:3923-3930.

5p0d$$0023 04-19-96 18:49:51 hepa WBS: Hepatology