Available online at www.sciencedirect.com

Theriogenology 75 (2011) 1005–1015

0d

Purification, sequence characterization and effect of goatoviduct-specific glycoprotein on in vitro embryo development

M.A. Pradeep, J. Jagadeesh, A.K. De, J.K. Kaushik, D. Malakar, S. Kumar,A.K. Dang, S.K. Das, A.K. Mohanty*

Animal Biotechnology Centre, National Dairy Research Institute, Karnal, India

Received 25 August 2010; received in revised form 4 November 2010; accepted 5 November 2010

Abstract

Oviduct-specific glycoprotein (oviductin) plays an important role during fertilization and early embryonic development. Theoviductin cDNA was successfully cloned and sequenced in goat, which possessed an open reading frame of 1620 nucleotidesrepresenting 539 amino acids. Predicted amino acid sequence showed very high identity with sheep (97%) followed by cow (94%),porcine (77%), hamster (69%), human (66%), rabbit (65%), mouse (64%) and baboon (62%). The bioinformatics analysis of thesequences revealed the presence of a signal sequence of 21 amino acids, one potential N-linked glycosylation site at position 402,21 potential O-linked glycosylation sites and 36 potential phosphorylation sites. The native oviductin was purified from theoviductal tissue, which showed three distinct bands on SDS-PAGE and western blot (MW �60–95 kDa). The predicted molecularweight of goat oviductin was 57.5 kDa, calculated from the amino acid sequences. The observed higher molecular weight has beenattributed to the presence of large number of potential O-linked glycosylation sites. The lower concentration (10 �g/mL) ofoviductin increased the cleavage rate, morula and blastocyst yield significantly (P � 0.05) as compared to higher concentration(100 �g/mL). Goat oviductin retarded the activity of pronase (0.1%) on zona solubility of oocytes significantly (P � 0.01).© 2011 Elsevier Inc. All rights reserved.

Keywords: Oviduct; Oestrogen-dependent glycoprotein; In vitro fertilization; Chitinase-like protein

www.theriojournal.com

bosdpotdpb

1. Introduction

The oviduct is an active secretory organ and pro-vides suitable milieu for the oocyte maturation, spermcapacitation, fertilization, early embryonic develop-ment and transportation [1]. The oviductal fluid con-stitutes a complex mixture of constituents, especiallyglycoproteins, derived from non-ciliated secretory epi-thelial cells of oviduct. Among them, Oviduct-specificglycoprotein (oviductin) represents a high molecular

* Corresponding author. Tel.: 91-184-2259538; fax: 91-184-2250042.

eE-mail address: akm@ndri.res.in (A.K. Mohanty).

093-691X/$ – see front matter © 2011 Elsevier Inc. All rights reserved.oi:10.1016/j.theriogenology.2010.11.007

weight glycoprotein. Oviduct-specific glycoprotein hasbeen identified in a variety of species including rabbits[2], sheep [3], hamsters [4], baboons [5], humans [6],ovine [7] and pigs [8]. Oviductin purified from theviduct have positive effects on sperm capacitation,perm-ovum binding, ovum penetration and embryoevelopment [9]. This glycoprotein is specifically ex-ressed within the oviduct during postovulatory phasef the estrous/menstrual cycle, and synthesis of oviduc-in is under the control of ovarian steroids [10]. Ovi-uctin associates with the zona pellucida (ZP) and isresent in the perivitelline space of oocytes and em-ryos during fertilization [11]. It has been reported to

nhance the in vitro fertilization rate in human when

efsrCrbtmTmv[

Rtgp

TGgsseRcosvl

1006 M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

supplemented as a media component [12]. In hamster,oviductin has been shown to enhance sperm bindingand sperm penetration rate [13]. Pre-treatment of gam-tes with oviductin has been reported to increase theertilization rate in bovine [14]. In a recent study, theecretions of equine oviductal epithelial cells have beeneported to increase in vitro fertilization rates [15]. The-terminal domain of the oviductin plays important

ole to overcome the early embryonic developmentlock at 2-cell stage [16]. The structure and organiza-ion of the oviductin gene have been described in hu-ans [17], mouse [18], hamster [19] and rabbit [20].he cDNA sequences of oviductin have been deter-ined in different species including baboons [21], bo-

ine [22], hamsters [23], humans [24], mice [25], pigs26], rhesus monkeys [27] and sheep [28].

Goat is an economically important livestock animal.esearch in goat reproduction has created renewed in-

erest due to its importance as a model animal in trans-enesis and stem cell research. So, it is essential toroduce large number of good quality in vitro fertilized

embryos. No scientific study has been reported on goatoviductin (gOVN). Its possible use as a media supplementin in vitro embryo production has not yet been explored.In the present study we report: 1. Isolation, purification,immunological characterization and cDNA sequenceanalysis of gOVN; and 2. Biological effect of gOVN onin vitro embryo development and zona solubility.

2. Materials and methods

2.1. Chemicals

The molecular biology grade chemicals and reagentswere used from Sigma Chemicals Co. (St. Louis, MO,USA) unless otherwise mentioned. All oligonucleotideprimers were used from Integrated DNA TechnologyIDT, USA. Thermoscript RT-PCR system and Plati-num Taq DNA polymerase were used from Invitrogen,USA. The PCR purification kit was used from Pro-mega, USA and pDrive cloning vector was used fromQiagen, USA. Nucleotide sequencing was performed atBangalore Genei, India. Pre-packed Wheat germ lec-tin-CL agarose columns were used from BangaloreGenei, India.

2.2. Collection of oviductal tissue

The goat oviductal tissues were collected from theslaughtered animals preferably in the late follicularstage when prominent follicles were present in the

ovary. For RNA isolation, fresh oviductal tissue was

collected and washed with DEPC treated water (0.1%)and stored in liquid nitrogen till further use. For thepurification of native oviductin, the oviductal tissueswere stored in Tris-buffered saline (TBS: 20 mmolTris-HCl, 0.5 M NaCl, pH 7.4) till further use.

2.3. cDNA cloning and sequencing

Total RNA was extracted from the ampullary re-gion of goat oviduct tissue using TRI reagent (Invit-rogen, USA). The oviductin gene sequences fromGenBank of Mouse (Acc. No. Q62010), Porcine(Acc. No. Q28990), bovine (Acc. No. Q28042), goldenhamster (Acc. No. Q60557), human (Acc. No. Q12889),sheep (Acc. No. Q28542) and olive baboon (Acc. No.P36718) were retrieved from NCBI nucleotide data baseand Swiss Protein Data Bank and were aligned usingClustal W (1.82) Multiple Alignment Program. Two setsof primers (OVN1F: 5= TGTCAGACCACA-GAGATGGGG 3=, OVN1R: 5= CTATGACCTGGGGC-CTGTTTG 3= and OVN2F: 5= GAAACACCATGATG-GTGCTG 3=, OVN2R: 5=

CAAAGTCTCCTCTCCAGG-TC 3=) were designed by analyzing the conserved re-ions of the aligned sequences of bovine and sheep for theynthesis of full length cDNA. To facilitate nucleic acidequencing of oviductin gene, one pair nucleotide prim-rs (Forward: 5= AAGGCTGCTGCTGTCTGCTG andeverse: 5= ATCCAGGTCCAATGTCCACAG 3=)onstituting the internal sequences of amplified goatviductin gene were designed. First strand cDNA wasynthesized using Thermoscript RT-PCR system (In-itrogen) following manufacturer’s protocol. Fullength goat oviductin cDNA was amplified using 3 �L

of first strand cDNA with PCR conditions: denaturationat 95 °C for 5 min; followed by 35 cycles of PCRreactions with denaturation at 95 °C for 30 s, annealingat 56 °C (60 °C for OVN2F/OVN2R primers) for 1 minand extension at 72 °C for 2.5 min; final extension at 72°C for 10 min. The purified PCR product was clonedinto pDrive vector following manufacturer’s protocol(Qiagen) and transformed into Top 10 cells (Invitro-gen). Plasmids isolated from the positive clones werecustom sequenced using SP6 and T7 sequencing prim-ers. The DNA and polypeptide precursor sequenceanalysis such as multiple alignment, pairwise align-ment, and phylogenetic tree of gOVN were done usingCLC Bio software, Denmark. Insilico identification ofglycosylation sites was done using NetNGlyc andNetOGly program using Swiss-prot site (www.expasy.ch). Probable phosphorylation sites were iden-

tified by using NetPhos 2.0 server (www.expasy.ch).

wcu

1

2f

fcmo

1007M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

2.4. Purification of native oviductin from goatoviductal tissue

Native goat oviductin (gOVN) was purified byfollowing the protocol of Sendai et al [22] withminor modification. Briefly, goat oviduct tissue ob-tained from slaughter house was thoroughly mincedusing a surgical scissor and then suspended in TBS(pH 7.4) containing 1mM PMSF followed by severalcycles of freeze/thaw. The oviductal extract was cen-trifuged at 1500 � g for 30min at 4 °C. The resultingsupernatant was recentrifuged at 20,000 � g for 1hr.The supernatant was used for the purification of goatoviductin. The supernatant of the oviduct extract wasloaded onto a 8mm � 45 mm Wheat Germ Lectin-CLAgarose equilibrated with TBS, pH 7.4 containing1mM PMSF and the column was washed with thesame buffer. Fractions containing the goat oviductinwere eluted with 100 mM N-acetyl-D-glucosaminein TBS. The eluted fraction was dialyzed overnightat 4 °C against buffer A (50 mM Tris-HCl, 100 mMNaCl, pH 7.4). After dialysis, the sample was con-centrated by ultra filtration using Centricon (Milli-pore, USA) centrifugal filter using 30 kDa cut offmembrane. The concentrated protein was loadedonto a Mono-Q anion exchange column pre equili-brated in buffer A and was eluted with a lineargradient of 100 to 500 mM NaCl in 50 mM Tris-HCl, (pH 7.4) at a flow rate of 0.5 mL/min. Thefractions representing distinct peaks were collecteddialyzed against 50 mM Tris-HCl, pH 7.4 and con-centrated by ultra filtration using a 30 kDa cut offmembrane.

2.5. SDS-PAGE and western blotting

The SDS-PAGE was done by using 12% poly-acrylamide gels. The protein separated on the poly-acrylamide gel was stained with coomassie blueR250. Unstained protein from the SDS-PAGE gelwas transferred to Immobilon PVDF membrane(Millipore, USA). The membrane containing trans-ferred proteins was blocked in 5% skim milk inTBST buffer. The membrane was incubated over-night at 4 °C with monoclonal antibody for bovineoviductin mAb 1H10 (1:3000), which was raised inrat. The membrane was washed thrice for 10 mineach time with TBS and incubated with goat anti-ratIgG conjugated with horseradish peroxidase (1:1500). The immune complex was then developed byusing DAB system following the manufacturer’s in-

structions (Banglore Genei, India).

2.6. Biological characterization of gOVN

2.6.1. Collection of goat oocytesGoat ovaries were collected from the local slaughter

house were transported to the lab in a thermo flaskcontaining normal saline (30–35 °C) fortified with pen-icillin (400 IU/mL) and streptomycin (50 �g/mL). Af-ter thorough washing with prewarmed normal saline thesurface follicles (3–5 mm diameter) were aspirated witha sterile 18 gauge needle in oocyte collection mediumconsisting of TCM-199 containing 0.3% bovine serumalbumin (BSA). The oocytes were washed 4–6 times withthe washing medium (TCM-199 � 10% fetal bovineserum (FBS) � 0.8 mM sodium pyruvate � 50 �g/mLgentamycin). Cumulus oocyte complexes (COCs) hav-ing more than 3 layers of cumulus cells with homoge-neous ooplasm were taken for in vitro maturation(IVM).

2.6.2. In vitro maturation of goat oocytesThe collected COCs were washed 3–4 times in wash-

ing medium followed by 2 times in maturation medium(HEPES modified TCM 199 � FSH � LH � Estradiol-17� � BSA and EGS) [29]. After washing 10–12 COCs

ere placed in 100 �L droplet of maturation medium,overed with mineral oil and incubated for 27 h at 38.5 °Cnder 5% CO2 in air with maximum humidity.

2.6.3. Semen collection and sperm processingFresh semen was collected from a fertile healthy

buck into a sterilized 15 mL plastic centrifuge tube(Tarsons, India) using an artificial vagina. Neat semen(50 �L) was placed in 2 mL sperm-TALP medium [30]in two tubes and allowed the spermatozoa to swim-upduring incubation for 15 min at 38.5 °C under 5% CO2.Thereafter 1.5 mL aliquot from the top layer was taken,mixed with 12 mL of sperm-TALP medium in a 15 mLtube and centrifuged at 296 g for 7 min. Supernatantwas discarded and sperm pellet was washed as de-scribed above. Finally, the sperm pellet was resus-pended in 2 mL of fert-TALP medium containingsperm-TALP supplemented with 50 �g/mL heparin[31] and incubated at 38.5 °C under 5% CO2 in air for.5 h for capacitation.

.6.4. Preparation of oocytes and in vitroertilization

After 27 h of incubation oocytes were taken outrom maturation medium and removed all expandedumulus cells by repeated gentle pipetting in fert-TALPedium using sterilized Pasteur pipette. Denuded

ocytes were washed 3–4 times and placed in 50 �L

droplet of fert-TALP (10–12 oocytes/droplet), covered

1008 M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

v

wc

s

a

(ouwp

2

cD

wcoww

3

3a

ccuwpgpcwasc[G

ssc

1009M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

with mineral oil and incubated at 38.5 °C under 5%CO2 in air for the equilibration of medium prior to initro fertilization. Capacitated sperm suspension of 50

�L (2 � 106 to 4 � 106 spermatozoa/mL) was added toeach 50 �L drop of fert-TALP medium containingdenuded oocytes and co-incubated for 6 h at 38.5 °C,5% CO2 in air with maximum humidity. At the end of6 h co-incubation oocytes were taken out from mediumdrop and washed thrice to remove attached spermato-zoa and placed in fert-TALP (pre-equilibrated) droplet(100 �L) and incubated in the CO2 (5%) incubator at38.5 °C for 10 h.

2.6.5. In vitro culture of embryosAt the end of 10 h of incubation putative zygotes were

taken out from fertilization drop and washed 5–6 timescarefully in the embryo development medium (EDM:TCM 199 � sodium pyruvate 0.03 mg/mL � glutamine0.1 mg/mL � gentamycin sulphate 50 �g/mL � essentialamino acids 10 �g/mL � non-essential amino acids 5�g/mL � BSA (Fraction-V) 10 mg/mL � FCS 10%) and

ere put in 100 �L drop of EDM in a 35 mm petri dish,overed with mineral oil and were kept in CO2 (5%)

incubator at 38.5 °C. The medium was replaced afterevery 48 h.

2.6.6. Experimental design

2.6.6.1. Effect of oviductin on IVF embryo production InExperiment 1, which was directed towards examiningthe effect of goat oviductin on in vitro embryo produc-tion, the in vitro maturation (IVM), in vitro fertilization(IVF) and in vitro culture of embryos (IVC) mediumwas supplemented with three different concentration ofgOVN, 1) 10 �g/mL, 2) 50 �g/mL, 3) 100 �g/mL. Thecontrol group was not supplemented with gOVN. 35oocytes were taken for each treatment and the experi-ments were repeated three times for statisticalsignificance.

2.6.6.2. Effect of oviductin on zona pellucida solubility InExperiment 2, which was aimed at examining the effectof oviductin on zona-pellucida solubility, the IVF me-dium was supplemented with 10, 50 and 100 �g/mL ofgOVN. The control group was not supplemented withgOVN. In vitro matured cumulus-free oocytes werewashed three times in 100 �L drops of IVF mediumupplemented with different concentration of gOVN

Fig. 1. Multiple sequence alignment of deduced amino acid sequence oin UniProtKB from various species with Acc. No: Sheep (Q28542),

Rabbit (Q95LB3) and Mouse (Q62010).

nd incubated in 5% CO2 in air at 38.5 °C for 4 h. 10oocytes were taken for each treatment and the experi-ments were repeated six times for statistical signifi-cance. Oocytes were then placed into 100 �L of a 0.1%w/v) pronase solution in PBS. Zona digestion wasbserved continuously at room temperature (25 °C)sing an inverted microscope. When the zona pellucidaas no longer visible for 90% of oocytes, the zonaellucida dissolution time was recorded.

.7. Statistical analysis

Data was analyzed by using one-way ANOVA pro-edure of SPSS 16.0 (SPSS Inc., Chicago, IL, USA).ata were expressed as means � SEM. Differences

between means were evaluated by Student-Newman-Kuels t-test for experiment 1. A probability of P � 0.05

as considered to be statistically significant. Signifi-ance of difference between concentrations (0, 10, 50,r 100 �g/mL) was tested by Duncan’s test using one-ay ANOVA procedure for Experiment 2. Significanceas tested at 1% level, P � 0.01.

. Results

.1. cDNA synthesis and nucleotide sequencenalysis of gOVN

Reverse Transcriptase PCR (RT-PCR) of gOVNDNA resulted in amplification of an expected 1.9 kbDNA. The nucleotide sequence of cloned PCR prod-ct revealed an open reading frame of 1620 bp startingith an ATG at position 1 and ending with a TGA atosition 1620. The deduced amino acid sequence ofOVN cDNA encoded 539 amino acids with signaleptide of 21 amino acids at the N-terminal end. Thealculated molecular mass of gOVN was 57,489 Daith the predicted isoelectric point being 9.6. The

mino acid sequence from residues 22–360 revealedignificant homology with chitinase-like proteins andhitinases belonging to family 18 glycosylhydrolase32]. gOVN cDNA sequence has been deposited in theenBank with accession no. DQ482670.The Basic Local Alignment Search Tool (BLAST)

earch and multiple alignment of gOVN amino acidequence with other species (Fig. 1) revealed signifi-ant homology between 51% to 97% (97% with sheep,

(UniProtKB Acc. No. A4Z8Y2) with oviductin sequences available(Q28042), Porcine (Q28990), Baboon (P36718), Human (Q12889),

f gOVNBovine

aea(Pw

eto5

BPHBMH 6.16

1010 M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

94% with cow, 77% with porcine, 69% with hamster,66% with human, 65% with rabbit, 64% with mouseand 62% with baboon). The BLAST search alsoshowed sequence similarity of gOVN with novel mem-bers of inactive chitinase-like proteins and mammalianchitinases belonging to glycosyl hydrolase 18 family inaddition to the oviductins from other species. It showed46% identity with goat MGP-40 (Mammary Gland Pro-tein-40), 45% with HC-gp39 (Human Cartilage glyco-protein-39) and 43% identity with mouse BRP-39(Breast Regression Protein-39). It also observed se-quence identity of gOVN (30–50%) with distantly re-lated chitinases. The deduced amino acid sequence ofgOVN demonstrated one potential N-linked glycosyla-tion site (Asn-Ser-Ser) at position 402 and 21 potentialO-linked glycosylation sites (Pro-Ser/Thr) (Table 1).The number of potential phosphorylation sites in gOVNwas predicted to be 36 (19 sites located at Ser positions,12 at Thr positions and 5 at Tyr positions) (Table 1).There were four cysteine residues in gOVN at positions26, 51, 303 and 367 (Fig.1) suggesting occurrence oftwo possible disulphide bridges.

3.2. Purification and western blot analysis of nativegOVN

The purification of gOVN was carried out by WGA-affinity column chromatography. The SDS-PAGE pro-file of the eluted fractions contained three major proteinbands with one most prominent at �95 kDa. Otherprominent bands with few minor bands were also vis-ible in between �60 kDa to �95 kDa (Fig. 2). Theffinity purified protein was further purified by anionxchange chromatography. The eluted fraction showedbroad peak, which further divided into smaller peaks

Fig. 3). All the fractions were subjected to SDS-AGE, which showed similar pattern of heterogeneity

Table 1Physico-chemical properties of oviductins from different species. Thcompared using bioinformatics tools. The molecular weight is predimolecular weight of the protein due to heavy glycosylation.

Species ORF (bp) AA MW (Da)

Goat 1620 518 57489Sheep 1620 518 57236

ovine 1615 519 57750orcine 1584 506 56267uman 2037 657 73039aboon 1872 602 66909ouse 2166 700 76616amster 2016 650 70970

ith multiple protein bands of different sizes. To fur-

ther confirm the homogeneity of purification, we per-formed western blot of purified protein using monoclo-nal antibody (mAb 1H10). Western blot analysisshowed four distinct bands corresponding to the sizerange of �60 kDa to �95 kDa (Fig. 2).

3.3. Effect of gOVN on in vitro embryo production

To evaluate in vitro embryo production in the pres-nce of varying concentrations of gOVN, in vitro ma-ured oocytes were subjected to IVF. The cleavage ratef embryos was observed as 52.1%, 75.1%, 61.8% and7.1% at oviductin concentrations of 0, 10, 50 and 100

�g/mL, respectively (Table 2). The rate of blastocystproduction after day 7 with respect to cleaved embryoswas observed as 16.0%, 24.5%, 15.4% and 11.5% when

Fig. 2. SDS-PAGE and Western blot goat oviductin. gOVN has beenstained with Coomassie brilliant blue. Lane M: Protein molecularweight standard; Lane 1: Affinity purified goat oviductin, Lane 2:

is taken from the gene sequences available in the database andm the amino acid sequences and it is different from the actual

N-Glysites O-Glysites Phosphorylation sites(Ser � Thr � Tyr)

1 21 36 (19 � 12 � 5)1 17 38 (20 � 13 � 5)1 17 33 (15 � 13 � 5)3 14 28 (14 � 10 � 4)5 9 49 (21 � 20 � 8)2 7 41 (17 � 17 � 7)3 50 58 (29 � 21 � 8)5 28 43 (23 � 14 � 6)

e datacted fro

pI

9.539.619.519.118.829.129.19

Western blot of purified goat oviductin.

m(mc

o(z

4

tcdmnd

atemvcmtdpgaqwis(atgtc1atemdmlpcgttdceps

c

1011M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

oviductin concentrations were 0, 10, 50 and 100 �g/L, respectively (Table 2). The lower concentration

10 �g/mL) of oviductin increased the cleavage rate,orula and blastocyst yield significantly (P � 0.05) as

ompared to higher concentration (100 �g/mL).

3.4. Effect of gOVN on zona pellucida solubility

The time taken for digestion of zona pellucida of invitro matured goat oocytes by pronase (0.1%) wasobserved as 4.36 � 0.05, 7.70 � 0.39, 11.30 � 0.56and 14.72 � 0.61 min for gOVN concentration of 0, 10,50 and 100 �g/mL respectively (Fig. 4). Therefore goatocytes treated with higher concentration of gOVN100 �g/mL) retarded the effect of pronase (0.1%) onona solubility.

. Discussion

Complementary DNA sequence analysis revealedhat gOVN cDNA has the highest similarity with itslosest neighbor sheep. A BLAST comparison of pre-icted gOVN sequence revealed that it constituted aajor chitinase-like N-terminal domain and is a chiti-

ase-like protein belonging to family 18 glycosyl hy-rolase. The N-terminal domain is mostly conserved

Fig. 3. Ion-exchange chromatography of goat oviductin usingMono-Q column connected with FPLC. The consecutive peaks ob-served in the linear gradient represent purified goat oviductin.

Table 2Effect of gOVN on cleavage rate and in vitro embryo production. Vconsidered at P � 0.05 for the mean percentage from six trials in eadiffer significantly P � 0.05).

Treatment No: of oocytes taken No: of cleaved(percentage of oocyte

ontrol 35.00 � 2.23 18.17 � 1.08 (52.08 � 110 �g/ml 35.00 � 2.23 26.67 � 2.87 (75.14 � 350 �g/ml 35.00 � 2.23 21.67 � 1.65 (61.81 � 1

100 �g/ml 35.00 � 2.23 20.00 � 1.69 (57.08 � 3.10)a

cross the species while most of the variability is due tohe variation in length of C-terminal residues in differ-nt species (Fig. 1). The N-terminal chitinase-like do-ain showed significant amino acid similarities with

arious chitinase-like proteins such as a secreted gly-oprotein (MGP-40 and BRP39) expressed duringammary gland involution [33,34], to a major secre-

ory glycoprotein (HC gp-39) of human articular chon-rocytes [35], to a protein secreted by mouse macro-hages (YM1) [36] and to a human chitinase [37].OVN also showed sequence homology to bacterialnd microfilarial chitinases [38]. The amino acid se-uences of oviductin suggest structural relationshipsith the chitinase protein family. The patterns of sim-

larities are distributed throughout the length of theequence till the boundary of chitinase-like domainFig. 1). The mammalian proteins MGP-40, HC gp-39nd YM1 have lost their chitinase activity due to mu-ation of the critical glutamic acid to either leucine orlutamine in the active site. Non-conservative substitu-ion of this catalytic residue from glutamic acid inhitinase to leucine also occurs in gOVN at position41 suggesting that oviductin may not be catalyticallyctive but may use some of the structural elements ofhe chitinases to mediate their own functions or prop-rties such as specific binding to related carbohydrateoieties. The mechanism of biological activity of ovi-

uctin is not yet clearly known. It is noteworthy toention that oviductin interacts with oocyte zona pe-

ucida during fertilization process [32]. As the zonaellucida of oocyte and embryos constitute many gly-an residues, oviductin might be interacting with theselycan residues present on the surface of oocyteshrough its chitinase-like domain thereby facilitatinghe process of fertilization. Moreover, the chitinase-likeomain of oviductin may be responsible in a signalingascade during the process of fertilization that leads tombryo cleavage and cell proliferation. Chitinase-likerotein such as HCgp-39 has been reported to initiate aignaling cascade in connective-tissue cells, which

re mean � SE from six trials in each treatment. Significance istment (a,b,c; values with different superscript in each column

Morula(percentage of cleaved)

Blastocyst(percentage of cleaved)

8.33 � 0.88 (45.31 � 2.77)a 1.33 � 0.21 (16.01 � 1.59)b

18.17 � 1.80 (68.63 � 1.80)c 4.5 � 0.56 (24.47 � 1.03)c

13.00 � 1.13 (59.80 � 1.36)b 2.00 � 0.26 (15.42 � 1.63)b

alues ach trea

s)

.42)a

.60)b

.81)a

11.33 � 1.12 (56.85 � 2.87)b 1.33 � 0.21 (11.53 � 0.90)a

hebb

tr4pttpta

s

1012 M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

leads to increased cell proliferation [39,40]. Occurrenceof oviductin in the perivitelline space of oocytes andembryos has been reported [11]. Presence of oviductinin the perivitelline space of oocyte and embryos mayfacilitate the process of cell proliferation leading toembryo cleavage in line with the proliferation activityof other chitinase-like proteins [41].

The predicted molecular weight of secreted oviduc-tin proteins from different species is shown in Table 1.Molecular weight of goat oviductin was predicted to be57,489 Daltons. The goat, sheep, bovine and porcineshowed almost similar predicted molecular weight(56–57 kDa) while primates and rodents showed highermolecular weights (70–76 kDa) in comparison to ru-minants and porcine. Apparently there is a difference of�30 kDa in the molecular weight of purified gOVN incomparison to the predicted molecular weight of 57kDa. This observed large molecular weight difference(as observed in SDS-PAGE) in comparison to the pre-dicted molecular weight may be attributed to the heavyO-linked glycosylation of oviductin. The presence ofO-linked glycosylation is supported by the fact that wedid observe 21 potential O-linked glycosylation sites ingOVN using NetOGly bioinformatics tool. Occurrenceof O-linked glycosylation in oviductin causes size vari-ation and contributes approximately 60% of its appar-ent molecular mass [42]. Hamster oviductin was treatedwith trifluoromethanesulphonic acid (TMFSA), whichcauses slow loss of serine- and threonine linked N-acetylgalactosamine and retention of N-linked N-acetyl-D-glucosamine, suggesting that oviductin wasO-glycosylated [43]. The contribution of N-linked gly-cosylation in size variation is limited due to the pres-ence of only one N-linked glycosylation site in goat.Similar differences in the predicted and observed mo-

Fig. 4. Effect of different concentrations of gOVN on zona pellucidasolubility of goat oocytes after treatment with 0.1% pronase. Signif-icance was considered at p � 0.01 for the mean of time taken forolubility from six trials in each treatment.

lecular weight of oviductins have also been reported in s

other species [9], which has been attributed due to thepresence of O-linked glycosylations. These results in-dicated the occurrence of structural polymorphism inoviductin. Presence of four cystein residues in gOVNsuggests occurrence of 2 disulfide bridges. All the Cysresidues in gOVN were observed to be conservedamong oviductins of all the species suggesting theirimportant role in structure stabilization. In a relatedstudy occurrence of 2 disulfide bridges in other chiti-nases-like proteins such as MGP-40 and SPS-40 hasbeen reported [32,44].

The present study shows that supplementation ofoviductin in the IVM, IVF and IVC media improves thecleavage rate and blastocyst production rates in goats.Studies in sheep [45], cow [46] and pigs [47] haveshown that co-culture of oviductal cells increases em-bryonic development. They have suggested that someof the oviduct specific factors play important roles innormal embryonic development. Oviductin is one suchimportant constituent that helps to decrease polyspermy,increases rate of in vitro maturation, fertilization andembryo development in many species [48]. The bene-ficial effects of addition of purified oviductin into IVM,IVF and IVC culture media of goat oocytes was ob-served to be optimum at 10 �g/mL compared to thecontrol. At higher concentrations of 50 �g/mL and 100�g/mL, oviductin significantly decreased the rates ofembryo cleavage, morula and blastocyst production re-spectively. Results from this study are in agreementwith that of the effect of porcine oviductin on cleavageand blastocyst rate [49]. Our results indicate that use ofoptimum concentration of oviductin is an importantparameter for in vitro embryo production becauseigher concentration of oviductin exhibits inhibitoryffect. Oviductin increases the cleavage rate probablyecause it helps in overcoming the developmentallock, which takes place at early stage of embryo [16].

Zona pellucida of oocyte and embryo is highly sus-ceptible to proteolytic degradation by different pro-teases [50]. In the present investigation, we have ob-served that when in vitro matured goat oocytes werereated with gOVN, the zona solubility by pronase wasetarded considerably in comparison to the control (Fig.). This observation suggests that oviductin may belaying an important role in protecting the integrity ofhe zona pellucida from oviductal or embryonic pro-eases inside the lumen of the oviduct and could be aotential factor in preventing zona solubility. This inurn may provide stability to zona pellucida of oocytesnd inhibits polyspermy in goat embryos. In a related

tudy, it has been reported that incubation in oviductal

o

5

mrsossliccptcoiiph

A

cAakR

Ya

R

1013M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

fluid of porcine and bovine IVM oocytes make the zonapellucida resistant to proteolytic digestion, decreasepolyspermy, and increase the incidence of mono-spermy. The factor responsible for effecting thesechanges was found to be oviductins of porcine andbovine respectively [50]. However, contradictory find-ings have been reported in porcine where no treatmenteffect was observed for zona digestion time of oocyteswhen incubated for 4 h in the presence of variousconcentration of porcine oviduct specific glycoprotein(0–100 �g/mL) [51]. In case of porcine, oocytes andembryos derived from oviduct have been reported to bemore resistant to proteolytic degradation than oocytesor embryos recovered from the uterine lumen suggest-ing a potential interaction of oviductal protease inhib-itors with the oocyte or embryos. The zona pellucida ofoocytes matured in vitro have been reported to be moresusceptible to protease digestion by pronase than non-fertilized oocytes flushed from the oviduct on 2nd dayf the estrous cycle [52].

. Conclusion

In the present investigation, we have reported theolecular cloning and cDNA sequence of oviductin

epresenting its open reading frame. Goat oviductinhows maximum similarity with amino acid sequencef sheep oviductin followed by oviductins from otherpecies. The N-terminal domain of oviductin showsignificant similarity with chitinase-like proteins be-onging to family 18 glycosyl hydrolase. In vitro stud-es indicate that when gOVN was used at an optimumoncentration of 10 �g/mL, this enhances embryoleavage rate, blastocyst formation including block ofolyspermy. When in vitro matured goat oocytes werereated with gOVN, the zona solubility was retardedonsiderably in comparison to the control. Therefore,viductin may play an important role in protecting thentegrity of the zona pellucida from oviductal proteasesnside the lumen of the oviduct, which in turn mayrovide stability to zona pellucida of oocytes and in-ibits polyspermy in goat embryos.

cknowledgments

We extend our gratitude to Indian Council of Agri-ultural Research (ICAR) for the financial support toKM under NICHE area of excellence on production

nd reproduction genomics at NDRI, Karnal. We ac-nowledge our sincere thanks to Dr. Yutaka Sendai,

esearch Institute for the Functional Peptides,

amagata, Japan for providing monoclonal antibodygainst bovine oviductin.

eferences

[1] Hunter RH. Reflections upon sperm-endosalpingeal and sperm-zona pellucid interactions in vivo and in vitro. Reprod DomestAnim 2003;38:147–54.

[2] Oliphant G, Reynolds AB, Smith PF, Ross PR, Marta JS.Immunocytochemical localization and determination of hor-mone-induced synthesis of the sulfated oviductal glycoproteins.Biol Reprod 1984;31:165–74.

[3] Sutton R, Nancarrow CD, Wallace ALC, Rigby NW. Identifi-cation of an oestrus-associated glycoprotein in oviducal fluid ofthe sheep. J Reprod Fertil 1984;72:415–22.

[4] Leveille MC, Roberts KD, Chevalier S, Shapdelaine V, BleauG. Uptake of an oviductal antigen by the hamster zona pellu-cida. Biol Reprod 1987;36:227–38.

[5] Verhage HG, Fazleabas AT. The in vitro synthesis of estrogen-dependent proteins by the baboon (Papio anubis) oviduct. En-docrinology 1988;123:552–8.

[6] Verhage HG, Fazleabas AT, Donnelly K. The in vitro synthesisand release of proteins by the human oviduct. Endocrinology1988;122:1639–45.

[7] Boice ML, Geisert RD, Blair RM, Verhage HG. Identificationand characterization of bovine oviductal glycoproteins synthe-sized at estrus. Biol Reprod 1990;43:457–565.

[8] Buhi WC, Alvarez IM, Suldhipong V, Donnes-Smith MM.Identification and characterization of de-novo synthesized ofporcine oviductal secretory proteins. Biol Reprod 1990;43:929 –38.

[9] Killian GJ. Evidence for the role of oviduct secretions in spermfunction, fertilization and embryo development. Anim ReprodSci 2004;82:141–53.

[10] Verhage HG, Mavrogianis PA, O’Day-Bowman MB, SchmidtA, Arias EB, Donnelly KM, Boomsma RA, Thibodeaux JK,Fazleabas AT, Jaffe RC. Characteristics of an oviductal glyco-protein and its potential role in the fertilization process. BiolReprod 1998;58:1098–101.

[11] Boice ML, McCarthy TJ, Mavrogianis PA, Fazleabas AT,Verhage HG. Localization of oviductal glycoproteins withinthe zona pellucida and perivitelline space of ovulated ova andearly embryos in baboons (Papio anubis). Biol Reprod 1990;43:340 – 46.

[12] O’Day-Bowman MB, Mavrogianis PA, Reuter LM, JohnsonDE, Fazleabas AT, Verhage HG. Association of oviduct specificglycoproteins with human and baboon (Papio anubis) ovarianoocytes and enhancement of human sperm binding to humanhemizonae following in vitro incubation. Biol Reprod 1996;54:60–9.

[13] Boatman DE, Magnoni GE. Identification of a sperm penetra-tion factor in the oviduct of the golden hamster. Biol Reprod1995;52:199–207.

[14] Martus NS, Verhage HG, Mavrogianis PA, Thibodeaux JK.Enhancement of bovine oocyte fertilization in vitro with abovine oviductal specific glycoprotein. J Reprod Fertil 1998;113:323–9.

[15] Mugnier S, Kervella M, Douet C, Canepa S, Pascal G,Deleuze S, Duchamp G, Monget P, Goudet G. The secretionsof oviduct epithelial cells increase the equine in vitro fertil-

ization rate: are osteopontin, atrial natriuretic peptide A

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

1014 M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

and oviductin involved? Reprod Biol Endocrinol 2009;19:7:129.

16] Yong P, Zheng GU, Luo JP, Wang JR, Tso JK. Antibodiesagainst the C-terminal peptide of rabbit oviductin inhibit mouseearly embryo development to pass 2-cell stage. Cell Res 2002;12:69–78.

17] Agarwal A, Yeung WSB, Lee K. Cloning and characterizationof the human oviduct-specific glycoprotein (HuOGP) gene pro-moter. Mol Hum Reprod 2002;8:167–75.

18] Takahashi K, Sendai Y, Matsuda Y, Hoshi H, Hiroi M, Araki Y.Mouse oviduct-specific glycoprotein gene: genomic organiza-tion and structure of the 5= flanking regulatory region. BiolReprod 2000;62:217–26.

19] Merlen Y, Bleau G. Organization of a gene coding for anoviduct-specific glycoprotein (oviductin) in the hamster. MolReprod Dev 2000;57:238–46.

20] Merchán M, Peiró R, Santacreu MA, Francino O, Folch JM.Rabbit oviductal glycoprotein 1 gene: genomic organizationpolymorphism analysis and mRNA expression. Mol ReprodDev 2007;74:687–93.

21] Jaffe RC, Arias EB, O’Day-Bowman MB, Donnelly KM, Ma-vrogianis PA, Verhage HG. Regional distribution and hormonalcontrol of estrogen-dependent oviduct-specific glycoproteinmessenger ribonucleic acid in the baboon (Papio anubis). BiolReprod 1996;55:421–6.

22] Sendai Y, Abe H, Kikuchi M, Satoh T, Hoshi H. Purificationand molecular cloning of bovine oviduct-specific glycoprotein.Biol Reprod 1994;50:927–34.

23] Suzuki K, Sendai Y, Onuma T, Hoshi H, Hiroi M, Araki Y.Molecular characterization of a hamster oviduct-specific glyco-protein. Biol Reprod 1995;53:345–54.

24] Arias EB, Verhage HG, Jaffe RC. Complementary deoxyribo-nucleic acid cloning and molecular characterization of an estro-gen dependent human oviductal glycoprotein. Biol Reprod1994;51:685–94.

25] Sendai Y, Komiya H, Suzuki K, Onuma T, Kikuchi M, Hoshi H,Araki Y. Molecular cloning and characterization of a mouseoviduct-specific glycoprotein. Biol Reprod 1995;53:285–94.

26] Buhi WC, Alvarez IM, Choi I, Cleaver BD, Simmen FA. Mo-lecular cloning and characterization of an estrogen-dependentporcine oviductal secretory glycoprotein. Biol Reprod 1996;55:1305–14.

27] Verhage HG, Mavrogianis PA, Boomsma RA, Schmidt A,Brenner RM, Slayden OV, Jaffe RC. Immunologic and molec-ular characterization of an estrogen-dependent glycoprotein inthe rhesus (Macaca mulatta) oviduct. Biol Reprod 1997;57:525–31.

28] DeSouza MM, Murray MK. An estrogen-dependent secretoryprotein, which shares identity with chitinases, is expressed in atemporally and regionally specific manner in the sheep oviductat the time of fertilization and embryo development. Endocrinol1995;36:2485–96.

29] Malakar D, Majumdar AC. Isolation, identification and charac-terization of secretory proteins of IVMFC embryos and bloodcirculation of estrus and early pregnant goat. Indian J Exp Biol2005;43:693–701.

30] Parrish JJ, Susko-Parrish J, Winer MA, First NL. Capacitationof bovine sperm by heparin. Biol Reprod 1988;38:1171–80.

31] Katska L, Rynska B, Gajda B, Smorag Z. Effect of donorstimulation, frozen semen and heparin treatment on the effi-ciency of in vitro embryo production in goats. Theriogenology

2004;62:576–86.

32] Buhi WC. Characterization and biological roles of oviductin-specific, oestrogen dependent glycoprotein. Reproduction 2002;123:355–62.

33] Mohanty AK, Singh G, Paramasivam M, Saravanan K, JabeenT, Sharma S, Yadav S, Kaur P, Kumar P, Srinivasan A, SinghTP. Crystal structure of a novel regulatory 40-kDa mammarygland protein (MGP-40) secreted during involution. J BiolChem 2003;278:14451–60.

34] Mohanty AK, Fisher AJ, Yu Z, Pradeep MA, Janjanam J,Kaushik JK. Cloning, expression, characterization and crystal-lization of BRP39, a signaling glycoprotein expressed duringmammary gland apoptosis. Expr Purif 2009;64:213–8.

35] Houston DR, Recklies AD, Krupa JC, van Aalten DM. Structureand ligand-induced conformational change of the 39-kDa gly-coprotein from human articular chondrocytes. J Biol Chem2003;278:30206–12.

36] Tsai ML, Liaw SH, Chang NC. The crystal structure of YM1 at1.31 A resolution. J Struct Biol 2004;148:290–6.

37] Fusetti F, von Moeller H, Houston D, Rozeboom HJ, DijkstraBW, Boot RG, Aerts JM, van Aalten DM. Structure of humanchitotriosidase. Implications for specific inhibitor design andfunction of mammalian chitinase-like lectins. J Biol Chem2002;277:25537–44.

38] Henrissat B. A classification of glycosyl hydrolases based onamino acid sequence similarities. Biochem J 1991;280:309–16.

39] Recklies AD, White C, Ling H. The chitinase 3-like proteinhuman cartilage glycoprotein 39 (HC-gp39) stimulates prolif-eration of human connective-tissue cells and activates bothextracellular signal-regulated kinase- and protein kinase B-me-diated signalling pathways. Biochem J 2002;365:119–26.

40] Ling H, Recklies AD. The chitinase 3-like protein human car-tilage glycoprotein 39 inhibits cellular responses to the inflam-matory cytokines interleukin-1 and tumour necrosis factor-al-pha. Biochem J 2004;380:651–9.

41] Hartl D, He CH, Koller B, Silva CAD, Kobayashi Y, Lee CG,Flavell RA, Elias JA. Acidic mammalian chitinase regulatesepithelial cell apoptosis via a chitinolytic-independent mecha-nism. J Immunol 2009;182:5098–106.

42] Malette B, Paquette Y, and Bleau G. Size Variations in theMucin-Type Domain of Hamster Oviductin: Identification ofthe Polypeptide Precursors and Characterization of Their Bio-synthetic Maturation. Biol Reprod 1995;53:1311–23.

43] Malette B, Bleau G. Biochemical characterization of hamsteroviductin as a sulfated zona pellucida-binding glycoprotein.Biochem J 1993;295:437–45.

44] Srivastava DB, Ethayathulla AS, Kumar J, singh N, Sharma S,Das U, Srinivasan A, Singh TP. Crystal structure of a secretorysigalling glycoprotein from sheep at 2.0A resolution. J StructBiol 2006;156:505–16.

45] Rexroad CEJr, Powell AM. Co-culture of ovine ova with ovi-ductal cells in medium 199. J Anim Sci 1988;66:947–53.

46] Eyestone WH, First NL. Co-culture of early cattle embryos tothe blastocyst stage with oviducal tissue or in conditioned me-dium. J Reprod Fertil 1989;85:715–20.

47] White KL, Hehnke K, Rickords LF, Southern LL, ThompsonDLJr, Wood TC. Early embryonic development in vitro bycoculture with oviductal epithelial cells in pigs. Biol Reprod1989;1:425–30.

48] Buhi WC, Alvarez IM, Kouba AJ. Secreted proteins of theoviduct. Cells Tissues Organs 2000;166:165–79.

49] Kouba AJ, Abeydeera LR, Alvarez IM, Day BN, Buhi WC.

Effects of the porcine oviduct-specific glycoprotein on fertiliza-

[

[

[

1015M.A. Pradeep et al. / Theriogenology 75 (2011) 1005–1015

tion, polyspermy, and embryonic development in vitro. BiolReprod 2000;63:242–50.

50] Coy P, Canovas S, Mondejar I, Saavedra MD, Romar R, Grul-lon L, Matas C, Aviles M. Oviduct-specific glycoprotein andheparin modulate sperm-zona pellucida interaction during fer-tilization and contribute to the control of polyspermy. Proc Natl

Acad Sci 2008;105:15809–14.

51] Broermann DM, Xie S, Nephew KP, Pope WF. Effects of theoviduct and wheat germ agglutinin on enzymatic digestion ofporcine zona pellucidae. J Anim Sci 1989;67:1324–9.

52] Wang WH, Abeydeera LR, Prather RS, Day BN. Morphologiccomparison of ovulated and in vitro-matured porcine oocytes,with particular reference to polyspermy after in vitro fertiliza-

tion. Mol Reprod Dev 1998;9:308–16.