PTPN12/PTP-PEST Regulates Phosphorylation- Dependent … · Molecular Cell Biology PTPN12/PTP-PEST Regulates Phosphorylation-Dependent Ubiquitination and Stability of Focal Adhesion

Molecular Cell Biology

PTPN12/PTP-PEST Regulates Phosphorylation-Dependent Ubiquitination and Stability of FocalAdhesion Substrates in Invasive GlioblastomaCellsZhihua Chen1, John E. Morales1, Paola A. Guerrero1, Huandong Sun2, andJoseph H. McCarty1

Abstract

Glioblastoma (GBM) is an invasive brain cancerwith tumor cells that disperse from the primarymass, escaping surgical resection and invariablygiving rise to lethal recurrent lesions.Herewe reportthat PTP-PEST, a cytoplasmic protein tyrosinephosphatase, controls GBM cell invasion by phys-ically bridging the focal adhesion protein Crk-asso-ciated substrate (Cas) tovalosin-containingprotein(Vcp), an ATP-dependent protein segregase thatselectively extracts ubiquitinated proteins frommultiprotein complexes and targets them for deg-radation via the ubiquitin proteasome system.Both Cas and Vcp are substrates for PTP-PEST, withthe phosphorylation status of tyrosine 805 (Y805)in Vcp impacting affinity for Cas in focal adhesionsand controlling ubiquitination levels and proteinstability. Perturbing PTP-PEST–mediated phos-phorylation of Cas and Vcp led to alterations inGBM cell-invasive growth in vitro and in preclinicalmouse models. Collectively, these data reveal anovel regulatory mechanism involving PTP-PEST,Vcp, and Cas that dynamically balances phosphor-ylation-dependent ubiquitination of key focal pro-teins involved in GBM cell invasion.

Significance: PTP-PEST balances GBM cell growth and invasion by interacting with the ATP-dependent ubiquitin segregase Vcp/p97and regulating phosphorylation and stability of the focal adhesion protein p130Cas.

Graphical Abstract: http://cancerres.aacrjournals.org/content/canres/78/14/3809/F1.large.jpg. Cancer Res; 78(14); 3809–22. �2018 AACR.

IntroductionPatients with the malignant cancer glioblastoma (GBM)

have a median survival time of less than two years afterdiagnosis (1). This poor prognosis is largely due to invasiveGBM cells that escape surgical resection and give rise to recur-rent lesions that are resistant to chemotherapy such as temo-zolomide. Targeted therapies such as the anti-VEGF blockingantibody bevacizumab have yielded disappointing results inGBM clinical trials, with no improvements in overall patientsurvival. Many patients treated with bevacizumab developacquired resistance, leading to lethal recurrent lesions associ-ated with robust tumor cell invasion (2). While a great deal isknown about genes and pathways that promote GBM growth

© 2018 American Association for Cancer Research

+/– pY degrons

SH3 C-term

Y805

+ Ubiquitin Segregation

Degradationvia UPS

Elongins

RBXSH2

Cullin?

Cullin RINGligase

PBS D2 D1

pY..Y...pY

GBM cellfocal adhesion

PTPase PEST-rich

A four-part model illustrates how PTP-PEST regulates phosphorylation-dependent ubiquitinationof focal adhesion proteins to control GBM cell polarity and invasion.

PTP-PEST

CAS

1

2 3

4 VCP

VC

IP135

Trim9

Fem1C Ube2r2

C

C

C N

N

N

E3 ligase

1Department of Neurosurgery, University of Texas MD Anderson Cancer Center,Houston, Texas. 2Institute for Applied Cancer Sciences, University of Texas MDAnderson Cancer Center, Houston, Texas.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: Joseph H. McCarty, Department of Neurosurgery,University of Texas M.D. Anderson Cancer Center, Unit 1004, 1515 HolcombeBoulevard, Houston, TX 77030. Phone: 713-792-0429; Fax: 713-834-6257;E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-18-0085

�2018 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 3809

on April 6, 2020. © 2018 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst May 9, 2018; DOI: 10.1158/0008-5472.CAN-18-0085

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-18-0085&domain=pdf&date_stamp=2018-6-27

http://cancerres.aacrjournals.org/content/canres/78/14/3809/F1.large.jpg

http://cancerres.aacrjournals.org/

and neovascularization, relatively little is understood aboutmechanisms that drive GBM cell invasion during progressionwho follow antiangiogenic therapy.

PTP-PEST is a 110 kDa cytosolic phosphatase that contains a30 kDa N-terminal catalytic domain and a C-terminus withseveral proline, glutamate, serine, and threonine-rich (PEST)sequences. PTP-PEST plays important roles in promoting tissuemorphogenesis, with deletion of the murine PTP-PEST gene(Ptpn12) in all cells leading to embryonic lethality (3). Struc-tural studies of the PTP-PEST catalytic domain reveal that itrecognizes phosphotyrosine (pY) motifs in diverse substrates(4), including Rho GEFs, GAPs, and focal adhesion proteinssuch as paxillin and focal adhesion kinase (FAK). CulturedPTP-PEST�/� cells show defective polarity and migration due,in part, to abnormal activation of Rho GTPase signaling andimbalances in cell–ECM adhesion (5, 6).

Focal adhesions are multiprotein complexes that connect thecytoskeleton to the extracellular matrix (ECM) via integrins (7).Integrin–ECM adhesions continually develop and disassemble asa cell moves, with intermediate structures (nascent adhesions)forming and growing into larger focal adhesions at the leadingedge, and subsequently disassembling under the cell body (8). Akey regulatory event in the formation and disassembly of focaladhesions is posttranslational tyrosine phosphorylation, relatedto activities of tyrosine kinases such as Src and FAK (9). Crk-associated substrate (Cas) is a 130-kDa protein that was originallyidentified as a substrate of Src (10). There are several members ofthe Cas protein family: Cas, also known as breast cancer anti-estrogen resistance (Bcar1), Nedd9, Cass4, and embryonal Fynsubstrate (Efs; ref. 11). Cas is a core component of focal adhesionswhere it bridgesmultiple signalingproteins tomodulate adhesionandmotility (12). Cas-deficient cells show normal focal adhesionassembly, but dramatically impaired disassembly, leading todefective migration and invasion (13).

Phosphorylation and ubiquitination are tightly coupled pro-cesses, with "phosphodegron" sequences in target proteinsrecruiting E3 ubiquitin ligases and other proteins involved indegradation by the ubiquitin proteasome system (14). Proteinsare covalently tagged with ubiquitin via the activities of threeenzymes, termed E1, E2, and E3 (15). Ubiquitinated proteinswithin multicellular complexes are selectively removed via chap-erone activities associated with Vcp, a 97-kDa evolutionarilyconserved protein (16). Vcp catalyzes the segregation of ubiqui-tinated proteins from organelles, chromatin, and multiproteincomplexes, and promotes destruction by the proteasome (17).Vcp protein contains two AAAþ adenosine triphosphatase(ATPase) domains and an N-domain, which interacts with lipidsin the plasmamembrane and other proteins, including E2 and E3enzymes (18). A Peptide:N-glycanase/UBA or UBX (PUB)domain-interaction sequence (PBS) in the Vcp C-terminus med-iates associations with PUB domain-containing proteins andother factors (19). Src phosphorylation of Vcp tyrosine 805(Y805) in the PBS blocks interactions with ubiquitinated PUBdomain–containing proteins (20).

Here, we report that PTP-PESTdynamically regulatesGBMcell–invasive growth via the formation of a complex with Cas and Vcp.PTP-PEST enzymatic activities create phosphodegrons in Cas thattarget it for extraction by Vcp, thus stabilizing focal adhesions andbalancing GBM cell–invasive growth. Cells expressing PTP-PESTare less invasive due to lower levels of phosphorylated Cas and thepresence of more stable focal adhesions. GBM cells that express

low levels of PTP-PEST display enhanced invasion due toincreasedCas phosphorylation andmore dynamic focal adhesiondisassembly. Collectively, these results not only elucidate novelsignaling pathways that link the phosphorylation and ubiquiti-nation pathways.

Materials and MethodsEthics statement

Approval for the use of human specimens was obtained fromthe Institutional ReviewBoard (IRB) at theUniversity of TexasMDAnderson Cancer Center. The IRB waived the requirement forinformed consent for previously collected residual tissues fromsurgical procedures stripped of unique patient identifiers accord-ing to the Declaration of Helsinki guidelines. All animal proce-dures and experiments conducted in this study were reviewed andapproved by the University of Texas MD Anderson Cancer CenterInstitutional Animal Care and Use Committee (IACUC).

GBM cell culturing and analysisPrimary human GBM cells from patient samples were cultured

in the following growth media: DMEM-F12 (Mediatech), 20ng/mL EGF and bFGF (Gibco), B27 supplement (Life Technolo-gies) and 1 U/mL penicillin–streptomycin (Gibco). After 7 to 10days, spheroids were passaged by accutase (Sigma #A 6964) treat-ment and mechanical disruption using a 1-mL syringe and a 23-gauge needle, and dissociated cells were replated in fresh growthmedia. LN229GBMcells andHEK293T cellswerepurchased fromthe ATCC. GBM cell lines were cultured in DMEM (Mediatech)supplemented with 10% FBS (Atlanta Biologics) and antibiotics.All cells were authenticated byDNA short tandem repeat profilingin an institutional Characterized Cell Line Core Facility. In addi-tion, all cultured cells were routinely tested formycoplasma usingcommercially available kits (Thermo Fisher Scientific), and onlythose cells deemed mycoplasma free were used for experiments.

PTPN12-dependent cell viability was quantified using theCellTiter-Glo luminescent assay kit (Promega) according to themanufacturer's protocol. Briefly, control or PTPN12 KO sphereswere dissociated as detailed above and 5 � 103 stem-like GBMcells (GSC)were added perwell in a 96-well format. At 48, 72, and96 hours after plating CellTiter-Glo reagent was added to eachwell. Plates were incubated at room temperature for 10 minutesand the luminescence intensity was measured with a microplatereader.

To analyze adherent cells by immunofluorescence, spheroidswere dissociated as detailed above and GSCs were plated on glasscoverslips coated with laminin for 24 hours (10 mg/mL) prior tofixation and permeabilization. For Matrigel invasion assays, 5 �104 GBM cells (control or PTPN12 KO) were added in serum-freemedia (GSCs) or 1% serum-containingmedia (LN229GBMcells)in the top chambers ofMatrigel (BDBiosciences, 8-mmpore sizes)invasion transwell systems (n ¼ 3 wells per cell type). For RNAi-mediated silencing experiments, LN229 GBM cells were added toMatrigel transwell chambers 22–24 hours after transfection withsiRNAs. Normal growth medium containing 10% FBS was addedto the lowerwells to stimulate cellmotility. GBMcell invasionwasquantified after 24 hours by staining the excised filters withProtocal HEMA3 stain followed by counting cells on the under-side of the transwell filters.

For pharmacologic treatment experiments, CB-5083(Selleckchem) was dissolved in DMSO (10 mmol/L stock

Chen et al.

Cancer Res; 78(14) July 15, 2018 Cancer Research3810




solution) and diluted in growth media before addition toadherent LN229 GBM cells (5 � 103 cells per well) in a 96-wellformat. At 24, 48, or 72 hours after treatment, CellTiter Gloreagent was added to each well and viability was quantified onthe basis of luminescence readings. GraphPad Prism was used toanalyze and viability and determine IC50 concentrations. Forstudies of focal adhesion proteins, LN229 cells were treated withDMSOor CB-5083 (0.4 mmol/L) dissolved in DMSO for 24 hoursfollowed by lysis with RIPA buffer and immunoblotting.

Experimental miceAll animal experiments were reviewed and approved prior to

animal use under the guidance of the IACUC and the MDAnderson Subcommittee on Animal Studies, both AAALACaccredited institutions. NCR-nu/nu mice were purchased fromJackson Laboratories and used for all experiments involvingintracranial injections of human GBM cells. Healthy maleNCR-nu/nu mice between 6 and 12 weeks of age were purchasedfrom Jackson Laboratories. NCR-nu/nu mice were injected intra-cranially with 1–2 � 105 GBM cells as described previously (21).Mice were anesthetized by intraperitoneal injection of a mixtureof ketamine/xylazine/acepromazine (100 mg/kg þ 2.5 mg/kg þ2.5 mg/kg body weight) using a 1 mL syringe and sterile 22 Gneedle. At these dosages, the mice remain deeply anesthetizedfor approximately 30 minutes, which allows sufficient time toperform the intracranial injections. At 5 minutes postanesthesia,lower limb reflexivity was checked: deeply anesthetized animalswere not responsive to a toe pinch. Corneal reflex was also usedto assess depth of anesthesia during surgery. After surgery, micewere kept warm with gauze pads and a heat lamp and monitoreduntil recovering fully from the procedure. No animals wereexposed to unreasonable pain or distress. Analgesia in the formof subcutaneous injections of Buprenorphine SR was adminis-tered as necessary based on routine veterinary care guidelines.Mice were monitored daily for the development of brain tumor–related deficits, including lack of coordination, lethargy, andcachexia.

Upon the development of tumor-related deficits in the firstanimal, all mice in the cohort were immediately euthanized byintraperitoneal injection of a lethal dose of Avertin (1 mg/10 gbody weight). The chest cavity was exposed by an incision abovethe diaphragm. A 22 G needle was inserted into the left ventriclefollowed by continued perfusion with 4% PFA/PBS. Brains werepostfixed overnight followed by experimental analyses. To com-pare the PTPN12-dependent size of tumors, FFPE brain sectionswere stainedwith hematoxylin and eosin. The cross-sectional areaof each tumor was measured at its largest point. Measurementsfrom at least five tumors were averaged from either condition. TheTCGA-based coincidental expression analysis for VCP andPTPN12 in GBM samples was performed using Project Betastasis(http://www.betastasis.com/). For quantitation of mitotic cancercells in control and PTPN12 KO tumor sections (n ¼ 3 differentmice per tumor type), randomly selected fields (n¼ 3 per section)in fixed paraffin-embedded brain sections were labeled with anti-pHH3 and anti-GFP. Percentages of pHH3þ/GFPþ cells per fieldwere quantified and plotted.

For subcutaneous tumor selection experiments, 5 � 105 U87GBM cells were implanted into the flank of NCR-nu/nu athymicmice (n ¼ 5) in a 100 mL suspension of growth factor–reducedMatrigel (BD Biosciences) and serum-free culture media asdescribed previously (22). To develop U87-bevR and -bevS

xenografts, five subcutaneous U87 tumors were treated withbevacizumab (10 mg/kg) or IgG from human serum (Sigma) forfour weeks. The largest tumor was extracted, dissociated, andthen reinjected subcutaneously (n ¼ 5 NCR-nu/nu mice), atwhich point the process was repeated two more times. Mice withtumors were monitored daily. Euthanasia occurred whenmice reached institutional euthanasia criteria (2.1 cm maximaldimension or tumor symptoms). The final tumor lysates collect-ed from bevacizumab-treated and IgG-treated mice represent theU87-bevR and U87-bevS xenografts, respectively.

AntibodiesImmunoblotting was performed on detergent-soluble lysates

using standard protocols. The following primary antibodies wereused: mouse anti-b-Actin antibody AC-15 (Abcam #ab6276,1:5000), chicken anti-GFP (Aves Labs GFP-1020, 1:5,000),anti-phosphotyrosine PY99 (Santa Cruz Biotechnology, sc-7020,1:1,000), rabbit-anti-GST (Novus Biologicals, NB600326,1:2,000), rabbit anti-Vcp (GeneTex GTX101089, 1:2,000), andmouse anti-ubiquitin (FK2Millipore 04-263, 1:800). The follow-ing antibodies were purchased from Cell Signaling Technology:anti-p130 Cas (#13846), anti-phospho-p130 Cas pY410(#4011), anti-FAK (#3285), anti-phospho-FAK pY397 (#8556),anti-phospho-FAK pY925 (#3284), anti-phospho-FAK pY576/577 (#3281, 1:1,000), FAK (BD810087), anti-paxillin pY118(2541S, 1:1,000), and rabbit anti-PTP-PEST (D4W7W,1:1,000), anti-EGFR (#4267, 1:1,000), anti-EGFR pY1068(#2234, 1:1,000), and pY992 (#2235, 1:1,000), anti-Her2(#2242, 1:500), and anti-Her2 pY1196 (D66B7, 1:1,000). Immu-noblots were overlaid with donkey anti-rabbit 800, donkey anti-mouse 680 secondary antibodies purchased from LI-COR Bios-ciences (1:10,000). Antibodies were added in blocking buffercomprising 3% BSA in Tris-buffered saline containing 0.1%Tween-20 (TBST). Immunofluorescence and IHC was performedon formalin-fixed paraffin-embedded (FFPE) tissue according tostandard protocols using the following primary antibodies: ratanti-mouse CD31 (BD Biosciences, 1:200), chicken anti-Nestin(Neuromics, 1:50), rabbit anti-GFAP (DAKO, 1:500), and rabbitanti-laminin (Sigma, 1:500), anti-PTP-PEST (Abcam, Ab76942,1:250), and rabbit anti-phospho-Histone H3 pSer10 (Cell Sig-naling Technology, 1:100). Donkey anti-chicken 488, Alexa-con-jugated goat anti-rabbit 488, goat anti-rabbit 594, and goat anti-mouse 594 secondary antibodies (1:500) were used. Antibodieswere incubated in blocking buffer comprising 1% BSA in PBScontaining 0.1% TritonX-100 (PBST).

Mass spectrometry experimentsSoluble GST-tagged recombinant PTP-PEST proteins from bac-

terial lysates were fractionated using glutathione-Agarose prior tomixing with detergent-soluble cell lysates as described previously(23). Glutathione-bound fractions were resolved on an SDSpolyacrylamide gel under reducing conditions. Control andexperimental bands were cut from the gel, and subjected to in-gel digestion with trypsin. Peptides were extracted and analyzedby LC/MS-MS. Peptides were resuspended in 2.5% formic acid(FA), 2.5% acetonitrile (MeCN), and were loaded using a MicroAS autosampler (Thermo Electron) onto amicrocapillary columnof 100 mm inner diameter packed with 12 cm of reversed-phaseMagic C18packingmaterial (5mm, 200Å;MichromBioresources,Inc.). SEQUEST matches were filtered by XCorr scores to a lessthan 1% false discovery rate when the control proteins were

PTP-PEST Regulates Focal Adhesion Dynamics in Glioma Cells

www.aacrjournals.org Cancer Res; 78(14) July 15, 2018 3811



http://www.betastasis.com/


eliminated and protein matches were required to have threespectralmatches, no identifiable false positive peptides remained.

CRISPR/Cas9 gene editing and siRNA transfectionsTo target PTPN12 using CRISPR/Cas9 methods three different

synthetic guide DNAs (gDNA) were designed using open sourceplatforms (http://crispr.mit.edu). The PTP-PEST guide DNAsequences are as follows: 4A2 (KO-1), 50-GAGCGCTATTGGC-CTTTGTA-30, and 5B2 (KO-2), 50-TCATCAAGAGGCAAGCGG-TC-30. 6C2 (KO-3), 50 GTAAGATCGGAATGGAGTGA 30. Thevector LentiCRISPR (Addgene, #57818) were digested usingBsmBI, and a pair of annealed oligos was cloned into the vectorto make lentivirus using 293 (F)T and infected target GSCs.Infected cells were selected by FACS based on GFP expressionand individual clones were screened. PTPN12 editing was con-firmed by immunoblotting and qRT-PCR. For quantitativeRT-PCR experiments, total RNA was extracted using the RNAeasyMini Kit (Qiagen) and 500 ng of RNA were reversed-transcribedusing SuperScript VILO Master Mix (Thermo Fisher Scientific).Primer sequences used for human PTP-PEST 50-AAATACTG-CAGCCACCGGAAC-30 and 50-GCAACACTGGCTTTGGATGG-30,for human VCP qRT-PCR reactions are 50-AATTGCAGTTGTT-CCGAGGT-30 and 50-TTGCCGTACTTCACATCAGG-30.

To silence VCP gene expression, LN229 GBM cells werecultured in 6-well plates until 50%–60% confluent. Cells weretransfected with targeting siRNAs or nontargeting controls at afinal concentration 50 nmol/L using Lipofectamine RNAiMAXaccording to the manufacturer's instructions. For transientsilencing of VCP the following siRNA sequences (Sigma) wereused: Duplex 1, 50-GAAUAGAGUUGUUCGGAAU-30 and 50-AUUCCGAACAACUCUAUUC-30; Duplex 2, 50-GGAGGUA-GAUAUUGGAAUU-30 and 50AAUUCCAAUAUCUACCUCC-30.The non-targeting control duplex was 50-UGGUUUACAUG-UCGACUAA-30 and 50-UUAGUCGACAUGUAAACCA-30. Theeffect of siRNA on cell viabilty was measured using the Cell-Titer-Glo luminescent cell viability assay kit according to themanufacturer's protocol. Briefly, at 24 hours after transfection,cells were collected and 5 � 103 cells were plated into 96-wellplates. At 48, 72, and 96 hours posttransfection respectively,CellTiter-Glo reagent was added to each well that containedculture medium. Plates were incubated at room temperature for10 minutes and the luminescence intensity was measured witha microplate reader.

Statistical analysesAll data represented herein were performed in replicates of

three or more and are presented as the mean � SD, unlessotherwise indicated. Differences among groups were analyzedusing one-way ANOVA. When overall analysis revealed signifi-cance among groups, means were compared and tested usingTukey post hoc analysis. Statistical significance was set at P < 0.05.All statistical analyses were performed in SigmaPlot 12.0 software(Systat Software, Inc.).

ResultsOncomine-based analysis for PTPN12 gene expression levels in

open source datasets, including transcriptome sequences fromGBM samples in The Cancer Genome Atlas (TCGA) and a large-scale cDNAmicroarray analysis ofGBMsamples, revealed approx-imately 2-fold higher amounts of PTPN12 mRNA in GBM tissueversus normal human brain tissue (Fig. 1A). In addition, querying

the IVY GBM Atlas Project revealed that PTPN12 gene expressionis spatially heterogeneous in different tumor samples. Mostnotably, invasive GBM regions expressed low levels of PTPN12mRNA versus core regions of the tumor or the intratumoralvasculature, which expressed higher levels of PTPN12mRNA (Fig.1B). Robust levels of PTP-PEST protein expression were detectedin detergent-soluble lysates collected from 10 of 11 freshlyresected GBM biopsies (Fig. 1C). Next, we used an anti-PTP-PESTantibody to label fixed tissue sections fromanormal humanbrainor from five different surgically resected GBM samples. All surgi-cally resected specimens were from patients with primary GBMthat had not received prior radiation or chemotherapy. As shownin Fig. 1D–I, PTP-PEST protein was expressed at higher levels inGBM samples versus the noncancerous brain. In all five GBMsamples analyzed, PTP-PEST protein was detected in tumor cellsas well as in vascular endothelial cells that comprise angiogenicGBM blood vessels. High levels of PTPN12 gene expression inpatients withGBMor low-grade glioma, correlatedwith a reducedsurvival at 3 and 5-yearmarks, based on analysis of Kaplan–Meierplots (Supplementary Fig. S1A and S1B).

Next, we analyzed levels of PTP-PEST protein in 9 differentprimary GSC preparations that were cultured from freshlyresected human tumor tissue (24). Human GSCs express theneural stem cell marker nestin and grow as neurosphere-likespheroids in serum-free media (Fig. 2A). GSCs implanted intothe brains of immunocompromised (NCR-nu/nu) mice generatedmalignant tumors that were well-vascularized and infiltrative (Fig.2B). The 9 GSCs analyzed expressed variable levels of PTP-PESTprotein (Fig. 2C). We selected GSC6-27 cells for more detailedfunctional analyses using Crisp/Cas9 gene editing, as these cellsexpressed robust levels of PTP-PEST protein and been reportedpreviously to generatemalignant brain tumors inmice (25). Selectclinical features of patient tumors used for isolation of GSC6-27cells and GSC7-2 cells are detailed in Supplementary Fig. S1C.GSC6-27 spheroids were infected with recombinant lentivirusesexpressing GFP and Cas9 (control lentivirus) or GFP and Cas9 incombination with guide RNAs (n ¼ 3) targeting different regionsof PTPN12. Cas9-mediated targeting of PTPN12 in GSC6-27 cellsresulted in a significant reduction in PTP-PEST protein expression,as determined by immunoblotting (Fig. 2D) and immunofluo-rescence (Fig. 2E and F). Analysis of viability and invasion revealedthat GSC6-27 cells lacking PTP-PEST (KO) showed reduced viability(Fig. 2G), but were significantly more invasive in comparison to"wild type" (WT) PTPN12-expressing control cells (Fig. 2H; Supple-mentary Fig. S2A–S2F).

Intracranial injection of control or KO GSCs led to the devel-opment of tumor-related neurologic deficits within 3 months, atwhich point all mice were sacrificed for comparative analyses.Control GSC6-27 cells that expressed PTP-PEST formed tumors inthe injected brain hemisphere (Fig. 3A–F) that displayed localizedpatterns of invasion (Fig. 3C and F; Supplementary Fig. S3A andS3B) as revealed bymonitoring tumor cells for expression of GFP.In contrast, tumors derived from PTPN12 KO GSCs were signif-icantly larger (Fig. 3G–L) and displayed more invasive behaviorsas evidenced by dispersive tumor cells in the contralateral hemi-sphere (Fig. 3I and L; Supplementary Fig. S3C and S3D). Moredetailed microscopic analyses of brains in xenograft mice byhematoxylin and eosin staining, IHC using a human-specificanti-vimentin antibody or double immunofluorescence stainingwith anti-GFP and anti-GFAP antibodies revealed significantlylarger and more invasive tumors generated from PTPN12

Chen et al.




http://crispr.mit.edu


KO GSCs versus control PTPN12-expressing GSCs, which dis-played more localized invasion (Fig. 3M–R). IHC analysis ofcontrol and PTPN12 KO brain tumor sections (GSC6-27) usingan antibody directed against PTP-PEST revealed significantlyreduced levels of PTP-PEST protein expression in KO tumorsversus control tumors (Supplementary Fig. S4A and S4B). Wealso utilized CRISPR/Cas9 methods in a second primary GSCpreparation (GSC7-2), which expresses PTP-PEST (Fig. 2C) andgenerates malignant tumors in the mouse brain (25). Consistentwith the GSC6-27 results, genetic deletion of PTPN12 in a secondGSC cell culture (GSC7-2) led to larger,more invasive intracranialtumors (Supplementary Fig. S5A–S5C).

On the basis of the in vitro viability and invasion data (Fig. 2),we hypothesized that the larger tumors generated by PTPN12KO GSCs in vivo were due to enhanced invasive growth beha-viors. Therefore, we analyzed proliferative capacities of controland PTP12 KO tumors by immunofluorescence labeling withantibodies recognizing histone H3 phosphorylated on Ser10(pHH3) and GFP to identify tumor cells in the mitotic stage ofthe cell cycle. PTPN12 KO GBM cells displayed similar rates ofproliferation as control cells (Supplementary Fig. S6A–S6C).Interestingly, comparison of tumor core regions by immuno-fluorescence staining for laminin, an abundant vascular base-ment membrane protein, revealed likely roles for tumor-expressed PTP-PEST in suppression of angiogenesis. While bothcontrol and PTPN12 KO tumors were well-vascularized, KOtumors contained abnormally large blood vessels with tortuous

and telangiectasia-like morphologies (Supplementary Fig. S7Aand S7B).

Patients treated with antiangiogenic agents such as the anti-VEGFneutralizing antibody bevacizumabdevelop drug resistancethat is frequently associated with robust GBM cell invasion(26, 27). We analyzed roles for PTP-PEST in GBM cell invasionfollowing treatment with bevacizumab using a xenograft mousemodel in which human U87 cell-derived tumors are selected foracquired resistance to bevacizumab (Supplementary Fig. S8A).Immunoblot analysis with a human-specific anti-PTP-PEST anti-body revealed robust levels of PTP-PEST protein in five differentcontrol (bevacizumab-sensitive) tumor samples. In contrast,three of five bevacizumab-resistant U87 tumor lysates showedreduced levels of PTP-PEST expression (Supplementary Fig. S8Band S8C).

CRISPR/Cas9 gene editing strategies were incomplete in poolsof GSCs, as low levels of PTP-PEST protein were detected (Fig.2D). Therefore, we performed selection experiments to identifyGSC clones that displayed complete loss of PTP-PEST protein.Single GSCs were sorted based on GFP expression, deposited intoindividual wells of a 96-well plate, and allowed to grow as clonalspheroids in serum-free media. Protein lysates from expandedclones were then analyzed for PTPN12 expression by anti-PTP-PEST immunoblotting. In comparison with Cas9 controls, someclones expressingCas9 and guideRNAs showed complete absenceof PTP-PEST protein, whereas other clones expressed comparablelevels of PTP-PEST (Supplementary Fig. S9A–S9C). Quantitation

Figure 1.

PTP-PEST expression is upregulated in human GBM. A, Oncomine summary of two independent whole transcriptome datasets comparing PTPN12 mRNA levels innoncancerous human brain samples versus primary GBM samples. B, Differential expression of PTPN12 mRNA in various intratumoral regions based on analysisof the IVY GBM Atlas Project. Note that PTPN12 levels are lowest in invasive and infiltrating regions. C, Comparative immunoblot analyses of PTP-PESTprotein expression in 11 different detergent-soluble lysates from freshly resected humanGBMsamples.D–I,Characterizationof PTP-PESTprotein expression patternsin the noncancerous human brain (D) and in five different human GBM tissue sections (E–I) using an anti-PTP-PEST antibody. Scale bars, 50 mm.






of isolated clones did not reveal an essential role for PTPN12 inGSC self-renewal based on numbers of spheres formed (Supple-mentary Fig. S9D). Finally, in support of the tumor data for theGSC pools (Figs. 2 and 3), PTPN12 KO cell clones (GSC6-27)generated larger brain tumors in vivo with prominent invasivegrowth features (Supplementary Fig. S10A–S10F).

We next performed biochemical analyses of control andPTPN12 KO GSC6-27 cells. As shown in Fig. 4A, immunoblotsof detergent-soluble PTPN12 KO lysates revealed high levels ofphosphotyrosine-containing proteins in comparisonwith controlcell lysates. Immunofluorescence analysis of adherent PTPN12KO cells also showed elevated levels of phosphotyrosine-contain-ing proteins within cell–ECM attachment points (Fig. 4B and C),

suggesting hyperphosphorylation of PTP-PEST protein substrates.To identify and characterize PTP-PEST–regulated signaling path-ways in GSCs, we performed a substrate-trapping screen. Thisstrategy involves the use of a GST-tagged wild-type PTP-PESTcatalytic domain (GST-WT) or a catalytic domain containing aC231S point mutation (GST-C/S) that reduces enzymatic activ-ities (23). Substrates that bind to wild-type PTP-PEST protein aredephosphorylated, dissociate from the enzyme, and are notdetected in the bound pull-down fraction, whereas substratesthat interact with the mutant PTP-PEST protein are not rapidlydephosphorylated and remain in the bound fractions. In com-parison with the GST control protein or the GST-WT recombinantprotein (Fig. 4D), the GST-C/S protein bound to multiple

Figure 2.

Genetically inhibiting PTP-PEST expression in human GSCs leads to enhanced invasion in vitro. A and B, GSCs express the neural stem cell protein nestin andgrow as free-floating spheroids in serum-free media (A). B, GSCs generate well-vascularized and invasive tumors after injection into the mouse brain. Left,arrows identify invasive GBM cells within white matter of the corpus callosum. Scale bars, 50 mm. H&E, hematoxylin and eosin. C, Comparative immunoblotshowing PTP-PEST protein expression in detergent-soluble lysates from 9 different primary GSC cultures. D, Anti-PTP-PEST immunoblot confirming CRISPR/Cas9gene editing strategies to delete PTPN12 in GSC6-27 cells. Controls cell pools were generated with pLentiCRISPR lentivirus expressing GFP and Cas9 withouttargeting gDNAs, whereas KO cell pools were generated using lentivirus expressing GFP, Cas9, and gDNAs targeting three different regions of PTPN12.E and F, Adherent control (E) and PTPN12 KO GSC6-27 (F) cells were labeled with anti-PTP-PEST and anti-GFP antibodies and visualized with fluorescentsecondary antibodies. Scale bars, 20 mm. G, Control and PTPN12 KO GSC6-27 spheroids were analyzed for viability over four days in vitro. Note that in comparisonto control GSC spheroids, PTPN12 KO-1 spheroids show diminished viability (�� , P < 0.001). Similar results were found with the PTPN12 KO-2 cells. H, Analysisof invasive capacities of control and PTPN12 KO GSC6-27 cells. PTPN12 KO-2 spheroids were dissociated and three-dimensional cell invasion through Matrigeltranswell assays, revealing increased invasion in cells with low levels of PTPN12 gene expression (�� , P < 0.001).

Chen et al.





tyrosine-phosphorylated substrates from GSC lysates (Fig. 4E).Next, we used GST-WT and GST-C/S recombinant proteins andfractionated interacting substrates from GSC6-27 lysates. Silver-stained SDS gels revealed several protein bands that interactedpreferentially with GST-C/S PTP-PEST versus GST-WT PTP-PESTprotein or the GST control protein (Fig. 4F). Therefore, excisedbands from silver-stained gels were enzymatically digested andanalyzed by mass spectrometry, revealing human peptidesequences that bound preferentially to the GST-C/S PTP-PEST(Supplementary Table S1). The two major PTP-PEST substratesidentified by mass spectrometry (based on total number ofpeptides with unique sequences) were human Vcp/p97 andCas/Bcar1.

PTP-PEST binding to Cas and Vcp was next confirmed by pull-down experiments with recombinant GST-C/S protein (Fig. 5A).We also confirmed multiprotein complex formation betweenPTP-PEST, Cas, andVcp by coimmunoprecipitating these proteinsfrom detergent-soluble WT and KO GSC6-27 lysates using dif-ferent antibody combinations (Fig. 5B–E). Notably, interactionsbetween Cas and Vcp were not detected in KO lysates, revealingthat PTP-PEST is necessary to effectively bridge Vcp and Cas inGSCs. Use of PTPN12 KO cells also supports the specificity of theanti-PTP-PEST antibody. Analysis of Vcp binding to phosphory-lated Cas revealed reduced interactions in PTPN12 KO cells (Fig.5F). Furthermore, we detected tyrosine hyperphosphorylation ofVcp in PTPN12 KO cells (Fig. 5F). In comparison with controlGSC6-27 cells, PTPN12 KO cell lysates contained significantlyhigher levels of Cas phosphorylated on tyrosine 410 (Fig. 5G).Increased levels of other tyrosine phosphorylated focal adhesioncomponents, including FAK and paxillin, were also detected inPTPN12 KO cells, as revealed by immunoblotting with phospho-specific antibodies (Fig. 5G). Immunofluorescence analyses

revealed elevated levels of total paxillin protein with enrich-ment at the leading edge of PTPN12 KO GSCs (Supplement-ary Fig. S11A–S11F), supporting possible roles for PTP-PESTin regulating focal adhesion substrate phosphorylation and/orfocal adhesion protein stability. Prior reports have shown thatPTP-PEST mediates the dephosphorylation of various receptortyrosine kinases to suppress their signaling capacities in breastcarcinoma cells (28). We analyzed the phosphorylation statusof EGFR and Her2/ErbB2, two receptor tyrosine kinases withestablished roles in GBM initiation and progression. As shownin Fig. 5H, increased tyrosine phosphorylation of these proteinswas detected in PTPN12 KO cells versus control cells.

Src phosphorylates Vcp at Y805 and this impacts interactionswithother proteins (20). Therefore, we generatedpointmutationsat Vcp Y805 that would block tyrosine phosphorylation (Y805F)or partially mimic phosphorylation (Y805E). Coimmunopreci-pitation experiments confirmed that full-length PTP-PEST inter-acts with Vcp, with the Y805E phosphomimetic diminishinginteractions between PTP-PEST and Cas (Fig. 6A). There werealso differences in the subcellular distribution of EGFP-taggedVcpproteins, with the Y805E-mutant protein showing enriched local-ization at cell–ECM contacts, likely representing focal adhesions(Fig. 6B). Analysis of subcellular localization of endogenousVcp protein by immunofluorescence also revealed expressionthroughout control and PTPN12 KO cells. Interestingly, inPTPN12 KO cells we detected possible enrichment of Vcp atcell-ECM attachment points (Supplementary Fig. S12A, B).

The C-terminal domain of Vcp interacts with various proteinsinvolved in segregating ubiquitinated substrates for degradationby the proteasome (18), and these interactions can bemodulatedvia phosphorylation of Y805 (20). Therefore, we analyzed levelsof ubiquitinated proteins in cells expressing EGFP-tagged wild-

Figure 3.

PTP-PEST suppresses GBM cell invasive growth in vivo. A–L, Representative images of coronal sections from two different mouse brains harboring intracranialtumors derived from control (A–F) or PTPN12 KO-1 GSC6-27 cell pools (G–L). Note that control GSCs expressing PTP-PEST generate diffuse tumorsthat show localized patterns of invasion. In contrast, GSCs that lack PTP-PEST generate significantly larger tumors displaying robust patterns ofinvasion, with many GFP-expressing cells dispersing into the contralateral hemisphere. Images in top and middle panels are of freshly cut brainsections. Images in bottom panels are of anti-GFP immunofluorescence stains of vibratome-sectioned brains. M–R, Coronal brain sections containingtumors generated from GSC6-27 control cells (M–O) or PTPN12 KO-1 cells (P–R) were stained with hematoxylin and eosin (H&E; M and P), anti-vimentinantibody (N and Q), or anti-GFP and anti-GFAP antibodies in combination (O and P). Note that PTPN12 KO-1 cell pools generate significantly largerand more invasive intracranial brain tumors, as compared with control tumors that had more defined margins (dashed lines in N and O). PTPN12 KOtumors lack clearly defined margins due to their more dispersive behaviors.






type Vcp, Y805F, or Y805E-mutant proteins. Expression of wild-type Vcp or Y805F resulted in similar levels of ubiquitin-contain-ing proteins, whereas cells expressing Vcp Y805E showed anoticeable increase in ubiquitinated proteins (Fig. 6C). Next, weused siRNAs to transiently silence VCP gene expression in LN229human GBM cells, which form invasive brain tumors in vivo (21).A significant reduction in Vcp gene expression was confirmed byquantitative RT-PCR with primers specific for VCP, as well as byimmunoblotting detergent-soluble lysates with anti-Vcp antibo-dies (Fig. 6D). Interestingly, silencing Vcp expression correlatedwith reduced levels of tyrosine phosphorylated Cas and paxillin,

although the total levels of these proteins were not impacted (Fig.6D). Vcp has been shown to bind to multiple ubiquitinatedtargets and direct them for degradation via the proteasome. Alongthese lines, we detected increased levels of ubiquitinated proteinsin siRNA-transfected GBM cells lacking VCP expression (Fig. 6E),similar to levels detected after expressing the Vcp Y805E phos-phomimetic protein (Fig. 6C). Consistent with the reduced levelsof phosphorylated focal adhesion proteins and increased ubiqui-tination, RNAi-mediated silencing of VCP resulted in impairedinvasion as quantified in Matrigel transwell assays (Fig. 6F) anddiminished LN229 GBM cell viability (Fig. 6G).

Figure 4.

A substrate trapping screen to identify PTP-PEST protein substrates in GBM cells. A, Detergent-soluble lysates from control and PTPN12 KO GSC6-27 cells wereimmunoblotted with an anti-phosphotyrosine antibody, revealing increased levels of tyrosine phosphorylated proteins in KO-1 cells. B and C, Control cells(B) and PTPN12 KO GSC6-27 cells (C) were immunofluorescently labeled with anti-phosphotyrosine (red) and anti-GFP (green) antibodies. Scale bars, 20 mm.D, Anti-GST immunoblot showing expression of GST-tagged wild-type and mutant (C231S) PTP-PEST recombinant proteins purified from bacteria. E, Detergent-soluble lysates from control and PTPN12 KO-1 cells (GSC6-27) were incubated with recombinant GST-tagged wild-type and mutant (C231S) PTP-PESTprotein constructs. Interacting proteins were identified by anti-phosphotyrosine immunoblotting. F, Silver-stained gel showing protein bands that differentiallyinteract with GST-tagged wild-type PTP-PEST versus catalytically inactive (C231S) PTP-PEST protein. Detergent-soluble lysates from GSC6-27 cells wereused for the substrate-trapping screen.

Chen et al.





Figure 5.

PTP-PEST forms a multiprotein complex with Cas and Vcp in GBM cells. A, Pull-down experiments with GST-tagged PTP-PEST proteins (WT and C/S) revealinteractions with Vcp and Cas in detergent-soluble GSC lysates. B and C, Lysates from GSC6-27 control or PTPN12 KO-1 cells were immunoprecipitatedwith anti-PTP-PEST antibodies and resolved lysates were immunoblotted to analyze protein–protein interactions. Note that Cas (B) and Vcp (C) proteins interact incontrol lysates but not in PTPN12 KO lysates, as revealed by coimmunoprecipitation. D and E, Detergent-soluble lysates from GSC6-27 control or PTPN12KO-1 cellswere immunoprecipitatedwith anti-Vcp (D) or anti-Cas (E) antibodies and resolved lysateswere immunoblotted to analyze protein-protein interactions.F,Tyrosine phosphorylated Cas protein or total cellular phosphotyrosine-containing proteins were immunoprecipitated from control or PTPN12 KO GSC6-27cells and Vcp interactions were analyzed by immunoblotting with anti-Vcp antibodies. Note that in comparison with control cells, Vcp is hyperphosphorylated inPTPN12 KO-1 cells, but also shows reduced interactions with phosphorylated Cas. G, Detergent-soluble lysates from control (n ¼ 2) and PTPN12 KO GSC6-27cells (n ¼ 2) were immunoblotted for phosphorylated Cas and other phospho-specific antibodies recognizing common focal adhesion proteins such asFAK and paxillin. H, Control and PTPN12 KO GSC6-27 cell lysates were immunoblotted for total EGFR, total Her2/ErbB2, or specific cytoplasmic domainphosphorylated sites on each protein. Note the increased levels of EGFR and Her2/ErbB2 tyrosine phosphorylation in PTPN12 KO GSCs.






Analysis of fixed human tissue sections by IHC labeling withanti-Vcp antibodies revealed elevated levels of Vcp protein inhuman GBM cells in fixed tissue sections versus noncanceroushuman brain tissue (Fig. 7A–D). Interestingly, comparisons ofVCP versus PTPN12 mRNA expression levels in microdissectedtumor regions (IVY GBM Atlas Project) revealed an inverse rela-tionship between the two genes in GBM cells, but not in intra-tumoral blood vessels (Fig. 7E). GBM cells in proliferative zonesexpressed higher levels of PTPN12 and low levels of VCP, whereasGBMcells at the invasivemargins expressed lowPTPN12 andhighVCP. These results are consistent with our analyses of GSCs andtumor invasiveness in preclinical animal models. To furtherestablish links between Vcp and GBM cell focal adhesion dynam-ics, we used CB-5083, a pharmacologic inhibitor of Vcp ATPaseactivities (29). Treatment of LN229 GBM cells with of CB-5083resulted in a significant increase in ubiquitinated proteins and areduction in total cellular tyrosine phosphorylated proteins(Fig. 7F and G). Analysis of focal adhesion proteins revealed thatVcp inhibition with CB-5083 resulted in a reduction in thephosphorylation of Cas and Paxillin and this correlated withreduced expression of PTP-PEST (Fig. 7H). A major reduction inexpression of total FAK and phosphorylation of FAK at Y925 wasdetected following CB-5083 treatment. Interestingly, expressionof PTP-PEST was also reduced in CB-5083–treated cells. In

contrast, Vcp protein levels were not impacted in cells treatedwith CB-5083. Finally, in cells we detected PTPN12-dependentsensitivity to CB-5083. As shown in Fig. 7I, high concentrations ofCB-5083 impacted the viability of control cells (IC50¼ 5mmol/L),whereas PTPN12 KO cells showed significantly reduced viabilityatmuch lower concentrations of CB-5083 (IC50¼ 0.937 mmol/L).Collectively, these genetic and pharmacologic data reveal thatPTP-PEST in GBM cells precisely balances focal adhesion assem-bly and disassembly via regulation of the phosphorylation statusof Vcp and key focal adhesion and cytoskeletal proteins such asCas. These regulatory mechanisms control the stability of focaladhesion proteins such as Cas via phosphorylation-mediatedubiquitination, which balances GBM cell viability and growthversus invasion (Fig. 7J and K).

DiscussionThere is precedent for the ubiquitin proteasome system in the

regulation of cell–ECM adhesion and signaling dynamics. Forexample, SOCS7, an SH2 domain–containing component ofCullin-5 E3 ubiquitin ligase complex (CRL5), promotes degra-dation of FAK (30). In addition, the E3 ligase Trim15 bindsto paxillin and promotes focal adhesion disassembly (31). Deg-radation of Cas in focal adhesions via SOCS6 and CRL5 is

Figure 6.

PTP-PEST–dependent phosphorylation of Vcp at Y805 regulates interactions with Cas and impacts protein ubiquitination in GSCs. A, GST pull-downexperiments reveal that PTP-PEST C/S protein interacts with Vcp independently of Y805 phosphorylation status. HEK-293T cells were transientlytransfected with plasmids expressing Flag-tagged PTP-PEST in combination EGFP-tagged wild-type Vcp or Vcp mutant constructs containing Y805F orY805E point mutations. Note that expression of the VcpY805E phosphomimetic point mutation leads to reduced interactions between Vcp andphosphorylated Cas. B, LN229 cells were transfected with plasmids expressing EGFP-tagged wild-type Vcp or EGFP-Vcp constructs containing Y805F orY805E point mutations. Anti-GFP immunofluorescence revealed that wild-type and Y805F proteins display diffuse intracellular expression, whereas theY805E protein shows enriched localization in focal adhesions. Scale bars, 20 mm. C, Detergent-soluble lysates from cells transiently expressing eitherEGFP-tagged wild-type Vcp, Vcp Y805F, or Vcp Y805E proteins were analyzed for total ubiquitination levels by immunoblotting with anti-ubiquitinantibodies after pretreatment with the proteasome inhibitor MG132. Note that overexpression of the Vcp Y805E phosphomimetic-mutant protein leadsto higher levels of ubiquitinated cellular proteins, similar to the nontransfected control cells. D and E, Transient RNAi-mediated targeting of VCP geneexpression in LN229 GBM cells using two different siRNAs. F and G, Transiently silencing VCP expression using two different transfected siRNAsleads to diminished LN229 GBM cell invasion (F) and growth (G) in vitro.

Chen et al.





Figure 7.

PTPN12 and VCP gene expression are inversely correlated with GBM cell invasive behaviors.A–D, Fixed normal human brain (A) or human GBM (B–D) sections wereimmunolabeled with anti-Vcp antibodies. Note the increased expression of Vcp protein in GBM cells of the tumor core in comparison with the noncancerousbrain region. Scale bars, 50 mm. E,Querying the IVYGBMAtlas Project revealed inverse expression of PTPN12 andVCPmRNA levels in variousGBM regions, includingthe invasive front. Notably, in comparisonwith intratumoral blood vessels, invasive GBM cells express significantly lower levels of PTPN12mRNA and higher levels ofVCP. F and G, Detergent-soluble lysates from LN229 GBM cells treated with DMSO or 0.4 mmol/L CB-5083 were immunoblotted with anti-ubiquitin (F)or anti-phosphotyrosine antibodies (G). Note that treatment with CB-5083 leads to higher levels of ubiquitinated proteins, but lower levels of tyrosinephosphorylated proteins. H, LN229 GBM cell lysates were immunoblotted with antibodies recognizing specific focal adhesion proteins. Note the decreased levels ofCas, paxillin, and FAK tyrosine phosphorylation in cells treatedwith CB-5083. In addition, CB-5083 treatment leads to decreased levels of total PTP-PEST expression,but Vcp protein expression levels are not impacted. I, Analysis of survival in control and PTPN12 KO LN229 GBM cells treated with varying concentrations ofCB-5083. In contrast to control cells (IC50¼ 5mmol/L), note that PTPN12KOcells aremore sensitive toCB-5083 (IC50¼0.937mmol/L; � ,P¼0.03; �� ,P<0.001). J andK, Illustrative model showing that GBM cells with high levels of PTP-PEST are more proliferative (J). PTP-PEST interacts with Vcp (shown as a monomer) andubiquitinated and phosphorylated Cas (pY-Cas-Ubiq) in focal adhesions (blue hexagons), leading to Vcp-mediated Cas protein segregation and degradation via theUPS. As a result, there is balanced focal adhesion assembly and disassembly, leading to more viable and less invasive cells. K, In GBM cells that express lowlevels of PTP-PEST, interactions between Vcp and pY-Cas-Ubiq are impaired, due in part to hyperphosphorylation at Vcp Y805 and altered phosphodegrons inCas and probably other proteins. This leads to increased FA disassembly and robust tumor cell invasion in vivo.






involved in Src-dependent cell transformation (32) andmigration(33). Our data showing that PTP-PEST couples protein phos-phorylation and ubiquitination are consistent with these priorreports, and suggest that PTP-PEST control of Vcp segregaseactivities is an additional regulatory step to control focaladhesion dynamics by selectively targeting Cas for degradationby the proteasome. Cas contains a substrate binding domaincomprised of amino acids approximately 100–450, whichcontains 15 YxxP motifs that are phosphorylated by Src (34)that is involved in the recruitment of various SH2 domain-containing proteins. Cells expressing mutant Cas that lack all15 tyrosine phosphorylation sites (Y-F mutations) displaydefects in migration, but not proliferation (35). In epithelialcells, mutant Cas protein that lacks these Src phosphorylationmotifs is resistant to degradation by the Cul5SOCS6 E3 ligasecomplex (33). We propose that PTP-PEST-mediated dephos-phorylation of Cas creates phosphodegrons that lead to addi-tional posttranslational modifications via recruited ubiquitinligase complexes. Vcp subsequently segregates Cas from focaladhesions and targets it to the proteasome for destruction.

The substrate trapping screen was performed with the iso-lated catalytic domain of PTP-PEST, revealing that this regionalone can interact with Cas. However, it is likely that the SH3domain of Cas is also important for interactions with proline-rich region of PTP-PEST based on a previous substrate trappingscreen (36) as well as a more recent structural study showingthat the isolated SH3 domain of Cas binds to PTP-PEST (37).Interactions between Vcp and PTP-PEST may also impactPTP-PEST functions; indeed, we detect reduced phosphorylatedlevels of the PTP-PEST substrates Cas and Paxillin in GBM cellsthat lack Vcp expression, suggesting that Vcp may normallysuppress PTP-PEST enzymatic activities. However, silencingVCP in GBM cells does not impact total PTP-PEST proteinlevels. We have discovered an inverse relationship betweenVCP and PTP-PEST mRNA levels in different GBM regions,suggesting that PTPN12 and VCP expression in GBM regionsmay be linked to gene regulatory events. While we have char-acterized these signaling links in GBM cells, it is likely thattyrosine phosphorylation-mediated regulation of Vcp occurs inother cell types, and may actually be a general regulatorymechanism during cell migration. For example, a substrate-trapping screen using Ewing sarcoma cells identified Vcp as asubstrate of PTPN13/PTPL1, with Y805 as the major site ofdephosphorylation (38). However, the functional significanceof the PTPL1–Vcp interaction was not elucidated.

While we have focused on GBM cell–intrinsic regulatorymechanisms underlying PTP-PEST control of invasion, thereare extracellular cues that activate and inhibit PTP-PEST func-tions. For example, we have reported that the adhesion receptorb8 integrin is upregulated in invasive GBM cells and drivestumor cell invasion along blood vessels. In cultured neuro-blasts we have found that b8 integrin is necessary for locali-zation of a fraction of PTP-PEST protein to the leading edge(39). However, when we use RNAi strategies to inhibit b8integrin gene expression in GBM cells or fractionate cancercells that lack endogenous b8 integrin from resected GBMsamples (40, 41), tumor invasion in the mouse brain is dimin-ished. This is in contrast to inhibition of PTP-PEST, which leadsto enhanced GBM cell invasion. b8 integrin interacts with cellsurface receptors such as Nrp1 to regulate ECM adhesion(22, 42) and intracellular proteins such as RhoGDI1 and

Spinophilin to control Rac1/Cdc42 signaling and actin dynam-ics to promote migration and invasion (21, 43). Hence, it islikely that integrin signaling via PTP-PEST suppresses GBM cellinvasion, whereas interactions with RhoGDI1 and Spinophilinpromote cell invasion. PTP-PEST is also reported to have tumorsuppressor–like functions in breast cancer via negative regula-tion of HER2/ErbB2 signaling (28), with loss of PTPN12expression leading to enhanced tumor cell growth, migration,and survival (44). In hepatocellular carcinoma, downregula-tion of PTPN12 expression also enhances tumor growth viaincreased RTK signaling and increased ubiquitin proteasome–related activities (45). In contrast to these studies of epithelialcell–derived carcinomas, our data for PTPN12 in gliomas,which are mainly derived from neural stem cells, reveals thatit suppresses migration/invasion but promotes growth andviability, with PTPN12 KO cells showing increased motilitybut diminished growth and survival, even though EGFR andHer2 are hyperphosphorylated. Hence, we propose thatPTPN12 has cell type–specific roles in differentially regulatinggrowth, survival, and migration. Alternatively, in PTPN12 KOGBM cells, cross-talk between receptor tyrosine kinases and b8integrin or other receptors may be altered, leading to reducedgrowth/viability, but enhanced invasion.

The ubiquitin proteasome system is deregulated in GBM,with elevated expression of key proteasome components andincreased enzymatic activities, which likely provide growth andsurvival advantages to tumor cells (46). Treatment with borte-zomib/velcade (47) or the related compound carfilzomib (48),which both bind and inhibit the core catalytic site of the 26Sproteasome, leads to diminished GBM cell proliferation andinvasion. Unfortunately, bortezomib in combination withtemozolomide has shown limited clinical efficacy in patientswith recurrent GBM (49). Additional components of the ubi-quitin proteasome system, such as Vcp, are also attractivetargets for therapy. For example, CB-5083 induces the accu-mulation of ubiquitinated peptides in tumor cells, resulting inproteotoxic crisis and apoptosis. Given our discovery of impor-tant functions for Vcp in phosphorylation-dependent ubiqui-tination of key focal adhesion proteins, targeting Vcp or itsregulatory effectors with specific small-molecule inhibitors mayprove beneficial for blocking tumor cell–invasive growth inpatients with GBM.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: Z. Chen, J.H. McCartyDevelopment of methodology: Z. Chen, P.A. Guerrero, J.H. McCartyAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): Z. Chen, J.E. Morales, J.H. McCartyAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): Z. Chen, H. Sun, J.H. McCartyWriting, review, and/or revision of the manuscript: Z. Chen, J.H. McCartyAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): Z. Chen, J.E. Morales, H. Sun, J.H. McCartyStudy supervision: Z. Chen, J.H. McCarty

AcknowledgmentsWe thank Dr. David Hawk for technical assistance with mass spectrometry

analyses, Dr. Jordan Toutounchian for assistance with figure compilation,and Dr. Manish Aghi for providing the U87 xenograft lysates. J.H. McCartyreceived grant support from NIH/NINDS (R01NS07635, R01NS078402, and


Chen et al.




R21NS085688), Cancer Prevention and Research Institute of Texas(RP140411), and NIH/NCI (P50CA127001).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby marked

advertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received January 8, 2018; revised April 3, 2018; accepted May 7, 2018;published first May 9, 2018.

References1. Louis DN. Molecular pathology of malignant gliomas. Ann Rev Pathol

2006;1:97–117.2. Batchelor TT, Reardon DA, de Groot JF, Wick W, Weller M. Antiangiogenic

therapy for glioblastoma: current status and future prospects. Clin CancerRes 2014;20:5612–9.

3. Sirois J, Cote JF, Charest A, Uetani N, Bourdeau A, Duncan SA, et al.Essential function of PTP-PEST during mouse embryonic vascularization,mesenchyme formation, neurogenesis and early liver development. MechDev 2006;123:869–80.

4. Li H, Yang F, Liu C, Xiao P, Xu Y, Liang Z, et al. Crystal Structure andSubstrate Specificity of PTPN12. Cell Rep 2016;15:1345–58.

5. Jamieson JS, Tumbarello DA, Halle M, Brown MC, Tremblay ML, TurnerCE. Paxillin is essential for PTP-PEST-dependent regulation of cellspreading and motility: a role for paxillin kinase linker. J Cell Sci2005;118:5835–47.

6. Sastry SK, Lyons PD, Schaller MD, Burridge K. PTP-PEST controls motilitythrough regulation of Rac1. J Cell Sci 2002;115:4305–16.

7. Sun Z, Guo SS, Fassler R. Integrin-mediated mechanotransduction. J CellBiol 2016;215:445–56.

8. Devreotes P, Horwitz AR. Signaling networks that regulate cell migration.Cold Spring Harbor Perspect Biol 2015;7:a005959.

9. Kleinschmidt EG, Schlaepfer DD. Focal adhesion kinase signaling inunexpected places. Curr Opin Cell Biol 2017;45:24–30.

10. Tikhmyanova N, Little JL, Golemis EA. CAS proteins in normal andpathological cell growth control. Cell Mol Life Sci 2010;67:1025–48.

11. Deneka A, Korobeynikov V, Golemis EA. Embryonal Fyn-associated sub-strate (EFS) and CASS4: The lesser-known CAS protein family members.Gene 2015;570:25–35.

12. Sawada Y, Tamada M, Dubin-Thaler BJ, Cherniavskaya O, Sakai R, TanakaS, et al. Force sensing by mechanical extension of the Src family kinasesubstrate p130Cas. Cell 2006;127:1015–26.

13. WebbDJ, Donais K,Whitmore LA, Thomas SM, Turner CE, Parsons JT, et al.FAK-Src signalling through paxillin, ERK and MLCK regulates adhesiondisassembly. Nat Cell Biol 2004;6:154–61.

14. Cooper JA, Kaneko T, Li SS. Cell regulation by phosphotyrosine-targetedubiquitin ligases. Mol Cell Biol 2015;35:1886–97.

15. Komander D, Rape M. The ubiquitin code. Ann rev Biochem 2012;81:203–29.

16. Yamanaka K, Sasagawa Y, Ogura T. Recent advances in p97/VCP/Cdc48cellular functions. Biochim Biophys Acta 2012;1823:130–7.

17. Banerjee S, Bartesaghi A, Merk A, Rao P, Bulfer SL, Yan Y, et al. 2.3 Aresolution cryo-EM structure of human p97 and mechanism of allostericinhibition. Science 2016;351:871–5.

18. Richly H, Rape M, Braun S, Rumpf S, Hoege C, Jentsch S. A series ofubiquitin binding factors connects CDC48/p97 to substrate multiubiqui-tylation and proteasomal targeting. Cell 2005;120:73–84.

19. Madsen L, Seeger M, Semple CA, Hartmann-Petersen R. New ATPaseregulators–p97 goes to the PUB. Int J Biochem Cell Biol 2009;41:2380–8.

20. Li G, Zhao G, Schindelin H, Lennarz WJ. Tyrosine phosphorylation ofATPase p97 regulates its activity during ERAD. Biochem Biophys ResCommun 2008;375:247–51.

21. Reyes SB, Narayanan AS, Lee HS, Tchaicha JH, Aldape KD, Lang FF, et al.alphavbeta8 integrin interacts with RhoGDI1 to regulate Rac1 and Cdc42activation and drive glioblastoma cell invasion. Mol Biol Cell 2013;24:474–82.

22. Kwiatkowski SC, Guerrero PA, Hirota S, Chen Z, Morales JE, Aghi M, et al.Neuropilin-1 modulates TGFbeta signaling to drive glioblastoma growthand recurrence after anti-angiogenic therapy. PLoS One 2017;12:e0185065.

23. Blanchetot C, Chagnon M, Dube N, Halle M, Tremblay ML. Substrate-trapping techniques in the identification of cellular PTP targets. Methods2005;35:44–53.

24. Wei J, Barr J, Kong LY, Wang Y, Wu A, Sharma AK, et al. Glioma-associatedcancer-initiating cells induce immunosuppression. Clin Cancer Res2010;16:461–73.

25. Bhat KPL, Balasubramaniyan V, Vaillant B, Ezhilarasan R, Hummelink K,Hollingsworth F, et al. Mesenchymal differentiation mediated by NF-kappaB promotes radiation resistance in glioblastoma. Cancer Cell 2013;24:331–46.

26. Jahangiri A, De Lay M, Miller LM, Carbonell WS, Hu YL, Lu K, et al. Geneexpression profile identifies tyrosine kinase c-Met as a targetable mediatorof antiangiogenic therapy resistance. Clin Cancer Res 2013;19:1773–83.

27. Lu KV, Chang JP, Parachoniak CA, Pandika MM, Aghi MK, Meyronet D,et al. VEGF inhibits tumor cell invasion and mesenchymal transitionthrough a MET/VEGFR2 complex. Cancer Cell 2012;22:21–35.

28. Sun T, Aceto N, Meerbrey KL, Kessler JD, Zhou C, Migliaccio I, et al.Activationofmultiple proto-oncogenic tyrosine kinases in breast cancer vialoss of the PTPN12 phosphatase. Cell 2011;144:703–18.

29. Blythe EE, Olson KC, Chau V, Deshaies RJ. Ubiquitin- and ATP-dependentunfoldase activity of P97/VCP�NPLOC4�UFD1L is enhanced by a muta-tion that causes multisystem proteinopathy. Proc Nat Acad Sci U S A2017;114:E4380–E8.

30. Liu E, Cote JF, Vuori K. Negative regulation of FAK signaling by SOCSproteins. EMBO J 2003;22:5036–46.

31. Uchil PD, Pawliczek T, Reynolds TD, Ding S, Hinz A, Munro JB, et al.TRIM15 is a focal adhesion protein that regulates focal adhesion disas-sembly. J Cell Sci 2014;127:3928–42.

32. Teckchandani A, LaszloGS, Simo S, ShahK, Pilling C, Strait AA, et al. Cullin5 destabilizes Cas to inhibit Src-dependent cell transformation. J Cell Sci2014;127:509–20.

33. Teckchandani A, Cooper JA. The ubiquitin-proteasome system regulatesfocal adhesions at the leading edge of migrating cells. eLife 2016;5:pii:e17440.

34. Reynolds AB, Kanner SB, Bouton AH, Schaller MD, Weed SA, Flynn DC,et al. SRChing for the substrates of Src. Oncogene 2014;33:4537–47.

35. Patwardhan P, Shen Y, Goldberg GS, Miller WT. Individual Cas phos-phorylation sites are dispensable for processive phosphorylation by Srcand anchorage-independent cell growth. The J Biol Chem 2006;281:20689–97.

36. Cote JF, Charest A, Wagner J, TremblayML. Combination of gene targetingand substrate trapping to identify substrates of protein tyrosine phospha-tases using PTP-PEST as a model. Biochemistry 1998;37:13128–37.

37. Gemperle J, Hexnerova R, Lepsik M, Tesina P, Dibus M, Novotny M, et al.Structural characterization of CAS SH3 domain selectivity and regulationreveals new CAS interaction partners. Sci Rep 2017;7:8057.

38. Abaan OD, Hendriks W, Uren A, Toretsky JA, Erkizan HV. Valosin contain-ing protein (VCP/p97) is a novel substrate for the protein tyrosine phos-phatase PTPL1. Exp Cell Res 2013;319:1–11.

39. Lee HS, Cheerathodi M, Chaki SP, Reyes SB, Zheng Y, Lu Z, et al. Proteintyrosine phosphatase-PEST and beta8 integrin regulate spatiotemporalpatterns of RhoGDI1 activation in migrating cells. Mol Cell Biol 2015;35:1401–13.

40. Guerrero PA, Tchaicha JH, Chen Z, Morales JE, McCarty N, Wang Q, et al.Glioblastoma stem cells exploit the alphavbeta8 integrin-TGFbeta1 sig-naling axis to drive tumor initiation and progression. Oncogene 2017;36:6568–80.

41. Tchaicha JH, Reyes SB, Shin J, Hossain MG, Lang FF, McCarty JH. Glio-blastoma angiogenesis and tumor cell invasiveness are differentially reg-ulated by beta8 integrin. Cancer Res 2011;71:6371–81.

42. Hirota S,Clements TP, Tang LK,Morales JE, LeeHS,OhSP, et al.Neuropilin1 balances beta8 integrin-activated TGFbeta signaling to control sproutingangiogenesis in the brain. Development 2015;142:4363–73.

43. Cheerathodi M, Avci NG, Guerrero PA, Tang LK, Popp J, Morales JE, et al.The cytoskeletal adapter protein spinophilin regulates invadopodia






dynamics and tumor cell invasion in glioblastoma. Mol Cancer Res2016;14:1277–87.

44. Li J, Davidson D, Martins Souza C, ZhongMC, WuN, Park M, et al. Loss ofPTPN12 stimulates progression of ErbB2-dependent breast cancer byenhancing cell survival, migration, and epithelial-to-mesenchymal transi-tion. Mol Cell Biol 2015;35:4069–82.

45. Kodama T, Newberg JY, Kodama M, Rangel R, Yoshihara K, Tien JC, et al.Transposon mutagenesis identifies genes and cellular processes drivingepithelial-mesenchymal transition in hepatocellular carcinoma. Proc NatlAcad Sci U S A 2016;113:E3384–93.

46. Hede SM, Savov V, Weishaupt H, Sangfelt O, Swartling FJ. Oncoproteinstabilization in brain tumors. Oncogene 2014;33:4709–21.

47. Styczynski J, Olszewska-Slonina D, Kolodziej B, Napieraj M, Wysocki M.Activity of bortezomib in glioblastoma. AnticancerRes 2006;26:4499–503.

48. Areeb Z, Stylli SS,Ware TM,Harris NC, Shukla L, Shayan R, et al. Inhibitionof glioblastoma cell proliferation, migration and invasion by the protea-some antagonist carfilzomib. Med Oncol 2016;33:53.

49. Odia Y, Kreisl TN, Aregawi D, Innis EK, Fine HA. A phase II trial oftamoxifen and bortezomib in patients with recurrent malignant gliomas.J Neurooncol 2015;125:191–5.


Chen et al.




2018;78:3809-3822. Published OnlineFirst May 9, 2018.Cancer Res Zhihua Chen, John E. Morales, Paola A. Guerrero, et al. Invasive Glioblastoma CellsUbiquitination and Stability of Focal Adhesion Substrates in PTPN12/PTP-PEST Regulates Phosphorylation-Dependent

Updated version

10.1158/0008-5472.CAN-18-0085doi:

Access the most recent version of this article at:

Overview

Visual

http://cancerres.aacrjournals.org/content/78/14/3809/F1.large.jpgA diagrammatic summary of the major findings and biological implications:

Cited articles

http://cancerres.aacrjournals.org/content/78/14/3809.full#ref-list-1

This article cites 49 articles, 21 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/78/14/3809To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-18-0085

http://cancerres.aacrjournals.org/content/78/14/3809/F1.large.jpg

http://cancerres.aacrjournals.org/content/78/14/3809.full#ref-list-1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/78/14/3809


Documents

PTPN12/PTP-PEST Regulates Phosphorylation- Dependent … · Molecular Cell Biology PTPN12/PTP-PEST Regulates Phosphorylation-Dependent Ubiquitination and Stability of Focal Adhesion