Embed Size (px)
Citation preview
DNA FINGERPRINTING AND CHARACTERIZATION OF MUTATIONS ASSOCIATED WITH FIRST LINE ANTI-
TB DRUG RESISTANCE IN MYCOBACTERIUM TUBERCULOSIS
STRAINS PREVALENT IN PAKISTAN Submitted in partial fulfillment of
Ph.D.
By
Memona Yasmin
Department of Biotechnology (NIBGE)
Nilore - 45650 Islamabad, Pakistan
Pakistan Institute of Engineering and Applied Sciences
National Institute for Biotechnology and Genetic Engineering
P. O. BOX 577, JHANG ROAD, FAISALABAD.
(Affiliated with PIEAS, Islamabad)
Declaration of Originality I hereby declare that the work accomplished in this thesis is the results of my own research carried out in Health Biotechnology Division (NIBGE). This thesis has not been published previously nor does it contain any material from the published resources that can be considered as the violation of international copyright law.
Furthermore I also declare that I am aware of if any copyright violation was found out in this work I will be held responsible of the consequences of any such violation.
Signature: _______________ Memona Yasmin Registration No: 10-7-1-060-2011
Date: Place: NIBGE, Faisalabad
National Institute for Biotechnology and Genetic Engineering
P. O. BOX 577, JHANG ROAD, FAISALABAD.
(Affiliated with PIEAS, Islamabad)
Research Completion Certificate Certified that the research work contained in this thesis titled ““DNA fingerprinting and characterization of mutations associated with first line anti-TB drug resistance in Mycobacterium tuberculosis strains prevalent in Pakistan” has been carried out and completed by “Memona Yasmin” under my supervision during her PhD studies in the subject of Biotechnology.
Date Dr. Rubina Tabassum Research Supervisor
Submitted through
Dr. Shahid Mansoor Director NIBGE
Certificate of Approval This is to certify that the work contained in this thesis titled “DNA fingerprinting and characterization of mutations associated with first line ant-TB drug resistance in Mycobacterium tuberculosis strains prevalent in Pakistan” carried out by “Memona Yasmin” in our opinion is fully adequate, in scope and quality, for the degree of Ph.D. Biotechnology from Pakistan Institute of Engineering and Applied Sciences (PIEAS).
Approved by:
Signature: _____________________
Dr. Rubina Tabassum
Internal Examiner/Supervisor
Signature: _______________________
Name
External Examiner:
Verified by:
Signature: _____________________
Dr. Shahid Mansoor
Head, Department of Biotechnology (NIBGE)
Stamp:
Dedicated to my family
and to all those
who burnt themselves
to make me a candle
Acknowledgment
Thank God for the wisdom and perseverance that He has been bestowed upon me during this research project, and indeed, throughout my life. All respects and reverence for Holy Prophet (PBUH) whose teachings are complete guidance for humanity.
It is my utmost pleasure to avail the opportunity to extend my heartiest gratitude to Dr. Shahid Mansoor, director NIBGE, along with ex-directors for providing me and facilitation an encouraging environment for competitive research.
I am deeply acknowledged to Dr. Shahid Baig, Head Health Biotechnology Division at NIBGE, for providing an open access to all available facilities in the division.
I wish to thank my advisor Dr. Rubina Tabassum for her guidance, caring attitude, patience and for providing me with an excellent atmosphere for doing research. Indeed, without her guidance, I would not be able to put the topic together.
I would like to express my deep gratitude and respect to Dr. Christophe Sola of Institut de Génétique et Microbiologie at University of Paris for his inspiring guidance and ever encouraging attitude during my six months training in his laboratory funded by French Embassy. It gives me great pleasure in acknowledging the support and help of Dr. Guislaine Refregier, associate professor in Institut de Génétique et Microbiologie at University of Paris for her productive discussions and opinions regarding research work carried out under her kind guidance.
I would like to offer my heartiest appreciation to my loving and caring parents, brothers and sister for their great sacrifice, moral support, cooperation encouragement, patience and prayers for me during the completion of this work. No acknowledgement would ever adequately express my obligation to my family who always wished to see me glittering high on the skies of success.
Special thanks to my friends for their marvelous behavior, friendly attitude, valuable help and their everlasting moral support.
May Allah grant success and honour to all the above mentioned personalities along with all those who contributed at any level and in any capacity for the fulfillment of this achievement.
Memona Yasmin
i
TABLE OF CONTENTS
Table of contents i
List of tables Iv
List of figures vii
List of abbreviations x
Abstract xiii
1. Introduction and review of literature 1
1.1 History of tuberculosis 1
1.2 Morphology of M. tuberculosis 2
1.3 Genome and phylogeny of M. tuberculosis 3
1.4 Burden of tuberculosis 7
1.5 Epidemiology of tuberculosis 9
1.6 Latent tuberculosis infection 10
1.7 Tuberculosis and HIV 10
1.8 Types of tuberculosis 11
1.9 Clinical presentation 11
1.10 Diagnostic tools 11
1.11 DNA fingerprinting of M. tuberculosis 15
1.12 Drug resistance 20
1.13 Epidemiology of Multiple drug resistance 24
1.14 Drug susceptibility testing 24
1.15 Treatment of tuberculosis 31
1.16 Molecular mechanisms of drug resistance 32
1.17 Tuberculosis control strategy 36
1.18 Objectives of the study 38
2. Material and methods 40
2.1 Collection of M. tuberculosis culture isolates and clinical specimens 40
2.2 M. tuberculosis culture on Lowenstein Jenson (LJ) medium from clinical specimens
41
2.3 Isolation of M. tuberculosis genomic DNA 41
ii
2.4 Analysis of DNA extracted from M. tuberculosis isolates on agarose gel electrophoresis
44
2.5 DNA fingerprinting of M. tuberculosis isolates 45
2.6 Determination of recent transmission index (RTI) 60
2.7 Hunter and Gaston discriminatory index (HGDI) 61
2.8 Lineage assignation and evaluation of performance of different online tools
61
2.9 Development of reverse line blot hybridization assay to characterize mutations associated with rifampicin resistance
62
2.10 Cloning of PCR amplified hotspot region of rpoB gene from M. tuberculosis
73
2.11 DNA Sequencing of hotspot region of rpoB gene of M. tuberculosis
76
2.12 Characterization of mutations associated with isoniazid resistance 77
2.13 Characterization of mutations associated with pyrazinamide resistance using single strand conformational polymorphism (SSCP)
78
2.14 Characterization of mutations associated with Isoniazid, Ethambutol, Streptomycin and Pyrazinamide with sequencing
80
2.15 Statistical analysis 80
3. Results 83
3.1 M. tuberculosis culture on LJ slants from clinical samples 83
3.2 Description of study subjects 83
3.3 Analysis of DNA extracted from M. tuberculosis isolates by agarose gel electrophoresis
83
3.4 Analysis of PCR products of MIRU-VNTR loci 84
3.5 Spoligoriftyping of M. tuberculosis isolates 91
3.6 Assessment of global and local transmission dynamics by the combination of 24 MIRU-VNTR and spoligotyping patterns
94
3.7 M. tuberculosis strain differentiation by 25 additional spacers (68 spacer format spoligotyping)
100
3.8 Discriminatory power of genotyping techniques 119
3.9 Assessment of freely available databases for lineage assignation 120
3.10 Characterization of mutations in rpoB gene associated with 135
iii
rifampicin resistance by Spoligoriftyping
3.11 Reverse hybridization line probe assay 168
3.12 Characterization of mutations associated with Isoniazid resistance using micro beads based assay
189
3.13 Poor standards of phenotypic drug susceptibility in the country 196
3.14 Cumulative genotypic drug susceptibility to Rifampicin and Isoniazid
196
3.15 Association of M. tuberculosis lineages with specific mutations 196
3.16 Characterization of mutations in embB gene associated with ethambutol resistance in M. tuberculosis culture isolates
225
3.17 Characterization of mutations in rrs and rpsL genes associated with streptomycin resistance in M. tuberculosis culture isolates
227
3.18 Characterization of mutations in pncA gene associated with pyrazinamide resistance in M. tuberculosis culture isolates
223
4. Discussion 247
5. Recommendations and future research directions 262
6. References 265
7. Appendix I 309
iv
LIST OF TABLES
Table 1.1 Estimate of TB Burden in Pakistan 9
Table 1.2 Molecular Mechanism of Resistance in M. tuberculosis 37
Table 2.1 MIRU-VNTR Loci Designation and Parameters for PCR Primers
45
Table 2.2 Reaction Mixture for MIRU-VNTR PCR 48
Table 2.3 Allele Designation Table for MIRU-VNTR Analysis of M. tuberculosis Isolates
50
Table 2.4 Parameters of Oligonucleotides used for Spoligoriftyping Assay 53
Table 2.5 PCR Primers for Spoligoriftyping Assay 56
Table 2.6 PCR Reaction Mixture for Spoligoriftyping 57
Table 2.7 Reaction Mixture for Hybridization 57
Table 2.8 Parameters of 25 Additional Spacer Oligonucleotides 59
Table 2.9 Regular PCR Primer Parameters 64
Table 2.10 Reaction Mixture for Regular PCR 64
Table 2.11 Nested PCR Primer Parameters 65
Table 2.12 Reaction Mixture for Nested PCR 65
Table 2.13 Parameters of Oligonucleotides Used in RHLiP Assay 69
Table 2.14 Optimization of Hybridization Conditions 72
Table 2.15 Ligation Mix 74
Table 2.16 Restriction Mix for Restriction Analysis 76
Table 2.17 Oligonucleotides used for Characterization of Mutations in katG and inhA genes
77
Table 2.18 PCR Primers for Amplification of katG and inhA Genes 77
Table 2.19 PCR Primers to Amplify pncA gene 78
Table 2.20 Reaction Mixture of PCR Amplification of pncA Gene 79
Table 2.21 Polyacrylamide Gel Composition for SSCP of PncA2 PCR Products
79
Table 2.22 PCR Primers used for Amplification of Hotspot Regions of katG, inhA, rrs, rpsL, embB and pncA Genes for DNA Sequencing
81
v
Table 2.23 Reaction Mixture of PCR for DNA Sequencing 81
Table 3.1 Discriminatory Power of MIRU-VNTR Loci 89
Table 3.2 Determination of Most Discriminatory Subset of MIRU-VNTR loci as “Fast Lane” Screening Markers
90
Table 3.3 HGDI of Different Tested Subset of Loci 90
Table 3.4 Mean Fluorescence Intensity Values Obtained from Luminex 92
Table 3.5 Interpretation of the MFI Values According to Defined Cutoff Values
93
Table 3.6 Local and Cumulative Recent Transmission Indices 95
Table 3.7 Strain Discrimination of M. tuberculosis Isolates by 68 Spacer Format Spoligotyping
100
Table 3.8 Spoligotyping using 43 Spacer and 68 Spacer Format 102
Table 3.9 Discriminatory Powers of Genotyping Techniques 119
Table 3.10 Assessment of Freely Available Databases for Lineage Assignation 122
Table 3.11 Characterization of Mutations in rpoB Gene Associated with Rifampicin Resistance in M. tuberculosis Strains
137
Table 3.12 Probe Hybridization and Signal Detection at Different Conditions
170
Table 3.13 Detected Mutations in rpoB Gene of M. tuberculosis Culture Isolates by In-house Line Probe Assay
177
Table 3.14 Approximate Cost of In-house Line Probe Assay 182
Table 3.15 Overall Spectrum of Mutations Observed in rpoB Gene of M. tuberculosis Culture Isolates
184
Table 3.16 Percentage Concordance of Phenotypic and Genotypic DST for Rifampicin
186
Table 3.17 Mutations in “Hotspot” Region of rpoB Gene in Clinical Specimens
188
Table 3.18 Frequency of Mutations in katG and Promoter Region of inhA Gene Associated with Isoniazid Resistance in M. tuberculosis Isolates
193
Table 3.19 Percentage Concordance of Phenotypic and Genotypic DST for Isoniazid
194
Table 3.20 Detected Mutations in katG and Prmoter region of inhA Gene Associated with Isoniazid Resistance in M. tuberculosis Isolates
197
vi
Table 3.21 Frequency of Mutations in embB Gene Associated with Ethambutol Resistance in M. tuberculosis Isolates
225
Table 3.22 Detected Mutations in embB Gene of M. tuberculosis 226
Table 3.23 Frequency of Mutations in rrs and rpsL Genes Associated with Streptomycin Resistance in M. tuberculosis Isolates
229
Table 3.24 Detected Mutations in rpsL and rrs Genes of M. tuberculosis 229
Table 3.25 Frequency of Mutations in pncA Gene Associated with Pyrazinamide Resistance in M. tuberculosis Isolates
236
Table 3.26 Detected Mutations in pncA Gene Associated with Pyrazinamide Resistance in M. tuberculosis Isolates
236
vii
LIST OF FIGURES
Figure 1.1 M. tuberculosis under the electron microscope 3
Figure 1.2 Circular map of the chromosome of M. tuberculosis H37Rv 4
Figure 1.3 Schematic representation of the proposed evolutionary pathway of the tubercle bacilli
6
Figure 1.4 Comparison of four phylogenies of M. tuberculosis 8
Figure 1.5 Estimated TB incidence rates, 2012 9
Figure 1.6 Physical map of IS6110 element 17
Figure 1.7 Variable human minisatellite‐like regions in the M. tuberculosis genome
21
Figure 1.8 Chromosome of hypothetical strain X of M. tuberculosis and genotyping of M. bovis, the M. tuberculosis laboratory strain H37Rv, and strain X on the basis of IS6110 insertion sequences and mycobacterial interspersed repetitive units
33
Figure 1.9 Mutations and alleles in rifampicin resistant M. tuberculosis isolates reported by different groups
38
Figure 1.10 Directly observed treatment, short course (DOTS), 5-part framework
40
Figure 2.1 Description of the isolates collected from different locations of Pakistan
41
Figure 2.2 Schematic representation of spoligoriftyping principle 52
Figure 2.3 Principle of reverse hybridization line probe assay to detect mutations in rpoB gene
63
Figure 2.4 Distribution of oligonucleotide on hotspot region of rpoB gene 71
Figure 3.1 Ethidium bromide stained 0.8% gel of extracted DNA of M. tuberculosis
84
Figure 3.2 Resolution of ETR A and MIRU 39 PCR amplified products 84
Figure 3.3 Resolution of ETR B and Qub 26 PCR amplified products 85
Figure 3.4 Resolution of ETR C and MIRU 20 PCR amplified products 85
Figure 3.5 Resolution of MIRU 2 and MIRU 27 PCR amplified products 85
Figure 3.6 Resolution of MIRU 16 and Qub 11b PCR amplified products 86
viii
Figure 3.7 Resolution of ETR D and MIRU 10 PCR amplified products 86
Figure 3.8 Resolution of MIRU 23 and Mtub 30 PCR amplified products 86
Figure 3.9 Resolution of ETR E and MIRU 24 PCR amplified products 87
Figure 3.10 Resolution of MIRU 26 and Mtub 29 PCR amplified products 87
Figure 3.11 Resolution of MIRU 40 and Mtub 34 PCR amplified products 87
Figure 3.12 Resolution of Mtub 39 and Mtub 21 PCR amplified products 88
Figure 3.13 Resolution of Mtub 04 and Qub 4156 PCR amplifications 88
Figure 3.14 Distribution of MFI across samples 92
Figure 3.15 Final display of the interpreted spoligoriftyping results 93
Figure 3.16 Minimum Spanning Tree based on 43 spacer format spoligotyping data
96
Figure 3.17 Distribution of lineages in various regions, as described by SpolDB4 database and expert visual inspection
97
Figure 3.18 Dendrogram showing clustering of M. tuberculosis strains from Rawalpindi district by 43 Spacer Spoligotyping and 24 MIRU-VNTR
98
Figure 3.19 Dendrogram showing clustering of M. tuberculosis strains from Lahore + Faisalabad District by 43 Spacer Spoligotyping and 24 MIRU-VNTR
99
Figure 3.20 Graphical representation of performance of the different online tools for lineage assignation
121
Figure 3.21 PCR amplification of rpoB gene of M. tuberculosis isolates by regular primers
168
Figure 3.22 PCR amplification of rpoB gene of M. tuberculosis isolates by nested primers
168
Figure 3.23 Optimization of conditions for reverse line blot 169
Figure 3.24 Elimination of nonspecific binding of PCR product 169
Figure 3.25 Optimization of different hybridization and washing conditions 170
Figure 3 26 Optimization of DNA cross linking time 171
Figure 3.27 Application of strip optimized conditions in Mini blotter45 171
Figure 3.28 Optimization of amplicon concentration 172
Figure 3.29 Reverse hybridization line blot 173
Figure 3.30 Reverse hybridization line blot 174
Figure 3.31 Reverse hybridization line blot 175
ix
Figure 3.32 Restriction analysis of pTZ57R/T vector DNA containing cloned rpoB gene fragment
176
Figure 3.33 Percentage of different mutations observed in rpoB Gene of M. tuberculosis culture isolates
185
Figure 3.34 Final display of the interpreted microbead assay results for isoniazid
190
Figure 3.35 PCR amplification of katG gene of M. tuberculosis isolates 192
Figure 3.36 PCR amplification of promoter region of inhA gene of M. tuberculosis isolates
192
Figure 3.37 Percent frequency of different mutations observed in katG and promoter region of inhA gene of M. tuberculosis culture isolates
193
Figure 3.38 PCR amplification of emb gene of M. tuberculosis isolates 225
Figure 3.39 PCR amplification of rpsL gene of M. tuberculosis isolates 227
Figure 3.40 PCR amplification of rrs gene of M. tuberculosis isolates 228
Figure 3.41 PCR amplification of pncA1 segment of pncA gene of M. tuberculosis isolates
233
Figure 3.42 PCR amplification of pncA2 segment of pncA gene of M. tuberculosis isolates
233
Figure 3.43 SSCP analysis of pncA1 segment by polyacrylamide gel electrophoresis
234
Figure 3.44 SSCP analysis of pncA3 segment by polyacrylamide gel electrophoresis
234
Figure 3.45 PCR amplification of pncA gene in M. tuberculosis isolates 235
x
LIST OF ABBREVIATIONS
AFB Acid-fast bacilli
ALMS Automated liquid media systems
APS Ammonium per sulphate
BCG Bacillus Calmette-Guérin
BMRC British Medical Research Council
CAS Central Asian strains
CRISPR Clustered regularly interspaced short palindromic repeats
CTAB Cetyltrimethylammonium bromide
DNA Deoxyribo nucleic acid
dNTP Deoxyribo nucleotide tri phosphate
DOTS Directly observed therapy scheme
DPO Dual priming oligonucleotide
DST Drug sensitivity testing
DVR Direct variant repeat
EAI Euro American Indian
EDC 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride
EDTA Ethylenediaminetetraacetic acid
ELISA Enzyme linked immunosorbent assay
ETH Ethambutol
FM Fluorescent microscope
FQ Fluoroquinolone
H Haarlem
HGDI Hunter and Gaston discriminatory index
HIV Human immunodeficiency virus
IGRA Interferon gamma release assay
INH Isoniazid
IPTG Isopropyl Thio-beta-D-Galactoside
IUATLD International Union Against Tuberculosis and Lung Disease
xi
LAM Latin American Mediteranian
LB Luria Bertani
LED Light emitting diodes
LJ Lowenstein Jenson
LM Light microscope
LTBI Latent tuberculosis infection
MDR Multiple drug resistance
MES 2-(N-morpholino) ethane sulfonic acid
MFI Mean fluorescence intensity
MGIT Mycobacterium growth indicator tube
MIC Minimal inhibitory concentration
MIRU-VNTR Mycobacterium Interspersed Unit Variable Number Tandem Repeat
MST Minimum Spanning Tree
MTBC Mycobacterium tuberculosis complex
MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide
NAAT Nucleic acid amplification test
NaOAc Sodium acetate
NJ Neighbour Joining
OD Optical density
PAS Para-amino salt of salicylic acid
PCR Polymerase chain reaction
PGRS Polymorphic GC-rich repetitive sequence
POA Pyrazinoic acid
PPD Purified protein derivatives
PZA Pyrazinamide
PZase Pyrazinamidase
RD Region of difference
RFLP Restriction fragment length polymorphism
RIF Rifampicin
RRDR Rifampicin resistance determining region
RTI Recent transmission index
SLV Single locus variant
xii
SNP Single-nucleotide polymorphism
SSCP Single-stranded conformation polymorphism
STR Streptomycin
TB Tuberculosis
TE Tris-EDTA
TEMED Tetramethylethylenediamine
TMAC Tetra-methyl ammonium chloride
TST Tuberculin skin test
UPGMA Unweighted Pair Group Method with Arithmetic Averages
UV Ultra violet
WHO World Health Organization
XDR-TB Extensively drug resistant tuberculosis
Xgal 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside
xiii
ABSTRACT
Tuberculosis (TB) is one of the most devastating infectious diseases that is highly
endemic in Pakistan. Pakistan is ranked 5th amongst 22 high tuberculosis burden
countries of the world. Global as well as national tuberculosis control program is
further challenged by the spread of multiple drug resistant strains of Mycobacterium
tuberculosis, the causative agent of tuberculosis. For controlling the spread of M.
tuberculosis isolates, circulating in this region, it is important to explore the
transmission dynamics and characteristics of these strains. This information, in turn,
can help to implement better treatment and control measures.
The study provides the information about the population structure of M.
tuberculosis isolates in Pakistan. DNA fingerprinting of the strains was performed by
high throughput spoligoriftyping and 24 MIRU-VNTR typing techniques. CAS family
constituted the dominant group of the strains followed by the T family and EAI family
while Beijing family showed the low prevalence. However, EAI strains were found to
show high prevalence in Eastern part of the country.
Molecular epidemiological methods play an important role to identify
appropriate public health interventions and to measure their impact. Despite of the
fact that Pakistan is harboring high disease burden, no molecular epidemiologic
studies have yet been conducted to assess the disease transmission. Our study
explores, for the first time, TB epidemiology in the Punjab province of Pakistan, using
the gold standard tools of molecular epidemiology. We document a relatively low
disease transmission rate in the population.
The study also provides a good assessment of the discriminatory powers of the
various genotyping techniques and suggests the use of duplex format of MIRU-VNTR
typing to be used as genotyping technique in this setting because of its low cost and
relatively less turnaround time as compared to simplex format. We further suggest the
use of Qub 26, MIRU 10, Mtub 04, MIRU 26, MIRU 31 (ETR E), MIRU 16, Qub
4156 and Mtub 21 to be used as preliminary ‘fast lane’ screen to differentiate the M.
tuberculosis strains in this particular geographical setting.
xiv
The use of high throughput techniques like spoligoriftyping is recommended
to be used as good tool to help the TB control programs in high disease burden
countries. This powerful technique also helped to identify unreliable standards of
phenotypic drug sencitivity testing (DST) in some local hospitals.
Besides this, an in-house low cost test platform is configured and validated for
the rapid screening of multiple drug resistance (MDR) in the present study. Being
highly sensitive and specific, not only in the culture isolates but also in clinical
samples, it could be used to screen MDR in point of care settings in the developing
world where the need is acute.
This study for the first time gives the comparative assessment of three freely
available databases used to assign lineage to the M. tuberculosis isolates, uncovering
the errors and inability of these databases in assigning lineages to isolates. Further,
our study also pinpointed the defects in lineage assignation at sublineage level that
arose due to the lack of database up gradation.
The study also covered the assessment of occurrence of mutations at various
target loci and their frequencies in M. tuberculosis isolates, resistant to first line anti-
TB drugs. Overall, the profile of the mutations at various loci was similar to that
found at other geographical locations worldwide. The most common mutations
responsible for the rifampicin resistance were found in codon 531, 526 and 516 of
rpoB gene, in isoniazid resistant isolates affecting the codon 315 of the katG and
position -15 of the promoter region of inhA gene, in ethambutol resistant isolates
affecting the codon 306 of embB gene and in streptomycin resistant isolates, targeting
the codon 43 of rpsL gene and codon 512, 513 and 516 of rrs gene. In case of
pyrazinamide, very few isolates showed mutations in targeted regions of pncA gene.
Besides this, some novel mutations were also observed in this study. The relationship
of specific mutations in rpoB and katG genes with M. tuberculosis lineages is also
explored. The information about these mutations can be used to develop novel
molecular diagnostic method that specifically could be implemented in Pakistan.
However, prospective thorough epidemiological studies are needed to monitor
continuously changing disease transmission dynamics in the community.
1
INTRODUCTION AND REVIEW OF LITERATURE
Tuberculosis (TB) is one of the most devastating diseases that have affected mankind.
It is an infectious disease caused by Mycobacterium tuberculosis (M. tuberculosis)
that primarily affects the lungs, but can spread to almost any part of the
body. The introduction of effective chemotherapy in 1950s and 1960s raised the hope
that tuberculosis may soon be controlled and ultimatey eliminated. Though, the
incidence of tuberculosis dramatically decreased in certain parts of the world (Zhang
and Young, 1994) but it did not last for long. In 1993, World Health Organization
(WHO) declared tuberculosis a “Global Public Health Emergency” (WHO, 2012). TB
had re-emerged with a new face leading to high rates of mortality and morbidity all
over the world. The combination therapy proposed by WHO was not administered in
its true essence and that led to emergence of multiple drug resistance (resistance to at
least two first line anti-TB drugs; rifampicin and isoniazid). Tuberculosis is now
ranked second leading cause of death by infectious diseases after HIV/AIDS (WHO,
2012). One third of the world’s population harbors M. tuberculosis and every second,
one person becomes newly infected with tuberculosis (Landry and Menzies, 2008).
1.1 History of tuberculosis
The history of tuberculosis appears to be as old as humanity itself. It has been
called “The Captain of all Diseases”, Man of War”, “The King of Diseases” and the
“White Plague” (Reichman, 1991). Historical evidences indicate that tuberculosis has
infected the humans for thousands of years. Its signs have been reported in skeletons
from the Neolithic Age, a time period ranging from about 8000 to 2000 B.C (Todar,
2009).
People worked on tuberculosis to find out the nature of the disease. Franciscus
Sylvius in 1679 described the lung nodules as “tubercula” (small knots) but
unfortunately was believed to be a form of tumor or abnormal gland for a long time.
Benjamin Maten made first credible speculation about the infectious nature of the
tuberculosis in 1722 (Doetsch, 1978). He proposed that TB is caused by the
“animaliculae” that can be transmitted by breath from the patient to healthy person.
2
The contagious nature of the tuberculosis was demonstrated by Jean-Antonine
Villemin in 1865 (Doetsch, 1978), who successfully transmitted pus and fluid from
human and bovine lesions to rabbit that subsequently developed tuberculosis. His
contemporaries ignored his findings until 1882 when the work of Robert Koch was
presented. Koch successfully isolated and cultured M. tuberculosis from crushed
tubercles (Daniel, 2005). In 1890, Koch announced that culture filtrates can cure the
disease but his claim was strongly discredited at that time (Daniel, 2006). The Koch’s
filtrates were later on purified and were used to establish infection, the tuberculin skin
test.
Lack of effective treatment was major hurdle to the control of tuberculosis. In
England and France, it was believed that newly crowned kings have special healing
power for this disease so the only treatment of this “King’s Evil” was being touched
by the kings (Daniel, 2006). In 1854, Herman Brehmer established first sanatorium
with the belief that exercise and altitude could serve to cure (Bloom and Murray,
1992). Pasteurization of cow’s milk was the next measure to reduce the possibility of
M. bovis being a cause of human TB. Another speculative intervention was made by
Albert Calmette and Camille Guérin in 1908, the BCG vaccine, the most widely used
vaccine against tuberculosis throughout the world (Pym et al., 2003). Finally, the
introduction of antibiotics led to the effective treatment of tuberculosis, hence, ending
the sanatorium era.
1.2 Morphology of M. tuberculosis
M. tuberculosis is a large non motile, rod-shaped, facultative intracellular
parasite. The rods range in size from 2 to 4 µm in length and 0.2 to 0.5 µm in width.
It is an obligate aerobic bacterium, and is usually found in well aerated upper lobes of
the lungs, in classic cases of tuberculosis (Todar, 2009).
The distinctive feature of M. tuberculosis is its cell wall that is rich in
glycolipid contents, the mycolic acid that contributes not only to its virulence but also
promotes its growth as tight, rope-like aggregates of acid-fast bacilli (AFB)
(Yagupsky et al., 1990). The cell wall is hydrophobic, waxy and contains a
peptidoglycan layer held together with polysaccharide, arabinogalactan (Alderwick et
al., 2007). The lipid rich cell wall is important not only for the survival of the bacteria
3
but also provides intrinsic resistance to many therapeutic agents (Brennan and
Nikaido, 1995) (Hong and Hopfinger, 2004). It is a slow grower as under optimum
conditions; it takes 16 to 18 hours to undergo one cycle of replication. Since M.
tuberculosis lacks cell membrane and does not retain crystal violet dye, a property
known as acid-alcohol fastness that largely depends on properties of cell wall so they
are characterized as acid fast bacilli. They are stained by special stains like Ziehl-
Neelsen stain, Fite's stain and Kinyoun stain (Smithwick, 1976).
Figure 1.1 M. tuberculosis under the electron microscope (Courtesy of
Institute Pasteur library (The Sanger Institute: TB website)
1.3 Genome and phylogeny of M. tuberculosis
M. tuberculosis belongs to the order Actinomycetales (Rastogi et al., 2001;
Smith et al., 2006). The M. tuberculosis H37Rv genome is 4.41 million bp long and
has approximately 4047 predicted genes (Cole et al., 1998). Re annotation of the
genome was done in 2002 and with the prediction of function of 2058 proteins (52%
of the proteome), the number of unknown proteins decreased from 606 to 272 (Camus
et al., 2002). Genome sequencing demonstrates that it has the potential to synthesize
all the necessary vitamins and coenzymes cofactors, amino acids, enzymes necessary
for glycolysis. It can metabolize large variety of carbohydrates, alcohols, ketones,
carboxylic acids and hydrocarbons. It also possesses the enzymes that are necessary
for the pentose phosphate pathway, glyoxylate cycle and the tricarboxylic acid cycle.
Besides this, several oxidoreductases, dehydrogenases and oxygenases are also
predicted. Components of several anaerobic phosphorylative electron transport chains
are also predicted.
4
Figure 1.2 Circular map of the chromosome of M. tuberculosis H37Rv The outer circle shows the scale in Mb. 0 represents the origin of replication. The first ring denotes the positions of stable RNA genes (tRNAs are blue while others are pink) and the direct repeat region (pink cube); the second ring depicts the coding sequence by strand (clockwise, dark green; anticlockwise, light green); the third ring shows repetitive DNA (insertion sequences are orange; 13E12 REP family in dark pink; prophage in blue); the fourth ring denotes the positions of the PPE family members (green); the fifth ring dipicts the PE family members (purple, excluding PGRS); and the sixth ring shows the positions of the PGRS sequences (dark red). The histogram (centre) represents G + C content, 65% G + C in yellow, and .65% G + C in red (Cole et al., 1998)
It has been found that most of the bacterial species consist of distinct clones or
clonal complex (Achtman et al., 1999; Maiden, 2000) that possesses only 1% or more
difference at synonymous nucleotide sites (Feil and Spratt, 2001; Palys et al., 1997).
The basic mechanisms that constitute the intraspecies genetic diversity include
mutations and horizontal genetic exchanges. On the other hand, M. tuberculosis
complex (MTBC) (M. tuberculosis, M. bovis, M. microti, M. africanum, M.
pinnipedii, and M. caprae species) reflects the extreme example of genetic
homogeneity as reflected by only 0.01%–0.03% synonymous nucleotide variations
(Garnier et al., 2003; Sreevatsan et al., 1997) although members of the complex
5
exhibit a broad spectrum of host range and phenotypic characteristics. There is also a
little evidence of horizontal gene transfer in M. tuberculosis reflecting that its
evolution has occurred in clonal manner (Gutacker et al., 2002; Hirsh et al., 2004;
Smith et al., 2003). Possible explanation of this little genetic variation may be due to
selective pressure or the hypothesis that M. tuberculosis has evolved through a recent
evolutionary bottleneck at the time of speciation estimated to have occurred
approximately 15,000 to 20,000 years ago (Brosch et al., 2002; Gutacker et al., 2002;
Hughes et al., 2002; Sreevatsan et al., 1997).
Although there is a very little genetic diversity among the strains, the
differences observed have been exploited to find out the global evolution of M.
tuberculosis complex. In 1997, Sareevatsan et al., sequenced two megabases in 26
structural genes of M. tuberculosis and the three members of the M. tuberculosis
complex (M. africanum, M. bovis, and M. microti) in 840 isolates collected
worldwide. On the basis of combinations of polymorphisms at codon katG463 and
codon gyrA95, members of MTC were assigned to one of three genotypic groups.
Organisms in Principal Group 1 were considered as the common precursor of the
MTBC possessing the allele combination katG463 CTG (Leu) and gyrA95 ACC (Thr).
This group included the strains M. tuberculosis, M. africanum, M. bovis, and M.
microti. Principal Group 2 organisms possessed katG463 CGG (Arg) and gyrA95 ACC
(Thr) while Principal Group 3 organisms had katG463 CGG (Arg) and gyrA95 AGC
(Ser) polymorphis.
The presence of deletions in genome further uncovered the evolution of
MTBC. Fourteen regions of difference (RD1–14) that range in size from 2 to 12.7 kb
were identified by differential hybridization arrays. These were found to be absent
from bacillus Calmette–Guérin Pasteur relative to M. tuberculosis H37Rv (Behr et al.,
1999; Gordon et al., 1999). In addition, comparative genomics approach revealed six
regions (H37Rv related deletions (RvD) 1–5, and M. tuberculosis specific deletion 1,
TbD1) that were absent from the M. tuberculosis H37Rv genome relative to other
members of the M. tuberculosis complex (Brosch et al., 1999; Gordon et al., 1999).
M. tuberculosis strains are divided into ancestral and “modern” strains on the
basis of presence or absence of M. tuberculosis specific deletion (TbD1). Further,
6
characterization of strains by examining the number of regions of differences (RD)
and single nucleotide polymorphism in addition to presence or absence of TbD1
deletion resulted in discrediting of often-presented hypothesis that M. tuberculosis
evolved from M. bovis (Brosch et al., 2002).
Figure 1.3 Schematic representation of the proposed evolutionary pathway of the tubercle bacilli, illustrating successive loss of DNA in certain lineages (grey boxes) (Brosch et al., 2002)
Synonymous single-nucleotide polymorphisms (sSNPs) reflect neutral
genomic variation, which can be used to trace out the phylogeny. In 2004, Baker et
al., constructed a phylogeny of MTBC by analyzing genetically 37 neutral sSNPs for
seven unlinked loci (rpoB, katG, oxyR, ahpC, pncA, rpsL, and gyrA) that divided the
strains in 4 distinct groups (I-IV). These 4 groups showed the congruence between
previously defined 3 Principal Genetic Groups of Sreevatsan et al., (1997) and
“Ancestral” and “Modern” classification based on TbD1 by Brosch et al., (2002). This
study further reflected a highly significant association between continent of birth and
defined lineages. Lineages I, II, and III were associated with South-Eastern Asia,
Europe, and the Indian subcontinent, respectively while Lineage IV was globally
distributed but had a negative association with Europe. This finding provided strong
7
evidence for geographic structuring in M. tuberculosis populations (Baker et al.,
2004).
Two other groups of scientists, Filliol et al., (2006) and Gutacker et al., (2006)
independently exploited the power of SNPs to further investigate the global
phylogeny of M. tuberculosis which placed the strains in 7 and 9 linages, respectively.
These studies also showed congruence with previous studies. Gagneux and colleagues
(2006a) identified 19 lineage specific large sequence polymorphisms (LSPs). The
constructed phylogeny revealed 6 main lineages and 15 sublineages of M.
tuberculosis. They also demonstrated that population genetics of M. tuberculosis is
geographically structured. Each of the six main lineages was associated with
particular geographical setting and that was reflected by their names. Their findings
further strengthen the scenario of the origin and evolution of human tuberculosis
demonstrating that M. tuberculosis had expanded and diversified during its spread out
of East Africa. Brudey et al., in 2006, analysed international spoligotyping database
(SpolDB4) and showed that most of the spoligotyping patterns can be classified
according to a limited number of prototype patterns. Some of these patterns were
found to show congruence with the lineage determination reviewed above.
In short, these five studies (Baker et al., 2004; Filliol et al., 2006; Gagneux et
al., 2006a; Gutacker et al., 2006; Sreevatsan et al., 1997) using phylogenetically
informative mutations to the analysis of a globally sampled collection of M.
tuberculosis isolates, can be used to demonstrate the global phylogeny of M.
tuberculosis as they have come to the same conclusion.
1.4 Burden of tuberculosis
In 2011, the global incidence of TB was reported to be 8.7 million (8.3 million–9.0
million), equivalent to 125 cases per 100,000 population. Most of the cases cropped
up in Asia (59%) and Africa (26%) while smaller proportions of cases occurred in the
Eastern Mediterranean Region (7.7%), the European Region (4.3%) and the Region of
the Americas (3%). The 22 high TB burden countries accounted for 82% of all
estimated cases. Five high TB burden countries, in 2011 were India (2.0 million–2.5
million), China (0.9 million–1.1 million), South Africa (0.4 million–0.6 million),
8
Indonesia (0.4 million–0.5 million) and Pakistan (0.3 million–0.5 million). India and
China alone accounted for 26% and 12% of global cases, respectively (WHO, 2013b).
In Pakistan, the magnitude of TB burden in terms of the number of cases per
100,000 populations is reported to be 231. This figure ranks Pakistan 5th amongst high
TB burden countries (WHO, 2012). For the developing countries like Pakistan, this
situation is alarming as most of the victims of TB are found to be in their
economically productive years of life. Estimation of epidemiological burden of TB in
Pakistan is given in table 1.1.
Figure 1.4 Comparison of four phylogenies of M. tuberculosis (Gagneux and Small, 2007)
9
Figure 1.5 Estimated TB incidence rates, 2012 (WHO, 2013b)
Table 1.1 Estimate of TB Burden in Pakistan
Number (Thousands) Rate (per 100,000
population)
Mortality (excludes HIV+TB) 59 (26–110) 33 (15–60)
Prevalence (includes
HIV+TB) 620 (280–1 100) 50 (158–618)
Incidence (includes HIV+TB) 410 (340–490) 231 (190–276)
Incidence (HIV+TB) 1.5 (0.99–2.1) 0.84 (0.56–1.2)
Case detection, all forms (%) 64 (54–78)
1.5 Epidemiology of tuberculosis
Understanding the epidemiology of tuberculosis is important to control TB
because the information on pattern of infection and disease can greatly assist in
identifying groups of people at risk for TB. At the same time information regarding
transmission of the disease helps in planning appropriate use of resources (Davies and
Pai, 2008) for the control of the disease. Global epidemiology of tuberculosis varies
significantly, however, poor infrastructure, overcrowded living conditions due to
poverty, prevalence of human immunodeficiency virus (HIV) infection, immigration,
10
and multidrug resistant TB (MDR-TB) are major contributors of resurging TB
epidemic (Iademarco and Castro, 2003). Tuberculosis spreads in three distinct phases.
In transmission phase, M. tuberculosis is transferred from the source via the aerosol
formation of respiratory secretion. Next comes infective phase where the pathogen
establishes itself in the lungs of the host. The last phase is the pathogenic phase in
which the pathogen and host-related mechanisms bring about the disease (Colice,
1995). The effects of globalization on epidemiology could be seen in perspective of
drug resistance, a phenomenon caused by inappropriate therapy on the part of
physicians and non-compliance on the part of patients leading to multi drug resistant
bacilli in patients that cannot be treated with standard therapy. These strains are
distributed across the borders with increase in cross-country travel thus shifting the
TB burden in other countries.
1.6 Latent tuberculosis infection
A person who is exposed to M. tuberculosis may not necessarily develop the
disease. In most of the cases host’s immune response can control the infection but
could not completely remove the bacterium from the body. This leads to the
development of latent tuberculosis infection (LTBI), a condition in which a person is
infected with M. tuberculosis, but does not currently have active tuberculosis disease.
In LTBI, bacilli remain in the inactive or latent state. In about 90-95% of cases,
infection doesn’t lead to disease but in 5-10% cases progression from LTBI to active
infection occurs when the host’s immune system is weakened. The risk of progression
from LTBI to active tuberculosis is high in the first two years after infection, when
about one half of 5 to 10% lifetime risk occurs. This risk is increased in children
younger than four years; persons with diabetes, HIV infection and other chronic
conditions where patients have to use immunosuppressant drugs (Hauck et al., 2009).
1.7 Tuberculosis and HIV
HIV infection is playing an important part in fuelling the TB pandemic. Co-
infection of TB with HIV drastically shifts the distribution of TB. Globally, of the 8.7
million incident cases in 2011, 1.0 million–1.2 million (12–14%) were found among
people living with HIV. The proportion of TB/HIV co-infected cases was highest in
countries in the African Region (overall, 39% of TB cases that accounted for 79% of
11
TB cases among people living with HIV worldwide) (WHO, 2012). This is because
the tuberculosis requires cellular immunity for its control. HIV infection disables and
kills CD4+ or helper T lymphocyte, the cells central to tuberculosis immunity, thus
slowly impairing the cell mediated immunity leading to high level resurgence of
tuberculosis (Iseman, 1994; Raviglione et al., 1992). At the same time, progression of
active TB in people infected with HIV increases the risk of transmission of TB to
general community (Godfrey-Faussett et al., 2002).
1.8 Types of tuberculosis
Tuberculosis can broadly be classified into (a) pulmonary and (b) extra
pulmonary tuberculosis. Pulmonary tuberculosis is a form of TB in which the affected
organ of the host is lungs. This is the most common form of tuberculosis. In about 15
to 20 % cases of the active TB, infection moves from lungs to other parts of the body
and is collectively referred to as extra pulmonary tuberculosis (Sharma and Mohan,
2004). The most commonly affected organs in case of extra pulmonary tuberculosis
are lymphatic system, central nervous system, kidneys and genitourinary system.
Extra pulmonary tuberculosis can coexist with pulmonary tuberculosis (Golden and
Vikram, 2005).
1.9 Clinical presentation
In most of the cases, early symptoms include fever, chills, night sweats, flu-
like symptoms, gastrointestinal symptoms, weight loss, loss in appetite, weakness and
fatigue while persistent cough, chest pain, coughing up bloody sputum and difficulty
in breathing are specifically associated with pulmonary tuberculosis (Hauck et al.,
2009). Patients co-infected with HIV show different clinical presentation. Anorexia,
weight loss, low BMI, less cavitations and lung involvement are more frequently
observed in patients of tuberculosis co-infected with HIV (Lawson et al., 2008).
1.10 Diagnostic tools
Early and accurate diagnosis of the disease helps control the disease at early
stage and prevents transmission of the disease in the population. Hence, it plays a
crucial role in the effective management of the disease.
12
1.10.1 Radiological analysis
In tuberculosis patients, alveolar infiltrate in the upper lobe or apical segment
of the lower lobe with cavitation is often observed. Lesions may appear anywhere in
the lungs. In disseminated TB, miliary pattern throughout the lung fields is common
(Leung, 1999). Abnormalities in the radiographs can help to rule out the pulmonary
tuberculosis however, they are not clear indicative of TB. Unilateral hilar and
mediastinal enlargement and infiltrates in the mid or lower lung zones without
cavitation are often observed in HIV patients (Brandli, 1998). In fact, radiography is a
nonspecific investigation for tuberculosis. Hence, it is recommended that all persons
should submit sputum specimen for microbiological examination (Davies and Pai,
2008).
1.10.2 Microscopy
The first technique for diagnosing TB was reported by Robert Koch and Paul
Erlich in 1882 when they developed acid-fast stain as a means to identify M.
tuberculosis under the microscope (Tang and Stratton, 2007). With certain
modifications, this technique is still being used for sputum smear examination as a
first step for the diagnosis of pulmonary tuberculosis especially in resource poor
settings where majority of the disease burden lies. Either light microscope (LM) or
fluorescent microscope (FM) can be used to examine the respiratory samples.
Fluorescence microscope has higher sensitivity as compared to light microscope but it
is more expensive and needs a dark working place. Recent development of light
emitting diodes (LED) has led to the development of LED FM that does not need dark
room (Drobniewski et al., 2012). However, microscopic technique has a limitation of
low sensitivity as it can detect 5000-10000 bacilli per ml of specimen (Bates, 1979)
which is far higher number than is required for the culture. Sensitivity of the
microscopy can be increased by sputum induction methods, sample concentration and
by fluorescent microscopy (Davies and Pai, 2008).
A meta-analysis found the sensitivity of conventional microscope in the range
of 32-94%, and sensitivity of fluorescence microscopy as 52-97% while specificities
were found to be 94-100% for both microscopes (Steingart et al., 2006).
13
1.10.3 Culture
M. tuberculosis culture is considered “the gold standard” for the diagnosis of
tuberculosis. Clinical specimens of both pulmonary and extra-pulmonary TB patients
could be cultured (Palomino, 2005). The threshold of detecting M. tuberculosis is 10-
100 organisms (Bates, 1979) which is far less to that of the microscopy. Therefore,
the cultivation of M. tuberculosis is more effective as a diagnostic tool as it has not
only high sensitivity of 93% with specificity of 98% but it also allows speciation,
drug sensitivity testing and genotyping for epidemiological purpose (Davies and Pai,
2008; Palomino, 2005).
There are three types of media used for M. tuberculosis culture
1. Solid media, with coagulated egg (Lowenstein-Jensen (LJ) media)
2. Agar based media (Middlebrook 7H10 and 7H11)
3. Liquid based media (Middlebrook 7H12)
The main problem associated with cultivation of M. tuberculosis is slow
growth of bacteria with a doubling time of 24 hours that hampers rapid diagnosis. The
solid media may take up to 4-8 weeks to show visible colonies of M. tuberculosis.
This time period can be reduced up to 2 weeks using liquid media but still it is a long
time in perspective of diagnosis (Davies and Pai, 2008). However, liquid culture is
more prone to contamination as compared to solid media. Recently, use of automated
liquid culture systems like MB/BacT and BACTEC™ MGIT™ 960 for cultivation of
M. tuberculosis has considerably improved the sensitivity and time of detection as
compared to solid media (Palomino et al., 2008). But these systems are expensive and
cannot replace LJ media in resource-poor settings.
1.10.4 Immunological assays
1.10.4.1 Purified protein derivative (PPD) test
Tuberculin PPD is a cocktail of proteins, prepared from the culture filtrates of
M. tuberculosis. PPD is utilized to detect the tuberculosis infection and is known as
14
Mantoux test or tuberculin skin test (TST). This test involves injecting a small amount
of tuberculin under the skin on lower part of the arm. The reaction to the testing fluid
is measured after two to three days. If there is a small bump and redness where the
tuberculin was injected, it is measured to find out if the test reaction is positive or
negative (Landry and Menzies, 2008). The main disadvantage of the tuberculin skin
test is its lack of sensitivity, particularly in immunocompromised individuals and the
poor specificity because of antigenic cross reactivity with Bacillus Calmette-Guérin
(BCG) vaccination (Chapman et al., 2002).
1.10.4.2 Interferon gamma release assays (IGRA)
Development of interferon γ release assay (IGRA) has addressed some of the
difficulties due to TST. The principle of the assay is based on the fact that T-cells
sensitized with tuberculosis antigen release INF-γ when are re-exposed to
mycobacterial antigens. This INF-γ is measured to detect M. tuberculosis. These
assays are more specific than TST as the antigens used are encoded by region of
difference 1 (RD1) which is not present in BCG and most of other mycobacteria. The
commercially available assays are in two formats: QuantiFERON-TB Gold In-Tube
assay (Cellestis, Carnegie, Australia) which is ELISA based IGRA (INF-γ is
measured in whole blood after sensitization of T cells with M. tuberculosis specific
antigens) and T-SPOT (Oxford Immunotec, Abingdon, UK) which is ELISPOT based
IGRA (INF-γ producing T cells are individually counted) (Drobniewski et al., 2012).
A meta-analysis showed a pooled sensitivity of 78% for QuantiFERON-TB Gold and
70% for QuantiFERON-TB Gold In-Tube while the pooled specificities for
QuantiFERON-TB Gold was observed to be 99% among non-BCG-vaccinated
participants and 96% among BCG-vaccinated participants. The pooled specificity of
T-SPOT.TB was found to be 93% (Pai et al., 2008). More studies are needed to assess
the usefulness of these assays in children, immunocompromised individuals and
patients of extra pulmonary tuberculosis (Palomino, 2005).
1.10.5 Nucleic acid amplification test (NAAT)
The development of nucleic acid amplification techniques is one of the
greatest achievements in the field of molecular biology during past few decades.
These techniques are used for the detection of M. tuberculosis complex with
15
considerable sensitivity, specificity and rapidity in a variety of specimens. These
assays target various gene segments that are specifically present in M. tuberculosis
like 65 kDa protein-encoding gene, (Brisson-Noel et al., 1991), IS6110 element
(Eisenach et al., 1990; Kolk et al., 1992) and mpt64 gene (Dar et al., 1998; Manjunath
et al., 1991; Seth et al., 1996). It should be noted that although presence of multiple
copies of IS6110 element in the genome make it an ideal target for diagnosis but there
are reports about M. tuberculosis strains that lack IS6110 element (Das et al., 1995).
Hence, the use of IS6110 as diagnostic marker should be considered carefully. Several
assays are commercially available like Amplified MTD artus® M. tuberculosis LC
PCR Kit (QIAGEN, Hilden, Germany), COBAS® zero-band strains TaqMan® MTB
Test (Roche Molecular Diagnostics, USA), COBAS AMPLICOR PCR system (Roche
Molecular Diagnostics, USA) and BD ProbeTec™ ET (Becton Dickinson, USA).
NAAT are known to have higher sensitivity and specificity for smear positive disease
while lower for smear negative disease. In a study conducted in USA, sensitivity and
specificity of the NAAT in smear positive patients was found to be 96% and 95.3%
while in smear negative patients, it was 79.3% and 80.3%, respectively (Laraque et
al., 2009). Another study reports the sensitivity and specificity of NAAT as 80% and
98-99%, respectively with a threshold of as low as 10 bacilli per sample (Davies and
Pai, 2008). Nucleic acid amplification techniques are now extensively being used for
the detection of pathogens in clinical specimens because of low turnaround time, high
sensitivity, reliable specificity and being relatively safe.
1.11 DNA fingerprinting of M. tuberculosis
DNA fingerprinting/genotyping is the determination of genotypes of an
individual by using various biological assays. In case of tuberculosis, fingerprinting
methods have proven to be valuable tools for TB control. They have their role both in
individual patient management as well as in controlling the disease transmission at
community level. At the individual management level, the DNA fingerprinting
enables the detection (Allix et al., 2004) or exclusion (Loiez et al., 2006) of laboratory
errors and the follow-up of relapse cases to identify treatment failures, exogenous
reinfections and reactivations of latent disease. At the community/population level,
DNA fingerprinting helps to detect the potential outbreaks and the identification of
transmission dynamics and secondary cases of infection (Barnes and Cave, 2003).
16
DNA fingerprinting has unveiled the clonal population structure of M.
tuberculosis complex, which consists of distinct phylogenetic lineages. These lineages
are characterized by differences in their geographical distributions, virulence,
immunogenicity and associations with MDR-TB (Filliol et al., 2006; Gagneux and
Small, 2007; Hirsh et al., 2004; Reed et al., 2004; Supply et al., 2003; van Soolingen
et al., 1995). On the other hand, quantitative analysis of fingerprinting data may also
help for the identification of emerging strains (Tanaka and Francis, 2006). From a
research perspective, the accurate identification of specific clones worldwide may
contribute to the development of new tools in the fields of diagnostics, prophylactic,
and therapeutics for TB control (Allix-Beguec et al., 2008). Brief description of some
of the important fingerprinting methods used for M. tuberculosis is given below:
1.11.1 IS6110 restriction fragment length (IS6110 RFLP) polymorphism
The presence of repetitive elements in the genome of M. tuberculosis and their
potential use for fingerprinting was first discovered independently by Eisenach et al.,
(1988) and Zainuddin and Dale (1989). Thierry et al., (1990a,b) for the first time
reported the sequence of this element, named. Sequencing of element, isolated by
Zainuddin and Dale was carried out independently by McAdam et al., (1990) and it
was named as IS986. Subsequently, a related element was sequenced form M. bovis
and was named IS987 (Hermans et al., 1991). These three sequences were found to
have the difference of only few base pairs and were considered essentially the same
elements given the name of IS6110.
DNA fingerprinting using IS6110 involves bacterial growth, extraction of
DNA, digestion of DNA, agarose gel electrophoresis, Southern hybridization and
detection of IS6110 element with a labelled probe. PvuII is considered as the standard
enzyme for the digestion since it cleaves IS6110 element only once. Use of 0.9-10 kb
ladder is standardized along with the probe that binds to the right side of the PvuII
enzyme site (Figure 1.6) (van Embden et al., 1993). Polymorphisms of IS6110 are
based on the variation of the copy numbers and the molecular weights of the
fragments in which IS6110 element is located. In population-based studies, isolates
that share the same IS6110 RFLP pattern are considered to be clustered and hence
epidemiologically linked (Daley et al., 1992; Small et al., 1994; Small et al., 1993).
17
Figure 1.6 Physical map of IS6110 element (van Embden et al., 1993)
Use of IS6110 DNA fingerprinting has been documented in many studies
(Case et al., 2013; Green et al., 2013; Hu et al., 2010; Purwar et al., 2011; Shamputa
et al., 2010; Sukkasem et al., 2013). IS6110 DNA fingerprinting, though highly
discriminatory, is associated with several drawbacks. This technique is time
consuming, labour intensive and requires large quantity of DNA. Mature cultures are
required for the supply of sufficient quantity of DNA which limits the use of this
method in real time out break investigation. It lacks the discriminatory power for the
strains that have fewer or no IS6110 insertion elements. Further, the lack of
reproducibility and difficulty in comparing generated patterns in an RFLP DNA
fingerprint database remain important limitations (McNabb et al., 2002).
1.11.2 Polymorphic GC-rich repetitive sequence (PGRS) genotyping
Polymorphic GC-rich repetitive sequence (PGRS) is the most abundant
repetitive element in the MTBC. It has many copies (De Wit et al., 1990; Poulet and
Cole, 1995; Ross et al., 1992) and consists of several tandem repeats of a 96 bp GC-
rich consensus sequence. PGRS elements are present at 26 sites in M. tuberculosis
genome (Poulet and Cole, 1995). This method is similar to the standardized IS6110
fingerprinting in that it also requires purified DNA for blotting and banding pattern
analysis. A recombinant plasmid pTBN12 containing the GC-rich consensus sequence
is used as a probe (Yang et al., 2000). PGRS fingerprinting method has proven to be
useful for differentiating M. tuberculosis strains that possess fewer than six copies of
IS6110 and hence could not readily be differentiated by IS6110 fingerprinting method
(Barnes et al., 1997; Braden et al., 1997; Burman et al., 1997; Chaves et al., 1996; van
Soolingen et al., 1993). Compared with IS6110 RFLP fingerprinting, PGRS RFLP
method produces many more bands with different intensities hence, making PGRS
fingerprint analysis difficult and impracticable (Yang et al., 2000).
18
1.11.3 Mycobacterium Interspersed Unit Variable Number Tandem Repeat (MIRU-VNTR) analysis
The mycobacterial interspersed repetitive units occur in variable number
tandem repeats (VNTR) that consist of multiple loci scattered throughout the genome.
It is believed that MIRU-VNTR are reminiscent of human microsatellites which are
often hyper-variable and may have an evolutionary function. The 41 MIRUs
identified by comparative sequence analysis of strains H37Rv, CDC1551, M. bovis
strain AF212/97, and 31 M. tuberculosis clinical isolates have been reported (Supply
et al., 2000). Various combinations of MIRU-VNTR loci have been used to find the
most discriminatory and phylogenetically informative set of loci (Comas et al., 2009).
Three sets of MIRU-VNTR were formulated in an effort to attain maximum strain
discrimination which includes 12 loci (Supply et al., 2001), 15 loci and 24 loci
(Supply et al., 2006).
MIRU-VNTR analysis is based on PCR amplification and determination of the
number of repeats at different loci. Comparison of the product sizes is done with a
molecular size marker on agarose gel. Isolates with different number of repeats are
easily discriminated by PCR analysis as the sizes of the MIRU repeats range from 51
to 77 bp (Lee et al., 2002). MIRU-VNTR fingerprinting has several advantages over
the use of gold standard IS6110 fingerprinting method as it is easy to set up and yields
results within a day. Moreover, it is relatively inexpensive and can easily be adopted
by a standard molecular biology laboratory even in resource poor countries. Results
are obtained in the form of numerical data that are portable. Another advantage is that
it is able to discriminate isolates with fewer copies of IS6110 for which IS6110 RFLP
typing is known to have limited discriminatory power (Das et al., 1995). This method
has a discriminatory power close to that of IS6110 RFLP (Cowan et al., 2002;
Hawkey et al., 2003; Kremer et al., 1999; Savine et al., 2002; Supply et al., 2001) and
has the ability to split certain IS6110 clusters. This suggests that the use of IS6110
alone may overestimate the existence of transmission clusters (Barlow et al., 2001;
Cowan et al., 2002; Gascoyne-Binzi et al., 2001; Hawkey et al., 2003; Kwara et al.,
2003; Lok et al., 2002). Hence, MIRU-VNTR fingerprinting method has been
proposed as an efficient first line genotyping method that should be followed by
19
IS6110 RFLP subtyping of the resulting MIRU-VNTR clusters (Cowan et al., 2002;
Savine et al., 2002).
Figure 1.7 Variable human minisatellite‐‐‐‐like regions in the M. tuberculosis genome (Supply et al., 2000)
1.11.4 Spoligotyping
Clustered regularly interspaced short palindromic repeats (CRISPRs) are
series of repetitive structures in bacteria and Archaea composed of exact repeat
sequences 24 to 48 bases long and are separated by unique spacers of similar length
(Hermans et al., 1991; Kamerbeek et al., 1997). Direct Repeat loci (DR) are members
of the CRISPR (Jansen et al., 2002). The Direct Repeat locus consists of identical
DRs of 36 bp with each DR being separated by non-repetitive unique spacer DNA of
34 to 41 bp in length that can be assessed using the spoligotyping fingerprinting
method. The order of spacers appears to be about the same among different strains but
insertions or deletions of DR and spacers do occur (Groenen et al., 1993; Hermans et
al., 1991; Kamerbeek et al., 1997).
Spoligotyping involves amplification of entire direct repeat locus with the
labelled DR specific primers. Presence of set of spacers is determined by the
hybridization of the amplified DNA to 43 spacer oligonucleotides, covalently linked
to a membrane. Spoligotypes are determined as the presence or absence of any of
these 43 spacers (Kamerbeek et al., 1997). Variability in the direct repeat locus most
20
likely occurs by one of three mechanisms: homologous recombination between
neighbouring or distant direct variable repeats, DNA replication slippage and IS-
mediated transposition (van Embden et al., 2000). It has been observed that isolates of
MTBC differ in the presence or absence of one or more DR plus the adjacent spacer,
the so-called direct variant repeat (DVR). Hence, homologous recombination between
neighbouring or distant DRs may lead to deletion of one or more discrete DVRs (Fang
et al., 1998; Groenen et al., 1993). Further, the DR region in M. tuberculosis has been
identified as a hotspot of integration of IS6110 element (Fang et al., 1998; Hermans et
al., 1991)
Spoligotyping and MIRU-VNTR typing is routinely being done in several
laboratories as part of TB surveillance programmes leading to the development of
large databases rich in information regarding clinical presentation, risk factors and
strain data (Shabbeer et al., 2012). The most attractive advantage of the method is its
ability to rapidly fingerprint strains without the need to subculture isolates for DNA.
Further, it can also be applied to smear positive sputum samples, hence, reducing the
time required to determine the fingerprint by approximately a month. However, the
drawback of the method is that it has less discriminatory power as compared to
IS6110 fingerprinting (Yang et al., 2000).
1.12 Drug resistance
Discovery of streptomycin (STR) by Selman Waksman in 1944 revolutionized the
treatment of TB (Iseman, 2002). Initially, it was reported to be an efficient drug but
soon it was recognized that use of only streptomycin was not sufficient in most of the
cases.
The use of streptomycin alone results in the elimination of the drug susceptible
bacteria from the population, leaving behind the resistant mutants that flourish
without any competition in their host, a Darwinian selective process of “survival of
the fittest”. Subsequently, these bacteria become the dominant strains (Iseman, 1994).
In the same year when streptomycin was discovered, Jorgen Lehman synthesized the
para-amino salt of salicylic acid (PAS). This agent like streptomycin was found to
have antimicrobial activity and its use was started. One of the first randomized
clinical trials, comparing PAS or STR alone and with the combination of both agents
21
was performed by British Medical Research Council (BMRC). The results showed
that the combination is more effective in achieving cure and preventing drug
resistance than monotherapy (MRC, 1950). This shaped the future anti-TB therapy
substantially.
Figure 1.8 Chromosome of hypothetical strain X of M. tuberculosis and genotyping of M. bovis, the M. tuberculosis laboratory strain H37Rv, and strain X on the basis of IS6110 insertion sequences and mycobacterial interspersed repetitive units (MIRUs) (Barnes and Cave, 2003).
Development of antibacterial drug resistance is an increasing health and
economic concern. It can not only result in treatment failure but the use of antibiotics
for which bacteria are not susceptible can increase the mortality rate in patients.
Further, resistant bacteria can spread MDR-TB in the community making it difficult
to control. Finally, antibacterial drug resistance poses additional cost burden to
individual as well as health care sector.
22
Antibiotics can broadly be divided into four major categories on the basis of
their mode of action:
a) interference with cell wall synthesis
b) inhibition of protein synthesis
c) interference with nucleic acid synthesis
d) inhibition of a metabolic pathway (Neu, 1992)
As the usage of antibacterial agents is increasing so is the complexity of resistance
mechanisms exhibited by bacteria. However, these mechanisms can broadly be
divided into three fundamental categories:
a) enzymatic degradation/modification of antibacterial drugs
b) modification of antimicrobial targets
c) changes in membrane permeability to antibiotics (Dever and Dermody, 1991)
Specific mechanisms that are adopted by M. tuberculosis for resistance against
first line anti-TB drugs will be discussed in section 1.16. Drug resistance in M.
tuberculosis occurs spontaneously and at random (David, 1970). David, in 1970,
calculated the mutation rates in M. tuberculosis H37Rv for four first line anti-TB
drugs i.e. rifampicin, isoniazid, streptomycin and ethambutol using the fluctuation test
of Luria and Delbruk. The average mutation rates calculated were 2.25 × 10-10, 2.56 ×
10-8, 1 × 10-7 and 2.95 × 10-8 mutation per bacterium per generation for rifampicin,
isoniazid, ethambutol and streptomycin, respectively. In the presence of selection
pressure of antimicrobial drugs, resistant organism would get establish in the
population. The resistant organisms will fix in the population due to this advantage if
the selection pressure of antimicrobial drugs is present. The development of drug
resistance is often seen in the non-compliant patients (Mahmoudi and Iseman, 1993).
The bacterial load in a patient of active tuberculosis is likely to range from 107
to 1010 organisms which means that resistant clones are certain to be present in the
population in sufficient number to emerge if mono therapy is used (Chaisson, 2003).
23
On the other hand, the probability of selecting resistant mutants to multiple drugs
decreases exponentially by increase in number of drugs to which M. tuberculosis is
exposed (Schluger, 1996). However, sequential mutations may get accumulated by
administration of monotherapy, inappropriate prescription of treatment regimen and
patient’s non-compliance (Yew, 1999). The subsequent transmission of resistant
strains from index patient to others, most often facilitated by diagnostic delays,
augments the problem (Caminero, 2010)
1.12.1 Types of drug resistance in tuberculosis patients
1.12.1.1 Primary drug resistance
Drug resistance in an individual with tuberculosis who has never been treated
previously with anti-tuberculosis drugs is called primary drug resistance. It may be
due to infection with resistant organisms from another patient.
1.12.1.2 Secondary drug resistance
Secondary drug resistance develops either due to patient’s noncompliance to
treatment or due to administration of inappropriate drug regimen. This is also called
as acquired drug resistance. Malabsorption of anti-TB drugs, inefficient health care
system or malfunctioning of digestive system are the factors that contribute to the
acquisition of secondary drug resistance.
1.12.1.3 Multiple drug resistance (MDR)
Multiple drug resistance is defined as resistance to at least rifampicin and
isoniazid, the two most potent drugs in tuberculosis treatment (Watterson et al., 1998).
Multiple drug resistance arises due to inappropriate management of the disease and
requires long term treatment with less effective, more toxic and more expensive
drugs.
1.12.1.4 Extensively drug resistance (XDR)
XDR is form of TB caused by M. tuberculosis strain resistant to at least
rifampin (RIF) and isoniazid (INH) among the first-line anti-TB drugs as well as
resistant to a fluoroquinolone (FQ), and to at least one of the three injectable second-
24
line drugs (Sun et al., 2008). XDR often results from mismanagement of the MDR-
TB. It is difficult and expensive to treat.
1.13 Epidemiology of Multiple drug resistance
Multiple drug resistance develops in the course of treatment. The main causes
are inappropriate treatment, noncompliance by the patient or use of poor quality
medicines. In 2013, 3.7% of new cases of MDR-TB were reported while the incident
was much higher in the previously treated cases (20%) (WHO, 2013c). According to
WHO statistics, there were 0.5 million new MDR-TB cases in the world in 2011 and
about 60% of these cases were reported in Brazil, China, India, the Russian
Federation and South Africa.
Pakistan, with a population of 177 million, has an estimated MDR-TB incident
rate of 3.4% in new cases while of 32% in retreated cases (WHO, 2013a). The main
reasons for the high rate of MDR-TB are poor socio-economic condition in the
country leading to the noncompliance in patient and over the counter availability of
the drugs.
1.14 Drug susceptibility testing
Availability of rapid and accurate methods for drug susceptibility testing
(DST) is crucial to manage individual cases as well as to control tuberculosis
efficiently. Delays in drug sensitivity testing result in delayed initiation of effective
therapy which is one of the factors contributing to the increased incidence of MDR
tuberculosis. The high infection and death rate associated with MDR tuberculosis
poses an urgent need for MDR-TB case detection (Edlin et al., 1992).
Drug susceptibility testing methods can broadly be divided into two categories:
a) Phenotypic methods
b) Genotypic methods
25
1.14.1 Phenotypic methods
Phenotypic methods rely on detection of growth of M. tuberculosis in the
presence of antibiotics being tested. Three main types of phenotypic methods are
being used:
a) Methods that utilize microscopic observation of growth of M.
tuberculosis in drug free and drug containing media
b) Methods that make use of the lysis with bacteriophages
c) Methods that detect or observe metabolic activity of growing bacteria
(Kim, 2005)
1.14.1.1 Proportion method
In proportion method, mycobacterium isolates are grown on drug containing
as well as drug free media. Number of colonies formed on both the media is counted.
The isolate is classified as drug susceptible if the number of colonies on drug
containing media is < 1% of number of colonies that grow on drug free media. On the
other hand, the isolate is classified as resistant if the number of colonies on drug
containing media is > 10%. If the number of colonies is between 1 and 10% then
isolate is classified as partially resistant. Although proportion method is a reference
standard method, an inexpensive and relatively simple technique but it takes
minimum of three weeks of incubation before an isolate can be designated as drug
susceptible (Yajko et al., 1995).
1.14.1.2 Absolute concentration method
In this method, standardized inoculum is grown on drug free and drug
containing medium that contains gradients of drugs to be tested. The lowest
concentration of the drug that inhibits the growth determines the drug resistance in
terms of minimal inhibitory concentration (MIC). This method is greatly affected by
the viability of the organism.
26
1.14.1.3 Resistance ratio method
In this method, the growth of unknown strain of M. tuberculosis is compared
with that of the reference laboratory strain that is H37Rv. Sets of media are inoculated
with the dilutions of the drugs to be tested and the resistance is determined by
comparing the minimum inhibitory concentration of the test strain to that of the
reference strain. This test is dependent not only to the viability of the strain of the
Mycobacterium but also on the size of the inoculum (Tansuphasiri et al., 2001).
1.14.1.4 E-test
In E-test, drug sensitivity testing is performed using strips that contain
different gradients of the drugs to be tested. The results could be obtained within 6 to
10 days. Although E-test results are easy to interpret and results can be obtained
within 5 days, however, results correlated well with those obtained by the BACTEC
and LJ proportion methods only for INH and RIF. High proportion of false-sensitive
and false-resistant results were observed, mostly for streptomycin (Freixo et al.,
2002). Another study reports the overall agreement between the standard proportion
method and E-test only 48.6% (Verma et al., 2010).
1.14.1.5 Bacteriophage based assay
This assay utilizes the ability of resistant mycobacterium to support infection
by the bacteriophage when they are exposed to drugs while sensitive mycobacterium
will not support the bacteriophage infection. A plaque formation on drug containing
media will indicate the presence of viable resistant isolates while absence of plaque in
the presence of drug containing media will be indicative of susceptible isolates. One
such commercially available assay is FASTPlaqueTB (FPA) assay also called phage
amplification assay (BIOTECH Laboratories). For rifampicin resistance in M.
tuberculosis, a meta-analysis of studies based on the bacteriophage assays showed
sensitivity and specificity of ≥ 95% in 11 of 19 studies while ≥ 95% agreement was
observed with reference in case of 13 out of 19 studies (Pai et al., 2005). But
mycobacteriophage assay had poor susceptibility results for isoniazid with sensitivity
of 80.4% and specificity of 80.8%, hence, the limited usefulness of this assay for
diagnostic purpose (Chauca et al., 2007). Another disadvantage is that phage based
27
methods can be implemented in laboratories with highly trained personnel (Neonakis
et al., 2008).
1.14.1.6 Colorimetric methods
Colorimetric methods are based on the oxidation reduction phenomenon.
Oxidation reduction indicators are added to the media containing the drugs.
Resistance to drug is indicative by the change in colour of oxidation reduction
indicator which is directly proportional to the number of viable isolates in media.
Large number of oxidation reduction indicators is used in colorimetric methods. One
of the first redox indicators to be used was Alamar blue which is blue in colour in the
oxidised state, but turns pink when reduced as a result of bacterial metabolism.
Several tetrazolium salts most important of which is 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyl tetrazolium bromide (MTT) are used. MTT is a yellow coloured compound
in the oxidised state that turns into purple MTT formazan crystals when reduced by
metabolically activity of cells which can be measured with a spectrophotometer
(Palomino et al., 2007).
Recently, nitrate reduction method is gaining attention in colorimetric
methods. This assay is based on the ability of M. tuberculosis to reduce nitrate to
nitrite by nitrate reductase enzyme. After 10 days of incubation of M. tuberculosis on
drug containing media, the reducing ability of mycobacterium is measured by adding
chemical reagent to media. Resistant isolates will reduce the nitrate to nitrite, shown
by the production of pink red colour while absence of the colour will show the
presence of susceptible strains as their growth will get inhibited by drug. Comparison
of nitrate reductase assay to proportion method indicated the turnaround mean time of
10 days with 98.8% overall agreement between two methods (Lemus et al., 2006).
Another study showed 100% rate of susceptibility detection for isoniazid and
ethambutol and 97% for streptomycin and rifampicin (Shikama Mde et al., 2009). In a
comparative study done at National Reference Laboratory of Colombia, MGIT 960
showed the sensitivity and specificity of 100% for isoniazid and 100% and 99.4%,
respectively for rifampicin while NRA showed sensitivity and specificity of 86% and
94.8%, respectively for isoniazid and 100% and 99% for rifampicin (Zabaleta-
Vanegas et al., 2013).
28
1.14.1.7 Radiometric methods
Radiometric assays are based on the use of radioisotopes in detection systems.
One of the most important radiometric systems is BACTEC 460-TB system (BD,
Sparks, MD, USA) that utilizes liquid media. Detection of mycobacterial growth is
carried out by quantitative measurement of the 14CO2, liberated by the metabolism of 14C-labelled substrate present in the medium. Drug susceptibility results can be
obtained within 10 to 14 days (Rodrigues et al., 2007). A meta-analysis showed the
sensitivity and specificity of the BACTEC 460-TB system to be 85.8% and 99.9%,
respectively (Cruciani et al., 2004). Despite reduced turnaround time, the use of
radioactive isotopes and expensive equipment restricted its use in resource poor
settings.
1.14.1.8 Fluorescence based assay
Fluorescence based assays are used as an alternative to radiometric method.
The Mycobacterium growth indicator tube (MGIT) is one such system. A fluorescent
compound sensitive to the presence of oxygen dissolved in the broth is embedded in
silicon on the bottom of tubes. Initially, emission of fluorescence is quenched by the
large amount of dissolved oxygen in the tubes but later on the active consumption of
oxygen by bacteria allows the fluorescence to be detected by ultra violet lamp
(Bergmann and Woods, 1997). BACTEC MGIT-960 is a fully automated system that
can be used for the drug sensitivity testing of first and second line anti-TB drugs. A
multicenter study showed concordance of result obtained by BACTEC MGIT-960 to
the indirect drug susceptibility as 95.1% for isoniazid and 96.1% for rifampicin with
the average reporting time of 11 days (Siddiqi et al., 2012). Since 2007, WHO has
recommended the use of non-radiometric automated liquid media systems (ALMS) in
low and middle income countries. The main drawbacks of ALMS are high associated
cost and continuous supply of commercially manufactured consumables (Drobniewski
et al., 2012).
1.14.2 Genotypic methods
Genotypic methods are based on genetic determinants of resistance in M.
tuberculosis. All the molecular detection based assays are although expensive as
29
compared to that of conventional drug susceptibility tests but they give major
advantages over conventional methods such as (1) reduction in turnaround time (2)
possibilities of automation (3) reduction of biohazard in laboratories. These assays
can provide results within hours to couple of days as compared to that of conventional
methods that provide results in 2 to 8 weeks. This reduction in turnaround time can
help control the spread of drug resistant strains in populations.
1.14.2.1 Single-stranded conformation polymorphism (SSCP)
SSCP utilizes the power and flexibility of PCR. This procedure involves
amplification of specific segment of DNA followed by denaturation and gel
electrophoresis. Presence of mutation in clinical samples is evidenced by different
electrophoretic mobility in a strand under study as compared to that of wild type
strand. This change in electrophoretic mobility is due to change in conformation of
the single stranded DNA caused by change in nucleotide sequence. A strong
correlation was observed between DNA sequencing and SSCP assay with the
sensitivity of 80% and 81.8% for isoniazid and rifampicin, respectively and
specificity of 100% and 92%, for isoniazid and rifampicin, respectively (Cheng et al.,
2007). Another study on finding the mutations associated with pyrazinamide showed
89 to 97% agreement with the four other tests (the Wayne biochemical test, Bactec-
460 automated culture, DNA sequencing, and traditional microbiological broth
culture) for pyrazinamide resistance (Sheen et al., 2009).
1.14.2.2 Hetero duplex analysis
In heteroduplex analysis, DNA from test organism and reference drug
sensitive organism is mixed and denatured. Then it is cooled to produce double
stranded DNA by complimentary base pairing. In the regions of mutations, there
would be mismatching between the two strands: the one from the reference
susceptible strain and the other from the mutant test strain. The resulting heteroduplex
would then have different mobility as compared to that of the homoduplex, formed by
the reference strain that has no mutation, on the denaturing electrophoresis gel. This is
relatively robust method as results could be provided within 24 hours but experience
with this technique is limited to screen rifampicin resistance (Telenti and Persing,
30
1996). Sequencing is ultimately needed to determine the exact type and position of the
mutation.
1.14.2.3 Hybridization based techniques (Line probe assays)
Line probe assays utilize reverse hybridization techniques that involve
targeted amplification of specific fragment of M. tuberculosis followed by
hybridization of PCR product with oligonucleotide probes immobilized on membrane.
Three such commercially available kits are INNO-LiPA Rif.TB (Innogenetics,
Zwijndrech, Belgium), GenoType MTBDR/MTBDRPlus and GenoType MTBDRsl
(Hain Lifescience, Nehren, Germany). Inno-LiPA Rif.TB can provide susceptibility
test only for rifampicin, GenoType MTBDR/MTBDRPlus for rifampicin and
isoniazid and GenoType MTBDRsl for fluoroquinolones. Another commercially
available fully automated reverse transcriptase based system for the detection of M.
tuberculosis and rifampicin resistance is Xpert MTB/RIF assay (Xpert; Cepheid,
Sunnyvale, CA, USA). A study documented the pooled sensitivity of INNO-LiPA
Rif.TB, GenoType MTBDR/MTBDRPlus and Xpert MTB/RIF assay to detect
rifampicin resistance as 93%, 97% and 98%, respectively while pooled specificities as
99%, 98% and 99%, respectively (Drobniewski et al., 2012). A study conducted in
Columbia reported the sensitivity and specificity of the GenoType MTBDRplus assay
from 92 to 96% and from 97 to 100%, respectively. The sensitivity of the GenoType
MTBDRsl assay ranged from 84 to 100% and the specificity from 88 to 100% (Ferro
et al., 2013). In another study, rifampicin resistant strains were identified with 100%
accuracy while isoniazid resistant strains were found with 89% accuracy for high
level resistance but only 17% accuracy for low level isoniazid resistance by
GenoType MTBDR/MTBDRPlus (Brossier et al., 2006).
1.14.2.4 DNA chips
DNA chips are glass surfaces that represent thousands of oligonucleotide
probes arrayed at discrete sites. Detection of mutations is accomplished by coupling
of PCR product with immobilized oligonucleotides on microchips. The number of
probes that can be spotted on chip is so high that these can be designed to screen
every base in the gene and it is just like sequencing on a chip (Fan et al., 2000).
Analysis of 55 rifampicin resistant isolates using DNA chip technology, showed
31
87.3% accuracy and 83.6% concordance relative to DNA sequencing (Deng et al.,
2004). One commercially available assay is TB-Biochip ® MDR. A study reported
that the Xpert and Biochip are similar in accuracy for detecting M. tuberculosis and
rifampicin resistance compared to conventional culture methods (Kurbatova et al.,
2013). The major drawback associated with DNA chip is difficulty in designing the
oligonucleotides that can discriminate at the level of single base mutations under
uniform hybridization conditions (Gerhold et al., 1999; Lipshutz et al., 1995). At the
same time cost of the tools and the expertise needed hamper the use of this tool in
resource poor settings.
1.14.2.5 DNA sequencing
DNA sequencing is considered as reference method to characterize mutations
associated with drug resistance (Kim et al., 2001). In this method, the “hotspot” for
mutations is amplified and the amplicons are subjected to sequencing to determine the
presence and absence of specific mutations. However, the most serious drawbacks of
this method are expensive equipment and expertise needed which make it inefficient
method in cases where either long stretches or large numbers of samples have to be
evaluated.
1.15 Treatment of tuberculosis
Tuberculosis is nowadays mostly treated outside the hospitals. Gone are the
days when long bed rest and journey to the mountains was considered part of
tuberculosis treatment. Currently, a standard short course regimen for tuberculosis, as
recommended by WHO and International Union Against Tuberculosis and Lung
Disease, (IUATLD) requires 6 months (WHO, 2010). It comprises a combination of
isoniazid, rifampicin, ethambutol and pyrazinamide in initial two-months intensive
phase followed by consolidation phase of four months with rifampicin and isoniazid.
The aminoglycoside, streptomycin is not generally recommended in the intensive
phase as a fourth drug because it is not only associated with higher resistance rate as
compared to ethambutol (Quy et al., 2006) but also its requirement of parenteral route
for administration. It is recommended in cases where use of ethambutol is
contraindicated.
32
1.16 Molecular mechanisms of drug resistance
1.16.1 Rifampicin
Rifampicin was discovered in 1963 (Lemus et al., 2004). It is a semi synthetic
compound which is produced by fermentation of the soil mold Streptomyces
mediterranei (Wong et al., 1990). It is backbone of cocktail chemotherapy
recommended by WHO for the treatment of tuberculosis (Vall-Spinosa et al., 1970).
Rifampicin is a potent bactericidal agent that actively kills multiplying
extracellular, intracellular, and semi dormant mycobacteria in tissues. Reduction in
duration of chemotherapy from 12 to 6 months for the treatment of active tuberculosis
and from 9 months to 2-3 months for the treatment of latent tuberculosis was possible
by the addition of rifampicin to anti-TB treatment regimens (Chaisson, 2003). Its
action against dormant bacilli is its unique property (Dickinson and Mitchison, 1981).
At the outset of therapy, majority of organisms replicate actively and therefore are
susceptible to other anti-tuberculosis drugs but in later phase of treatment, the residual
organisms enter the phase of inactive metabolic status thus making them less
susceptible to other drugs (Dickinson and Mitchison, 1981). It is thought that these
dormant organisms undergo brief periods of metabolic reactivation during which
rifampicin can exert its effect on RNA polymerase hampering the cellular function
leading to cell death while other drugs cannot produce any appreciable effect during
such short periods of metabolic reactivation (Mitchison, 2000).
The mechanism of resistance against rifampicin is based on studies on the
DNA dependant RNA polymerase of Escherichia coli (Burgess et al., 1987). DNA
dependent RNA polymerase is a complex oligomer that consists of four different
subunits: α, β, β’, and σ which are encoded by rpoA, rpoB, rpoC, and rpoD genes,
respectively. This enzyme assembles in two forms, holoenzyme (α, β, β’ and σ
subunits) and the core enzyme (α, β and β’ subunits) (Ishihama, 1988). Site specific
transcription is initiated after the recognition of promoter region by σ subunit. The σ
subunit dissociates from holoenzyme after the formation of short oligonucleotide
transcript thus leaving behind the catalytically active core enzyme to finish its job of
producing RNA transcript. Rifampicin targets the β subunit of DNA dependent RNA
polymerase which is essential for chain initiation and elongation. Binding of
33
rifampicin to polymerase subunit, deep within the DNA/RNA channel, results in
blocking of RNA elongation, leading to abortive initiation of transcript (Johnston and
McClure, 1976).
Mutations in the gene that encodes β subunit of DNA dependent RNA
polymerase can lead to rifampicin resistance. These mutations occur in 81 base pair
hotspot region encoding 27 amino acids from 507 to 533 (Ramaswamy and Musser,
1998; Saribas et al., 2003). Mutations in rpoB locus confer conformational changes
that lead to defective binding of the drug and consequently resistance to rifampicin.
Resistance to rifampicin alone is rare (Githui et al., 1993; Mitchison and
Nunn, 1986). In almost 90% of the cases, rifampicin resistance is associated with
isoniazid resistance (Drobniewski and Wilson, 1998). In treatment trials conducted at
British Medical Research Council, primary resistance to isoniazid alone was seen in
5% patients while resistance to rifampin alone was seen in only 0.02% isolates
(Mitchison and Nunn, 1986). Since rifampicin resistance is often found to be
associated with isoniazid resistance, so rifampicin resistance can be used as potential
surrogate marker for the detection of MDR-TB cases (Rossau et al., 1997).
Figure 1.9 Mutations and alleles in rifampicin resistant M. tuberculosis isolates reported by different groups (Cavusoglu et al., 2002)
34
1.16.2 Isoniazid (isonicotinyl hydrazine)
Isoniazid is a corner stone in drug susceptible tuberculosis therapy. It was first
found to be effective in the treatment of tuberculosis in 1952 (Bernstein et al., 1952).
Isoniazid is a pro-drug that requires activation by the catalase-peroxidase enzyme
encoded by the katG gene (Shoeb et al., 1985; Zhang et al., 1992). Catalase per
oxidase also protects bacteria form reactive oxygen species produced by macrophages
(Wengenack and Rusnak, 2001). Activation of INH leads to the formation of
isonicotinoyl acyl radical that combines with NAD+/NADH to form isoniazid-NADH
adduct (INH-NADH) (Scior et al., 2002; Slayden and Barry, 2000; Vilcheze and
Jacobs, 2007). This adduct inhibit the inhA, an enoyl acyl-carrier protein reductase
involved in the biosynthesis of mycolic acids that are key structural components of
the cell wall of M. tuberculosis (Ducasse-Cabanot et al., 2004; Quemard et al., 1991;
Quemard et al., 1995; Rozwarski et al., 1998). Mutations in the peroxidase are
responsible for the development of resistance to INH (Zhang et al., 1993). The hotspot
for mutations in katG gene lies between codons 138 to 328, and codon 315 being the
most common target (Slayden and Barry, 2000). The substitution mutation at codon
315(Ser→Thr) is found in 30–60% of INH resistant isolates (Musser et al., 1996;
Ramaswamy and Musser, 1998; Slayden and Barry, 2000). Mutations in katG gene
result in reduced peroxidase activity that leads to the inability to activate INH. This in
turn results in poor formation of INH-NADH adduct, hence, preventing it from
binding to inhA (Chen and Bishai, 1998).
Mutations in promoter region of inhA gene also contribute to development of
INH resistance. These mutations result in over expression of the inhA gene leading to
low level INH resistance (Larsen et al., 2002). The most common mutations found in
the promoter region of inhA gene are at -8(T-G/A), -15(C-T), -16(A-G), -17(G-T) and
-24(G-T) of which -15(C-T) is the most common (Leung et al., 2006; Schroeder et al.,
2005). It has been observed that 70–80% of INH resistance in M. tuberculosis is
attributed by the mutations in the katG and inhA genes (Ramaswamy and Musser,
1998). In addition to this other chromosomal sites for the INH mutations include
kasA, and oxyR-ahpC intergenic region have been associated with INH resistance but
lower percentages of strains exhibit mutation in these genes (Ramaswamy and
Musser, 1998; Rattan et al., 1998).
35
1.16.3 Ethambutol
Another first line drug which is a key component of the tuberculosis
chemotherapy is ethambutol (S, S)-2,2′-(ethylenediimino)di-1-butanol). Only the
dextro isomer of the drug is biologically active (Blessington and Beiraghi, 1990).
Ethambutol affects the pathway for biosynthesis of M. tuberculosis cell wall. The
putative target is membrane-associated arabinosyl transferases, enzymes which are
involved in biosynthesis of arabinan. Arabinan is component of arabinogalactan
which is an important constituent of cell wall of M. tuberculosis (Khoo et al., 1996;
Takayama and Kilburn, 1989; Wolucka et al., 1994). Three contiguous genes embC,
embA, and embB that come under a single emb operon, encode arabinosyl
transferases. Mutations at codon 306 of the embB have been identified that confer
resistance to M. tuberculosis isolates (Escalante et al., 1998; Mokrousov et al., 2002;
Ramaswamy and Musser, 1998). Mutations at codon 306 are found to be associated
with EMB resistance in 70–90% of isolates (Ramaswamy and Musser, 1998).
1.16.4 Streptomycin (STR)
Streptomycin was the first antibiotic used for the treatment of tuberculosis. It
inhibits protein synthesis. It affects only on extracellular bacilli and is bactericidal in
nature. Streptomycin interacts with 16S rRNA and S12 ribosomal protein (rrs and
rpsL) (Abbadi et al., 2001; Escalante et al., 1998; Finken et al., 1993; Sreevatsan et
al., 1996a). This results in ribosomal changes that lead to the misreading of the
mRNA and inhibition of protein synthesis.
About 65–67% of STR resistant isolates are found to have mutations in rrs
and rpsL gene (Ramaswamy and Musser, 1998). A C-T substitution at positions 491,
512 and 516 and an A-(C→T) transversion at position 513 of rrs gene were observed
in 530 loop (Carter et al., 2000). In rpsL gene, mutations at codon 43
(AAG→AGG/ACG) (Lys→Arg/Thr) and codon 88 (AAG→AGG/CAG)
(Lys→Arg/Gln) are associated with STR resistance. Analysis of STR resistant
isolates for MIC indicates that amino acid substitutions in the rpsL gene are
associated with high level of resistance whereas mutations in the rrs gene are
36
associated with an intermediate level of resistance (Cooksey et al., 1996; Meier et al.,
1996)
1.16.5 Pyrazinamide (PZA)
Pyrazinamide, a nicotinamide analog, was reported to have anti-TB activity in
1952. PZA has sterilizing activity and actively kills the tubercle bacilli in intensive
phase of treatment (Somoskovi et al., 2001). Its introduction in treatment regimen has
resulted in shortening of tuberculosis treatment duration from 12 to 6 months (CDC,
1993). It is a pro-drug that is converted in its active form, pyrazinoic acid (POA) by
the pyrazinamidase (PZase) enzyme encoded by pncA gene. PZA is active at acidic
pH where POA accumulates in the cytoplasm resulting in the lowering of intracellular
pH to a level that inactivates a fatty acid synthase (Zimhony et al., 2004). Mutations
conferring resistance to PZA are scattered throughout the pncA gene thus indicating
absence of any potential hotspot (Scorpio et al., 1997; Scorpio and Zhang, 1996;
Sreevatsan et al., 1997). There are some PZA resistant isolates that do not have
mutation in pncA gene. Further, all the mutations (e.g. 114(Thr→Met)) in pncA gene
do not confer resistance which suggests that there might be other mechanism for
development of PZA resistance. Pyrazinamide susceptibility testing is not being done
routinely in many countries due to technical difficulties. Hence, the real magnitude of
PZA resistance is not known (Johnson et al., 2006).
It is essential for the anti-TB drugs to enter the bacteria to reach their
molecular targets. These drugs cannot penetrate into the mammalian cells therefore
they cannot kill intracellular bacteria (Damper and Epstein, 1981; Heifets and
Lindholm-Levy, 1989). Moreover, these are bactericidal against actively replicating
bacteria, therefore these are effective against extracellular, replicating bacteria (Di
Perri and Bonora, 2004).
1.17 Tuberculosis control strategy
Tuberculosis is not only highly prevalent but is also a leading cause of
mortality throughout the world. Of great concern is the spread of drug resistant TB
that has become a global threat to tuberculosis control programs. Patients’ non-
compliance to the treatment regimen is a major contributing factor towards
37
development of MDR-TB. To increase compliance to therapy, WHO introduced
directly observed therapy scheme (DOTS) in which the patients are supervised while
the medicines are administered. DOTS strategy consists of five important elements as
shown in the figure 1.10.
TB-DOTS has been promoted as global strategy since 1990. Although it was
piloted in Pakistan in 1995 but the progress in TB control was achieved after 2001
when tuberculosis was declared a “National Emergency”. Expanding DOTS in
Pakistan has always proved to be a great challenge. The main obstacle to achieve
implementation of DOTS is weak health care infrastructure primarily due to unstable
political environment of the country. In short the public-private mix DOTS is feasible
in Pakistan but the cost, time and effort required to establish the program is higher
than in developing countries (Naqvi et al., 2012).
Table 1.2 Molecular Mechanism of Resistance in M. tuberculosis
Drug Gene(s) involved
Gene Target(s) Mechanism(s) of action
Rifampicin rpoB RNA polymerase Inhibition of
transcription
Isoniazid
katG Catalase-peroxidase Inhibition of mycolic acid biosynthesis and others effects on metabolism of lipids, carbohydrates and NAD
inhA Enoyl ACP reductase Ndh NADH dehydrogenase
ahpC Alkyl hydroperoxidase
Ethambutol embCAB Arabinosyl transferase Inhibition of arabinoglactan synthesis
Streptomycin rpsL S12 ribosomal protein Inhibition of protein synthesis
Pyrazinamide pncA Nicotinamidase/ Pyrazinamidase
Acidification of cytoplasm and de-energizing the cell membrane
(Yew and Leung, 2008)
38
Figure 1.10 Directly observed treatment, short course (DOTS), 5-part framework (Jassal and Bishai, 2010)
1.18 Objectives of the study
Genotypic methods for DST involve the elucidation of mutations associated
with drug resistance to be used as molecular markers. These mutations are reported to
be geographically distributed. Hence, there existed a need to screen M. tuberculosis
isolates prevalent in population of Pakistan for mutations that can be used as
molecular markers for DST. The present study was designed to fulfil the following
objectives:
1 Identification of the predominant lineages of M. tuberculosis complex in
Pakistan and to trace the transmission dynamics of the disease
2 Elucidation of the most predictive and discriminatory set of MIRU-VNTR
loci for rapid typing of the isolates in this particular geographical setting
DOTS
STRATEGY
Political
commitment
with increased
and sustained
financing
Monitoring and
evaluation
system and
impact
measurement
An effective
drug supply and
management
system
Case detection
through quality
assured
bacteriology
Standardized
treatment with
supervision and
patient support
39
3 Comparison of the performance of the most commonly used databases for
lineage assignment so that the most informative and precise data can more
easily be retrieved by surveillance-laboratories in future studies
4 Establishment and validation of in-house line probe assay to detect
mutations in rpoB gene of M. tuberculosis
5 Characterization of mutations associated with rifampicin, isoniazid,
streptomycin, ethambutol and pyrazinamide in M. tuberculosis isolates
prevalent in Pakistan
40
MATERIALS AND METHODS
Recipes of all the reagents/solutions used in the study are given in the appendix I.
This study was approved by Institutional Ethical Committee of National Institute
for Biotechnology and Genetic Engineering.
2.1 Collection of M. tuberculosis culture isolates and clinical specimens
A total of 545 M. tuberculosis specimens, collected from all the four provinces
of Pakistan, were included in the study. These specimens include M. tuberculosis
culture isolates as well as blood and sputum samples of the individuals suspected to
have tuberculosis on the basis of clinical history. Seventy nine M. tuberculosis culture
isolates were collected form Lahore, 111 from Islamabad and 201 were collected from
Rawalpindi, 42 from Peshawar, 6 from Quetta while 84 were from Karachi (Figure
2.1). Nine culture isolates and 13 clinical samples were collected from Faisalabad.
Sputum samples were collected in sterile vials while blood samples were collected in
vacutainer tubes containing EDTA.
Figure 2.1 Regions from where M. tuberculosis isolates were collected
41
2.2 M. tuberculosis culture on Lowenstein Jenson (LJ) medium from clinical specimens
Reagents
NaOH/N.acetyl-L-cystein solution
2.2.2 Culture of M. tuberculosis from sputum specimens
The first step of culturing M. tuberculosis involves liquefaction and
decontamination of the sputum samples. The recovery of M. tuberculosis from
mucous containing samples like sputum is difficult; hence, NaOH/N-acetyl-L-cystein
is used for gentle digestion and decontamination. The ingredients of
digestion/decontamination solution liquefy the mucous content of the sample and kill
the normal flora.
Method
To liquefy the sputum sample, equal volume of sputum was mixed with
NaOH/N.acetyl-L-cystein solution on a horizontal rocker at medium speed for 20
minutes. To this mixture was added, 1 drop of phenol dye which was neutralized by
10% HCl. This mixture was centrifuged for 1 to 2 minutes at 3000 rpm. The
supernatant was removed and 100 µL of this solution was spread on LJ medium slants
and incubated at 37°C. The media slants were checked for growth every week for a
period of at least 8 weeks.
2.3 Isolation of M. tuberculosis genomic DNA
2.3.1 Extraction of DNA from M. tuberculosis culture (CTAB method)
Reagents
10%SDS
5 M NaCl
24:1 chloroform/isoamyl alcohol
CTAB/NaCl solution
42
SDS/Proteinase K mix
Lysozyme
Method
A loopful of M. tuberculosis colonies on LJ media was taken in 400 µL of 1X
TE buffer in micro centrifuge tube, vortexed for even suspension, heat deactivated for
20 minutes at 80°C and cooled to room temperature. To that suspension was added 50
µL of 10 mg/mL solution of lysozyme. The solution was vortexed and incubated for
at least 1 hour at 37°C. To that was added 75 µL of 10%SDS/Proteinase K solution,
vortexed shortly and incubated for 10 minutes at 65°C. In the next step, 100 µL of 5M
NaCl was added and mixed by inverting the tube. It was followed by the addition of
125 µL of CTAB/NaCl solution (pre-warmed at 65°C), vortexed gently and incubated
at 65°C for 10 minutes. 750 µL of chloroform/isoamyl alcohol (24:1) was added,
mixed by inverting and centrifuged at 4oC for 5 minutes at 12,000×g. The aqueous
phase was transferred to fresh microfuge tube and 450 µL of cold isopropanol, was
added, inverted to mix and was placed at -20oC for 20 minutes. The DNA in the
isopropanol was pelleted by centrifugation at 14,000×g for 15 minutes. The
supernatant was discarded carefully leaving the pellet undisturbed. The pellet was
washed with 1 mL of cold 70% ethanol and centrifuged at 14,000×g for
approximately 15 minutes. The supernatant was removed carefully and the pellet was
air dried and re-suspended in 20 to 80 µL of 1X TE depending upon the size of the
pellet. The DNA was stored at -20°C till further use.
2.3.2 Isolation of M. tuberculosis DNA from blood
Reagents
Digestion buffer
Equilibrated buffered phenol
3 M sodium acetate (NaOAc)
70% ethanol
0.5 M EDTA
43
Method 1
One milliliter blood specimen was added in 2-3 mL of digestion buffer and
incubated overnight at 60oC. It was vortexed for 20 seconds and to 1 mL of the
sample, 0.5 mL phenol was added, vortexed for 30 seconds and centrifuged at 13000
rpm for 5 minutes. The aqueous phase was transferred to fresh microfuge tube,
containing 0.5 mL phenol, vortexed for 20 seconds and centrifuged at 13000 rpm for
5 minutes. The aqueous phase was again transferred to fresh microfuge tube
(approximately 350 µL). To this aqueous phase, 1/10th volume of 3 M NaOAc was
added and mixed. The DNA was precipitated with 800 µL of absolute ethanol at -
20oC for 20 minutes. The DNA was then pelleted by centrifugation at 13000 rpm for
30 minutes at room temperature. The supernatant was discarded and the pellet was
washed with 500 µL of 70% ethanol. The pellet was air dried and the DNA was
suspended in 50-100 µL 1X TE depending upon the size of the pellet and stored at -
20οC till further use.
Reagents
10X Digestion buffer
Triton Tris lysis buffer (TT lysis buffer)
TE buffer
Method 2
500 µL of EDTA blood was treated with equal volume of TT lysis buffer to
remove red blood cells. The mixture was centrifuged at 12000×g for 2 to 3 minutes.
The supernatant was discarded and the pellet was treated again with TT lysis buffer.
The supernatant was discarded and the pellet was washed with 100 µL of TE. The
solution was then treated with 10X digestion buffer and incubated at 65οC for one
hour. The digested specimen was put to boiling for 20 minutes after which 5 µL of
this solution was used in PCR reaction (Kolk et al., 1994).
44
2.3.3 Isolation of M. tuberculosis DNA from sputum
To liquefy the sputum sample, equal volume of sputum was mixed with
NaOH/N-acetyl-L-cysteine solution in 50 mL falcon tube. This tube was placed on
the horizontal rocker at medium speed for 20 minutes. The sample was centrifuged at
12000×g for 10 minutes. The supernatant was removed and the pellet was re-
suspended in 1.5 mL of 1X TE buffer. The tube was vortexed and centrifuged again at
12000×g for 10 minutes. After removing the supernatant, the pellet was re-suspended
in 100 µL of 1X TE buffer. One third volume of the digestion buffer was added in the
sample and was placed in boiling water for 10 minutes. DNA was stored at -20°C till
further use. 5 µL of DNA was used in PCR.
2.4 Analysis of DNA extracted from M. tuberculosis isolates on agarose gel electrophoresis
The quality of extracted DNA was checked by resolving the DNA on agarose gel.
Reagents
Agarose
10XTris borate EDTA buffer (TBE)
6X DNA tracking dye/ DNA loading dye
2.4.1 Gel casting
An adequate volume of electrophoresis buffer (0.5X TBE) was taken in the
electrophoresis tank. 0.8% agarose gel was made for the detection of extracted
genomic DNA, according to the size of gel cast. It was then cooled to 55οC before
pouring in the gel casting tray and the comb was inserted ensuring that no air bubbles
were trapped in the gel. After polymerization of the gel at room temperature, comb
was removed carefully and the gel was placed in electrophoresis chamber containing
0.5X TBE buffer (Sambrook et al., 1989).
2.4.2 Sample application
Two microliter of the genomic DNA was loaded on the gel after mixing with
appropriate amount of 6X DNA loading dye. The migration of DNA in the gel from
the cathode (-ve) to anode (+ve) was monitored by looking at the movement of dye.
45
When the adequate migration had occurred (approximately 3/4th of the length of gel),
the power supply was turned off.
2.4.3 Staining and visualization of gel
Reagents
Ethidium bromide solution
The gel was immersed in ethidium bromide solution (0.5 µg/mL) for
approximately 15 minutes to stain DNA. The gel was then destained in distilled water
(dH2O) for 15 minutes. The DNA was visualized under UV at a wavelength of 254
nm and photographed using gel documentation system (Uvitec USA).
2.5 DNA fingerprinting of M. tuberculosis isolates
2.5.1.1 MIRU-VNTR analysis
A total of 258 isolates were genotyped with MIRU-VNTR using a panel of 24
loci. All MIRU-VNTR loci were amplified with primers specific for sequences
flanking the MIRU units using duplex format developed by Guislain et al.,
(unpublished data). Primer sequences were those reported by Supply et al., (2006).
The primers used for amplification of MIRU-VNTR, their standardized designation,
corresponding loci and quantities used are described in the table 2.1 while PCR
reaction constituents and their concentration is given in table 2.2.
Table 2.1 MIRU-VNTR Loci Designation and Parameters for PCR Primers
Duplex Locus* Primer Code Sequence (5´ to 3´) Tm
(°C) Direction Final conc. (µM)/15µL
Mix 1
2165 ETR A
ATTTCGATCGGGATGTTGAT 52 Forward 1.00
TCGGTCCCATCACCTTCTTA
56 Reverse 1.00
4348 MIRU 39
CGCATCGACAAACTGGAGCCAAAC
63 Forward 0.67
CGGAAACGTCTACGCCCCACACAT
65 Reverse 0.67
46
Duplex Locus* Primer Code Sequence (5´ to 3´) Tm
(°C) Direction Final conc. (µM)/15µL
Mix 2
2461 ETR B
GCGAACACCAGGACAGCATCATG 63 Forward 0.67
GGCATGCCGGTGATCGAGTGG 65 Reverse 0.67
4052 Qub 26
GGCCAGGTCCTTCCCGAT 59 Forward 1.00
AACGCTCAGCTGTCGGAT
55 Reverse 1.00
Mix 3
577 ETR C
GACTTCAATGCGTTGTTGGA 54 Forward 0.67
GTCTTGACCTCCACGAGTGC 60 Reverse 0.67
2059 MIRU 20
TCGGAGAGATGCCCTTCGAGTTAG 63 Forward 0.67
GGAGACCGCGACCAGGTACTTGTA
65 Reverse 0.67
Mix 4
580 ETR D or MIRU 04
GCGCGAGAGCCCGAACTGC 64 Forward 0.67
GCGCAGCAGAAACGTCAGC
60 Reverse 0.67
960 MIRU 10
GTTCTTGACCAACTGCAGTCGTCC
53 Forward 0.67
TACTCGGACGCCGGCTCAAAAT
61 Reverse 0.67
Mix 5
154 MIRU 02
TGGACTTGCAGCAATGGACCAACT 62 Forward 0.67
TACTCGGACGCCGGCTCAAAAT 51 Reverse 0.67
3007 MIRU 27
TCGAAAGCCTCTGCGTGCCAGTAA 63 Forward 0.67
GCGATGTGAGCGTGCCACTCAA
63 Reverse 0.67
Mix 6 1644 MIRU 16
TCGGTGATCGGGTCCAGTCCAAGTA 65 Forward 1.00
CCCGTCGTGCAGC 67 Reverse 1.00
47
Duplex Locus* Primer Code Sequence (5´ to 3´) Tm
(°C) Direction Final conc. (µM)/15µL
CCTGGTAC
2163b Qub 11b
CGTAAGGGGGATGCGGGAAATAGG 65 Forward 0.67
CGAAGTGAATGGTGGTGGCAT
59 Reverse 0.67
Mix 7
2531 MIRU 23
CAGCGAAACGAACTGTGCTATCAC 62 Forward 0.67
CGTGTCCGAGCAGAAAAGGGTAT 61 Reverse 0.67
2401 Mtub 30
AGTCACCTTTCCTACCACTCGTAAC 62 Forward 0.67
ATTAGTAGGGCACTAGCACCTCAAG
62 Reverse 0.67
Mix 8
3192 ETR E or MIRU 31
CTGATTGGCTTCATACGGCTTTA
58 Forward 0.67
GTGCCGACGTGGTCTTGAT
58 Reverse 0.67
2687 MIRU 24 CGACCAAGATGTGCAGGAATACAT
60 Forward 0.67
GGGCGAGTTGAGCTCACAGAA
61 Reverse 0.67
Mix 9
2996 MIRU 26
CCCGCCTTCGAAACGTCGCT 62 Forward 0.67
TGGACATAGGCGACCAGGCGAATA 63 Reverse 0.67
2347 Mtub 29
AACCCATGTCAGCCAGGTTA 56 Forward 1.00
ATGATGGCACACCGAAGAAC
56 Reverse 1.00
Mix 10
802 MIRU 40
GGGTTGCTGGATGACAACGTGT 61 Forward 0.67
GGGTGATCTCGGCGAAATCAGATA
62 Reverse 0.67
3171 Mtub 34 GCAGATAACCCGCAGGAATA
56 Forward 1.00
48
Duplex Locus* Primer Code Sequence (5´ to 3´) Tm
(°C) Direction Final conc. (µM)/15µL
GGAGAGGATACGTGGATTTGAG
59 Reverse 1.00
Mix 11
424 Mtub 04
GTCCAGGTTGCAAGAGATGG 58 Forward 0.67
GGCATCCTCAACAACGGTAG 58 Reverse 0.67
4156 Qub 4156
CTGGTCGCTACGCATCGTG 60 Forward 1.00
TGGTGGTCGACTTGCCGTCGTTGG
67 Reverse 1.00
Mix 12
1955 Mtub 21
AGATCCCAGTTGTCGTCGTC 58 Forward 0.67
CAACATCGCCTGGTTCTGTA 56 Reverse 0.67
3690 Mtub 39
AATCACGGTAACTTGGGTTGTTT 56 Forward 1.00
GATGCATGTTCGACCCGTAG
58 Reverse 1.00
• (Supply et al., 2006).
Reagents 10X Buffer Q
Table 2.2 Reaction Mixture for MIRU-VNTR PCR
Constituents Final
concentration
Volume used(µL)
/15 µL reaction 10X PCR buffer Q 1 X 1.5
2.5 mM 4 dNTPs (Fermentas Cat #R0181) 0.33 mM 2.0
1st pair of primers (5µ M) 0.67 or 1.0 µ M 2 or 3
2nd pair of primers(5µ M) 0.67 or 1.0 µ M 2 or 3
Betaine 5M (Sigma CAS # 107-43-7) 1 M 3.0
Dimethyl sulfoxide (DMSO) 5% 0.75
Taq polymerase (Fermentas Cat #EP0402) 1 unit 0.1
Water 2 or 1
DNA~5 ng ~ 10 ng 2.0
49
2.5.1.2 Thermal profile for MIRU-VNTR PCR
Initial denaturation: 95°C for 5 minutes
Amplification: 35 cycles of following:
95°C for 60 s
61ºC for 30 s
70ºC for 1 min
Extension: 72ºC for 7 minutes
H37Rv DNA was used as positive control and water (no DNA) as negative control.
2.5.1.3 Analysis of PCR products of MIRU-VNTR loci on agarose gel
PCR products of MIRU-VNTR loci were resolved on agarose gel using
methodology as described in section 2.4 except that 2.0% gel was used instead of
0.8%. The size of the PCR products was assessed using DNA markers.
2.5.1.4 Determination of copy number of MIRU-VNTR units
All the isolates were typed based on the number of copies of repeat units of
VNTR. Allele designation table (table 2.3) was used to assign copy numbers for
various VNTR alleles corresponding to size of PCR products. PCR reactions for the
isolates for which duplex format did not prove informative were repeated in simplex
format and allele scoring was done by independent analysis by two persons. The data
generated was entered in the Microsoft Excel files and was exporPted to Bionumerics
software (version 6.6; Applied Maths, Sint-Martens-Latem, Belgium) to analyse
molecular typing results.
50
Table 2.3 Allele Designation Table for MIRU-VNTR Analysis of M. tuberculosis Isolates
0 copy 1 copies 2 copies 3 copies 4 copies 5 copies 6 copies 7 copies 8 copies 9 copies 10 copies
ETR A 2165_75bp 247 322 397 472 547 622 697 772 847 922 ETR B 2461_57bp 178 235 292 349 406 463 520 577 634 691 ETR C 0577_58bp 172 230 288 346 404 462 520 578 636 684
MIRU 02 0154_53bp 455 508 561 614 667 720 773 826 879 932 MIRU 04-ETR D 0580_77bp 176 253 330 407 484 561 638 715 792 869
MIRU 10 0959_53bp 535 590 643 696 749 802 855 908 961 1013 MIRU 16 1644_53bp 618 671 724 777 829 882 935 988 1041 MIRU 20 2050_77bp 514 591 668 745 822 899 976 MIRU 23 2531_53bp 607 661 714 767 820 873 926 979 MIRU 24 2687_53bp 447 500 553 606 659 712 765 818 871 924 MIRU 26 2996_51pb 511 562 613 664 715 766 817 868 919 MIRU 27 3006_53bp 551 604 657 709 762 815 868 921
MIRU 31-ETR E 3192_53bp 545 598 651 704 757 810 863 916 MIRU 39 4348_53bp 593 646 699 752 805 858 911 964 MIRU 40 0802_54bp 407 461 515 569 623 677 731 785 839 893 Mtub 04 0424_51bp 177 218 269 320 371 422 473 524 575 626 Mtub 21 1955_57pb 149 206 263 320 377 434 491 548 605 662 Mtub 29 2347_57bp 179 236 293 350 407 464 521 578 635 692 Mtub 30 2401_58bp 261 319 377 435 493 551 609 667 725 783 Mtub 34 3171_54bp 171 225 279 333 387 441 495 549 603 657 Mtub 39 3690_58bp 225 283 341 399 457 515 573 631 689 747 Qub 11b 2163_69bp 136 205 274 343 412 481 550 619 688 757 Qub 26 4052_111bp 264 375 486 597 708 819 930 1041
Qub 4156 4156_59bp 563 622 681 740 799 858 917
Dark grey coloured boxes show the copy number of H37Rv for corresponding allels
51
2.5.2 DNA fingerprinting by Spoligoriftyping assay
Spoligoriftyping of 457 samples was performed as described by
Gomgnimbou et al. (2012).
2.5.2.1 Principle of spoligoriftyping
Spoligoriftyping is a combination of two preexisting assays “Spoligotyping”
and “Rifoligotyping” which allows simultaneous detection of polymorphism in
clustered regularly interspersed palindromic region (CRISPR) and in rifampicin
resistance determining region (RRDR) of rpoB gene as shown in the figure 2.2. The
direct repeat locus, a member of CRISPR loci genetic family and RRDR is
simultaneously amplified and is allowed to hybridize with specifically designed
capture probes, corresponding to 1 to 43 spacers and most frequent mutations in
“hotspot region” of rpoB gene targeting codon 531, 526 and codon 516. In addition to
this, use of spanning probes allows the detection of other potential mutations in
RRDR of rpoB gene. The absence of any spacer in DR region would lead to the
negative hybridization signal for any of the corresponding probe while presence of
specific spacer would show positive hybridization signal. Similarly, presence of any
single nucleotide polymorphism (SNP) in RRDR region would give negative
hybridization signal for any one of the wild types panning probe and willgive positive
hybridization signal for corresponding mutant probe. The absence of hybridization
signal for both wild type as well as corresponding mutant probe would indicate the
presence of mutation other than the targeted one. Hence, a rifampicin susceptible
clinical isolate must show a wild type profile i.e. positive signal for all the wild type
probes while a rifampicin resistant isolate must show absence of positive signal for at
least one wild type probe.
Luminex200 is a flexible analyzer system based on the principle of flow
cytometry that allows the user to multiplex up to 100 analytes in a single microplate
well. The whole system is a combination of three core xMAP technologies:
• xMAP microspheres are 5.6 micron polystyrene microspheres that act
both as the identifier and the solid support to build the assay
52
• Luminex200 analyzer includes key xMAP detection components such
as lasers, optics, fluidics and high-speed digital signal processors
• xPONENT® software, which is designed for protocol-based data
acquisition with robust data regression analysis
(http://www.luminexcorp.com/Products/Instruments/Luminex100200/)
Figure 2.2 Schematic representation of spoligoriftyping principle (Gomgnimbou et al., 2012)
Microspheres are color coded with precise concentration of various
fluorescent dyes and are coupled with the specifically designed oligonucleotides.
These are allowed to hybridize with PCR product, labeled with the fluorescent
reporter molecule. When these microspheres pass through the analyzer system, red
laser or LED excites the internal dyes to distinguish the microsphere set and a green
laser or LED excites the fluorescent dye on reporter molecule. A high speed digital
signal processer identifies each microsphere and quantifies the fluorescent signal of
53
the reporter
(http://www.luminexcorp.com/prod/groups/public/documents/lmnxcorp/082-xmap-
tech-sell-sheet.pdf).
2.5.2.3 Oligonucleotides used for spoligoriftyping assay
DNA probe sequences used in spoligoriftyping were those described by
Kamerbeek et al., 1997 and Gomgnimbou et al., 2012. All the oligonucleotides had 5´
amino group modification along with 12 carbon spacer linker. This spacer linker increases the
space between microspheres and oligonucleotides for better hybridization. The detail of the
oligonucleotides is given in the table 2.4.
Table 2.4 Parameters of Oligonucleotides used for Spoligoriftyping Assay
Probe Name Genome Spacer
No. Sequence 5´ to 3´ Tm (oC)
- 1 ATAGAGGGTCGCCGGCTCTGGATC 67
- 2 CCTCATGCTTGGGCGACAGCTTTTG 65
- 3 CCGTGCTTCCAGTGATCGCCTTCTA 65
- 4 ACGTCATACGCCGACCAATCATCAG 64
- 5 TTTTCTGACCACTTGTGCGGGATTA 60
- 6 CGTCGTCATTTCCGGCTTCAATTTC 62
- 7 GAGGAGAGCGAGTACTCGGGGCTGC 70
- 8 CGTGAAACCGCCCCCAGCCTCGCCG 74
- 9 ACTCGGAATCCCATGTGCTGACAGC 65
- 10 TCGACACCCGCTCTAGTTGACTTCC 65
- 11 GTGAGCAACGGCGGCGGCAACCTGG 72
- 12 ATATCTGCTGCCCGCCCGGGGAGAT 69
- 13 GACCATCATTGCCATTCCCTCTCCC 65
- 14 GGTGTGATGCGGATGGTCGGCTCGG 70
- 15 CTTGAATAACGCGCAGTGAATTTCG 60
- 16 CGAGTTCCCGTCAGCGTCGTAAATC 65
- 17 GCGCCGGCCCGCGCGGATGACTCCG 77
- 18 CATGGACCCGGGCGAGCTGCAGATG 70
- 19 TAACTGGCTTGGCGCTGATCCTGGT 65
- 20 TTGACCTCGCCAGGAGAGAAGATCA 64
- 21 TCGATGTCGATGTCCCAATCGTCGA 64
54
Probe Name Genome Spacer
No. Sequence 5´ to 3´ Tm (oC)
- 22 ACCGCAGACGGCACGATTGAGACAA 65
- 23 AGCATCGCTGATGCGGTCCAGCTCG 69
- 24 CCGCCTGCTGGGTGAGACGTGCTCG 72
- 25 GATCAGCGACCACCGCACCCTGTCA 69
- 26 CTTCAGCACCACCATCATCCGGCGC 69
- 27 GGATTCGTGATCTCTTCCCGCGGAT 65
- 28 TGCCCCGGCGTTTAGCGATCACAAC 67
- 29 AAATACAGGCTCCACGACACGACCA 64
- 30 GGTTGCCCCGCGCCCTTTTCCAGCC 72
- 31 TCAGACAGGTTCGCGTCGATCAAGT 64
- 32 GACCAAATAGGTATCGGCGTGTTCA 62
- 33 GACATGACGGCGGTGCCGCACTTGA 69
- 34 AAGTCACCTCGCCCACACCGTCGAA 67
- 35 TCCGTACGCTCGAAACGCTTCCAAC 65
- 36 CGAAATCCAGCACCACATCCGCAGC 67
- 37 CGCGAACTCGTCCACAGTCCCCCTT 69
- 38 CGTGGATGGCGGATGCGTTGTGCGC 70
- 39 GACGATGGCCAGTAAATCGGCGTGG 67
- 40 CGCCATCTGTGCCTCATACAGGTCC 67
- 41 GGAGCTTTCCGGCTTCTATCAGGTA 64
- 42 ATGGTGGGACATGGACGAGCGCGAC 69
- 43 CGCAGAATCGCACCGGGTGCGGGAG 72
Spa_wt1 - AGCCAGCTGAGCCAATTC 55
rpoB_516 wt - AATTCATGGACCAGAACA 48
rpoB_516 mutGTC - AATTCATGGTCCAGAACA 48
Spa_wt2 - AGAACAACCCGCTGTCGG 57
rpoB_526 wt - GGGTTGACCCACAAGCGCC 62
rpoB_526 mutGAC - GGGTTGACCGACAAGCGCC 62
rpoB_526 mutTAC - GGGTTGACCTACAAGCGCC 60
rpoB_531 wt - CCGACTGTCGGCGCTGGG 64
rpoB_531 mutTTG - CCGACTGTTGGCGCTGGG 62
rpoB_531 mutTGG - CCGACTGTGGGCGCTGGG 64
55
2.5.2.4 Coupling of oligonucleotides to microspheres
Reagents
0.1M 2-(N-morpholino) ethane sulfonic acid, pH 4.5 (MES)
Method
All the microspheres were handled in dark. The stock solution of microsphere
(400 µL) was transferred to appropriately labelled protein low bind microcentrifuge
tube (Fermentas Cat # 022431081) after vortexing and sonication for 20 seconds.
Microspheres were pelleted by centrifugation at 15,300 rpm for 2 minutes. The
supernatant was discarded and the pellet was suspended in 50 µL of 0.1 M MES by
vortexing and sonication for 20 seconds followed by addition of 3.0 µL of 0.1 mM
oligos. For each coupling reaction, 2.5 µL of freshly prepared solution of EDC was
added, mixed by vortexing and was incubated for 30 minutes at room temperature in
the dark. This step was repeated again with freshly prepared solution of EDC. After
30 minutes of incubation, 1.0 mL of 0.02% Tween 20 was added in coupled
microspheres and vortexed briefly. The microspheres were pelleted by centrifugation
at 15,300 rpm for 2 minutes. The supernatant was removed and the coupled
microspheres were resuspended in 1.0 mL of 0.1% SDS by vortexing. The
microspheres were pelleted again by centrifugation at 15,300 rpm for 2 minutes. The
supernatant was removed and coupled microspheres were resuspended in 100 µL 1X
TE by vortexing and sonication for approximately 20 seconds. The coupled
microspheres were stored in dark at 4oC, till further use.
2.5.2.5 Amplification of DR locus and RRDR region of rpoB gene for spoligoriftyping assay
The classical primers were used to amplify DR locus of M. tuberculosis
(Kamerbeek et al., 1997) and hotspot region of β subunit of RNA polymerase gene of
M. tuberculosis was amplified using previously reported primers (Gomgnimbou et al.,
2012). The amplification of DR locus gave a mixture of different sized fragments
since any of the DRs could serve as a target. Amplification of rpoB gene provided 181
bp fragment, encompassing the hotspot region. The primer sequences used for the
56
spoligoriftyping assay along with specific modification and their codes are listed in
table 2.5. The PCR reaction mixture contents and their final concentration are
described in table 2.6.
2.5.2.6 Thermal profile for spoligoriftyping PCR
Initial denaturation: 95°C for 3 minutes
Amplification: 25 cycles of following:
95°C for 30 s
58ºC for 30 s
72ºC for 30 s
Extension: 72ºC for 10 minutes
H37Rv and M. bovis DNA were used as positive control and water (no template) as
negative control.
Table 2.5 PCR Primers for Spoligoriftyping Assay Primer
code Sequence (5´ to 3´) Tm (°C) Modification Direction
DRa GGTTTTGGGTCTGACGAC
55 5´ Biotinylation Forward
DRb CCGAGAGGGGACGGAAAC
59 - Reverse
rpoB_Dfw* CGGTGGTCGCCGCGATCAAGGAIIIIITCGGCA
73 - Forward
rpoB_Drv* CCGTAGTGCGACGGGTGCACGTIIIIIACCTCC
73 5´ Biotinylation Reverse
* rpoB_Dfw and rpoB_Drv primers were designed according to dual priming oligonucleotide principle (DPO) (Chun et al., 2007).
57
Table 2.6 PCR Reaction Mixture for Spoligoriftyping
Constituents Final Concentration
Volume used(µL)/25 µL reaction
10X PCR buffer Q 1 X 2.5
2.5 mM 4 dNTPs (Fermentas Cat #R0181) 0.25 mM 2.5
Primer Dra (10 µ M) 1.0 µ M 2.5
Primer Drb (10 µ M) 1.0 µ M 2.5
rpoB_Dfw (10 µ M) 1.0 µ M 2.5
rpoB_Drv (10 µ M) 1.0 µ M 2.5
5X Betain 1.0 X 5.0
Taq polymerase (Fermentas Cat #EP0402) 1 unit 0.1
Water 2.9
DNA (20 to 40 ng) 2.0
2.5.2.7 Hybridization of oligonucleotides with PCR product
Table 2.7 Reaction Mixture for Hybridization
Constituents Volume(µL)/ Sample
1.5X TMAC 33
1X TMAC 25
1X TE buffer (pH 8.0) 15
1mg/mL Streptavidin-R-Phycoerythrin (Qiagen #922721) 0.025
The stock solution of microspheres was resuspended by vortexing and
sonication. To prepare working microsphere mixture, 1.0 µL of each coupled
microsphere was diluted with 1.0 mL of 1.5X TMAC hybridization solution, vortexed
briefly and sonicated for 20 seconds. To each sample in 96 well plate, 33 µL of
working mixture and 15 µL of 1X TE buffer was added. After this 2.0 µL of PCR
product was added to appropriate wells and reaction mixture was mixed gently by
pipetting. The reaction plate was sealed to prevent evaporation and incubated at 95oC
for 10 minutes and then at 52oC (hybridization temperature) for 20 minutes.
Centrifugation was performed at 3000 rpm for 5 minutes to pellet the microspheres.
58
After that 35 µL of supernatant was removed and the pellet was resuspended in 35 µL
of TE buffer.
The reporter mixture was prepared fresh by diluting streptavidin-R-
phycoerythrin to 1.0 µ g/mL in 1X TMAC hybridization buffer and was added as 25
µL/ reaction. The reaction mixture was mixed by gentle pipetting and the reaction
plate was incubated at hybridization temperature for 5 minutes. 75 µL reaction
mixture was analyzed at hybridization temperature on Luminex200 analyzer
according to the instructions given in the manual.
2.5.2.7 Interpretation of Mean Fluorescence Intensity (MFI) values of Luminex
The results from Luminex were obtained in the form of quantitative mean
fluorescence intensity (MFI) values. These quantitative values were converted into
qualitative positive (indicating presence of target), negative (indicating absence of
target) or undetermined (grey zone: where an expert examination was necessary to
interpret the results) values on the basis of two pre-determined cutoffs (cutoff for
positive values and cutoff for negative values) specific for each marker. These cutoffs
were defined after exploring several positive and negative values and keeping the one
that gave narrowest grey zone as well as 100% sensitivity and specificity as reported
earlier (Gomgnimbou et al., 2012). Final results were displayed in Excel spreadsheet
as string of 53 characters giving the spoligotype pattern (n=43) and rpoB hotspot
mutation pattern (n=10).
2.5.3 DNA fingerprinting with 25 additional spacers of DR locus
To improve the discrimination for the M. tuberculosis complex (MTBC),
isolates were screened with 25 additional spacers. The oligonucleotides used were as
described by Zhang et al., (2010). All these oligonucleotides were provided with 5´
amino group modification using 12 carbon spacer linker. The detail of these
oligonucleotides is given in table 2.8.
59
Table 2.8 Parameters of 25 Additional Spacer Oligonucleotides
Sr. No. Genome Spacer
No. Sequence 5´ to 3´ Tm (°C)
1 44 ATGGCACGGCAGGCGTGGCTAGGGG 72
2 45 GTGCGCCGTCGCCGTAAGTGCCCCA 72
3 46 TTTCGACGACAATTCGTTGACCACG 62
4 47 GTTACCGCTGGCGCGCATCATTCAT 65
5 48 CGTGCACATGCCGTGGCTCAGGGGT 70
6 49 CATGCAGCATGCCGTCCCCGTTTTT 65
7 50 TGCTCTTGAGCAACGCCATCATCCG 65
8 51 GGCAAGTTGGCGCTGGGGTCTGAGT 69
9 52 GCGAGGAACCGTCCCACCTGGGCCT 72
10 53 GGAAACGCAGCACCAGCCTGACAAT 65
11 54 GCACTGCAACCCGGAATTCTTGCAC 65
12 55 CCATATCGGGGACGGCGACGCTGCG 72
13 56 ACGCGTCGTGCCATCAGTCAGCGTC 69
14 57 AACACTTTTTTTGAGCGTGGCGCGG 64
15 58 GGGCATCGATCATGAGAGTTGCGTT 64
16 59 CTGGCGACGATTTTCGCTGTTGTGG 65
17 60 AGCACCTCCCTTGACAATCCGGCAG 67
18 61 GGCCTAAGGGTGCTGACTTCGCCTG 69
19 62 ACGACGAGCAGCGGCATACAGAGCC 69
20 63 TTGCATCCACTCGTCGCCGACACGG 69
21 64 TGGTAATTGCGTCACGGCGCGCCTG 69
22 65 ACCATCCGACGCAGGCACCGAAGTC 69
23 66 CACACCACAGCCACGCTACTGCTCC 69
24 67 ACACCGCCGATGACAGCTATGTCCG 67
25 68 CTTCGCGCGGTGTTTCGGCCGTGCC 72
2.5.3.1 Coupling of oligonucleotides to microsphere
Coupling of all these oligonucleotides to microspheres was done as described
previously in 2.5.2.4.
60
2.5.3.2 PCR amplification of DR locus and hybridization of PCR products with the oligonucleotides
Dra and Drb primers were used for the amplification of direct repeat locus of
M. tuberculosis as described previously in section 2.5.2.5. Hybridization and
interpretation of MFI values was done as described previously in section 2.5.2.7 and
2.5.2.7, respectively except that the final results were obtained in the form of string of
25 characters in the Excel spreadsheet giving the pattern of 25 spoligo spacers.
2.5.3.3 Data analysis
The data obtained from 24 loci MIRU-VNTR typing and spoligoriftyping
was entered in the Microsoft Excel spreadsheet and was uploaded in Bionumerics
software (version 6.6; Applied Maths, Sint-Martens-Latem, Belgium). For clustering
analysis, dendrograms were generated using Unweighted Pair Group Method with
Arithmetic Averages (UPGMA) while to have an insight in strain diversity, Minimum
Spanning Tree (MST) using Neighbour Joining (NJ) method was built. The
spoligotypes were identified using International SpolDB4/SITVIT database available
at (http://www.pasteur-guadeloupe.fr:8081/SITVITDemo/). Families and lineages
were assigned by comparing the observed profile with those contained in database.
The data obtained from 25 additional spacers was also entered in the Microsoft Excel
spreadsheet. The data was then assessed for its use in strain discrimination.
2.6 Determination of recent transmission index (RTI)
The percentage of cases due to active transmission can be calculated by the
number of clustered strains in a population using (n-1) formula (Small et al., 1994).
Where Nci stands for total number of strains in clusters, Nc for total number of clusters
and N for total number of strains. The data obtained by 43 spacer spoligotyping and
24 MIRU-VNTR typing was utilized to calculate the index of recent transmission
using 100% locus identity and single locus variant (SLV). Isolates from Faisalabad
and Lahore were handled collectively to find out the RTI as both are not only
neighbouring cities but are also related to each other socio-economically. RTI was
calculated for Lahore + Faisalabad and Rawalpindi while a cumulative RTI, to have
61
an overall picture of the disease transmission dynamics of the province of Punjab, was
also calculated (using isolates from Rawalpindi, Lahore and Faisalabad).
2.7 Hunter and Gaston discriminatory index (HGDI)
Hunter and Gaston index (Hunter and Gaston, 1988) was used to assess the
discriminatory power of each typing method, to calculate the allelic diversity of
MIRU-VNTR loci and to select “fast lane” screening MIRU-VNTR markers using
following equation:
( ) ( )
1
11 , 1
1
s
j
D nj njN N =
= − − −
∑
Where D is the numerical index of discrimination, N is the total number of
strains in the typing scheme, s is the total number of different strain types, and nj is
the number of strains belonging to the jth type. MIRU-VNTR loci were designated as
highly (HGDI>0.6), moderately (HGDI 0.3–0.6) and poorly discriminatory
(HGDI<0.3).
2.8 Lineage assignation and evaluation of performance of different online tools
Reference assignation was generated by the expert visual inspection using the
43 spacer spoligotype pattern only and applying the rules as defined by Filliol et al.
(2002). This procedure was performed like experts of SITVITWEB but including
some knowledge acquired by the scientific community. For instance, patterns
previously coined as Haarlem4 (H4) should be renamed Ural because they share no
phylogenetic relationships with true Haarlem isolates such as H1, H2 and H3 (Abadia
et al., 2010). The lineages retained for finest description of TB diversity were Beijing
(also known as East-Asian); CAS (also known as East African and Indian); EAI (also
known as Indo-Oceanic); Euro-American, H (for Haarlem); Euro-American, LAM;
Euro-American, T; Euro-American, Ural; Euro-American, X; Manu.
Performance of three freely accessible databases, SPOLDB4/SITVIT
http://www.pasteur-guadeloupe.fr:8081/SITVITDemo/ (but could have been also
achieved with the more recent interface SITVITWEB), MIRU-VNTRplus
(http://www.miru-vntrplus.org/) and TB-Lineage
62
(http://tbinsight.cs.rpi.edu/run_tb_lineage.html) to assign lineage to 225 isolates
having complete genotype data (both MIRU-VNTR and spoligotyping) were assessed.
Assignations generated by these databases were compared to the reference (Filliol et
al., 2002).
24 loci MIRU-VNTR data was used to assign lineages by MIRU-VNTRplus
using the most similar isolate when applying a maximum categorical distance in the
range 0.17 to 0.3. In contrast, 43 spacer spoligo format was used for lineage
assignation using SPOLDB4/SITVIT and TB-Lineage databases. All these
assignations were entered in Microsoft Excel file. Comparison with the reference
assignation was done by visual inspection and 5 classes were distinguished: 1) not
informative (inability of the database to perform the assignation), 2) incompatible
(different large lineage inferred), 3) imprecise (providing an assignation much more
imprecise than that of the expert), 4) incorrect at a fine scale (providing a fine
assignation incompatible with that of the expert but belonging to the same large
lineage) and 5) true and precise.
2.9 Development of reverse line blot hybridization assay to characterize mutations associated with rifampicin resistance
2.9.1 Principle of reverse line blot hybridization assay
For the detection of rifampicin resistance, oligonucleotides that correspond to
wild type and mutant rpoB gene sequences are immobilized on the membrane. The
hotspot region of the rpoB gene is amplified by PCR. The PCR products get labeled
by biotin labeled primer. The subsequent steps involved the hybridization of the PCR
amplified products to the immobilized oligonucleotides. The PCR product of the
rifampicin sensitive strain will only hybridize to wild type oligonucleotides while
resistant strains will fail to hybridize with any one of the wild type oligonucleotide
and will show hybridization signals with corresponding mutant oligonucleotide.
To link several oligonucleotides to the membrane and subsequently screening
large number of samples, Miniblotter-45 system was used. This miniblotter system
consists of two blocks. One block consists of 45 channels. The membrane is fixed in
between these two blocks and the oligonucleotides are applied in these channels in the
form of parallel lines. To hybridize the PCR product with the oligonucleotides, the
63
membrane is rotated at right angle so that the oligonucleotide lines come
perpendicular to channels. The PCR product is then applied to the membrane through
the channels and is hybridized to the oligonucleotide. Hybridization of the PCR
product with the oligonucleotides is detected by a suitable detection system that gives
positive signals on detecting biotin only with the PCR product that is bound with
oligonucleotides.
Figure 2.3 Principle of reverse hybridization line probe assay to detect mutations in rpoB gene. The oligonucleotides derived from wild type and mutatnt strains are represented by horizontal numbers from 1 to 11. (W=Wild, M=Mutant). The PCR amplified product is represented by horizontal lane. Lane 1-3 represents the pattern of hybridization by rifampicin sensitive strains of M. tuberculosis while lane 4-9 represents the pattern of hybridization by various rifampicin resistant strains of M. tuberculosis. This picture is adopted from Morcillo et al., 2002.
2.9.2 PCR amplification of hotspot region of β subunit of RNA polymerase gene
The hotspot region of the RNA polymerase gene from codon 455 to 582,
encoding amino acid Thr to Asn was amplified using primers listed in table 2.9 and
the reaction constituents as given in table 2.10.
64
Table 2.9 Regular PCR Primer Parameters
Primer code Sequence (5´ to 3´) Tm (°C) Direction
LiPA (OP1)* GAGAATTCGGTCGGCGAGCTGATCC 69.5 Forward
LiPA (OP2)* CGAAGCTTGACCCGCGCGTACACC 71.4 Reverse
(Viveiros et al., 2005)
Table 2.10 Reaction Mixture for Regular PCR
Constituents Final concentration
Volume used(µL) /25 µL
reaction 10X PCR buffer 1X 2.5
25 mM MgCl2 1.5 mM 1.5
2.5 mM 4 dNTPs (Fermentas Cat #R0181) 0.2 mM 2.0
Primer OP1 (100 µ M) 0.32 µ M 0.4
Primer OP2 (100 µ M) 0.32 µ M 0.4
Taq polymerase (Fermentas Cat #EP0402) 1 unit 0.2
Milli Q water 15.0
DNA 3.0
2.9.3 Thermal profile for regular PCR
Initial denaturation: 95°C for 5 minutes
Amplification: 25 cycles of the following:
95°C for 60 s
58ºC for 30 s
72ºC for 30 s
Extension: 72ºC for 10 minutes
H37Rv DNA was used as positive control and water as (no template) negative control.
2.9.4 Nested PCR
The hotspot region of the RNA polymerase gene of M. tuberculosis from
codon 465 to 551, encoding amino acid sequences Arg to His was amplified using
primers listed in table 2.11 and the reaction constituents as given in table 2.12.
65
Table 2.11 Nested PCR Primer Parameters
Primer code Sequence (5´ to 3´) Tm (°C) Modification Direction
LiPA(IP1)* GGTCGGCATGTCGCGGATGG 68.6 Forward
LiPA(IP2)* GCACGTCGCGGACCTCCAGC 70.6 Biotin
(at 3´ end)
Reverse
(Viveiros et al., 2005)
Table 2.12 Reaction Mixture for Nested PCR
Constituents Concentration Volume used(µL) /25 µL reaction
10X PCR buffer 1X 2.5
25 mM MgCl2 1.5 mM 1.5
2.5 mM 4 dNTPs (Fermentas Cat #R0181)
0.2 mM 2.0
Primer IP1 (20 µ M) 0.8 µ M 1.0
Primer IP2 (20 µ M) 0.8 µ M 1.0
Taq polymerase (Fermentas Cat #EP0402) 2 unit
0.2
Water 15.8
DNA 1.0 of regular PCR product
2.9.5 Thermal profile for nested PCR
Initial denaturation: 95°C for 5 minutes
Amplification: 25 cycles of following:
95°C for 60 s
58ºC for 30 s
72ºC for 30 s
Extension: 72ºC for 10 minutes
H37Rv DNA was used as positive control and water (no DNA) as negative control.
66
2.9.6 Analysis of PCR products by agarose gel electrophoresis
PCR products were resolved on agarose gel to find the quality and quantity of
the products using methodology described in section 2.4 except that 1.5% gel was
used instead of 0.8%. The size of the PCR products was assessed using DNA marker.
2.9.7 Reverse hybridization line probe assay
Reagents
20X SSC
20X SSPE
To begin with, Miniblotter-45 was thoroughly cleaned with detergent and soft
brush and was air dried. An appropriately sized Hybond N+ nylon membrane
(Amersham RPN 303N) was cut carefully. Plastic gloves or gloves without powder
were preferred as powder can inhibit the hybridization or cause background. One
corner of the membrane was cut to mark the orientation. Membrane was made wet by
2X SSC and placed in miniblotter system with cushions and screws were hand
tightened. The excess liquid was aspirated. All, except the first and the last slots were
filled with 120 µL of diluted oligonucleotide solutions. The first and the last slots
were filled with diluted drawing ink to mark the position on the membrane. While
filling the slots with oligonucleotide solutions, introduction of bubbles was avoided.
Oligonucleotide solutions were aspirated in the same order as were applied to the
slots. Membrane was removed from the miniblotter using forceps and
oligonucleotides were cross linked using DNA cross linker (Stratagene) keeping DNA
side up.
Biotin labeled nested PCR products were diluted in 2XSSC/0.1%SDS or
5XSSPE/0.5%SDS solution and heat denatured at 95οC for five minutes and snap
cooled on ice. Membrane, along with the supporting cushions, was placed in the
miniblotter in such a way that the slots were perpendicular to the pattern of applied
67
oligonucleotides. The residual fluid was removed from the miniblotter slots by
aspiration. Slots were filled with 120 µL of the diluted PCR products, avoiding the
introduction of bubbles and were allowed to hybridize. After incubation for
hybridization, the samples were aspirated from the slots and the membrane was
removed from the miniblotter. To remove unbound PCR product, membrane was first
washed twice with 2XSSC/0.1%SDS or with 2XSSPE/0.1%SDS for 10 minutes. The
membrane was then washed twice with 0.1X SSC/0.1%SDS or 2XSSPE/0.1%SDS at
55oC for 20 minutes followed by detection of hybridization signals as described in
section 2.9.8.
2.9.8 Detection of the hybridization signals
Reagents
Blocking / washing buffer
Blocking solution
Detection buffer
Substrate solution
2.8.2 Signal Detection
During all steps of the detection, solutions were added in such a quantity that
the membrane was evenly covered with solutions. After hybridization/washing steps,
the membrane was placed briefly on the filter paper to remove excess liquid. The
membrane was placed in rolling hybridization bottle and washed with
blocking/washing buffer for 5 minutes at room temperature with moderate shaking.
The blocking/washing buffer was removed and the membrane was incubated at room
temperature with blocking solution with moderate shaking for 30 minutes. The
blocking solution was discarded and the membrane was incubated with streptavidin-
AP conjugate dilution at room temperature for 30 minutes with moderate shaking.
The membrane was then washed twice with blocking/washing buffer at room
temperature for 15 minutes. The membrane was then incubated in detection buffer at
room temperature for 10 minutes with moderate shaking. This step was followed by
the enzymatic reaction which was performed in dark. The membrane was removed
68
from the rolling bottle and was placed in a dedicated container to perform enzymatic
reaction during which the substrate solution was added from one side of the container
to the membrane. The membrane was evenly covered with the substrate solution and
was placed in the dark at room temperature. The blue-purple precipitate became
visible after 15-30 minutes of incubation but for low intensity signals, longer
incubation period was required. To stop the reaction, the substrate solution was
discarded and the membrane was rinsed with double distilled water. The developed
membrane was air dried to document the results.
2.9.9 Optimization of conditions for reverse hybridization line probe assay
In first experiment, 15 mers oligonucleotides were applied on the membrane
as previously described in section 2.9.7 and allowed to hybridize with 50 µL of PCR
products that were heat denatured after diluting in 100 µL of 2XSSC/0.1%SDS. The
incubation for hybridization was carried out overnight at 42ºC after which the
washing of unbound PCR products and biotin detection was performed.
2.9.9.1 Elimination of non-specific signals
Reagents
Pre-hybridization solution
The previous experiment (section 2.9.7) was repeated with the introduction of
pre-hybridization step to eliminate non-specific binding of the PCR products with the
membrane. After cross linking oligonucleotides to the membrane, the membrane was
incubated in pre-hybridization solution at 42oC for two hours. The membrane was
again fixed in the blotter, the PCR products were hybridized and the chromogenic
signal was detected as described in section 2.9.8.
2.9.9.2 Immobilization of oligonucleotides
Deoxyribo-thymidine (dT) homopolymer tail was added to the
oligonucleotides (up to 50 nucleotides) at 3´end. The longer poly dT tail gives more
efficient binding of oligonucleotides with the nylon membrane after UV crosslinking.
Hence, the 5´ end of the oligos is more accessible to PCR product for hybridization.
The detail of the tailed oligonucleotides is given in Table 2.13.
69
Table 2.13 Parameters of Oligonucleotides used in RHLiPA Amino
acid No. Codon Type Sequence (5´ to 3') Tm (oC)
511 CTG Wild AGCCAGCTGAGCCAA 49
512 AGC Wild CAGCTGAGCCAATTC 46
513 CAA Wild GCTGAGCCAATTCAT 44
515 ATG Wild GCCAATTCATGGACCA 48
516 GAC Wild TTCATGGACCAGAAC 44
522 TCG Wild CCCGCTGTCGGGGTT 55
524 TTG Wild GGGTTGACCCACAAG 49
526 CAC Wild TTGACCCACAAGCGC 49
529 CGA Wild AAGCGCCGACTGTCG 52
531 TCG Wild CGACTGTCGGCGCTG 55
533 CTG Wild TCGGCGCTGGGGCCC 60
511 CTG→CCG Mutant AGCCAGCCGAGCCAA 52
511 CTG→CGG Mutant AGCCAGCGGAGCCAA 52
512 AGC→ACC Mutant CAGCTGACCCAATTC 46
513 CAA→GAA Mutant GCTGAGCGAATTCAT 44
513 CAA→CCA Mutant CTGAGCCCATTCATG 46
513 CAA→CTA Mutant CTGAGCCTATTCATG 44
513 TTC insertion Mutant AGCCAATTCTTCATG 41
512 TTCATG insertion Mutant GCCAATTCATGTTCA 41
513 AATTCA deletion Mutant CTGAGCCTGGACCAG 52
513 AATTCATGG
deletion Mutant CTGAGCCACCAGAAC 49
516 GAC CAG
deletion Mutant ATTCATGAACAACCC 41
518 AAC deletion Mutant GGACCAGAACCCGCT 52
515 ATG→GTG Mutant CCAATTCGTGGACCA 46
516 GAC→TAC Mutant ATTCATGTACCAGAA 38
516 GAC→GTC Mutant TTCATGGTCCAGAAC 44
516 GAC→GCC Mutant TTCATGGCCCAGAAC 46
70
Amino acid No. Codon Type Sequence (5´ to 3') Tm (oC)
516 GAC→ AAC Mutant ATTCATGAACCAGAA 38
522 TCG →CAG Mutant CCCGCTGCAGGGGTT 55
526 CAC→ACC Mutant GTTGACCACCAAGCG 49
526 CAC→CCC Mutant TTGACCCCCAAGCGC 52
526 CAC→CGC Mutant TTGACCCGCAAGCGC 52
526 CAC→CTC Mutant TTGACCCTCAAGCGC 49
526 CAC→TGC Mutant TTGACCTGCAAGCGC 49
526 CAC→TAC Mutant TTGACCTACAAGCG 42
526 CAC→TAC Mutant GTTGACCTACAAGC 42
525-526 ACCCAC→ ACTTAC
Mutant GTTGACTTACAAGCG 44
526 CAC→GAC Mutant TTGACCGACAAG CG 45
529 CGA→CAA Mutant AAGCGCCAACTGTCG 49
531 TCG→TTG Mutant GACTGTTGGCGCT 42
531 TCG→TGT Mutant CGACTGTGTGCGCTG 52
531 CTG→CCG Mutant TCGGCGCCGGGGCCC 63
516 GAC→GAA Mutant TTCATGGAACAGAAC 41
Poly (dT) tailed oligonucleotides (8 pM) were applied to the nylon membrane
using miniblotter 45 and were UV cross linked. To increase the efficiency of binding
of oligonucleotides, different combinations of hybridization buffers and washing
solutions were used. For this, the membrane with immobilized oligonucleotide was
cut into 5 cm wide strips from the same membrane so that the concentration of oligos
or any difference in their binding efficiency does not affect the results while
comparing different combinations of hybridization conditions. The detail of
combinations for different variables is given in the table 2.14.
71
T C G G C G C T G G G G C C C
T T C A T G G A C C A G A A C C G A C T G T C G G C G C T G
G C C A A T T C A T G G A C C A A A G C G C C G A C T G T C G
G C T G A G C C A A T T C A T T T G A C C C A C A A G C G C
C A G C T G A G C C A A T T C G G G T T G A C C C A C A A G
A G C C A G C T G A G C C A A C C C G C T G T C G G G G T TA G C C A G C T G A G C C A A T T C A T G G A C C A G A A C A A C C C G C T G T C G G G G T T G A C C C A C A A G C G C C G A C T G T C G G C G C T G G G G C C C5 0 9 5 1 0 5 1 1 5 1 2 5 1 3 5 # 5 1 5 5 1 6 5 1 7 5 1 8 5 1 9 5 2 0 5 2 1 5 2 2 5 2 3 5 2 4 5 2 5 52 6 5 2 7 5 2 8 5 2 9 5 3 0 5 3 1 5 3 2 5 3 3 5 3 4 5 3 5
Figure 2.4 Distribution of oligonucleotide on hotspot region of rpoB gene
2.9.9.3 Optimization of DNA cross linking time
To check whether the intensity of hybridization signal is dependent on the
time of UV exposure, the nylon membrane with oligonucleotides was divided in three
different sections. The first section was cross linked once, the second section was
cross linked twice and the third section was cross linked thrice with UV cross linker at
auto-crosslink mode (1200 micro joules). Heat denatured PCR products from two
samples were allowed to hybridize in each section followed by signal detection as
described in section 2.9.7 and section 2.9.8. The experiment on membrane strips was
repeated with full sized membrane with the best combination of conditions of
hybridization. For that, the hybridization was carried out at 45oC for half an hour.
Non-specifically bound PCR products were removed by washing twice with
2XSSPE/0.1%SDS at room temperature for 10 minutes and then at 52oC for 10
minutes twice followed by chromogenic detection of hybridization signals.
2.9.9.4 Optimization of the amount of PCR product
PCR products (from 5 to 50 µL) were allowed to hybridize with immobilized
poly (dT) tailed oligonucleotides. All the other conditions were the same as described
in section 2.9.7.
2.9.10 Characterization of mutations in rpoB gene of M. tuberculosis
After optimization of reverse hybridization line blot conditions, 168 samples
were screened under optimized conditions for mutations in rpoB gene associated with
rifampicin resistance in M. tuberculosis isolates from various regions of Pakistan.
These mutations were in codon rpoB 511, rpoB 512, rpoB 513, rpoB 515, rpoB 516,
rpoB 522, rpoB 524, rpoB 526, rpoB 529, rpoB 531 and rpoB 533.
72
Table 2.14 Optimization of Hybridization Conditions
Strip No.
Pre-Hyb (temp. and
time)
PCR product denaturation procedure
Hybridization solution
Hybridization temperature and
time
Washing conditions (twice)
Washing conditions (twice)
1 Yes (42oC for 2 hrs.)
50 µL diluted in 2X SSC/0.1%SDS and heat
denatured
PCR products directly added in pre-hyb. Solution
42oC
overnight
2XSSC/
0.1%SDS
RT/10 min
0.1XSSC/
0.1%SDS
50oC/10 min
2 Same as above
Same as above Same as above 55oC
Overnight Same as above
0.1XSSC/
0.1%SDS
63oC/10min
3 Same as above
Same as above Same as above 45oC
Overnight Same as above
0.1XSSC/
0.1%SDS
53oC/10 min
4 Same as above
Same as above Same as above 50oC
Overnight Same as above
0.1XSSC/
0.1%SDS
58 oC/10min
5 None 50 µL denatured in
NaOH/EDTA 5XSSPE/0.5%
SDS
42oC
Overnight
2XSSPE/
0.1%SDS
RT/10 min
2XSSPE/
0.1%SDS
50oC/10 min
73
2.10 Cloning of PCR amplified hotspot region of rpoB gene from M. tuberculosis
2.10.1 Preparation of competent cells
Reagents
Luria Bertani (LB) medium
Isopropyl Thio-beta-D-Galactoside (IPTG)
5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (Xgal)
Method
To make competent cells, 50 mL of LB medium was inoculated with a single colony
of the E. coli strain DH5α and was cultured overnight at 37°C. On subsequent
morning, pre culture was made by adding 4 mL of overnight culture in 400 mL of the
LB media (1 mL/ 100 mL). The pre culture was incubated in shaker incubator (180
rpm) at 37°C until its optical density (OD) ranged 0.6-0.8 (it took approximately 4
hours to reach the optical density 0.6-0.8). The culture was placed for half an hour on
ice after which it was shifted to pre cooled 50 mL falcon tubes (~ 50 mL in each
tube). The cells were harvested by centrifugation at 4000 rpm for 5 minutes at 4°C.
The supernatant was discarded and the pellet was resuspended in 5-7 mL of 0.1 M
MgCl2 by gentle shaking and centrifuged at 4000 rpm for 5 minutes at 4°C. The pellet
was resuspended in 7 mL of 0.1 M CaCl2 solution and placed on ice for 15-30
minutes. The cells were harvested by centrifugation at 4000 rpm for 5 minutes at 4°C
and resuspended in 3 mL of 0.1 M CaCl2. To that, 1 mL of glycerol was added and
mixed gently. The cells were briefly placed on ice and aliquoted in ice cooled
microfuge tubes using cut tips (50 µL or 100 µL in each tube) and immediately stored
at -80°C.
2.10.2 Ligation
PCR amplified products were cloned in DH5α strain of E. coli using TA
cloning vector pTZ57R (MBI Fermentas). This vector has ampicillin resistance and
blue/white selection marker. PCR products were ligated to the vector as described in
table 2.15.
74
Table 2.15 Ligation Mix
Reagents Final
Concentration
Volume used(µL)/10 µL
reaction
Vector pTZ57R (55ng/ µL) 27.9 ng 0.5
PCR Product - 6.0
10X Ligase buffer 1X 1.0
T4 DNA ligase (5U/µL) 2.5 U 0.5
Double distilled H2O - 2.0
Total 10
Ligation reaction mix was placed at 16°C overnight in circulating water bath.
2.10.3 Transformation
Heat shock method was used for transformation of competent cells of DH5α
E. coli strain. For that, 5 µL of ligation mixture was added in the 50 µL of competent
cells and incubated on ice for 30 minutes. The cells were heated at 42°C for 2 minutes
in dry bath. Cells were incubated on ice for 2 minutes after which 1 mL of LB broth
was added to each sample. Transformation mixture was incubated at 37°C for 1 hour
and then placed at 4°C till further use.
2.10.4 Preparation of LB agar plates
Reagents
LB agar
Ampicillin
Method
300 mL of LB agar media was melted thoroughly and cooled to 60°C. 300 µL
of ampicillin stock solution was added in 300 mL of LB agar media. The medium was
poured in plates and allowed to solidify under sterile conditions.
75
2.10.5 Spreading of transformed cells on LB agar plates
Reagents
IPTG
X-gal
Method
20 µL IPTG solution and 30 µL X-gal solution was poured on the ampicillin
agar plates and spread on the plates by sterile spreader (for immediate use of the
plates, 300 µL IPTG and 300 µL of X-gal were added in melted 300 mL LB agar
media along with the ampicillin and poured in plates to set). Transformation mixture
was centrifuged at maximum speed for 2 minutes. Supernatant was discarded leaving
small volume in which the pellet was resuspended. The cells were then spread on the
LB ampicillin plates with the help of sterile spreader and the plates were incubated
overnight at 37°C.
2.10.6 Liquid culture of E. coli cells
After 14-16 hours of incubation, white colonies were selected and single
colony was inoculated in ampicillin containing LB broth and incubated at 37°C for 14
hours in a shaker incubator.
2.10.7 Isolation of plasmid DNA from E. coli (Miniprep)
Reagents
Resuspension solution
Lysis solution
Neutralization solution
Method
1mL of overnight culture of E. coli was centrifuged at 14000×g for 2 minutes
and the pellet was suspended in 100 µL of resuspension solution by vortexing. 150 µL
of the lysis solution was then added to each tube and samples were mixed by
76
inverting. To the lysed cells, 200 µL of neutralization solution was added to
precipitate the chromosomal DNA. After centrifugation at 14000×g for 10-15
minutes, the DNA in the supernatant was precipitated with 1 mL of chilled absolute
ethanol keeping at -20°C for half an hour. The precipitated DNA was pelleted and
washed with 70% ethanol. The pellet was air dried and dissolved in 50-100 µL water.
2.6.8 Restriction Enzyme Digestion of E. coli plasmid DNA
For confirmation of inserts, isolated plasmid DNA was digested with
restriction enzymes as as given in table 2.15. Restriction mix was incubated at 37°C
for 1 hour and then resolved on 1% agarose gel. The DNA marker was used to see the
size of insert.
Table 2.16 Restriction Mix for Restriction Analysis
Reaction component Final concentration Volume used (µL) /10 µL reaction
DNA - 2.00
EcoR1 (5U/µL) (Fermentas) 1.25 U 0.25
Pst1 (5U/µL) (Fermentas) 1.25 U 0.25
10X Orange buffer (Fermentas) 1X 1.00
RNAase (10 mg/mL) 2.00 µg 2.00
water - 5.50
2.10.8 Isolation of bacterial plasmid DNA
To prepare the samples for sequencing, bacterial plasmid DNA was isolated
using GeneJet plasmid miniprep kit (Fermentas Cat # K0503). The process was
performed after sub culture of the samples according to the instructions given in the
manual. The clones in the pTZ57R vectors were sent for sequencing to Eurofins and
Macrogen.
2.11 DNA Sequencing of hotspot region of rpoB gene of M. tuberculosis
DNA sequencing is considered as the gold standard to find out the mutations
in DNA. PCR amplifications of hotspot region of rpoB gene for 50 samples were sent
to Beckman Coulter Genomics (Takeley, United Kingdom) for sequencing while PCR
products of 46 samples were cloned in TA cloning vector and sent for sequencing.
77
The results were compared with that of spoligoriftyping and reverse hybridization line
probe assays.
2.12 Characterization of mutations associated with isoniazid resistance
High throughput Bio-Plex (Bio-Rad, Hercules, CA) and Luminex 200
(Luminex Corp, Austin, TX) were used for this assay. Oligonucleotides used in the
assay are given in the table 2.17.
Table 2.17 Oligonucleotides used for Characterization of Mutations in katG and inhA genes
Sr. No. Name Sequence 5´ to 3´
1 katG_315 wt GATCACCAGCGGCATCGA
2 katG_315 mut_ACC GATCACCACCGGCATCGA
3 katG_315 mut_AAC GATCACCAACGGCATCGA
4 inhA_-15_Wt GCGAGACGATAGGTTGTC
5 inhA_-15 mut_T GGCGAGATGATAGGTTGT
6 inhA_-8 mut_A GATAGGATGTCGGGGTGA
2.12.1 Coupling of oligonucleotides to microsphere
The oligonucleotides were coupled to microspheres as described previously in
section 2.5.2.4.
2.12.2 PCR amplification of katG and promoter region of inhA gene of M. tuberculosis and hybridization
All the primers used to characterize mutations associated with isoniazid
resistance were designed using DPO principle (Gomgnimbou et al., 2013b). The
primers used to amplify the hotspot region of the katG gene and promoter region of
inhA gene of M. tuberculosis are listed in table 2.18.
Table 2.18 PCR Primers for Amplification of katG and inhA Genes
Primer code Sequence (5´ to 3´)
Tm (°C) Modification Direction
katG_Dfw
AGGCTGCTCCGCTGGAGCAGATGIIIIIGGGCTG
74 Forward
katG_Drev CAAGCGCCAGCAGGGCTCTTCGTIIIIICCCACT
73 5´ Biotinylation Reverse
78
Primer code Sequence (5´ to 3´)
Tm (°C) Modification Direction
inhA_Dfw TCACGAGCGTAACCCCAGTGCGAIIIIICCCGCC
74 Forward
inhA_Drev CCCCCGGTTTCCTCCGGTAACCAIIIIIGAACGG
73 5´ Biotinylation Reverse
All these primers were designed according to dual priming oligonucleotide principle (DPO) (Chun et al., 2007).
The PCR products were hybridized as described previously in section 2.5.2.7.
Quantitative MFI values from Luminex were interpreted in the same way as are
described for spoligoriftyping in section 2.5.2.7.
2.13 Characterization of mutations associated with pyrazinamide resistance using single strand conformational polymorphism (SSCP)
To screen the mutations in pncA gene of M. tuberculosis associated with
pyrazinamide resistance, two sets of primers (table 2.19) were used. The composition
of PCR reaction mix is given in table 2.20 while thermal profiles of these PCR
reactions were used as mentioned in section 2.5.2.6 except to that of difference of
annealing temperature that was set as given in table 2.19. H37Rv DNA was used as
positive control and water “no DNA” as negative control.
Table 2.19 PCR Primers to Amplify pncA gene Primer code
Sequence (5´ to 3´) Tm (°C)
Direction Tm (oC)
pncA1 ATCAGCGACTACCTGGCCGA 60 Forward 56 GATTGCCGACGTGTCCAGAC 60 Reverse
pncA2 CCACCGATCATTGTGTGC 55 Forward 55 GCTTTGCGGCGAGCGCTCCA 54 Reverse
79
Table 2.20 Reaction Mixture of PCR Amplification of pncA Gene
Constituents Final
concentration
Volume used /15µL
reaction (µL)
10X PCR buffer 1.0X 1.5
25 mM MgCl2 1.5 mM 0.9
2.5 mM 4 dNTPs (Fermentas Cat #R0181) 0.2 mM 1.2
Primer F (100 µM) 0.8 µM 0.6
Primer R (100 µM) 0.8 µM 0.6
Taq polymerase(Fermentas Cat #EP0402) 0.6 unit 0.06
Water - 9.44
DNA - 0.7
2.13.1 Denaturation of samples for SSCP
Reagents
Denaturing dye
PCR product (6µL) was added to 20µL of denaturing dye, heat denatured at
95oC and snap cooled on ice. Samples were either used fresh or stored at -20 till
further use. The PncA1 PCR products were run on PAGE with conditions given in
table 2.21.
Table 2.21 Polyacrylamide Gel Composition for SSCP of PncA2 PCR Products
Constituents Volume (µL) used/ 30mL
Acrylamide:bis-acrylamide (30:0.4) stock 6.00
10X TBE 5.80
10% Amonium per sulphate (APS) 0.28
Tetramethylethylenediamine (TEMED) (Sigma CAS # 110-18-9)
0.054
Deionized water 17.38
80
Polyacrylamide gel electrophoresis apparatus was thoroughly cleaned with
detergent and water. Plates were washed with 100% methanol and air dried. After
fixing the apparatus properly, all the constituents including acrylamide/bis-acrylamide
solution, 10X TBE, freshly prepared APS and water were added in the flask and were
thoroughly mixed. After that, TEMED was added and the mixture was immediately
poured between the glass plates ensuring no air bubbles were trapped. A comb was
inserted to make wells. After polymerization of gel, comb was removed carefully and
the apparatus was filled with 1X TBE. The DNA samples and DNA marker were
loaded with loading syringe in the respective wells. Standard DNA ladder was also
run to assess the size of the amplified product. The gel was run at constant voltage
(80V). Migration of the DNA in the gel from the cathode (-ve) to anode (+ve) was
monitored by looking at the movement of dye. Power supply was turned off when the
dye had reached to a distance sufficient for separation of denatured single strands of
DNA (approximately 4 hours).The gel was stained and visualized as described
previously in section 2.4.3 except that gel was stained in ethidium bromide solution
for 15 minutes.
SSCP analysis of PncA2 segment was done using the above mentioned
protocol except that the concentration of polyacrylamide gel used was 7%.
2.14 Characterization of mutations associated with Isoniazid, Ethambutol, Streptomycin and Pyrazinamide with sequencing
DNA sequencing, a gold standard, was used to screen the mutations leading to
resistance for the isoniazid, streptomycin and ethambutol drugs in M. tuberculosis
isolates. Seventy nine isolates (43 isolates showing no mutation while 36 showing
different mutations in hotspot regions as detected by microbead assay) were selected
to screen the hotspot region of katG and inhA genes. Ninety nine streptomycin
resistant (STRR), 37 ethambutol resistant (ETHR) as designated by phenotypic drug
sensitivity and 12 Pyrazinamide (4 PZAS and 8 PZAR as designated by SSCP
analysis) isolates were selected to screen hotspot regions of rrs, rpsL, embB and pncA
for potential mutations. Five isolates showing mobility shift in SSCP analysis could
not be sequenced due to unavailability of DNA.The primers used for amplification of
hotspot regions of these genes are listed in table 2.22. Thermal profiles of these PCR
reactions were used as mentioned in section 2.5.2.6 except to that of difference of
81
annealing temperature that was set as given in table 2.22. Water was used as “no
DNA” negative control. The PCR products were resolved on 1.5% agarose gel and
visualized under UV as described previously in section 2.4.
Table2.22 PCR Primers Used for Amplification of Hotspot Regions of katG, inhA, rrs, rpsL, embB and pncA Genes for DNA Sequencing
Drug Gene Sequence (5´ to 3´) Direction Tm (oC)
Rifampicin rpoB TACGGTCGGCGAGCTGATCC Forward 56 TACGGCGTTTCGATGAACC Reverse
Isoniazid katG GATCGTCGGCGGTCACACTT Forward 58
GAGGTCGGCGAAGGACACTT Reverse inhA ATGGTCGAAGTGTGCTGAGTCA Forward
55 TTGGAGGCTGCGTAGTTGGC Reverse
Streptomycin rrs
TCGGGATAAGCCTGGGAAACTG Forward 55
CGCATTCCACCGCTACACCA Reverse
rpsL GGTATTGTGGTTGCTCGTGCCT Forward
55 GGTGACCAACTGCGATCCGTAG Reverse
Ethambutol embB ACCATCGACACCCGGTTCTCCA Forward
56 ACAGCAGCAGCCAGCACACT Reverse
Pyrazinamide PncA GCGGCGTCATGGACCCTATATC Forward
59 GCCCGATGAAGGTGTCGTAGAA Reverse
Primers for amplification of rpoB gene were derived from the work of Telenti et al., (1993) while rest of the primers were designed in the present study.
Table 2.23 Reaction Mixture of PCR for DNA Sequencing
Constituents Final Concentration Volume
used(µL)/50 µL reaction
10X PCR buffer 1X 5.0
25 mM MgCl2 1.5 mM 3.0
2.5 mM 4 dNTPs (Fermentas Cat
#R0181) 0.2 mM 4.0
Primer F (20 µM) 0.8 µ M 2.0
Primer R (20 µM) 0.8 µ M 2.0
82
Constituents Final Concentration Volume
used(µL)/50 µL reaction
Taq polymerase (Fermentas Cat
#EP0402) 2 units 0.4
Water 31.6
DNA 2.0
2.14.1 Sequencing analysis
PCR amplified products were sent to Beckman Coulter Genomics (Takeley,
United Kingdom) or Macrogen (Korea) for Sanger sequencing. The results of DNA
sequencing were analyzed by SeqScape (Version 2.6; Applied Biosystems) software
for the presence or absence of mutations.
2.15 Statistical analysis
Statistical analysis was done using Chi2 test to assess the correlation between
the mutations at codon 526 of rpoB gene and CAS1-Dehli lineage as well as between
the mutation at codon 315 of katG gene and CAS lineage.
83
RESULTS
3.1 M. tuberculosis culture on LJ slants from clinical samples
Clinical specimens (sputum) of patients suspected for tuberculosis were
cultured during the course of study. Cultures were monitored weekly and the growth
was monitored until eight weeks. Slants showing buff-colored fluffy colonies were
selected and used to extract DNA of M. tuberculosis. Out of 10 sputum samples
cultured, 6 were found to be culture positive. Colonies from these slants were used to
extract DNA for subsequent experiments.
3.2 Description of study subjects
The data about gender was available for 141 patients with male to female ratio
of 1:1. Of the 116 patients for which age data was available, 32 patients were ≤ 20
years old, 61 ≤ 40 years old, 22 ≤ 60 years old and 1 was 80 years old.
3.2.1 Phenotypic drug susceptibility data
A total of 545 isolates were included in the study. The information about the
phenotypic drug sensitivity was obtained from the respective hospitals along with the
culture isolates. Detail of the drug sensitivity about each drug is provided in the
respective sections.
3.3 Analysis of DNA extracted from M. tuberculosis isolates by agarose gel electrophoresis
DNA extracted from M. tuberculosis isolates was resolved on agarose gel to
check the quality of DNA. The DNA obtained was of good quality. This DNA was
used in subsequent PCR reactions.
84
Figure 3.1 Ethidium bromide stained 0.8% gel of extracted DNA of M.
tuberculosis Lane L: 1kb DNA ladder (Fermentas Cat # SM0313) Lane 1-12: M. tuberculosis chromosomal DNA
3.4 Analysis of PCR products of MIRU-VNTR loci
PCR products of MIRU-VNTR loci were analysed by gel electrophoresis to
generate variable number of tandem-repeat allele profiles. Out of 258 isolates, with a
sufficient DNA quality and quantity, 237 gave interpretable results. All (24 MIRU-
VNTR loci could be amplified in 229 isolates. Isolates that did not give results for ≥ 4
markers or those that gave multiple copy number for any of the locus (likely due to
mixed infection or contamination during culture) were excluded from the study
(n=21). The rate of failure of amplification was observed to be the highest for Qub 26
(n=12) followed by Qub 11b, ETR A (n=8) and ETR D (n=5). For MIRU 16 and
MIRU 20, no amplification was observed for 3 isolates despite several efforts.
Figure 3.2 Resolution of ETR A and MIRU 39 PCR amplified products Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14:PCR amplification products, upper bands MIRU 39, lower bands ETR A Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
85
Figure 3.3 Resolution of ETR B and Qub 26 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands Qub 26, lower bands ETR B Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
Figure 3.4 Resolution of ETR C and MIRU 20 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentass Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands MIRU 20, lower bands ETR Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
Figure 3.5 Resolution of MIRU 2 and MIRU 27 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands MIRU 27and lower bands MIRU 2 Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
86
Figure 3.6 Resolution of MIRU 16 and Qub 11b PCR amplified products Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands MIRU 16, lower bands Qub 11b Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
Figure 3.7 Resolution of ETR D and MIRU 10 PCR amplified products Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bpDNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands MIRU 10,lower bands ETR D Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
Figure 3.8 Resolution of MIRU 23 and Mtub 30 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands MIRU 23, lower bands Mtub 30 Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
87
Figure 3.9 Resolution of ETR E and MIRU 24 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands ETR E, lower bands MIRU 24 Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
Figure 3.10 Resolution of MIRU 26 and Mtub 29 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands MIRU 26, lower bands Mtub 29 Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
Figure 3.11 Resolution of MIRU 40 and Mtub 34 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands MIRU 40, lower bands Mtub 34 Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
88
Figure 3.12 Resolution of Mtub 39 and Mtub 21 PCR amplified products
Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands Mtub 39, lower bands Mtub 21 Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
Figure 3.13 Resolution of Mtub 04 and Qub 4156 PCR amplifications Lane L: 100bp+500bp DNA ladder (Fermentas Cat # SM 0653) Lane L´: 100bp DNA ladder (Fermentas Cat # SM 0241) Lane 1-14: PCR amplification products, upper bands Qub 4156, lower bands Mtub 04 Lane 15: “No DNA” negative control; Lane 16: H37Rv as positive control
3.4.1 Allelic diversity of MIRU-VNTR loci
The allelic diversity of the samples was calculated for each of the MIRU-
VNTR locus using Hunter and Gaston discriminatory index (HGDI). Qub 26, MIRU
10, Mtub 04, MIRU 26 and MIRU 31 (ETR E) were found to be highly
discriminatory loci while MIRU 16, Qub 4156, Mtub 21, ETR A, MIRU 39, Mtub 39,
Mtub 30, MIRU 24, Qub 11b, MIRU 40 and ETR C as moderately discriminative
(Table 3.1).. Other loci, including ETR B, MIRU 23, MIRU 04 (ETR D), Mtub 29,
Mtub 34, MIRU 27, MIRU 02 and MIRU 20 showed poor discriminatory power.
89
Table 3.1 Discriminatory Power of MIRU-VNTR Loci
Marker No. of
patterns No. of
clusters
No. of clustered isolates
No. of unique isolates
Size of clusters
Ranking based on
allelic diversity
HGDI
Qub 26 11 9 235 2 2-90 1 0.7801
MIRU 10 8 8 236 1 2-85 2 0.753
Mtub 04 7 5 235 2 4-111 3 0.6943
MIRU 26 11 8 233 4 4-119 4 0.6016
MIRU 31 (ETR E)
7 5 235 2 6-140 5 0.5929
MIRU 16 6 6 234 3 4-141 6 0.5826
Qub 4156 6 4 235 2 11-145 7 0.5654
Mtub 21 8 6 234 3 2-159 8 0.5247
ETR A 8 7 236 1 2-161 9 0.5083
Mtub 39 6 6 237 0 5-162 10 0.4917
MIRU 39 4 4 236 1 2-149 11 0.4896
Mtub 30 4 4 237 0 2-161 12 0.4764
MIRU 24 8 7 236 1 2-171 13 0.4541
Qub 11b 8 7 236 1 2-175 14 0.4412
MIRU 40 6 5 236 1 3-181 15 0.3755
ETR C 5 3 235 2 8-182 16 0.3746
ETR B 4 4 237 0 5-199 17 0.2828
MIRU 23 8 7 235 2 3-204 18 0.2529
MIRU 04 (ETR D)
7 7 232 5 2-210 19 0.2133
Mtub 29 4 4 237 0 3-213 20 0.1879
Mtub 34 4 4 237 0 2-213 21 0.1869
MIRU 27 5 4 236 1 2-224 22 0.106
MIRU 02 2 2 236 1 10-226 23 0.0892
MIRU 20 3 2 233 5 5-228 24 0.0743
90
3.4.2 Determination of most discriminatory set of MIRU-VNTR loci to use as ‘fast lane’ screening markers
To select the subset of the loci giving discrimination power close to the 24
loci MIRU-VNTR, different combinations of the loci were assessed using HGDI. The
detail of the different combinations along with their comparison is given in the table
3.2 and table 3.3. Combination 3, including Qub 26, MIRU 10, Mtub 04, MIRU 26,
MIRU 31 (ETR E), MIRU 16, Qub 4156 and Mtub 21 was selected as least number of
loci that could provide the discriminatory power close to the 24 MIRU-VNTR typing.
Table 3.2 Determination of Most Discriminatory Subset of MIRU-VNTR loci as “Fast Lane” Screening Markers
Markers Supply* combinations Combinations tested in present study
24 15 12 1 2 3 4 5 6 7
Qub 26 �
� � � � � � � �
MIRU 10 � � � � � � � � � �
Mtub 04 �
� � � � � � � �
MIRU 26 � � � � � � � � � �
MIRU 31 (ETR E) � � � � � � � � � �
MIRU 16 � � � � � � � �
�
Qub 4156 �
� � � � �
�
Mtub 21 �
� � � �
� �
ETR A �
� � �
Mtub 39 �
� �
MIRU 39 � �
�
Mtub 30 �
� �
MIRU 24 � �
�
Qub 11b �
� �
MIRU 40 � � � �
ETR C �
�
ETR B �
MIRU 23 � �
91
Markers Supply* combinations Combinations tested in present study
24 15 12 1 2 3 4 5 6 7
MIRU 04 (ETR D) � � �
Mtub 29 �
Mtub 34 �
MIRU 27 � �
MIRU 02 � �
MIRU 20 � �
*(Supply et al., 2006; Supply et al., 2000) � indicates seleceted loci
Table 3.3 HGDI of Different Tested Subset of Loci
Combination No. of clusters No. of isolates in cluster
No. of isolates with unique pattern HGDI
Supply 24 21 58 179 0.9941
1 27 72 165 0.9938
Supply 15 28 81 156 0.9933
2 30 98 139 0.9905
3 32 94 143 0.9904
7 35 105 132 0.9896
4 33 113 124 0.989
8 31 112 125 0.988
5 33 126 111 0.9849
Supply 12 34 121 116 0.9842
6 36 143 97 0.9829
Determination of most discriminatory subset of MIRU-VNTR loci as “fast lane” screening markers was done using 237 isolates
3.5 Spoligoriftyping of M. tuberculosis isolates
3.5.1 Data interpretation
Data from the Luminex was obtained in the form of numerical values as
shown in the table 3.4. These values were mean of the fluorescence intensity (MFI)
for each probe that was interpreted on the basis of established cut off values (table
3.5). The distribution of mean fluorescence intensity values was presented in the form
of a graph as shown in the figure 3.14. The final display of the results was in the form
92
of blocks where each solid block represented the positive hybridization signal while
the open/un-filled block represented the absence of hybridization as shown in the
figure 3.15.
Table 3.4 Mean Fluorescence Intensity (MFI) Values Obtained from Luminex sp1 sp2 sp3 sp4 sp5 sp6 sp7 sp8 sp9 sp10 sp11 sp12 sp13 sp14
Type Well MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI
X1 A1 496 488 1300 846 975 1281 719 895 752 822 812 849 1602 684
X2 B1 605 23 17 976 1084 1409 836 1003 945 958 988 1043 1822 855
X3 C1 661 689 1531 104 29 1455 965 1118 1157 1065 1123 1050 1840 947
X4 D1 810 509 1830 135 34 35 45 1353 1228 1113 1462 1151 2160 904
X7 E1 623 563 1523 128 37 24 32 1111 1004 953 1185 891 1729 858
X8 F1 631 599 1592 113 29 23 50 1087 963 929 1222 937 1839 831
X9 G1 577 595 1544 108 17 20 48 1006 969 878 1273 970 1698 773
X10 H1 525 521 1410 949 1095 1283 36 897 963 843 867 1001 1702 760
X12 A2 642 644 1613 116 38 28 33 1076 979 904 1232 1019 1777 822
X13 B2 594 617 1673 124 23 29 37 1084 971 924 1331 931 1805 704
X14 C2 521 519 1426 100 20 44 32 942 835 831 1150 864 1689 721
X15 D2 548 554 1478 86 23 17 35 925 844 827 1214 899 1686 701
X16 E2 640 636 1591 101 24 20 42 994 1045 986 1371 1014 1861 788
Figure 3.14 Distribution of MFI across samples x axis: probes (1 to 43 are DR spacer capture probes and 44 to 53 are rpoB probes) y axis: MFI results obtained by each probe (data points represent individual sample)
93
Table 3.5 Interpretation of the MFI Values According to Defined Cutoff Values
sp1 sp2 sp3 sp4 sp5 sp6 sp7 sp8 sp9 sp10 sp11 sp12 sp13 sp14
Well MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI MFI
A1 496 488 1300 846 975 1281 719 895 752 822 812 849 1602 684
B1 605 23 17 976 1084 1409 836 1003 945 958 988 1043 1822 855
C1 661 689 1531 104 29 1455 965 1118 1157 1065 1123 1050 1840 947
D1 810 509 1830 135 34 35 45 1353 1228 1113 1462 1151 2160 904
E1 623 563 1523 128 37 24 32 1111 1004 953 1185 891 1729 858
F1 631 599 1592 113 29 23 50 1087 963 49 1222 937 1839 831
G1 577 595 1544 108 17 20 48 1006 969 878 1273 970 1698 773
H1 525 521 1410 949 1095 1283 36 897 963 843 867 1001 1702 760
A2 642 644 1613 116 38 28 33 1076 979 904 1232 1019 1777 822
B2 594 617 1673 124 23 29 37 1084 971 924 1331 931 1805 704
C2 521 20 1426 100 20 44 32 942 835 78 1150 864 1689 50
D2 548 554 1478 86 23 17 35 925 844 827 1214 899 1686 701
E2 640 636 1591 101 24 20 42 994 1045 986 1371 1014 1861 788 Grey cells represent hybridization while white cells represent absence of hybridization for corresponding probe
Figure 3.15 Final display of the interpreted spoligoriftyping results Column 1: well number Column 2: samples identification Column3: spoligotype patterns (solid blocks represent positive hybridization
signals while white blocks represent negative hybridization signals) Column 4-8: wild-type probes Column 9-13: mutant probes Column 14: prediction of multidrug resistance
Well Sample 43 spacer spoligotype spa
_W
t1
rif_
51
6 w
t (w
t3)
spa
_W
t2
rif_
52
6 w
t (w
t4)
rif_
53
1w
t (w
t5)
rif_
51
6_
mut
GT
C (
mut
1)
rif_
52
6 m
ut G
AC
(m
ut2
)
rif_
52
6_
mut
TA
C (
mut
3)
rif_
53
1_
mut
TT
G (
mut
4)
rif_
53
1_
mut
TG
G (
mut
5)
MD
R p
redi
ctio
n
A1 1 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
B1 2 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
C1 3 ■■■❏❏❏❏■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
D1 4 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ■ S
E1 5 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
F1 6 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
G1 7 ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
H1 8 ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■ ■ ■ ❏ ■ ❏ ■ ❏ ❏ ❏ R
A2 9 ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
B2 10 ■■■❏❏❏❏■■■■■■❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
C2 11 ■■■❏❏❏❏■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
D2 12 ■■■❏❏❏❏❏❏❏❏❏■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■❏❏❏❏ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
E2 13 ■■❏■■■■■❏■■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ RF2 14 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
G2 15 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ S
WT Probes Mut Probes
94
3.5.2 Diversity of M. tuberculosis complex as assessed by 43 spacer format Spoligotyping
Out of 457 isolates screened by spoligoriftyping method, 386 interpretable
results (84%) were obtained for 43 spacer format spoligotyping. Majority of the
isolates from Rawalpindi District could not be successfully typed due to poor DNA
quality but still we had 149 isolates from this district that gave interpretable data for
assessment of strain diversity (Table 3.8). Out of 386 isolates with 43 spacers
spoligotype patterns, 115 different spoligotypes were identified, only 71 (62%) of
which were already described in SITVITWEB. Classification performed by the
expert visual inspection allowed assigning a lineage to 373 (97%) isolates leaving
behind only 13 (3%) uncharacterized isolates.
The population structure of MTBC consisted of 3 main clusters including
Central Asian strains (CAS, 69%), East African Indian (EAI, 6%) and Modern/Euro
American strains (18%) as shown in the figure 3.16. The predominant families among
the Euro-American isolates were T (8.5 % of the total sample), Ural (6.5%), X
(1.3%), H (0.8%) and LAM (0.8%). Beijing family had a frequency of 3% while
MANU was represented by only 0.8% isolates. These percentages were similar in the
different settings, (Figure 3.17) however, a significant higher prevalence of EAI in
Faisalabad and Lahore as compared to Karachi and Rawalpindi [Chi2df=2=8.4;
p=0.015; n(Lahore+Faisalabad)=80; n(Karachi)=36; n(Rawalpindi)=14] was observed.
3.6 Assessment of global and local transmission dynamics by the combination of 24 MIRU-VNTR and spoligotyping patterns
Both 24 MIRU-VNTR + spoligotype identity (coined as 100% genotype
identity) and single locus variant (SLV) among the 24 MIRU-VNTR are considered
as a good marker for identifying epidemiologically-linked isolates. The recent
transmission index (RTI) was calculated using 100% locus identity at 24 MIRU-
VNTR and spoligotype patterns and also by allowing single locus variation (SLV)
among MIRU-VNTR patterns (Figures 3.18 and 3.19, table 3.6). The clustering rate
was found to be the higher for Rawalpindi (0.18 with 100% identity and 0.28 with
SLV) as compared to Lahore + Faisalabad (0.1 with 100% identity and 0.2 with
SLV). The cumulative RTI for the Province of Punjab was found to be low (0.155)
with 100% identity but reached 0.23 when SLV was allowed.
95
Table 3.6 Local and Cumulative Recent Transmission Indices
City
100% genotype identity SLV
Clustered strains
No. of clusters
Total No. of isolates
RTI Clustered
strains No. of
clusters
Total No. of isolates
RTI
Lahore+ Faisalabad
6 3 30 0.1 11 5 30 0.2
Rawalpindi 19 8 60 0.183 25 8 60 0.283
Cumulative 25 11 90 0.155 36 15 90 0.233
96
Figure 3.16 Minimum Spanning Tree (MST) based on 43 spacer format spoligotyping data This tree was built using all isolates with 43 spacer spoligotype patterns (n=386). They form a representative subset of the whole sample. The relative size of the circles corresponds to the number of isolates sharing the corresponding spoligotype pattern. Color codes specific to each lineage are: Light blue=CAS1-Dehli; Blue-green=other CAS; Dark blue=Beijing; Greenish=EAI; Lilac=T; Red=Ural; Dark-Green=H; Light-green=X; Dark-purple=LAM; Grey represents unlabeled isolates
CAS
Beijing
Euro-American
EAI
97
Figure 3.17 Distribution of lineages in various regions, as described by SpolDB4 database and expert visual inspection Isolates with available spoligotype patterns (85%) were used to build this graph. Beijing is represented in blue, CAS in yellow, EAI in green, Euro-American lineage in reddish colors (Dark-red=T, Dark-pink=Ural, Light-red=H, Light-pink=X, Orange=LAM), Manu in black, U in grey
98
Figure 3.18 Dendrogram showing clustering of M. tuberculosis strains from Rawalpindi district by 43 Spacer Spoligotyping and 24 MIRU-VNTR
99
Figure 3.19 Dendrogram showing clustering of M. tuberculosis strains from Lahore + Faisalabad District by 43 Spacer Spoligotyping and 24 MIRU-VNTR
100
3.7 M. tuberculosis strain differentiation by 25 additional spacers (68 spacer format spoligotyping)
Out of 386 isolates screened, 209 isolates produced 68 spacers spoligotypes
that were interpretable. These isolates belonged to CAS (n=126), EAI (n=6), Beijing
(n=7), T (n=16), Haarlem (n=3), Ural (n=12) and X (n=4) families in addition to
unclassified (n=35). Addition of 25 more spacers didn’t increase the strain
differentiation significantly in isolates clustered by 43 spacer spoligotyping format.
Only the two most represented families (CAS and T) showed differentiation. The
largest CAS cluster including 87 isolates was split in 12 clusters (table 3.7). Analysis
of clustered isolates (constituting 18 clusters by combined 43 spacer format and 24
MIRU-VNTR) with 25 additional spacers could not appreciably decrease the
clustering. Of 13 out of 18 clusters, for which results of all the isolates in cluster were
available, addition of 25 spacers could split only 3 clusters. Results of 68 spacer
spoligotyping are given in table 3.8.
Table 3.7 Strain Discrimination of M. tuberculosis Isolates by 68 Spacer Format Spoligotyping
SIT Clusters by 43 spacer format
Clusters by 68 spacer format Clade
No. of clustered isolates
26 Clade 1 Subclade 1 CAS 69
Subclade 2
4
Subclade 3
2
Subclade 4
2
Subclade 5
2
Subclade 6
2
Subclade 7
1
Subclade 8
1
Subclade 9
1
Subclade 10
1
Subclade 11
1
Subclade 12
1
429 Clade 2 Subclade 1 CAS 1
101
SIT Clusters by 43 spacer format
Clusters by 68 spacer format
Clade No. of
clustered isolates
25 Clade 3
Subclade 2 1
Subclade 1 CAS 5
Subclade 2
1
357 Clade 4 Subclade 1 CAS 1
Subclade 2 1
1256 Clade 5 No Subdivision CAS 4
1949 Clade 6 No Subdivision CAS 2
485 Clade 7 No Subdivision CAS 3
598 Clade 8 No Subdivision CAS 2
1122 Clade 9 No Subdivision CAS 2
11 Clade 10 No Subdivision EAI 5
127 Clade 11 No Subdivision H4=Ural 11
53 Clade 12 No Subdivision T1 4
264 Clade 13 No Subdivision T1 2
1877 Clade 14 Subclade 1
T1 2
Subclade 2 1
804 Clade 15 No Subdivision T1 2
Unknown Clade 16 No Subdivision Unknown 2
Unknown Clade 17 No Subdivision Unknown 2
Unknown Clade 18 No Subdivision Unknown 2
TOTAL
143
102
Table 3.8 Spoligotyping using 43 Spacer and 68 Spacer Format
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2009000062 Lahore ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 11 EAI3-IND
PAK1998000063 Peshawar ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2009000064 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000065 Peshawar ■❏■■■■■■■■■■■❏❏■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■❏❏■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK1998000067 Peshawar ■■■❏❏❏❏■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏❏ Not done 864 CAS
PAK1998000069 Peshawar ■■■❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■❏■■■■■ Not done Unknown Unknown
PAK1998000070 Peshawar ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000071 Peshawar ■❏■■■■■■■■■■■■■■■■❏■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■❏■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 656 H4
PAK1998000072 Peshawar ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000073 Peshawar ■■■❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■❏❏■■■■❏■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK1998000074 Peshawar ■■■❏❏❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1951 CAS
PAK2005000076 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2009000077 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2009000078 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 26 CAS1-Delhi
PAK2009000079 Lahore ■❏❏❏❏❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ Unknown Unknown
PAK2009000082 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2009000083 Lahore ■■■❏❏❏■■■❏■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■■■❏■■■ Not done Unknown Unknown
PAK2009000085 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2009000086 Quetta ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000088 Lahore ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 11 EAI3-IND
PAK2009000089 Lahore ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2009000090 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ 1264 CAS
103
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2009000092 Lahore ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2009000093 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1093 CAS
PAK2009000094 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ 2147 CAS1-Delhi
PAK2009000095 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2009000097 Quetta ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2005000103 Faisalabad ■❏■■■■■■■■■■■❏❏■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■❏❏■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2009000106 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK1998000107 Peshawar ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000109 Peshawar ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 288 CAS2
PAK1998000110 Peshawar ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000111 Peshawar ■■■■■■■■■■■■■■■■■■■■❏■■❏❏■■■❏■■❏❏❏❏❏■■■■■■■ Not done Unknown Unknown
PAK2009000112 Lahore ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 11 EAI3-IND
PAK2009000113 Lahore ■■■❏❏❏❏■■❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏■❏■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2009000115 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2009000116 Lahore ■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■■■❏❏❏❏ ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■■■■■■■■■■■■■❏❏❏❏■■■ 138 EAI 5
PAK2009000119 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK1998000121 Peshawar ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2009000122 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■❏■■❏❏■■■ Not done Unknown Unknown
PAK1998000123 Peshawar ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ Not done 127 H4
PAK2005000126 Faisalabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2009000127 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■❏■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■❏■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1091 CAS1-Delhi
PAK2010000128 Faisalabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2009000129 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
104
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2009000130 Lahore ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 11 EAI3-IND
PAK1998000131 Peshawar ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■■■■■■■■■ ■■■■■■❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■■■■■■■■■■■■■■■■■■■■■■■■ 100 MANU 1
PAK2009000132 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1093 CAS
PAK2009000133 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 357 CAS
PAK2009000136 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏■■■■■■■■■❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏■■■■■■■■■❏■❏❏■■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ 1887 ?
PAK2009000139 Lahore ■■■❏❏❏❏■❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1092 CAS1-Delhi
PAK1998000141 Peshawar ■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏■■■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Unknown Unknown
PAK1998000144 Peshawar ■■■■■■■■■■■■■■■■■■■■❏■■❏❏■■■❏■■❏❏❏❏❏❏■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■❏■■❏❏■■■❏■■❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏■■■■❏■■ Unknown Unknown
PAK1998000147 Peshawar ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 288 CAS2
PAK2009000148 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2009000149 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2009000154 Lahore ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK1998000155 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000156 Karachi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2009000157 Lahore ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2009000158 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■ 1878 CAS1-Delhi
PAK2009000159 Lahore ■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■■■■■■■ ■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■❏■■■■■■■❏■■■■■■■■■■■■ 1970 EAI6-BGD1
PAK2009000160 Lahore ■❏❏■■■■■❏■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■❏■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏■■■■■❏■■■■■■■■■ Unknown Unknown
PAK2009000161 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000164 Peshawar ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000167 Peshawar ■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■❏■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■❏❏❏❏■■■■❏■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 64 LAM 6
PAK2009000168 Lahore ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2009000169 Lahore ■■■❏❏❏❏■❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 2237 CAS1-Delhi
PAK2009000170 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1093 CAS
105
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2009000171 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏■■❏❏❏❏■■■■■■■■■ Not done Unknown Unknown
PAK2009000172 Lahore ■■■■■■■■■■■■❏❏❏❏■■■■■❏❏❏❏■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■❏❏❏❏■■■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2009000173 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2009000174 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000191 Peshawar ■■■■❏■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏■■■■■■■■■ Not done Unknown Unknown
PAK2010000196 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2010000197 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2010000198 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2010000199 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2010000200 Rawalpindi ■■■❏❏❏❏■■■■■❏❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■❏❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2010000202 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2010000203 Rawalpindi ■■■■■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 1166 T1
PAK2010000204 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■❏■❏❏❏❏❏❏❏❏■■■■■■■ 289 CAS1-Delhi
PAK2010000205 Rawalpindi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2010000206 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2010000207 Rawalpindi ■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■■■■■■■ ■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■❏■■■■■■■❏■■■■■■■■■■■■ 1970 EAI6-BGD1
PAK2010000208 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2010000210 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2010000211 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2010000213 Rawalpindi ■■■❏■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏❏■■■❏❏■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 1877 T1
PAK2010000214 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000215 Lahore ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2010000218 Rawalpindi ■■■■■■■■■■■■■■■■■■■❏❏■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 451 H37Rv
PAK2010000219 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ 27 ?
106
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2010000221 Rawalpindi ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■❏❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏■❏❏❏❏■■■■■■■■■■■■■■■ 625 EAI 5
PAK2011000222 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000223 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1 Beijing
PAK2011000224 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000225 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■ 1264 CAS
PAK2011000226 Islamabad ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏■■■■■■■■■■■■■■■ 11 EAI3-IND
PAK2011000227 Islamabad ■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏❏❏■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 358 T1
PAK2011000228 Islamabad ■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■■■■■■■ ■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■❏■■■■■■■❏■■■■■■■■■■■■ 1970 EAI6-BGD1
PAK2011000229 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000230 Islamabad ■■■■■■❏■■■■■■■■■❏■■■■■■■■■■■❏❏❏❏■❏■■■■■❏❏❏❏ ■■■■■■■■■■■■■■❏■■■■■■■■■■■❏■■■■■■■■■■■❏❏❏❏■❏■■■❏■■■■■■■■■■■■■❏❏❏❏■■■ Unknown Unknown
PAK2011000231 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏■■■■■■■ 598 CAS
PAK2011000232 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 142 CAS
PAK2011000233 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000234 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏■■■■■■■ 486 CAS
PAK2011000235 Islamabad ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2011000236 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 485 CAS
PAK2011000237 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000238 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000239 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 2145 CAS1-Delhi
PAK2011000240 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2011000241 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■ 1972 CAS
PAK2011000242 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000243 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Unknown Unknown
PAK2011000244 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
107
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2011000245 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000246 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000247 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000248 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000249 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ 27 ?
PAK2011000250 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1 Beijing
PAK2011000251 Islamabad ■■■■■❏■■■■■■■■■■■■■■■■■■■■■■■■❏■❏❏❏❏■■■❏■■■ ■■■■❏❏❏❏❏❏❏■■❏■❏❏■■■■■■■■■■■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏■■■■■■ Unknown Unknown
PAK2011000252 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2011000253 Islamabad ■■■■■■■■■❏■■■■■■■■■■■■❏❏■■■■■■■■❏❏❏❏■■■❏❏■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■❏■■■■■■■■■■■■❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏❏■■■■■ Unknown Unknown
PAK2011000254 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏❏■■■■■■ 429 CAS1-Delhi
PAK2011000255 Islamabad ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000256 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000257 Islamabad ■■■❏❏❏❏■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏■■■■■■■ 2419 CAS
PAK2011000258 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000259 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000260 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000261 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2011000262 Islamabad ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000263 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000264 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000265 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000266 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000267 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 357 CAS
PAK2011000268 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
108
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2011000269 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2011000270 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2011000271 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 429 CAS1-Delhi
PAK2011000272 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■ Unknown Unknown
PAK2011000273 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000274 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■■■■■❏❏❏❏■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000275 Islamabad ■■■■■❏■■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■❏■❏❏■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 490 X1
PAK2011000276 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000277 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏■■■■■■■ 598 CAS
PAK2011000279 Islamabad ■■■■■■■■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 119 X1
PAK2011000280 Islamabad ■■■❏❏❏❏■■■■■■❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Unknown Unknown
PAK2011000281 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000282 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000283 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000284 Faisalabad ■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 777 H3
PAK2011000285 Faisalabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■❏❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000286 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000288 Faisalabad ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏❏■■■■■■ 1120 CAS
PAK2011000289 Faisalabad ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■■■■■■■ Not done 126 EAI 5
PAK2011000290 Faisalabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏■■■■ Not done 381 CAS1-Delhi
PAK2011000291 Faisalabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000293 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000294 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000295 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
109
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2011000296 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000297 Lahore ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■
11 EAI3-IND
PAK2011000298 Lahore ■■■❏❏❏❏❏❏❏❏❏■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■❏❏❏❏ ■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■ 200 X 3
PAK2011000299 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000401 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2011000402 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000403 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2011000404 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1 Beijing
PAK2011000405 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ Not done 127 H4
PAK2011000406 Islamabad ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■❏❏❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■❏ 804 T1
PAK2011000407 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2011000408 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ 1878 CAS1-Delhi
PAK2011000409 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000410 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏■■■❏■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏■■■■■■ 125 LAM 3
PAK2011000411 Islamabad ❏❏■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏❏❏■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000412 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000413 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■❏❏❏❏■ 1883 CAS1-Delhi
PAK2011000414 Islamabad ■■■❏❏❏❏■■■■■❏❏❏❏■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■❏❏❏❏■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000415 Islamabad ■■■■■■■■■■■■■■■■■■■❏❏❏❏❏■■■■❏❏❏■❏❏❏❏■■■■■■■ Not done Unknown Unknown
PAK2011000416 Islamabad ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 11 EAI3-IND
PAK2011000417 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000418 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000419 Islamabad ■■■❏■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏❏■■■❏❏■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■❏ 1877 T1
110
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2011000420 Islamabad ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏❏❏ ■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏■❏❏❏❏■■ Unknown Unknown
PAK2011000421 Islamabad ■■■■■■■■❏❏❏■■■■■■■■■❏❏❏❏■■❏❏❏❏❏■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■❏❏❏■■■■■■■■■❏❏❏❏■■❏❏❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000422 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■❏■■❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■❏■■❏❏❏❏■■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000423 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000424 Islamabad ■■■❏❏❏❏■■■■■■❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 794 CAS1-Delhi
PAK2011000425 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■❏■■ 26 CAS1-Delhi
PAK2011000426 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1 Beijing
PAK2011000427 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000428 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000429 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1 Beijing
PAK2011000430 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■❏■ 26 CAS1-Delhi
PAK2011000431 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000432 Islamabad ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■❏❏■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏❏■■■■■ 78 T1
PAK2011000433 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000434 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK2011000435 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000436 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000437 Rawalpindi ■❏❏■■■■■■■■■■■■■❏■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■❏■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 624 EAI3-IND
PAK2011000439 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000440 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000441 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000442 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000443 Rawalpindi ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Unknown Unknown
PAK2011000444 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 485 CAS
111
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2011000445 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000447 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2011000448 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1949 CAS
PAK2011000449 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2011000450 Rawalpindi ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏❏■■■■■■ 1120 CAS
PAK2011000451 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000453 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ Not done 1949 CAS
PAK2011000454 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000455 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 1949 CAS
PAK2011000456 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000457 Rawalpindi ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ 126 EAI 5
PAK2011000458 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2011000459 Rawalpindi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2011000460 Rawalpindi ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1 Beijing
PAK2011000461 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000463 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000464 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK2011000465 Rawalpindi ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 11 EAI3-IND
PAK2011000466 Rawalpindi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 53 T1
PAK2011000467 Rawalpindi ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■❏❏❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■❏ 804 T1
PAK2011000468 Rawalpindi ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏■■■■■❏■■■■■■■■■ 11 EAI3-IND
PAK2011000469 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏■■■❏❏❏❏❏❏❏❏❏■■■■■■ 429 CAS1-Delhi
PAK2011000470 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ 1264 CAS
PAK2011000471 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ 1264 CAS
112
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2011000472 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■❏■■ 26 CAS1-Delhi
PAK2011000473 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ 1264 CAS
PAK2011000474 Rawalpindi ■■■■■■■■■■■■❏■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■❏■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■❏■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏■■■■■■ 1134 H3
PAK2011000476 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000477 Rawalpindi ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000478 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000479 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■❏❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1344 CAS1-Delhi
PAK2011000481 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000482 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■❏■❏❏❏❏❏❏❏❏■■■■■■■ 289 CAS1-Delhi
PAK2011000483 Rawalpindi ■■■❏❏❏❏❏❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■❏❏❏❏❏❏❏❏■■■■■■■ 2100 CAS
PAK2011000484 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 485 CAS
PAK2011000485 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000486 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■❏■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000487 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000488 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000489 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ 428 CAS1-Delhi
PAK2011000490 Rawalpindi ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done Unknown Unknown
PAK2011000491 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■❏❏❏❏❏ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏❏❏■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■ Unknown Unknown
PAK2011000492 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000493 Rawalpindi ■■■❏❏❏❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ ■■■■■■■■■❏❏❏❏❏❏❏❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Unknown Unknown
PAK2011000494 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■❏❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1344 CAS1-Delhi
PAK2011000495 Rawalpindi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■❏❏❏❏■■■■■■■ ■■■■■■❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 50 H3
PAK2011000497 Rawalpindi ■■■❏■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏❏■■■❏❏■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 1877 T1
PAK2011000498 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
113
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2011000499 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000501 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK2011000503 Rawalpindi ■■■❏❏❏❏❏❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ ■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK2011000504 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ 27 ?
PAK2011000505 Rawalpindi ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■ ■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏❏■■■■■■ Unknown Unknown
PAK2011000506 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000902 Karachi ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏■■❏❏❏❏❏❏❏❏■■■■■■■ 1591 CAS2
PAK1998000903 Karachi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK1998000904 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK1998000905 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000906 Karachi ■■■❏❏❏❏■❏❏❏■■■■■■■■■❏❏❏❏■■■■■■■■■❏❏❏❏■■■■■■ Not done Unknown Unknown
PAK1998000907 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK1998000908 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000909 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000910 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏❏❏❏■■■■■■■ 357 CAS
PAK1998000911 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■■■❏■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ 25 CAS1-Delhi
PAK1998000912 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000914 Karachi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■❏■■ 53 T1
PAK1998000916 Karachi ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 1 Beijing
PAK1998000917 Karachi ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ ■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏❏❏❏❏■■■■■■■■■■■■■■ 11 EAI3-IND
PAK1998000918 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000919 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000920 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000921 Karachi ■■■❏■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏❏■■■❏❏■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 1877 T1
114
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK1998000922 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■❏■■❏❏❏❏❏❏❏❏■■■■■■■ 27 ?
PAK1998000923 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000924 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■■ Unknown Unknown
PAK1998000925 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000927 Karachi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK1998000928 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■❏❏❏■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000929 Karachi ■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 264 T1
PAK1998000931 Karachi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 127 H4
PAK1998000932 Karachi ■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 264 T1
PAK1998000933 Karachi ■❏❏■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏■❏■■■■■■■■■ ■■❏❏■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏■❏■■■❏■❏■■■■■■■■■■■■■■■■■■ Unknown Unknown
PAK1998000934 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000935 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000937 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000938 Karachi ■■■■■■■■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■■ 119 X1
PAK1998000939 Karachi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 26 CAS1-Delhi
PAK1998000942 Karachi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■❏■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏❏■■■■■■ 1302 T2
PAK2012000507 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000508 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Not done 25 CAS1-Delhi
PAK2012000509 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000510 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000511 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Not done 25 CAS1-Delhi
PAK2012000512 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000513 Lahore ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 485 CAS
115
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2012000514 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000515 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000516 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000517 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■ Not done Unknown Unknown
PAK2012000518 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000520 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000521 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000522 Lahore ■■■■■■■■■■■■❏■■■■■❏■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Not done 442 Ambigous T4T3
PAK2012000523 Lahore ■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■■■■■■■ Not done 1970 EAI6-BGD1
PAK2012000525 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000526 Lahore ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2012000527 Islamabad ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■❏❏■ Not done Unknown Unknown
PAK2012000528 Islamabad ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Not done 53 T1
PAK2012000529 Islamabad ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1 Beijing
PAK2012000532 Islamabad ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ Not done 127 H4
PAK2012000534 Islamabad ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏■■❏❏❏■■■■ Not done 1948 ?
PAK2012000535 Islamabad ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏■■■■■■■ Not done 124 ?
PAK2012000537 Islamabad ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■ Not done 1151 CAS
PAK2012000538 Islamabad ■■■❏❏❏❏■■■■■■■❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 141 CAS1-Delhi
PAK2008000539 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000540 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Not done 1264 CAS
116
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2008000559 Rawalpindi ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1 Beijing
PAK2008000560 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■❏■■■■■■■ Not done 1091 CAS1-Delhi
PAK2008000562 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Not done 25 CAS1-Delhi
PAK2008000564 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000565 Rawalpindi ■■■❏❏❏❏■■■■■■■❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 141 CAS1-Delhi
PAK2008000567 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000568 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000569 Rawalpindi ■■■■■■■■■❏■■■■■■■■■■■■❏■■■■■■■■■❏❏❏❏■■■❏❏■■ Not done Unknown Unknown
PAK2008000571 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000572 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000573 Rawalpindi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ Not done 127 H4
PAK2008000574 Rawalpindi ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1 Beijing
PAK2008000576 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 485 CAS
PAK2008000577 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000578 Rawalpindi ■■■❏❏❏❏■■■■■■■❏❏■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 2692 CAS1-Delhi
PAK2008000579 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000582 Rawalpindi ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Not done Unknown -
PAK2008000584 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000585 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000586 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 2145 CAS1-Delhi
PAK2008000587 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■ Not done 203 CAS
117
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2008000589 Rawalpindi ■■■❏❏❏❏■■■■■■■❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 141 CAS1-Delhi
PAK2008000590 Rawalpindi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Not done 53 T1
PAK2008000593 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000594 Rawalpindi ■■■❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1551 CAS
PAK2008000595 Rawalpindi ■■■❏❏❏❏■❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■■■■❏❏❏❏❏❏■❏■❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■■ 2237 CAS1-Delhi
PAK2008000596 Rawalpindi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■❏ 53 T1
PAK2008000597 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000598 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000599 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Not done 25 CAS1-Delhi
PAK2008000600 Rawalpindi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■❏❏❏❏■■■■■■■ Not done 50 H3
PAK2008000601 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■■ ■■■■■■❏■■■❏❏❏❏❏■❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■❏❏❏❏❏❏❏❏■■■■■■❏ 428 CAS1-Delhi
PAK2008000602 Rawalpindi ■■■■■■■■■■■■■■■■■❏■■■■■■■■■■❏■■■❏❏❏❏■■■■■■■ ■■■■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■❏■■■■■■■■■■❏■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■❏ 1329 X1
PAK2008000603 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏■❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 26 CAS1-Delhi
PAK2008000604 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 26 CAS1-Delhi
PAK2008000605 Rawalpindi ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■ ■■■■■■❏■■■❏❏❏❏❏■❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏❏❏❏❏■■■■■❏ 1120 CAS
PAK2008000606 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏■❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 26 CAS1-Delhi
PAK2008000607 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ ■■■■■❏❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏■❏❏❏❏❏❏❏❏■■■■■■❏ 25 CAS1-Delhi
PAK2008000608 Rawalpindi ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ ■■❏■❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■❏ 127 H4
PAK2008000611 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ ■■■■■■❏■■■❏❏❏❏❏■❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏❏■■❏■■❏❏❏❏❏❏❏❏■■■■■■❏ 27 ?
PAK2008000614 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏■❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 26 CAS1-Delhi
PAK2008000617 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000618 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
118
Key Origin 43 spacer format spoligotyping 68 spacer format spoligotyping SIT Clades
PAK2008000619 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000620 Rawalpindi ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ ■■❏❏❏❏❏❏❏❏❏■■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏■■■❏❏❏❏❏❏❏❏■■■■■■❏ 804 T1
PAK2008000622 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■■ ❏■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏■■❏❏❏❏❏❏❏❏■■■■❏❏❏ 428 CAS1-Delhi
PAK2008000623 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏■■■❏❏❏❏❏❏❏❏■■■■❏❏❏ 26 CAS1-Delhi
PAK2008000625 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 26 CAS1-Delhi
PAK2008000626 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000627 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000628 Rawalpindi ■■■❏❏❏❏■■■■❏❏■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1327 CAS1-Delhi
PAK2008000630 Rawalpindi ■■■❏❏❏❏■■■■■❏■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 1343 CAS1-Delhi
PAK2008000631 Rawalpindi ■■■❏❏❏❏■■■■■❏■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done Unknown Unknown
PAK2008000633 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Not done 26 CAS1-Delhi
PAK2008000635 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■■❏❏❏❏❏■❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 26 CAS1-Delhi
PAK2008000636 Rawalpindi ■■■❏❏❏❏■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ❏■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏■■■❏❏❏❏❏❏❏❏■■■■❏❏❏ 2145 CAS1-Delhi
PAK2008000644 Rawalpindi ■■■❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ ■■■■■■❏■■❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■❏❏❏❏❏❏❏❏■■■■■■❏ 1551 CAS
PAK2008000646 Rawalpindi ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Not done 53 T1
119
3.8 Discriminatory power of genotyping techniques
Two hundred and twenty five isolates, with available results of both 24
MIRU-VNTR typing as well as spoligotyping were selected to evaluate the
discriminatory power of spoligotyping, spoligotyping plus 24 MIRU-VNTR and
MIRU-VNTR typing with 24, 15 and 12 format typing using Hunter and Gaston
Discriminatory Index (HGDI). Discriminatory power of 24 MIRU-VNTR was higher
(HGDI=0.997) as compared to spoligotyping alone (HGDI=0.823). Use of 12 and 15
MIRU-VNTR format gave less discriminatory power as compared to 24 MIRU-
VNTR format. Although combination of both typing methods resulted in six more
patterns yet the discriminatory power remained very close to that of 24 MIRU-VNTR
typing method (table 3.9).
Table 3.9 Discriminatory Powers of Genotyping Techniques
Typing method
No. of patterns
No. of clusters
No. of isolates in clusters
No. of isolates with unique
profile
Clustering rate
HGDI
43 spacers-Spoligo only
174 24 75 150 0.228 0.8241
43 spacers-Spoligo plus
MIRU-VNTR
195 18 48 177 0.133 0.99782
24 MIRU-VNTR only
189 21 57 168 0.16 0.9971
15 MIRU-VNTR
175 27 77 148 0.222 0.9929
12 MIRU-VNTR
141 32 116 109 0.373 0.9828
These calculations were performed using the 225 isolates with complete genotyping data (24 MIRU-VNTR and spoligotyping)
120
3.9 Assessment of freely available databases for lineage assignation
Lineages were assigned to M. tuberculosis isolates using three freely available
online interfaces: TB-lineage, SITVITWEB that can handle spoligotype-only data,
and MIRU-VNTRPlus that is designed to use 24 MIRU-VNTR data. Although they
have been validated and are widely used but they all were unable either to classify
(mainly TB-lineage and SpolDB4/SITVITWEB) or to provide correct classification
(TB-Lineage and MIRU-VNTRplus). Another limitation of these databases was found
in assigning sublineage. This is due to the fact that these databases are not being
upgraded regularly as it is difficult to decide whether the lineage should be assigned
according to the latest information available or it should be kept the same to make
previous studies more easily compared to the new ones? All databases chose to keep
original naming, for instance, the name of H4 sub lineage baptized into Ural since
2010, (Filliol et al., 2002; Gomgnimbou et al., 2013b) is still used in SITVITWEB.
However, this could have led to the overestimation of prevalence of Haarlem
sublineage in our isolates as Ural sublineage is much more prevalent (6.5%) as
compared to true Haarlem sublineage (0.8%). The TB-lineage was found to be error-
prone and imprecise. SITVITWEB and MIRU-VNTRplus performed well, but
couldn’t give exact assignation for 20% of the isolates (Figure 3.20 and table 3.10).
121
Figure 3.20 Graphical representation of performance of the different online tools Labels highlight the most represented categories when comparing the assignations with the reference assignation provided by the expert visual inspection. (1) no assignation provided by the web tool, (2) incorrect assignation involving a different major lineage as defined by Gagneux et al., (2006b) (3) imprecise assignation, (4) incorrect assignation at a fine level (but same major lineage as the reference), (5) correct and precise assignation.
122
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000222 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Incorrect
PAK2011000223 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Beijing Correct East Asian (Beijing) Correct Beijing Correct
PAK2011000224 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000225 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000226 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct EAI3-IND Correct
PAK2011000227 ■■■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000228 ■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■■■■■■■ EAI Correct Indo-Oceanic Correct EAI6-BGD1 Correct
PAK2011000229 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000230 ■■■■■■❏■■■■■■■■■❏■■■■■■■■■■■❏❏❏❏■❏■■■■■❏❏❏❏ EAI Correct Indo-Oceanic Correct Unknown
PAK2011000231 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000232 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS Correct
PAK2011000233 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000234 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000235 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000236 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS Correct
PAK2011000237 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000238 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
Table 3.10 Assesment of Freely Available Databases for Lineage Assignatio
123
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000239 ■■■❏❏❏❏■■■■■■■■■■■■■❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000240 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level Euro-American Imprecise H4
Incorrect at
fine level
PAK2011000241 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000242 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000243 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏❏❏❏ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000244 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000245 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000246 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000247 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000248 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000249 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong ? -
PAK2011000250 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Wrong East Asian (Beijing) Correct Beijing Correct
PAK2011000251 ■■■■■❏■■■■■■■■■■■■■■■■■■■■■■■■❏■❏❏❏❏■■■❏■■■ Haarlem Correct Euro-American Imprecise Unknown Unknown
PAK2011000252 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level Euro-American Imprecise H4 Incorrect at
fine level
PAK2011000253 ■■■■■■■■■❏■■■■■■■■■■■■❏❏■■■■■■■■❏❏❏❏■■■❏❏■■ S Incorrect at
fine level Euro-American Imprecise Unknown Unknown
PAK2011000254 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
124
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000255 ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000256 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000257 ■■■❏❏❏❏■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000258 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000259 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000260 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000261 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000262 ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000263 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000264 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000265 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000266 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000267 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000268 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level
Euro-American Imprecise H4 Incorrect at fine level
PAK2011000269 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level
Euro-American Imprecise H4 Incorrect at fine level
PAK2011000270 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level
Euro-American Imprecise H4 Incorrect at fine level
PAK2011000271 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
125
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000272 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■❏❏❏❏❏ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000273 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000274 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■■■■■❏❏❏❏■■■■■■■ unknown Unknown Euro-American Imprecise Unknown Unknown
PAK2011000275 ■■■■■❏■■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ unknown Unknown Euro-American Imprecise X1 Correct
PAK2011000276 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000277 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000279 ■■■■■■■■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Haarlem Incorrect at fine level Euro-American Imprecise X1 Correct
PAK2011000280 ■■■❏❏❏❏■■■■■■❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000281 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000282 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000283 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000284 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ unknown Unknown Euro-American Imprecise H4 Incorrect at fine level
PAK2011000285 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000286 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000288 ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000289 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■■■■■■■ EAI Correct Indo-Oceanic Correct EAI 5 Correct
PAK2011000290 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏❏■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000291 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
126
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000293 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000294 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000295 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000296 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000297 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct EAI3-IND Correct
PAK2011000298 ■■■❏❏❏❏❏❏❏❏❏■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■❏❏❏❏ Haarlem Incorrect at fine level Euro-American Imprecise X 3 Correct
PAK2011000299 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000401 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000402 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000403 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level Euro-American Imprecise H4
Incorrect at fine level
PAK2011000404 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Beijing Correct East Asian (Beijing)
Correct Beijing Correct
PAK2011000405 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level Euro-American Imprecise H4
Incorrect at fine level
PAK2011000406 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Cameroon Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000407 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000408 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■❏❏❏❏❏ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000409 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
127
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000410 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■❏❏❏❏■■■❏■■■ LAM Correct Euro-American Imprecise LAM 3 Correct
PAK2011000411 ❏❏■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000412 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000413 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000414 ■■■❏❏❏❏■■■■■❏❏❏❏■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000415 ■■■■■■■■■■■■■■■■■■■❏❏❏❏❏■■■■❏❏❏■❏❏❏❏■■■■■■■ Unknown Unknown Euro-American Imprecise Unknown Unknown
PAK2011000416 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct EAI3-IND Correct
PAK2011000417 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000418 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000419 ■■■❏■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000420 ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏❏❏ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000421 ■■■■■■■■❏❏❏■■■■■■■■■❏❏❏❏■■❏❏❏❏❏■❏❏❏❏■■■■■■■ LAM Incorrect at fine level Euro-American Imprecise Unknown Unknown
PAK2011000422 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■❏■■❏❏❏❏■■■■■■ Delhi/CAS - Indo-Oceanic - Unknown Unknown
PAK2011000423 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000424 ■■■❏❏❏❏■■■■■■❏■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000425 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000426 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Wrong East Asian (Beijing) Correct Beijing Correct
128
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000427 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000428 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000429 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Beijing Correct East Asian (Beijing) Correct Beijing Correct
PAK2011000430 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000431 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000432 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■❏❏■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000433 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000434 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level
Euro-American Imprecise H4 Incorrect at fine level
PAK2011000435 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000436 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000437 ■❏❏■■■■■■■■■■■■■❏■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct EAI3-IND Correct
PAK2011000439 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000440 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000441 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000442 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000443 ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000444 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS Correct
129
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000445 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000447 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000448 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000450 ■■■❏❏❏❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000451 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000453 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000454 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000455 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000456 ■■■❏❏❏❏■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000457 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■■■■■■■■ EAI Correct Indo-Oceanic Correct EAI 5 Correct
PAK2011000458 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000459 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000460 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Beijing Correct East Asian (Beijing) Correct Beijing Correct
PAK2011000461 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000463 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000464 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000465 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct EAI3-IND Correct
PAK2011000466 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
130
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000467 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Cameroon Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000468 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct EAI3-IND Correct
PAK2011000469 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■❏■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000470 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000471 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000472 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000473 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK2011000474 ■■■■■■■■■■■■❏■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■❏■■■ Unknown Unknown Euro-American Imprecise H4 Incorrect at fine level
PAK2011000476 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000477 ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000478 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000479 ■■■❏❏❏❏■■■■■■■■■■■■❏❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000481 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000482 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000483 ■■■❏❏❏❏❏❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS Correct
PAK2011000484 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS Correct
PAK2011000485 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000486 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
131
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2011000487 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000488 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000489 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000490 ■■■❏❏❏❏■■■■■■■■■❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000491 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■❏❏❏❏❏ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2011000492 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000493 ■■■❏❏❏❏■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000494 ■■■❏❏❏❏■■■■■■■■■■■■❏❏■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000495 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏■❏❏❏❏■■■■■■■ Haarlem Correct Euro-American Imprecise H3 Correct
PAK2011000497 ■■■❏■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2011000498 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000499 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000501 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2011000503 ■■■❏❏❏❏❏❏❏■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000504 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong ? -
PAK2011000505 ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■❏■■■ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2011000506 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000507 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000508 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
132
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2012000509 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000510 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000511 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000512 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000513 ■■■❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS Correct
PAK2012000514 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000515 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000516 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000517 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK2012000518 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000520 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000521 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000522 ■■■■■■■■■■■■❏■■■■■❏■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise Ambigous T4T3 Correct
PAK2012000523 ■■■■■■■■■■■■■■■■■❏■■■■❏■■■■■❏❏❏❏■❏■■■■■■■■■ EAI Correct Indo-Oceanic Correct EAI6-BGD1 Correct
PAK2012000526 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK2012000527 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■❏❏■ Delhi/CAS Correct Unknown Unknown Unknown Unknown
PAK2012000528 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ TUR Incorrect at fine level Euro-American Imprecise T1 Correct
PAK2012000529 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Beijing Correct East Asian (Beijing) Correct Beijing Correct
133
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK2012000532 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level Euro-American Imprecise H4
Incorrect at fine level
PAK2012000534 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct ? -
PAK2012000535 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏❏❏■■■■■■■ Haarlem - Euro-American
? -
PAK2012000537 ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS Correct
PAK2012000538 ■■■❏❏❏❏■■■■■■■❏■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000902 ■■■❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏■■■■■■ Delhi/CAS Correct Unknown Unknown CAS2 Correct
PAK1998000903 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level Euro-American Imprecise H4
Incorrect at fine level
PAK1998000904 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000905 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000907 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000908 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000909 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000910 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong CAS Correct
PAK1998000911 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■❏❏■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000912 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000914 ■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK1998000916 ❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Beijing Correct East Asian (Beijing) Correct Beijing Correct
134
Key 43 spoligotyping results
Lineage assignation by MIRU-VNTRPlus
Comparison with expert
visual inspection
Lineage assignation
byTB-Lineage
Comparison with expert
visual inspection
Lineage assignation by
SITVIT
Comparison with expert
visual inspection
PAK1998000917 ■❏❏■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■❏■■❏❏❏■■■■ EAI Correct Indo-Oceanic Correct EAI3-IND Correct
PAK1998000918 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000919 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000920 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000921 ■■■❏■■■■■❏■■■■■■■■■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ S Incorrect at fine level Euro-American Imprecise T1 Correct
PAK1998000922 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏■■■■■■■■■❏❏❏❏■■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong ? - PAK1998000923 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000924 ■■■❏❏❏❏■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏❏■■■■■ Delhi/CAS Correct Indo-Oceanic Wrong Unknown Unknown
PAK1998000925 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000927 ■❏■■■■■■■■■■■■■■■■■■■■■■■■■■❏❏❏■❏❏❏❏■■■■■■■ NEW-1 Incorrect at fine level Euro-American Imprecise H4
Incorrect at fine level
PAK1998000928 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000929 ■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏■■■■■■■ LAM Incorrect at fine level Euro-American Imprecise T1 Correct
PAK1998000932 ■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■❏❏❏❏■■■■■■■ LAM Incorrect at fine level Euro-American Imprecise T1 Correct
PAK1998000933 ■❏❏■■❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■■■■❏❏❏❏■❏■■■■■■■■■ EAI Correct Indo-Oceanic Correct Unknown Unknown
PAK1998000937 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
PAK1998000938 ■■■■■■■■■■■■■■■■■❏■■■■■■■■■■■■■■❏❏❏❏■■■■■■■ Haarlem Incorrect at fine level Euro-American Imprecise X1 Correct
PAK1998000939 ■■■❏❏❏❏■■■■■■■■■■■■■■■❏❏❏❏❏❏❏❏❏❏❏❏■■■■■■■■■ Delhi/CAS Correct Unknown Unknown CAS1-Delhi Correct
135
3.10 Characterization of mutations in rpoB gene associated with rifampicin resistance by Spoligoriftyping
Out of 457 isolates screened for the detection of mutations in hotspot region of
rpoB gene by spoligoriftyping, 426 gave interpretable results (table 3.11). Three
hundred and fifty one (82%) isolates showed no mutation while 75 (18%) isolates
showed different mutations in hot spot region of rpoB gene. The most common
mutation was found to be substitution mutation at codon 531 where 54 isolates
showed this mutation [44 showed (TCG→TTG), 8 showed (TCG→TGG) while two
showed unknown mutations]. Eight strains harbored SNP at codon 526 [3 had SNP
(CAC→GAC), 2 had (CAC→TAC), 3 had unknown mutation]. Eleven isolates
exhibited SNP at codon 516 [10 had (GAC→GTC) while one had unknown
mutation]. The presence of unknown mutations at codon 531, 526 and 516 was
detected by absence of positive hybridization signals both for corresponding wild type
as well as mutant probes. Double mutations were also detected in 3 isolates that
harbored mutations both at codon 531 and 526. Seven mutations were detected
indirectly by the absence of positive hybridization signals by spanning probes [2
isolates showed absence of hybridization signal at regions covered by spanning probe
spaWt_1 and spaWt_2 and one isolate showed no hybridization signal at region
covered by spaWt_1 and 2 isolates at region covered by spaWt_2].
3.10.1 Comparison of spoligoriftyping data with DNA sequencing
DNA sequence analysis revealed that the unknown mutations detected by
absence of hybridization signals at the region covered by spanning probes were
511(CTG→CCG), 517(CAG→CAA) and AAC deletion at codon 518. Unknown
mutations detected by spoligoriftyping at codon 526 were found to be (CAC→AAC)
and (CAC→CTG). Double mutations were also identified correctly (table 3.11).
The DNA sequencing of 84 samples (53 mutants and 31 wild type, based on
spoligoriftyping) served as reference to assess the accuracy of mutation profile
obtained by spoligoriftyping assay. DNA sequencing results correlated very well with
that of spoligoriftyping including those in the region of sequence covered by the
spanning probes Spa_wt1 and Spa_wt2. Double mutations were also confirmed by
sequencing. Contradictory results were found only for 3 isolates. Spoligoriftyping
136
identified a mutation in the region covered by spanning probes spaWt_2 in one isolate
and two mutations at spaWt_1 and spaWt_2 in the second isolate whereas sequencing
analysis showed no mutation in these regions. For a third isolate, a mutation at codon
520(CCG→CCA) could not be detected by spoligoriftyping. Hence, overall
sensitivity and specificity of the assay for predicting resistance in comparison to
sequencing was found to be 98% and 93%, respectively.
3.10.2 Comparison of the phenotypic drug sensitivity for rifampicin results with genotypic drug sensitivity results as obtained by spoligoriftyping
Comparison of the genotypic RifR patterns and the phenotypic drug sensitivity
data as provided by the local hospitals showed that out of 100 isolates annotated as
RifR by the local hospitals, 48 were classified as resistant and 50 as sensitive by
spoligoriftyping, while 216 (88%) out of 244 RifS isolates were confirmed sensitive
(two phenotypically RifR isolates and 19 RifS isolates did not succeed in
spoligoriftyping) (Table 3.11). Nine (4%) isolates designated as RifS by phenotypic
DST were found to possess substitution mutations according to spoligoriftyping at
codon 531(TCG→TTG) (n=5), 531(TCG→TGG) (n=1) and 516(GAC→GTC) (n=3)
of RRDR. These results were confirmed by sequencing for 6 randomly selected
isolates. As 531(TCG→TTG) mutants have always been described as strongly
resistant to rifampicin, the discrepancies between genotypic and phenotypic DSTs
seem to be due to errors in the phenotypic tests.
137
Table 3.11 Characterization of Mutations in rpoB Gene Associated with Rifampicin Resistance in M. tuberculosis Isolates
Key S
pa_w
t1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2009000062 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK1998000063 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2009000064 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK1998000065 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000067 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) 516(GAC→GTC) Resistant
PAK1998000069 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000070 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000071 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000072 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000073 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000074 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2005000076 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2009000077 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
138
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2009000078 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000079 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000082 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000083 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000085 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2009000086 ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ❏ ■ 526(CAC→???) and 531(TCG→TGG)
526(CAC→AAC) and 531(TCG→TGG) Not available
PAK2011000088 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2009000089 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000090 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Not available
PAK2009000092 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000093 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2009000094 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
139
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2009000095 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
PAK2009000097 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Not available
PAK2005000103 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2009000106 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
PAK1998000107 ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ❏ ■ 526(CAC→???) and 531(TCG→TGG)
526(CAC→AAC) and 531(TCG→TGG)
Resistant
PAK1998000109 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Not available
PAK1998000110 ■ ■ ■ ❏ ❏ ❏ ■ ❏ ❏ ■ 526(CAC→GAC) and
531(TCG→TGG) Not done Resistant
PAK1998000111 ■ ■ ■ ❏ ■ ❏ ■ ❏ ❏ ❏ 526(CAC→GAC) 526(CAC→GAC) Resistant
PAK2009000112 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
PAK2009000113 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Sensitive
PAK2009000115 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Sensitive
PAK2009000116 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
140
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2009000119 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK1998000121 ■ ■ ■ ❏ ■ ❏ ❏ ❏ ❏ ❏ 526(CAC→???) 526(CAC→CTG) Resistant
PAK2009000122 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ■ 531(TCG→TGG) 531(TCG→TGG) Resistant
PAK1998000123 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Resistant
PAK2005000126 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2009000127 ■ ■ ❏ ■ ■ ❏ ❏ ❏ ❏ ❏ spaWt_2 AAC Deletion Resistant
PAK2010000128 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2009000129 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000130 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK1998000131 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000132 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000133 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000136 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2009000139 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
141
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK1998000141 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000144 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Not available
PAK1998000147 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2009000148 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2009000149 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000154 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK1998000155 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000156 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2009000157 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation 520(CCG→CCA) Resistant
PAK2009000158 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000159 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2009000160 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000161 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK1998000164 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
142
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK1998000167 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ■ 531(TCG→TGG) Not done Resistant
PAK2009000168 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2009000169 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2009000170 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000171 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000172 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000173 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2009000174 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Not available
PAK1998000191 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2010000196 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2010000197 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000198 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000199 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Resistant
PAK2010000200 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
143
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2010000202 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000203 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000204 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000205 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2010000206 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2010000207 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000208 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000210 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2010000211 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2010000213 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2010000214 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2011000215 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2010000218 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2010000219 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
144
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2010000221 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2011000222 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000223 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000224 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000225 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000226 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000227 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000228 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000229 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000230 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000231 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000232 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000233 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000234 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
145
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000235 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000236 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000237 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000238 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000239 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000240 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000241 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000242 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000243 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000244 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000245 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000246 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000247 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000248 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
146
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000249 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000250 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000251 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000252 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000253 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000254 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000255 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000256 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000257 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000258 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000259 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000260 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000261 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000262 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
147
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000263 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000264 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000265 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000266 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000267 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000268 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000269 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000270 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000271 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000272 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000273 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000274 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000275 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000276 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
148
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000277 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000279 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000280 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000281 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000282 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000283 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000284 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000285 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000286 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2011000288 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000289 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000290 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000291 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000293 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
149
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000294 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000295 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000296 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000297 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000298 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2011000299 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) 516(GAC→GTC) Resistant
PAK2011000401 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000402 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ■ 531(TCG→TGG) 531(TCG→TGG) Resistant
PAK2011000403 ■ ■ ■ ❏ ■ ❏ ❏ ■ ❏ ❏ 526(CAC→TAC) 526(CAC→TAC) Resistant
PAK2011000404 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000405 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000406 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000407 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000408 ■ ■ ■ ❏ ■ ❏ ■ ❏ ❏ ❏ 526(CAC→GAC) 526(CAC→GAC) Resistant
150
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000409 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) 516(GAC→GTC) Resistant
PAK2011000410 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
PAK2011000411 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000412 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000413 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000414 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000415 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000416 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000417 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000418 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000419 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000420 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000421 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000422 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
151
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000423 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000424 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000425 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000426 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000427 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000428 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000429 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000430 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000431 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
PAK2011000432 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000433 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000434 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000435 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000436 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
152
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000437 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000439 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000440 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2011000441 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000442 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000443 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000444 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000445 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000447 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000448 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000449 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000450 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000451 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000453 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
153
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000454 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000455 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000456 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000457 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000458 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000459 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2011000460 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000461 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000463 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000464 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000465 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000466 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000467 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000468 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
154
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000469 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000470 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) 516(GAC→GTC) Sensitive
PAK2011000471 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000472 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2011000473 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) 516(GAC→GTC) Sensitive
PAK2011000474 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000476 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000477 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000478 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000479 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000481 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000482 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000483 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) Not done Resistant
PAK2011000484 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
155
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000485 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000486 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000487 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000488 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000489 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000490 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000491 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) 516(GAC→GTC) Sensitive
PAK2011000492 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000493 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) 531(TCG→TTG) Sensitive
PAK2011000494 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000495 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000498 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000499 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000503 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
156
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2011000504 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000505 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2011000506 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK1998000903 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Not available
PAK1998000904 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Not available
PAK1998000905 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000906 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000907 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000908 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000909 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000910 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000911 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Not available
PAK1998000912 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000913 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
157
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK1998000914 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000915 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000916 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000917 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000918 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000919 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000920 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000921 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000922 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000923 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000924 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000925 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000927 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
158
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK1998000928 ❏ ■ ❏ ■ ■ ❏ ❏ ❏ ❏ ❏ spaWt_1 and spaWt_2 511(CTG→CCG) and
517(CAG→CAA) Not available
PAK1998000929 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000930 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000931 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000932 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000933 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ❏ 531(TCG→???) Not done Not available
PAK1998000934 ■ ■ ■ ❏ ■ ❏ ❏ ■ ❏ ❏ 526(CAC→TAC) Not done Not available
PAK1998000935 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000936 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000937 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ■ 531(TCG→TGG) Not done Not available
PAK1998000938 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000939 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK1998000942 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
159
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2012000507 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000508 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000509 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000510 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000511 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000512 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000513 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000514 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Not available
PAK2012000515 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000516 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000517 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000518 ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutationpaWt_1 Not done Not available
PAK2012000520 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000521 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
160
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2012000522 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000523 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000525 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000526 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000527 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000528 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000529 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000530 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000532 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000533 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000534 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000535 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Not available
PAK2012000537 ■ ❏ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ 516(GAC→???) 516(GAC→TAC) Not available
PAK2012000538 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Not available
161
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2008000539 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000540 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000543 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000545 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000546 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000547 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000548 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000550 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) Not done Resistant
PAK2008000551 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000554 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000555 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2008000556 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000557 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000559 ■ ■ ❏ ■ ■ ❏ ❏ ❏ ❏ ❏ spaWt_2 No mutation Sensitive
162
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2008000560 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000561 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000562 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000563 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000564 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Resistant
PAK2008000565 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) Not done Resistant
PAK2008000566 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000567 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000568 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000569 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000571 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000572 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000573 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000574 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
163
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2008000575 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000576 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000577 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000578 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Resistant
PAK2008000579 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000581 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Sensitive
PAK2008000582 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000583 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000584 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000585 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000586 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000587 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000588 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000589 ■ ❏ ■ ■ ■ ■ ❏ ❏ ❏ ❏ 516(GAC→GTC) Not done Resistant
164
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2008000590 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2008000591 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000592 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000593 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000594 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000595 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000596 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000597 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000600 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000601 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000602 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000603 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000604 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000605 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
165
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2008000606 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000607 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000608 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000611 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000614 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000616 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
PAK2008000617 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation No mutation Sensitive
PAK2008000618 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000619 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000620 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Resistant
PAK2008000621 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000622 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2008000623 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000624 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ■ ❏ 531(TCG→TTG) Not done Sensitive
166
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2008000625 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000626 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000627 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000628 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000629 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2008000630 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000631 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000632 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000633 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000634 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000635 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000636 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000637 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000638 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
167
Key
Spa
_wt1
516_
wt
spa_
wt2
526_
wt
531_
wt
516_
mut
_GT
C
526_
mut
_GA
C
526_
mut
_TA
C
531_
mut
_TT
G
531_
mut
_TG
G
Spoligoriftyping results rpoB hotspot sequencing
results Phenotypic DST
PAK2008000639 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2008000640 ❏ ■ ❏ ■ ■ ❏ ❏ ❏ ❏ ❏ spaWt_1 and spaWt_2 No mutation Sensitive
PAK2008000641 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000643 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000644 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000645 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ❏ 531(TCG→???) Not done Resistant
PAK2008000646 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000647 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000649 ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ ■ 531(TCG→TGG) Not done Sensitive
PAK2008000650 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Resistant
PAK2008000651 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
PAK2008000653 ■ ■ ■ ■ ■ ❏ ❏ ❏ ❏ ❏ No mutation Not done Sensitive
168
3.11 Reverse hybridization line probe assay
3.11.1 Analysis of PCR products of “hot spot” region of rpoB gene
PCR products using outer pair of primers were resolved on 1.5% agarose gel
to check the quality of amplified products. A 382bp DNA band was observed for
specific amplification.
Figure 3.21 PCR amplification of rpoB gene of M. tuberculosis isolates
by regular primers Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 7: “No DNA” negative control; Lane 1-6: PCR amplification products
3.11.2 Analysis of nested PCR products by agarose gel electrophoresis
Nested PCR products were resolved on 1.5% agarose gel to check the
amplified products and 257 bp amplification product was observed.
Figure 3.22 PCR amplification of rpoB gene of M. tuberculosis isolates by
nested primers Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 1: “No DNA” negative control; Lane 2-13: PCR amplification products
3.11.3 Optimization of conditions for reverse hybridization line probe assay (RH-LiPA)
Un-tailed oligonucleotides could not be bound to the membrane. This was
evident by the nonspecific binding of the PCR product directly to membrane as shown
169
in the figure 3.23. Since PCR product was too long (265bp), it got bound to the
membrane without cross linking and could not be removed even after stringent
washing.
Figure 3.23 Optimization of conditions for reverse line blot. Continuous blue purple lines show nonspecific binding of PCR products
3.11.4 Elimination of nonspecific signals
Though nonspecific binding of the PCR products to the nylon membrane was
eliminated by the introduction of pre-hybridization solution to the procedure but no
specific signals were observed. This pointed out that the problem might be with the
binding of the oligonucleotides to the membrane which had resulted in the failure of
hybridization signals (Figure 3.24).
Figure 3.24 Elimination of nonspecific binding of PCR product Use of pre-hybridization solution resulted in the elimination of nonspecific binding of PCR products
3.11.5 Probe Hybridization and Signal Detection at Different Conditions
The best signal intensity was found with hybridization temperature of 45oC in
combination with 53oC washing temperature. 5XSSPE/0.5% SDS was found to be
optimum salt concentration for hybridization solution (table 3.12 and figure 3.25).
Moreover, it was found that addition of conjugate at hybridization step can not only
170
result in effective binding of the conjugate to the biotin along with the hybridization
but also reduced the assay time.
3.12 Probe Hybridization and Signal Detection at Different Conditions
Strip No: Nonspecific background Hybridization signals
1 No Weak
2 No Weak
3 No Strong
4 No Weak
5 Yes No signals due to dark background
6 Yes No signals due to dark background
7 No Strong
8 Yes Weak signals due to high background
9 No Strong
Figure 3.25 Optimization of different hybridization and washing conditions
Nylon membrane strips at different conditions of hybridization and washing showing different intensities of hybridization signals
3.11.6 Optimization of DNA cross linking time
The optimum time for cross linking DNA to the nylon membrane was when
the membrane was exposed to UV twice
171
Figure 3.26 Optimization of DNA cross linking time
3.11.7 Application of strip optimized conditions in Mini blotter45
Signals of the same intensity as to that in the strips were observed which
showed that the conditions optimized for the strips were equally good for
hybridization in Miniblotter except that the background was observed in the direction
of applied oligonucleotides (figure 3.27).
Figure 3.27 Application of strip optimized conditions in Mini blotter45 Background was observed in the direction of applied oligonucleotides
Oligonucleotides
172
3.11.8 Optimization of PCR product concentration
The intensity of hybridization signals was found to be directly proportional to
the quantity of the PCR products. The optimum quantity of PCR product was 10 µL
(figure 3.28).
Figure 3.28 Optimization of amplicon concentration
3.11.9 Characterization of mutations in rpoB gene of M. tuberculosis by In-house RH-LiPA
After optimization, 168 culture isolates, originating from different parts of
Pakistan, were screened for the mutations rpoB 511, rpoB 512, rpoB 513, rpoB 515,
rpoB 516, rpoB 522, rpoB 524, rpoB 526, rpoB 529, rpoB 531 and rpoB 533. The
results were visually analyzed (figure 3.29, 3.30 and 3.31) and are given in table 3.13.
Out of 168 culture isolates analyzed, 116 (69%) isolates showed no mutation
while 52 (31%) isolates showed either substitution or deletion mutation in hotspot
region of rpoB gene. The most common mutation was in codon 531 where 36 isolates
were found to harbor mutation at this codon [33 isolates showed (TCG→TTG), 3
isolates showed (TCG→TGG) mutation]. Seven isolates exhibited mutation in codon
526 [2 isolates showed (CAC→GAC), 3 had (CAC→TGC), (CAC→TAC) or
(CAC→CGC) mutation while 2 isolates showed unknown mutations]. The AAC
deletion at codon 518 was observed in one isolate while another isolate showed an
unknown mutation at codon 515(ATG→???). Two isolates showed mutation at codon
516 [one had GACCAG del mutation while other had (GAC→GTC) mutation] and 4
isolates harbored (CTG→CCG) mutation at codon 511. The presence of unknown
mutations at codon 526 and 515 were detected indirectly by the absence of signal for
wild type as well as mutant probes corresponding to codon 526 and 515.
5µl 10µl 20µl 30µl 40µl 50 µl
173
Figure 3.29 Reverse hybridization line blot
Horizontal lanes show oligonucleotides while vertical lanes correspond to PCR products from different isolates. Dark blue boxes indicate positive hybridization signals.
174
Figure 3.30 Reverse hybridization line blot
Horizontal lanes show oligonucleotides while vertical lanes correspond to PCR products from different isolates. Dark blue boxes indicate positive hybridization signals.
175
Figure 3.31 Reverse hybridization line blot
Horizontal lanes show oligonucleotides while vertical lanes correspond to PCR products from different isolates. Dark blue boxes indicate positive hybridization signals.
176
3.11.10 Cloning and DNA sequencing of PCR amplified hotspot region of rpoB gene from M. tuberculosis
A 382bp amplified fragment of rpoB gene was cloned in pTZ57R (MBI
Fermentas) vector for 30 isolates while 257bp amplified segment of rpoB gene was
cloned for 16 isolates. Extracted plasmid DNA was restricted by EcoR1 and Pst1
enzymes and was resolved on agarose gel to see the size and quality of insert (Figure
3.29).
Figure 3.32 Restriction analysis of pTZ57R/T vector DNA containing cloned
rpoB gene fragment Lane L: 1kb DNA ladder (Fermentas Cat # SM0313) Lane 1-9: Restricted E. coli plasmid DNA containing cloned fragment
3.11.11 Correlation of in-house line probe assay with DNA sequencing
DNA sequencing of 59 randomly selected samples (27 mutant and 32
susceptible as designated by in-house line probe assay) served as reference to assess
the accuracy of mutation profile of rpoB as detected by in-house assay. Of 32
susceptible designated isolates, DNA sequencing analysis showed no mutation in
hotspot region of rpoB gene in 31 isolates while one isolate was found to have a silent
mutation at codon 520(CCG→CCA). In-house line probe assay could not detect this
silent mutation. Of 27 isolates designated as mutant by in-house assay, 26 isolates
were found to have the corresponding mutations as in the sequencing analysis. The
one that showed the discrepant result was the isolate found to harbor double mutation
at codon 531(TCG→TGG) along with 526(CAC→AAC) while in-house assay could
only detect the mutation at codon 531. Hence, with two discrepant results sensitivity
and specificity of in-house line probe assay was found to be 96% and 97%,
respectively.
177
The unknown mutations detected at codon 526 in one isolate was found to be
(CAC→CTG) while sequencing of two isolates showing unknown mutations at codon
515 and 526 could not be done due to nonavailability of DNA. Other mutations
detected outside the hotspot region of rpoB gene by sequencing were
569(ATC→AAC), 548(CGC→TGC) and 506(GAC→ATC) where mutation at codon
548(CGC→TGC) was found to be coexisting with mutation at codon
531(TCG→TTG) (table 3.13).
Table 3.13 Detected Mutations in rpoB Gene of M. tuberculosis Culture Isolates by In-house Line Probe Assay
Code LiPA results Sequencing DST
PAK1998000059 515(ATG→???) Not available Resistant
PAK1998000060 526(CAC→TGC) Not done Resistant
PAK1998000061 526(CAC→TAC) 526(CAC→TAC) Resistant
PAK1998000063 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000065 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000067 516(GAC→GTC) 516(GAC→GTC) Resistant
PAK1998000069 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000070 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000071 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000072 531(TCG→TTG) 531(TCG→TTG Resistant
PAK1998000073 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000074 No mutation Not done Resistant
PAK1998000107 531(TCG→TGG) 526(CAC→AAC) and
531(TCG→TGG) Resistant
PAK1998000109 No mutation No mutation Not available
PAK1998000111 526(CAC→GAC) 526(CAC→GAC) Resistant
PAK1998000121 526(CAC→???)* 526(CAC→CTG) Resistant
PAK1998000123 531(TCG→TTG) Not done Resistant
PAK1998000141 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK1998000144 531(TCG→TTG) Not done Not available
PAK1998000155 No mutation Not done Not available
PAK1998000156 No mutation Not done Not available
PAK1998000167 531(TCG→TGG) Not done Resistant
PAK1998000191 531(TCG→TTG) 531(TCG→TTG) Resistant
178
Code LiPA results Sequencing DST
PAK2005000076 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2005000103 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2008000654 No mutation Not done Not available
PAK2008000655 531(TCG→TTG) Not done Not available
PAK2008000656 No mutation Not done Not available
PAK2008000657 531(TCG→TTG) Not done Not available
PAK2008000658 531(TCG→TTG) Not done Not available
PAK2008000659 No mutation Not done Not available
PAK2008000660 531(TCG→TTG) Not done Not available
PAK2008000661 No mutation Not done Not available
PAK2008000662 526(CAC→CGC) Not done Not available
PAK2008000663 531(TCG→TTG) Not done Not available
PAK2008000664 518 AAC del Not done Not available
PAK2008000567 511(CTG→CCG) Not done Not available
PAK2008000666 No mutation Not done Not available
PAK2008000667 No mutation Not done Not available
PAK2008000668 No mutation Not done Not available
PAK2008000669 No mutation 506(TTC→ATC) Not available
PAK2008000670 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2008000671 No mutation 569(ATC→AAC
outside the hotspot Not available
PAK2008000672 No mutation Not done Not available
PAK2008000673 No mutation No mutation Not available
PAK2008000674 No mutation No mutation Not available
PAK2008000675 No mutation No mutation Not available
PAK2008000676 No mutation No mutation Not available
PAK2008000677 No mutation No mutation Not available
PAK2008000678 No mutation Not done Not available
PAK2008000679 No mutation Not done Not available
PAK2008000680 No mutation Not done Not available
PAK2008000681 No mutation Not done Not available
PAK2008000682 No mutation Not done Not available
PAK2008000683 No mutation Not done Not available
PAK2008000684 No mutation Not done Not available
179
Code LiPA results Sequencing DST
PAK2008000685 No mutation Not done Not available
PAK2008000686 No mutation Not done Not available
PAK2008000687 No mutation Not done Not available
PAK2008000688 No mutation Not done Not available
PAK2008000689 No mutation Not done Not available
PAK2008000690 No mutation Not done Not available
PAK2008000691 No mutation Not done Not available
PAK2008000692 No mutation Not done Not available
PAK2008000693 No mutation Not done Not available
PAK2008000694 No mutation Not done Not available
PAK2008000695 No mutation Not done Not available
PAK2008000696 No mutation Not done Not available
PAK2008000697 516(GAC CAG)
deletions Not done Not available
PAK2008000698 No mutation Not done Not available
PAK2008000699 511(CTG→CCG) Not done Not available
PAK2008000700 No mutation Not done Not available
PAK2008000701 No mutation Not done Not available
PAK2008000702 No mutation Not done Not available
PAK2008000703 No mutation Not done Not available
PAK2008000704 No mutation Not done Not available
PAK2008000705 No mutation Not done Not available
PAK2008000706 No mutation Not done Not available
PAK2008000707 531(TCG→TTG) Not done Not available
PAK2008000708 511(CTG→CCG) Not done Not available
PAK2008000709 No mutation Not done Not available
PAK2008000710 No mutation Not done Not available
PAK2008000711 No mutation Not done Not available
PAK2008000712 No mutation No mutation Not available
PAK2008000713 No mutation No mutation Not available
PAK2008000714 No mutation Not done Not available
PAK2008000715 No mutation Not done Not available
PAK2008000716 531(TCG→TTG) Not done Not available
PAK2008000717 No mutation Not done Not available
180
Code LiPA results Sequencing DST
PAK2008000718 No mutation Not done Not available
PAK2008000719 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2008000720 No mutation No mutation Not available
PAK2008000721 No mutation No mutation Not available
PAK2008000722 No mutation No mutation Not available
PAK2008000723 531(TCG→TTG) Not done Not available
PAK2008000724 531(TCG→TTG) Not done Not available
PAK2008000725 531(TCG→TTG) Not done Not available
PAK2008000726 531(TCG→TTG) Not done Not available
PAK2008000727 526(CAC→???) Not available Not available
PAK2008000728 No mutation Not done Not available
PAK2008000729 511(CTG→CCG) Not done Not available
PAK2008000730 No mutation Not done Not available
PAK2008000731 No mutation Not done Not available
PAK2008000732 526(CAC→GAC) Not done Not available
PAK2008000733 No mutation Not done Not available
PAK2008000734 No mutation Not done Not available
PAK2008000735 No mutation Not done Not available
PAK2008000736 No mutation Not done Not available
PAK2008000737 No mutation Not done Not available
PAK2009000062 No mutation No mutation Not available
PAK2009000064 No mutation No mutation Not available
PAK2009000077 No mutation Not done Resistant
PAK2009000078 No mutation No mutation Not available
PAK2009000079 No mutation Not done Resistant
PAK2009000082 No mutation No mutation Not available
PAK2009000083 No mutation Not done Resistant
PAK2009000085 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2009000089 No mutation No mutation Sensitive
PAK2009000090 No mutation No mutation Not available
PAK2009000092 No mutation No mutation Resistant
PAK2009000094 No mutation No mutation Sensitive
PAK2009000095 No mutation No mutation Not available
PAK2009000106 No mutation No mutation Sensitive
181
Code LiPA results Sequencing DST
PAK2009000112 No mutation No mutation Sensitive
PAK2009000113 531(TCG→TTG) 531(TCG→TTG) Sensitive
PAK2009000115 531(TCG→TTG) 531(TCG→TTG) and
548(CGC→TGC) outside the hotspot
Sensitive
PAK2009000119 No mutation No mutation Not available
PAK2009000122 531(TCG→TGG) 531(TCG→TGG) and
571(CTG→CCG) Resistant
PAK2009000127 518 AAC deletion 518 AAC deletion Resistant
PAK2009000129 No mutation No mutation Resistant
PAK2009000130 No mutation No mutation Resistant
PAK2009000132 No mutation Not done Resistant
PAK2009000133 No mutation No mutation Resistant
PAK2009000136 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2009000139 No mutation Not done Resistant
PAK2009000148 No mutation Not done Not available
PAK2009000149 No mutation No mutation Resistant
PAK2009000154 No mutation Not done Resistant
PAK2009000157 No mutation 520(CCG→CCA) Resistant
PAK2009000158 No mutation Not done Resistant
PAK2009000159 No mutation No mutation Resistant
PAK2009000160 No mutation Not done Resistant
PAK2009000168 No mutation Not done Not available
PAK2009000169 No mutation Not done Not available
PAK2009000170 No mutation Not done Not available
PAK2009000171 No mutation Not done Resistant
PAK2009000172 No mutation Not done Resistant
PAK2009000173 No mutation Not done Resistant
PAK2009000174 531(TCG→TTG) 531(TCG→TTG) Not available
PAK2010000128 No mutation Not done Not available
PAK2010000196 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2010000197 No mutation Not done Resistant
PAK2010000198 No mutation Not done Resistant
PAK2010000199 No mutation No mutation Resistant
182
Code LiPA results Sequencing DST
PAK2010000200 No mutation Not done Resistant
PAK2010000202 No mutation Not done Resistant
PAK2010000203 No mutation Not done Resistant
PAK2010000205 No mutation Not done Not available
PAK2010000207 No mutation Not done Resistant
PAK2010000208 No mutation Not done Resistant
PAK2010000210 531(TCG→TTG) 531(TCG→TTG) Resistant
PAK2010000211 No mutation Not done Not available
PAK2010000213 No mutation Not done Not available
PAK2010000214 No mutation Not done Resistant
PAK2010000218 No mutation Not done Resistant
PAK2010000219 No mutation Not done Resistant
PAK2010000221 No mutation Not done Resistant
* Probe specific to this mutation was not present in the assay
3.11.12 Approximate cost study of the developed in-house assay
Approximate cost of the developed In-house assay was calculated which
included cost of collection of samples, DNA extraction, PCR, membrane, all
disposables, hybridization and detection. Our assay costs €3.16 per sample when a
single sample was analyzed. The detail description of the consumables along with the
approximate cost is given in the table 3.14.
Table 3.14 Approximate Cost of the Developed In-house Assay
Quantity Price Quantity used
per test Price per test
(Rs.)
DNA Extraction Vacutainer tubes 100 1300 1 13
Syringe 100 900 1 9
Pipet tips (total) 500 300 25 30.6
Eppendorff (total) 500 550 4 5
Proteinase K (10mg/mL) 1mL 2000
~10
183
Quantity Price Quantity used
per test Price per test
(Rs.)
PCR
Master Mix 250 Rx 6000 1 100
Primers for regular and nested PCR with Biotin modification
100µM×4 8330 2.1µM 44
PCR tubes 1000 1300 6 6
Gloves (total) 525 50 pair 4 42
DNA ladder 100 Rx 10,000 5 samples per gel 20
Agarose 500 g 37,000 0.1 g/reaction 8
TBE 1L 55
~6
Blotting
Nylon membrane 30 cm×3m 45000 30cm/80 samples 15
Oligos 30 oligo×50bp 37,500 8 pM per blot per
oligo 90
20XSSPE 1L 300 1mL 0.3
Hybridization
Biotin Chromogenic
Detection Kit
(Fermantas Cat #
K0662)
30 Blots 30,000 1000/15 67
Total
465.9 = €3.16
3.11.13 Frequency of mutations in rpoB gene of M. tuberculosis strains prevalent in Pakistan
Analysis of 515 isolates for the detection of mutations in rpoB gene revealed a
mutation profile that did not show a significant difference. Eighty one percent
(n=416) isolates showed no mutation while nineteen percent (n=99) isolates showed
mutations in rpoB gene. Dominant mutations were point substitution mutations (93%)
while deletion mutations had lesser contribution (3%). Mutations at codon 531 were
found at remarkably high frequency (64%). Other codons in hotspot region that had
mutations were 526, 516, 511 and 518 with the frequencies of 12%, 11%, 5% and 2%,
184
respectively. Novel mutations observed outside the hotspot region constitute 4% and
these were found in codon 571, 569, 548 and 506. The frequency of mutations is
listed in table 3.15 while figure 3.30 provides overall spectrum of the mutations in
rpoB gene.
Table 3.15 Overall Spectrum of Mutations Observed in rpoB Gene of M. tuberculosis Culture Isolates
Codon Nucleotide change
Amino acid change Type No. of
isolates
Mutation frequency
(%)
571 CTG→CCG Leu→Pro Substitution 1 1
569 ATC→AAC Ile→Asn Substitution 1 1
548 CGC→TGC Arg→Cys Substitution 1 1
531 TCG→TTG Ser→Leu Substitution 57
64 531 TCG→TGG Ser→Trp Substitution 9 531 TCG→*
Ser→* --- 2
526 CAC→CGC His→Arg Substitution 1
12
526 CAC→GAC His→Asp Substitution 4 526 CAC→* His→* --- 1 526 CAC→TAC His→Tyr Substitution 3 526 CAC→TGC His→Cys Substitution 1 526 CAC→CTG His→Leu Substitution 1 526 CAC→AAC His→Asn Substitution 3
520 CCG→CCA Pro→Pro Silent 1 1
518 AACdeletion - Deletion 2 2
517 CAG→CAA Gln→Gln Silent 1 1
516 GAC CAG deletions
- Deletion 1 11 516 GAC→GTC Asp→Val Substitution 10
516 GAC→TAC Asp→Tyr Substitution 1
515 ATG→* Met→* --- 1 1
511 CTG→CCG Leu→Pro Substitution 5 5
506 GAC→ATC Asp→Ile Substitution 1 1
spaWt_1 * * --- 1 1
* These isolates could not be sequenced
185
Figure 3.33 Percentage of different mutations observed in rpoB Gene of M.
tuberculosis culture isolates
3.11.14 Comparison of phenotypic drug sensitivity profile of different laboratories with genotypic drug sensitivity for rifampicin
The phenotypic drug sensitivity data as provided by different laboratories was
compared with genotypic drug sensitivity data. The samples included in this
comparison were 477 in number for which both the phenotypic and genotypic data
was available. The percent concordance of phenotypic DST with genotypic DST for
rifampicin is given in the table 3.16.
Laboratory 1
A total of 111 isolates from this laboratory were collected. The drug
sensitivity profile of 96 samples was available that designated 85 as RIFS while 11 as
RIFR. Genotypic drug sensitivity data revealed mutations in all the 11 RIFR isolates in
hotspot region of rpoB gene while no mutation was observed in any of RIFS isolates.
Results of 11 RIFR and 13 RIFS isolates were confirmed by sequencing.
Laboratory 2
A total of 38 isolates were received from this laboratory. Phenotypic drug
sensitivity profile designated 33 out of 38 isolates as RIFR while 5 as RIFS. Genotypic
drug sensitivity data showed mutations in 24 phenotypically RIFR and one RIFS
isolate while 9 RIFR and 4 RIFS isolates did not show any mutation.
186
Table 3.16 Percentage Concordance of Phenotypic and Genotypic DST for rifampicin
Genotypic rifampicin sensitivity data % age
concordance
Resistant Sensitive
Phe
noty
pic
rifam
pici
n se
nsiti
vity
dat
a
Laboratory 1 Resistant 11 0
100 Sensitive 0 85
Laboratory 2 Resistant 24 9
84.84 Sensitive 1 4
Laboratory 3 Resistant 7 30
25.58 Sensitive 2 4
Laboratory 4 Resistant 9 14 75.67 Sensitive 4 47
Laboratory 5 Resistant 7 6
90.62 Sensitive 3 80
Laboratory 6 Resistant 8 22 100 Sensitive 0 0
Only samples for which both phenotypic as well as genotypic DST data was available were included in the comparison
Laboratory 3
Out of 79 M. tuberculosis isolates collected from this laboratory, phenotypic
drug sensitivity data was available for 43 isolates that designated 37 as RIFR while 6
as RIFS. Genotypic screening detected mutations in 7 RIFR and 2 RIFS while 30 RIFR
and 4 RIFS isolates did not show any mutation. Isolates that were designated sensitive
by phenotypic DST but resistant by genotypic DST were found to have mutations in
codon 531 and these results were confirmed by sequencing.
Laboratory 4
A total of 80 M. tuberculosis isolates were included from this laboratory in
rifampicin drug resistance study. Phenotypic drug sensitivity data, available for 74
187
isolates, designated 23 isolates as RIFR while 51 as RIFS. Genotypic screening
detected mutations in 9 RIFR and 4 RIFS isolates while no mutation was detected in 14
RIFR and 47 RIFS isolates. Isolates that were designated sensitive by phenotypic DST
but resistant by genotypic DST were found to have mutations in codon 531 and 516.
Results of 14 isolates including 4 RIFS isolates showing mutations were confirmed by
sequencing.
Laboratory 5
A total of 96 M. tuberculosis isolates were included from this laboratory. Out
of 56 isolates for which phenotypic drug sensitivity data was available, 13 isolates
were rifampicin resistant while 83 were rifampicin sensitive. Genotypic screening
detected mutations in 7 RIFR and 3 RIFS isolates while no mutation was detected in 6
RIFR and 80 RIFS. The results of 4 phenotypically and genotypically RIFS isolates
were confirmed by sequencing.
Laboratory 6
A total of 78 samples were screened in this study. Drug sensitivity data for 30
isolates was available that were reported to be resistant (100%) with proportion
method. Genotypic drug sensitivity data designated only 8 isolates as resistant while
22 as sensitive. Results obtained by spoligoriftyping or in-house line probe assay were
confirmed by sequencing for 12 isolates.
3.11.15 Frequency of mutations in “hotspot” region of rpoB gene in clinical specimens
Patients referred to NIBGE for the diagnosis of tuberculosis were screened
using primers specific for IS6110. Those found to be positive by PCR (44 in number)
were also tested for the presence or absence of mutations in “hotspot” region of rpoB
gene. Majority of the patients belonged to Faisalabad and its adjoining cities. The
samples consisted of 37 blood and 6 sputum specimen. Out of these 43 samples, only
2 samples showed the presence of mutation in rpoB gene which was found to be in
codon 511(CTG→CCG) and 531(TCG→TTG). Isolate that showed mutation in
codon 531 was found to have hetero resistance (mixed infection) as indicated by the
presence of positive hybridization signals both for wild type as well as mutant probes
188
specific for this mutation. All other samples were found to have no mutation in
hotspot region of rpoB gene (table 3.17). Hence the frequency of mutations in hotspot
region of rpoB gene in clinical samples was found to be 4.5 %.
Table 3.17 Mutations in “Hotspot” Region of rpoB Gene in Clinical Specimens
Sr.No. NIBGE code
City Specimen RH-LiPA
1 06 Faisalabad Blood No mutation
2 07 Faisalabad Blood No mutation
3 08 Faisalabad Blood No mutation
4 R2476 Faisalabad Blood No mutation
5 R2477 Faisalabad Blood No mutation
6 R2493 Faisalabad Blood No mutation
7 R2497 Faisalabad Blood No mutation
8 R2498 Kamalia Blood No mutation
9 R2501 Faisalabad Blood No mutation
10 R2503 Faisalabad Blood No mutation
11 R2506 Faisalabad Blood No mutation
12 R2500 Faisalabad Blood No mutation
13 R2572 Faisalabad Sputum No mutation
14 R2573 Faisalabad Blood No mutation
15 R2465 Faisalabad Blood No mutation
16 R2478 Faisalabad Blood No mutation
17 R2521 Faisalabad Blood No mutation
18 R2560 Faisalabad Blood No mutation
19 R2542 Faisalabad Blood No mutation
20 R2543 Faisalabad Blood No mutation
21 R2540 Faisalabad Blood No mutation
22 R2533 Faisalabad Blood No mutation
23 09 Faisalabad Blood No mutation
24 R2532 Saangla Hill Blood No mutation
25 R2530 Faisalabad Blood No mutation
26 R2531 Faisalabad Blood No mutation
189
Sr.No. NIBGE code
City Specimen RH-LiPA
27 R2555 Faisalabad Blood No mutation
28 R2528 Faisalabad Blood No mutation
29 R2517 Faisalabad Blood No mutation
30 R2505 Jaranwala Blood No mutation
31 R2534 Toba Tek Singh Blood No mutation
32 R2536 Gojra Blood No mutation
33 R2455 Faisalabad Blood No mutation
34 R2545 Jaranwala Blood No mutation
35 R2483 Faisalabad Blood No mutation
36 R2550 Faisalabad Blood No mutation
37 R2535 Faisalabad Blood No mutation
38 01 Faisalabad Sputum No mutation
39 R2640 Faisalabad Sputum No mutation
40 R2643 Faisalabad Sputum No mutation
41 02 Faisalabad Sputum No mutation
42 R2655 Faisalabad Sputum No mutation
43 R2502 Faisalabad Blood 511(CTG→CCG)
44 R2657 Faisalabad Blood 531(TCG→TTG)
3.12 Characterization of mutations associated with Isoniazid resistance using microbeads based assay
3.12.1 Data interpretation
Mean fluorescence intensities were taken as positive or negative hybridization
signals according to the cut-off values specific for each probes. The final display of
the analysis was in the form of solid/un-filled blocks which corresponds to the
presence or absence of hybridization signals as shown in figure 3.13.
3.12.2 Mutations in promoter region of inhA gene and katG gene
A total of 457 isolates were screened for the detection of mutations at codon
315 of katG gene and at position -8 and -15 of promoter region of inhA gene by
190
microbead based assay. Results were available for 404 isolates while 52 isolates did
not succeed. Three hundred and twenty eight (81%) isolates showed none of the tested
mutations in katG and promoter region of inhA gene while 76 (19%) isolates showed
mutations in either katG and/or in inhA gene. One isolate (0.24%) was found to have
hetero-resistance as it showed positive hybridization signals both for wild type as well
as mutant probe. In 94% isolates, single mutation was observed while 5% isolates
showed double mutations.
Well Sample Kat
G_3
15_W
t
InhA
_-15
_Wt
KatG
_315_m
ut C
KatG
_315_m
ut A
InhA
_-1
5_m
ut T
InhA
_-8
_m
ut A
Resi
stanc
e p
redi
ctio
n
A1 1 ■ ■ ❏ ❏ ❏ ■ RB1 2 ■ ■ ❏ ❏ ❏ ❏ SC1 3 ■ ■ ❏ ❏ ❏ ❏ SD1 4 ■ ■ ❏ ❏ ❏ ❏ SE1 5 ■ ■ ❏ ❏ ❏ ■ RF1 6 ■ ■ ❏ ❏ ❏ ❏ SG1 7 ❏ ■ ❏ ■ ❏ ❏ RH1 8 ■ ❏ ❏ ❏ ■ ❏ RA2 9 ■ ■ ❏ ❏ ❏ ❏ SB2 10 ❏ ■ ■ ❏ ❏ ❏ RC2 11 ■ ■ ❏ ❏ ❏ ❏ SD2 12 ■ ■ ❏ ❏ ❏ ❏ SE2 13 ■ ■ ❏ ❏ ❏ ■ RF2 14 ❏ ■ ■ ❏ ❏ ❏ RG2 15 ■ ■ ❏ ❏ ❏ ❏ S
Mutation detection WT Probes Mut Probes
Figure 3.34 Final display of the interpreted microbead assay results for isoniazid
Column 1: well number Column 2: samples identification Column 3-4: wild-type probes Column 5-8: mutant probes Column 9: prediction of drug resistance
The frequency of mutations at codon 315 of katG gene was found to be higher
(72%) as compared to that of in promoter region of inhA gene (23%). Out of 63
mutations observed at codon 315 of katG, the frequency of (AGC→ACC) substitution
mutation was found to be high, as 57 isolates (90%) were found to possess this
mutation. Only 3 (5%) isolates showed (AGC→AAC) mutation while another 3 (5%)
isolates showed unknown mutation at codon 315 of katG as indicated by the absence
191
of hybridization signals both for wild as well as mutant probes specific for codon 315.
At -15 position of promoter region of inhA gene, 18 (90%) isolates showed (C→T)
substitution while 2 (10%) isolates showed unknown mutations at -15 position as
indicated by the absence of hybridization signals both for wild as well as mutant
probes specific for this position. None of the screened isolates showed any mutation at
-8 position of the promoter region of inhA gene. All the four isolates that showed
double mutations exhibited 315(AGC→ACC) mutation in combination with (C→T)
substitution at -15 promoter region of inhA gene. Detailed description about the
observed mutations is given in the table 3.20. The change in amino acid and relative
frequencies of mutations observed in katG gene and promoter region of inhA gene are
given in table 3.16.
3.12.3 Sensitivity and specificity of the microbead assay compared with DNA sequencing
PCR products of hotspot regions of katG and promoter region of inhA gene of
79 isolates were resolved on agarose gel to check the quality and size of amplified
products. The PCR products of 835bp and 612bp were observed for katG and
promoter region of inhA gene, respectively as shown in figure 3.35 and figure 3.36.
DNA sequencing of these 79 samples (43 isolates showing no mutation while
36 showing different mutations) served as reference to assess the accuracy of
mutation profile obtained by microbead assay (table 3.20). Seventy seven isolates
showed the results that were in complete agreement with the sequencing while
discrepant results were found in only two cases. All the isolates (n=43) that showed
no mutation in hotspot regions by sequencing were correctly identified by microbead
assay except one isolate. Microbead assay revealed that this isolate had an unknown
mutation at codon 315 as indicated by the absence of hybridization signal by the wild
as well as mutant probe specific for it but no mutation was detected by sequencing.
All the mutations identified by sequencing were correctly detected by microbead
assay except one mutation where microbead assay showed profile of a susceptible
isolate while this isolate was found to have mutation 315(AGC→ACC). Double
mutations were also confirmed for two isolates. Hotspot regions of katG and promoter
region of inhA gene for 4 isolates showing unknown mutations by microbead assay
could not be sequenced due to non-availability of DNA. Hence, the overall sensitivity
192
and specificity of the microbead assay to detect targeted mutations remained 97% and
98%, respectively.
In addition to the above results, some novel mutations were also detected by
DNA sequencing. These include substitution mutations at codon 412(TGG→TGC), a
nonsense mutation at codon 413(TAC→TAA) and an insertion mutation of AGCC
after codon 344 of katG gene, while one isolate showed mutation at -20(C→T) in
inhA gene. All these isolates except the one exhibiting mutation at codon 413 were
designated as resistant by phenotypic drug sensitivity.
Figure 3.35 PCR amplification of katG gene of M. tuberculosis isolates
Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 1: “No DNA” negative control; Lane 2-6: PCR amplification products
Figure 3.36 PCR amplification of promoter region of inhA gene of M.
tuberculosis isolates Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 1: “No DNA” negative control; Lane 2-7: PCR amplification
products
193
Table 3.18 Frequency of Mutations in katG and Promoter Region of inhA Gene Associated with Isoniazid Resistance in M. tuberculosis Isolates
Type and location of mutation Change in amino acid
Type of mutation
No. of isolates
Mutation frequency
(%) katG gene (Codon)
inhA gene (Nucleotide)
315(AGC→ACC) - Ser→Thr Substitution 57 66
315(AGC→AAC) - Ser→Asn Substitution 3 3
315(AGC→*) - Ser→* Substitution 3 3
412(TGG→TGC) - Trp→Cys Substitution 1 1
413(TAC→TAA) - Tyr→stop Nonsense 1 1
AGCC insertion - - Insertion 1 1
- -15(C→T) 18 21
- -15(C→*) 2 2
- -20(C→T) 1 1
* Could not be sequenced
Figure 3.37 Percent frequency of different mutations observed in katG and promoter region of inhA gene of M. tuberculosis culture isolates
3.12.4 Comparison of genotypic DST (by microbead assay) and phenotypic DST for Isoniazid
Phenotypic drug sensitivity data was available for 330 isolates out of which
296 could be amplified for genotypic microbead assay. Out of these 296 isolates 118
(40%) were INHR and 178 (60%) were INHS. Out of 118 INHR isolates, microbead
assay designated 53 (45%) isolates as resistant while 65 (55%) as susceptible. Results
of 43 out of these 65 isolates were confirmed by DNA sequencing. All except 3
isolates showed no mutation for the tested regions. These 3 isolates showed mutations
at codon 412(TGG→TGC) and 413(TAC→TAA) and 315(AGC→ACC) in katG
194
gene. Out of 178 INHS isolates, microbead based assay designated 172 isolates as
INHS while 6 as INHR. All these 6 isolates showed 315(AGC→ACC) mutation in
katG gene which is known to cause resistance for isoniazid in M. tuberculosis. With
all this data sensitivity and specificity of the microbead based assay in relation to
phenotypic drug sensitivity was found to be 50% and 72%, respectively.
3.12.5 Comparison of phenotypic drug sensitivity profile of different laboratories with genotypic drug sensitivity for isoniazid
The phenotypic drug sensitivity data as provided by different laboratories was
compared with genotypic drug sensitivity data. The samples included in this
comparison were 299 in number for which both the phenotypic and genotypic data
was available.
Table 3.19 Percentage Concordance of Phenotypic and Genotypic DST for Isoniazid
Genotypic isoniazid sensitivity data % age
concordance Resistant Sensitive
Phe
noty
pic
ison
iazi
d se
nsiti
vity
dat
a
Laboratory 1 Resistant 20 4
95.6 Sensitive 0 68
Laboratory 2 Resistant 12 5
70.6 Sensitive 0 0
Laboratory 3 Resistant 4 11
29.4 Sensitive 1 1
Laboratory 4 Resistant 10 25
64 Sensitive 2 38
Laboratory 5 Resistant 9 12 80.3 Sensitive 2 48
Laboratory 1
Out of 111 samples included from this laboratory, phenotypic drug sensitivity
data was available for 92 isolates that designated 24 as INHR while 68 INHS. Out of
195
these 92 isolates, genotypic drug sensitivity data revealed mutations in 20 INHR
isolates while no mutation was observed in 4 INHR isolates. Results of 19 INHR and
11 INHS isolates were confirmed by sequencing.
Laboratory 2
Out of 38 isolates included from this laboratory, phenotypic DST data was
available for only 17 isolates. All of which were phenotypic INHR isolates. Genotypic
drug sensitivity data detected mutations in 12 isolates while no mutation was observed
in 5 INHR isolates. Results of all these isolates were confirmed by DNA sequencing.
Laboratory 3
Out of 79 isolates from this laboratory, 17 were included in the comparison
where phenotypic drug sensitivity data designated 15 isolates as INHR while 2 as
INHS. Genotypic screening detected no mutations in 11 INHR and 1INHS isolates
while mutations were observed in 4 INHR and 1I NHS isolates. Mutation at codon
315(AGC→ACC) was observed in phenotypic INHS isolate. Results of 13 phenotypic
INHR isolates where genotypic DST designated 10 susceptible and 3 resistant were
confirmed by DNA sequencing.
Laboratory 4
A total of 75 M. tuberculosis isolates were included from this laboratory.
Phenotypic drug sensitivity designated 35 as INHR while 40 as INHS. Genotypic
screening detected no mutation in 25 INHR and 38INHS isolates while mutations were
detected in 10 INHR and 2I NHS isolates. One INHS isolate was found to have
mutations in codon 315(AGC→ACC) while the other showed mutation at -15(C→T).
Results of 28 phenotypic INHR isolates to which genotypic DST designated 21
resistant and 7 sensitive, were confirmed by DNA sequencing.
Laboratory 5
A total of 71 M. tuberculosis isolates were included from this laboratory.
Phenotypic drug sensitivity data designated 21 isolates as INHR while 50 as INHS.
Genotypic screening detected no mutation in 12 INHR and 48 INHS isolates while 9
196
INHR and 2 INHS isolates were found to have mutations. The 2 INHS isolates were
found to have mutation at codon 315 of katG gene. Results of 13 phenotypic INHR
isolates designated 9 sensitive and 4 resistant by genotypic DST were confirmed by
sequencing.
3.13 Poor standards of phenotypic drug susceptibility in the country
We found mutations rpoB531(TCG→TTG) or rpoB516(GAC→GTC) in 9
isolates out of 243 (4%) labeled rifampicin sensitive and mutation
katG315(AGC→ACC) or inhA-15(C→T) in 6 isolates out of 178 (3%) labeled
isoniazid sensitive isolates after phenotypic DST by the laboratories that performed
the initial phenotypic drug sensitivity. In addition, 43 out of 93 (46%) of the isolates
labeled as rifampicin resistant and 63 of 121(52%) of the isolates labeled as isoniazid
resistant showed no mutation with a test expected to have more than 99% of
sensitivity (Gomgnimbou et al., 2012; Gomgnimbou et al., 2013a).
3.14 Cumulative genotypic drug susceptibility to Rifampicin and Isoniazid
Of 383 isolates for which genotypic drug sensitivity profile was available for
both rifampicin and isoniazid, 277 (83%) were sensitive based on mutational analysis.
For the remaining 106 (27%) isolates, 38 (36%) were MDR; 28 (26%) isolates were
resistant only to Rif while 40 (38%) were resistant only for INH.
Out of 317 isolates with phenotypic drug sensitivity results available for
multiple drug resistance, 196 isolates (62%) were sensitive. For the remaining 121
(38%) isolates, 73 (60%) were MDR, 47 (39%) resistant only for Rif while one isolate
(0.8%) was resistant only for INH. The frequency of mutation at codon 315 in MDR
isolates was comparable (79% versus 72%) to that in non-MDR, isoniazid resistant
isolates.
3.15 Association of M. tuberculosis lineages with specific mutations
Statistical analysis showed that there is no statistically significant correlation
between the mutation at codon 526 of rpoB gene and CAS1-Dehli isolates
(Chi2=1=0.84; p=0.40; n=26 for CAS-Dehli, n=27 for all other isolates) as well as
between the mutation at codon 315 of katG and CAS isolates (Chi2=1=0.032; p=0.85;
n=37 for CAS, n=26 for all other isolates).
197
Table 3.20 Detected Mutations in katG and Prmoter region of inhA Gene Associated with Isoniazid Resistance in M. tuberculosis Isolates
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK1998000063 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK1998000065 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK1998000067 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK1998000069 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK1998000070 ■ ■ ❏ ❏ ❏ ❏ 412(TGG→TGC) No mutation No mutation Resistant
PAK1998000071 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK1998000072 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK1998000073 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK1998000074 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK1998000107 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK1998000109 ❏ ■ ❏ ❏ ❏ ❏ AGCC insertion after
codon 344 No mutation 315(AGC→???) Resistant
PAK1998000110 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK1998000111 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
198
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK1998000123 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK1998000131 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK1998000155 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000156 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000164 ■ ■ ❏ ❏ ❏ ❏ 413(TAC→TAA) No mutation No mutation Resistant
PAK1998000167 ❏ ■ ❏ ■ ❏ ❏ Not done Not done 315(AGC→AAC) Resistant
PAK1998000905 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000907 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000908 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000909 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000910 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000911 ■ ❏ ❏ ❏ ■ ❏ Not done Not done -15(C→T) Not available
PAK1998000912 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK1998000913 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000914 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
199
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK1998000915 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000916 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000917 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000918 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000919 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000920 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000921 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000922 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000923 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000924 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000925 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000927 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000928 ■ ❏ ❏ ❏ ■ ❏ Not done Not done -15(C→T) Not available
PAK1998000929 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000932 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
200
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK1998000937 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000938 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK1998000942 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2005000076 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2005000103 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2005000126 ■ ❏ ❏ ❏ ■ ❏ Not done Not done -15(C→T) Not available
PAK2008000539 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000540 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000541 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000542 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2008000543 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000544 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000545 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000546 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000547 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
201
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2008000548 ❏ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000550 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2008000552 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2008000553 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2008000554 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000555 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2008000556 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000557 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000558 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000559 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000560 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2008000561 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000562 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000563 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000564 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
202
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2008000565 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) and
463(CGG→CTG) No mutation 315(AGC→ACC) Resistant
PAK2008000566 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) and
463(CGG→CTG) No mutation 315(AGC→ACC) Resistant
PAK2008000567 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000568 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000569 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000571 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000572 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000573 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000574 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000575 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000576 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000577 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
203
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2008000578 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) and
463(CGG→CTG) No mutation 315(AGC→ACC) Resistant
PAK2008000579 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000581 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000582 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000583 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000584 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000585 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000586 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000587 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000588 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000589 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) and
463(CGG→CTG) No mutation 315(AGC→ACC) Resistant
PAK2008000590 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000591 ■ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Sensitive
204
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2008000592 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000593 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000594 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000595 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000596 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK2008000597 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000598 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000600 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK2008000601 ■ ❏ ❏ ❏ ❏ ❏ Not done Not done 315(AGC→???) Resistant
PAK2008000602 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000603 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000604 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000605 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000606 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000607 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
205
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2008000608 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000609 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000610 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000611 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000612 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000614 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000616 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000617 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000618 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000619 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000620 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK2008000621 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000622 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000623 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000624 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
206
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2008000625 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000626 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000627 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000628 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000629 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000630 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000631 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000632 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Sensitive
PAK2008000633 ■ ❏ ❏ ❏ ■ ❏ Not done Not done -15(C→T) Resistant
PAK2008000634 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000635 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000636 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000639 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000640 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000644 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
207
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2008000646 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2008000649 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2008000651 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2009000064 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000077 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000079 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000082 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000083 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000085 ❏ ❏ ■ ❏ ■ ❏ Not done Not done 315(AGC→ACC)
and -15(C→T) Not available
PAK2009000086 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000090 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000092 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000093 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2009000094 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
208
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2009000095 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000097 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000112 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No muataion Sensitive
PAK2009000113 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Sensitive
PAK2009000115 ❏ ❏ ■ ❏ ■ ❏ 315(AGC→ACC) -15(C→T) 315(AGC→ACC)
and -15(C→T) Resistant
PAK2009000122 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2009000127 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No muataion Resistant
PAK2009000129 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000130 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No muttion Resistant
PAK2009000133 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2009000139 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2009000148 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2009000149 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2009000154 ❏ ■ ❏ ❏ ❏ ❏ Not done Not done 315(AGC→???) Resistant
209
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2009000157 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2009000158 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2009000159 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000160 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000161 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000168 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2009000169 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2009000170 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000171 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2009000172 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2009000173 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2010000128 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2010000197 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000198 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2010000199 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
210
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2010000200 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000202 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2010000203 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000204 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2010000205 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000206 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2010000207 ■ ❏ ❏ ❏ ■ ❏ No mutation -15(C→T) -15(C→T) Resistant
PAK2010000208 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000210 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2010000211 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000213 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000214 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000218 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2010000219 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2010000221 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
211
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000088 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000215 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2011000223 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000224 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Sensitive
PAK2011000225 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000226 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000227 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Sensitive
PAK2011000228 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Sensitive
PAK2011000229 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000230 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000231 ■ ■ ❏ ❏ ❏ ❏ Not done Not done N mutation Sensitive
PAK2011000232 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000233 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK2011000234 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000235 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
212
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000236 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000237 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000238 ■ ❏ ❏ ❏ ■ ❏ Not done Not done -15(C→T) Resistant
PAK2011000239 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000240 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000241 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000242 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000243 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000245 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000246 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000247 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000248 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000249 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000250 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000251 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
213
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000252 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000253 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000254 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000255 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000256 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000257 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000258 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000259 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000260 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000261 ■ ❏ ❏ ❏ ■ ❏ No mutation -15(C→T) -15(C→T) Resistant
PAK2011000262 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000263 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000264 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000265 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000266 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
214
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000267 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000268 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000269 ■ ❏ ❏ ❏ ■ ❏ No mutation -15(C→T) -15(C→T) Resistant
PAK2011000270 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000271 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000272 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000273 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000274 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000275 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000276 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Resistant
PAK2011000277 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000278 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000279 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000280 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
215
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000281 ■ ❏ ❏ ❏ ■ ❏ No mutation -15(C→T) and -
20(C→T) -15(C→T) and -
20(C→T) Resistant
PAK2011000282 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000283 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000284 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000285 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000286 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000288 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000289 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000290 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000291 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000293 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000294 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000295 ❏ ■ ❏ ■ ❏ ❏ Not done Not done 315(AGC→AAC) Not available
PAK2011000296 ❏ ■ ❏ ■ ❏ ❏ Not done Not done 315(AGC→AAC) Not available
216
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000297 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000298 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000299 ❏ ❏ ■ ❏ ■ ❏ Not done Not done 315(AGC→ACC)
and -15(C→T) Resistant
PAK2011000401 ❏ ❏ ■ ❏ ■ ❏ 315(AGC→ACC) -15(C→T) 315(AGC→ACC)
and -15(C→T) Resistant
PAK2011000402 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000403 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000404 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000405 ■ ❏ ❏ ❏ ■ ❏ No mutation -15(C→T) -15(C→T) Resistant
PAK2011000406 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000407 ■ ❏ ❏ ❏ ■ ❏ Not done Not done 15(C-->T) Resistant
PAK2011000408 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000409 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000410 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
217
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000411 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000412 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000413 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000414 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000415 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000416 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000417 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000418 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000420 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000421 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000422 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000423 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000424 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000425 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000426 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
218
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000427 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000428 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000429 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000430 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000431 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000432 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000433 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000434 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000435 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000436 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000437 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000439 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000440 ■ ❏ ❏ ❏ ■ ❏ Not done Not done -15(C→T) Sensitive
PAK2011000441 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000442 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
219
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000443 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000444 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000445 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000447 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000448 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000450 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000451 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000453 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000454 ■ ■ ❏ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000455 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000456 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2011000457 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000458 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000459 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000460 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
220
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000461 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000462 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2011000463 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000464 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000465 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000466 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000467 ❏ ❏ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC)
and -15(C→?) Resistant
PAK2011000468 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000469 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000470 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000471 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000472 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000473 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000474 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
221
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000476 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000477 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000478 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000479 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000481 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000482 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000483 ■ ❏ ❏ ❏ ■ ❏ No mutation -15(C→T) -15(C→T) Resistant
PAK2011000485 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000486 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000487 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000488 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000489 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000490 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000491 ❏ ■ ■ ❏ ❏ ❏ 315(AGC→ACC) No mutation 315(AGC→ACC) Resistant
PAK2011000492 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
222
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2011000493 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Sensitive
PAK2011000494 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2011000495 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000497 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000498 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Resistant
PAK2011000499 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000501 ■ ■ ❏ ❏ ❏ ❏ No mutation No mutation No mutation Resistant
PAK2011000503 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000504 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000505 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2011000506 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Sensitive
PAK2012000507 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000508 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000509 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000510 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
223
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2012000511 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000512 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000513 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000514 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2012000515 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000516 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000517 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000518 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2012000519 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2012000520 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000521 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000522 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2012000523 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000524 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000525 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
224
Key
Kat
G_3
15_W
t
InhA
_-15
_Wt
Kat
G_3
15_m
ut C
Kat
G_3
15_m
ut A
InhA
_-15
_mut
T
InhA
_-8_
mut
A
katG hotspot sequencing inhA hotspot sequencing
Microbead assay results
Phenotypic DST
PAK2012000526 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000527 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000528 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000529 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000530 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000531 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000532 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000533 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000534 ■ ❏ ❏ ❏ ■ ❏ Not done Not done -15(C→T) Not available
PAK2012000535 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000536 ■ ■ ❏ ❏ ❏ ❏ Not done Not done No mutation Not available
PAK2012000537 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
PAK2012000538 ❏ ■ ■ ❏ ❏ ❏ Not done Not done 315(AGC→ACC) Not available
225
3.16 Characterization of mutations in embB gene associated with ethambutol resistance in M. tuberculosis culture isolates
The PCR products of the hotspot regions of emb gene of 37 isolates were
resolved on agarose gel to check the quality and size of amplified products. The size
of the PCR product was 484 bp.
Figure 3.38 PCR amplification of emb gene of M. tuberculosis isolates Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 1: “No DNA” negative control; Lane 2-8: PCR amplification
products
Out of 37 ethambutol resistant isolates, 16 (43%) isolates showed no mutation
while 21 (57%) isolates showed 5 different kinds of mutations in the emb gene (table
3.22). All these mutations had change in nucleotide at codon 306. Nucleotide changes
observed were (ATG→ATA), (ATG→GTG), (ATG→ATC), (ATG→CTG) and
(ATG→ATT). The corresponding amino acid change and relative frequencies of
mutations observed in emb gene are given in table 3.21.
Table 3.21 Frequency of Mutations in embB Gene Associated with Ethambutol Resistance in M. tuberculosis Isolates
Position of mutation (Codon)
Change in codon
Amino acid transition
Type of mutation
No. of isolates
Mutation frequency
(%)
306 ATG→ATA Met→Ile Substitution 8 38
306 ATG→GTG Met→Val Substitution 7 33
306 ATG→ATC Met→Ile Substitution 3 14
306 ATG→CTG Met→Leu Substitution 2 9
306 ATG→ATT Met→Ile Substitution 1 5
226
Table 3.22 Detected Mutations in embB Gene of M. tuberculosis Sr. No. Key Sequencing results Phenotypic
DST
1 PAK1998000065 306(ATG→ATA) Resistant
2 PAK1998000070 No mutation Resistant
3 PAK1998000071 306(ATG→ATA) Resistant
4 PAK1998000072 No mutation Resistant
5 PAK1998000074 306(ATG→GTG) Resistant
6 PAK1998000107 306(ATG→ATT) Resistant
7 PAK1998000111 306(ATG→GTG) Resistant
8 PAK1998000167 306(ATG→ATC) Resistant
9 PAK1998000191 No mutation Resistant
10 PAK2008000551 No mutation Resistant
11 PAK2008000565 306(ATG→ATA) Resistant
12 PAK2008000578 306(ATG→ATA) Resistant
13 PAK2008000579 No mutation Resistant
14 PAK2008000583 No mutation Resistant
15 PAK2008000620 306(ATG→GTG) Resistant
16 PAK2008000634 306(ATG→ATC) Resistant
17 PAK2009000122 306(ATG→ATA) Resistant
18 PAK2009000136 306(ATG→CTG) Resistant
19 PAK2010000197 No mutation Resistant
20 PAK2010000202 No mutation Resistant
21 PAK2010000205 No mutation Resistant
22 PAK2010000207 No mutation Resistant
23 PAK2010000210 306(ATG→GTG) Resistant
24 PAK2010000211 No mutation Resistant
25 PAK2010000214 No mutation Resistant
26 PAK2010000219 No mutation Resistant
27 PAK2011000277 306(ATG→ATA) Resistant
28 PAK2011000402 306(ATG→CTG) Resistant
29 PAK2011000404 No mutation Resistant
30 PAK2011000405 306(ATG→ATC) Resistant
227
Sr. No. Key Sequencing results Phenotypic
DST
31 PAK2011000406 306(ATG→GTG) Resistant
32 PAK2011000408 306(ATG→ATA) Resistant
33 PAK2011000440 No mutation Resistant
34 PAK2011000451 No mutation Resistant
35 PAK2011000454 306(ATG→ATA) Resistant
36 PAK2011000467 306(ATG→GTG) Resistant
37 PAK2011000483 306(ATG→GTG) Resistant
3.17 Characterization of mutations in rrs and rpsL genes associated with streptomycin resistance in M. tuberculosis culture isolates
PCR products obtained by amplification of hotspot regions of rrs and rpsL
gene were resolved on agarose gel to check the quality and size of amplified products.
552 bp and 645 bp amplified fragments were observed for rrs and rpsL gene,
respectively.
Figure 3.39 PCR amplification of rpsL gene of M. tuberculosis isolates
Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 1: “No DNA” negative control; Lane 2-6: PCR amplification
products
228
Figure 3.40 PCR amplification of rrs gene of M. tuberculosis isolates
Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 1: “No DNA” negative control; Lane 2-7: PCR amplification
products
Of 99 streptomycin resistant isolates, 28 (28%) showed mutation in either rpsL
or in rrs gene (Table 3.24) while 71 (72%) isolates did not show any mutation in
analyzed regions. Distribution of mutations in rpsL and rrs gene was 57% and 43%,
respectively. Analysis of rpsL hotspot showed that sixteen (16%) isolates harbored
mutations while 83 (84%) did not show any mutation. Most frequent mutation found
was substitution mutation at codon 43(AAG→AGG). Other mutations observed at
position 40(ACC→ACT), 118(GGC→GGA) and at 126(TGC→TGT) were silent
mutations.
Twelve (12%) isolates were found to have alterations in the rrs gene while 87
(88%) isolates did not show any mutation. Nucleotide changes found in rrs gene were
alteration at position 282(G→T), 420(C→T), 513(A→C), 512(C→T), 516(C→T) and
648(A→C). Corresponding amino acid change and relative frequencies of mutations
observed in rpsL and rrs gene are given in table 3.23.
229
Table 3.23 Frequency of Mutations in rrs and rpsL Genes Associated with Streptomycin Resistance in M. tuberculosis Isolates
Type and location of mutation Amino acid
change
Type of mutation
No of isolates
Mutation frequency
(%) rpsL gene (Codon)
rrs gene (Nucleotide
position)
40(ACC→ACT) - Thr→Thr Silent 1 4
43(AAG→AGG) - Lys→Arg Substitution 13 46
118(GGC→GGA) - Gly→Gly Silent 1 4
126(TGC→TGT) - Cys→Cys Silent 1 4
- 282(G→T) - 1 4
- 420(C→T) - 1 4
- 512(C→T) - 2 7
- 513(A→C) - 6 21
- 516(C→T) - 1 4
- 648(A→C) - 1 4
Table 3.24 Detectd Mutations in rpsL and rrs Genes of M. tuberculosis
Key rpsL sequencing rrs sequencing Phenotypic DST
PAK1998000067 No mutation 512(CAG→TAG) Resistant
PAK1998000069 43(AAG→AGG) No mutation Resistant
PAK1998000071 No mutation No mutation Resistant
PAK1998000072 118(GGC→GGA) No mutation Resistant
PAK1998000074 No mutation 512(CAG→TAG) Resistant
PAK1998000107 No mutation No mutation Resistant
PAK1998000111 No mutation 433(CGA→CTA) Resistant
PAK1998000131 No mutation No mutation Resistant
PAK1998000167 No mutation No mutation Resistant
PAK1998000620 43(AAG→AGG) No mutation Resistant
PAK1998000624 No mutation No mutation Resistant
PAK1998000627 43(AAG→AGG) No mutation Resistant
PAK1998000633 No mutation No mutation Resistant
230
Key rpsL sequencing rrs sequencing Phenotypic DST
PAK1998000636 No mutation No mutation Resistant
PAK1998000640 No mutation No mutation Resistant
PAK1998000649 No mutation No mutation Resistant
PAK1998000650 43(AAG→AGG) No mutation Resistant
PAK1998000651 No mutation No mutation Resistant
PAK2008000550 No mutation No mutation Resistant
PAK2008000551 No mutation No mutation Resistant
PAK2008000552 No mutation No mutation Resistant
PAK2008000553 No mutation No mutation Resistant
PAK2008000557 No mutation No mutation Resistant
PAK2008000558 No mutation No mutation Resistant
PAK2008000560 No mutation No mutation Resistant
PAK2008000565 No mutation No mutation Resistant
PAK2008000566 No mutation 512(CAG→CCG) Resistant
PAK2008000578 43(AAG→AGG) No mutation Resistant
PAK2008000585 No mutation No mutation Resistant
PAK2008000586 No mutation No mutation Resistant
PAK2008000590 No mutation No mutation Resistant
PAK2008000595 No mutation No mutation Resistant
PAK2008000600 43(AAG→AGG) No mutation Resistant
PAK2008000602 No mutation No mutation Resistant
PAK2008000608 No mutation No mutation Resistant
PAK2009000122 No mutation No mutation Resistant
PAK2009000127 43(AAG→AGG) No mutation Resistant
PAK2009000130 126(TGC→TGT) No mutation Resistant
PAK2009000133 No mutation No mutation Resistant
PAK2009000136 No mutation No mutation Resistant
PAK2009000139 No mutation No mutation Resistant
PAK2009000148 No mutation No mutation Resistant
PAK2009000154 No mutation No mutation Resistant
PAK2009000171 No mutation No mutation Resistant
231
Key rpsL sequencing rrs sequencing Phenotypic DST
PAK2009000173 No mutation No mutation Resistant
PAK2010000197 No mutation No mutation Resistant
PAK2010000202 No mutation No mutation Resistant
PAK2010000203 No mutation No mutation Resistant
PAK2010000204 No mutation No mutation Resistant
PAK2010000205 No mutation No mutation Resistant
PAK2010000207 No mutation No mutation Resistant
PAK2010000208 No mutation No mutation Resistant
PAK2010000213 No mutation No mutation Resistant
PAK2010000214 No mutation No mutation Resistant
PAK2010000218 No mutation No mutation Resistant
PAK2010000221 No mutation No mutation Resistant
PAK2011000222 43(AAG→AGG) No mutation Resistant
PAK2011000229 No mutation No mutation Resistant
PAK2011000238 43(AAG→AGG) No mutation Resistant
PAK2011000242 No mutation No mutation Resistant
PAK2011000243 No mutation No mutation Resistant
PAK2011000251 No mutation No mutation Resistant
PAK2011000258 No mutation No mutation Resistant
PAK2011000260 No mutation No mutation Resistant
PAK2011000268 No mutation No mutation Resistant
PAK2011000270 No mutation No mutation Resistant
PAK2011000272 No mutation No mutation Resistant
PAK2011000273 No mutation 512(CAG→CCG) Resistant
PAK2011000274 No mutation No mutation Resistant
PAK2011000275 No mutation No mutation Resistant
PAK2011000276 No mutation No mutation Resistant
PAK2011000279 No mutation No mutation Resistant
PAK2011000280 No mutation No mutation Resistant
PAK2011000281 No mutation 481(TCG→TTG) Resistant
PAK2011000401 No mutation No mutation Resistant
232
Key rpsL sequencing rrs sequencing Phenotypic DST
PAK2011000402 No mutation 513(CCG→CTG) Resistant
PAK2011000403 43(AAG→AGG) No mutation Resistant
PAK2011000404 43(AAG→AGG) No mutation Resistant
PAK2011000405 No mutation 512(CAG→CCG) Resistant
PAK2011000406 43(AAG→AGG) No mutation Resistant
PAK2011000408 No mutation No mutation Resistant
PAK2011000409 No mutation 557(TAC→TCC) Resistant
PAK2011000440 No mutation No mutation Resistant
PAK2011000445 No mutation No mutation Resistant
PAK2011000450 No mutation No mutation Resistant
PAK2011000451 No mutation 512(CAG→>CCG) Resistant
PAK2011000453 No mutation No mutation Resistant
PAK2011000454 No mutation No mutation Resistant
PAK2011000456 40(ACC→ACT) No mutation Resistant
PAK2011000459 No mutation No mutation Resistant
PAK2011000460 No mutation 512(CAG→CCG) Resistant
PAK2011000466 No mutation 512(CAG→CCG) Sensitive
PAK2011000467 43(AAG→AGG) No mutation Resistant
PAK2011000469 No mutation No mutation Resistant
PAK2011000470 No mutation No mutation Resistant
PAK2011000471 No mutation No mutation Resistant
PAK2011000476 No mutation No mutation Resistant
PAK2011000483 No mutation No mutation Resistant
PAK2011000484 No mutation No mutation Resistant
233
3.18 Characterization of mutations in pncA gene associated with pyrazinamide resistance in M. tuberculosis culture isolates
3.18.1 Analysis of PncA1 and PncA2 PCR products by agarose gel electrophoresis
PCR products from PncA1 and PncA2 primers were resolved on agarose gel to
check the quality and quantity of amplified products. The size of the PCR product was
180 bp and 216 bp for PncA1 and PncA2 amplifications, respectively.
Figure 3.41 PCR amplification of pncA1 segment of pncA gene of M.
tuberculosis isolates Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 7: “No DNA” negative control; Lane 1-6: PCR amplification products
Figure 3.42 PCR amplification of pncA2 segment of pncA gene of M.
tuberculosis isolates Lane L: 50 bp DNA ladder (Fermentas Cat # SM 0373) Lane 1: “No DNA” negative control; Lane 2-6: PCR amplification products
234
3.18.2 SSCP analysis of PncA1 and PncA2 amplification products by polyacrylamide gel electrophoresis
Denatured PCR products of both pncA1 and pncA2 segments were resolved
on polyacrylamide gel along with H37Rv as positive control. Samples that showed the
mobility shift as compared to positive control were selected for sequencing to identify
the potential mutations.
Figure 3.43 SSCP analysis of pncA1 segment by polyacrylamide gel
elecrophoresis Lane L: 50 bp DNA ladder (Invitrogen Cat # 10416-014)
Lane 5-8,10-11 and 16-23: isolates showing no mobility shift Lane 1-4,9, 12-15: isolates showing mobility shift Lane 24: positive control H37Rv
Figure 23.44 SSCP analysis of pncA2 segment by polyacrylamide gel
elecrophoresis Lane L: 50 bp DNA ladder (Invitrogen Cat # 10416-014) Lane 1-7: isolates showing no mobility shift Lane 8: positive control H37Rv
235
Of 317 isolates screened for the presence or absence of any mutation in coding
region of PncA gene, results were available for 302 isolates for pncA1 segment while
of 295 isolates for pncA2 segment. Complete set of results were available for 280
isolates (Table 3.26). Out of these 280 isolates, 268 (96%) did not show any shift in
mobility of denatured PCR products, while 12 (4%) isolates showed conformational
change as compared to that of H37Rv. All these isolates showed conformational
change for segment pncA1 while none of the sample showed any conformational
change in pncA2 segment.
3.18.3 Identification of mutations by DNA Sequencing of pncA gene associated with pyrazinamide resistance
PCR products obtained by pncA primers were resolved on agarose gel to
check the quality and size of the amplified products. A 829 bp amplification product
was observed.
Figure 3.45 PCR amplification of pncA gene in M. tuberculosis
isolates Lane L: 50 bp DNA ladder (Fermentas Cat # SM0373) Lane 1: “No DNA” negative control Lane 2-8: PCR amplification products
All the 4 isolates sequenced for which no mobility shift was observed in SSCP
analysis showed no mutation in the pncA gene in sequencing analysis while 8 out of
12 isolates that showed mobility shift in SSCP analysis were found to possess
mutations in targeted coding region of pncA gene. Five (38%) isolates out of 12
isolates showing mobility shift had silent mutation at codon 65(TCC→TCT). The
substitution mutations observed in 3 (23%) isolates were at codon 54(CCG→CTG),
236
58(TTC→CTC) and 76(ACT→CCT). DNA of the four isolates showing mobility
shift in SSCP analysis was not available for the DNA sequencing. Detailed
description of the observed mutations is given in the table 3.25 while corresponding
amino acid change and frequencies of observed mutations is given in the table 3.25.
Table 3.25 Frequency of Mutations in pncA Gene Associated with Pyrazinamide Resistance in M. tuberculosis Isolates
Position of mutation(codon)
Change in codon
Change in amino acid
No. of isolates
Type of mutation
Mutation frequency
(%) 54 CCG→CTG Pro→Leu 1 Substitution 8%
58 TTC→CTC Phe→Leu 1 Substitution 8%
65 TCC→TCT Ser→Ser 5 Silent 38%
76 ACT→CCT Thr→Arg 1 Substitution 8%
Segment pncA2 Couldn’t be sequenced ___ 4 ___ 38%
Table 3.26 Detected Mutations in pncA Gene Associated with Pyrazinamide Resistance in M. tuberculosis Isolates
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK1998000063 × × Not done
PAK1998000067 × × Not done
PAK1998000107 Mobility shift × Not available
PAK1998000109 × × Not done
PAK1998000110 Mobility shift × Not available
PAK1998000111 × × Not done
PAK1998000131 × × Not done
PAK1998000147 × × Not done
PAK1998000155 × × Not done
PAK1998000156 × × Not done
PAK1998000164 × × Not done
PAK1998000905 × × Not done
PAK1998000906 × × Not done
237
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK1998000907 × × Not done
PAK1998000908 × × Not done
PAK1998000909 × × Not done
PAK1998000911 × × Not done
PAK1998000912 × × Not done
PAK1998000913 × × Not done
PAK1998000914 × × Not done
PAK1998000915 × × Not done
PAK1998000916 × × Not done
PAK1998000917 × × Not done
PAK1998000918 × × Not done
PAK1998000922 × × Not done
PAK1998000923 × × Not done
PAK2005000076 Mobility shift × Not available
PAK2005000103 × × Not done
PAK2005000126 Mobility shift × 58(TTC→CTC)
PAK2008000556 × × Not done
PAK2009000062 × × Not done
PAK2009000064 × × Not done
PAK2009000077 × × Not done
PAK2009000078 × × Not done
PAK2009000079 × × Not done
PAK2009000082 × × Not done
PAK2009000083 × × Not done
PAK2009000085 × × Not done
PAK2009000086 × × Not done
PAK2009000089 × × Not done
PAK2009000090 × × Not done
238
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2009000092 × × Not done
PAK2009000093 × × Not done
PAK2009000094 × × Not done
PAK2009000095 × × Not done
PAK2009000097 × × Not done
PAK2009000106 × × Not done
PAK2009000113 × × Not done
PAK2009000115 × × Not done
PAK2009000116 × × Not done
PAK2009000119 × × Not done
PAK2009000122 × × Not done
PAK2009000127 × × Not done
PAK2009000129 Mobility shift × 65(TCC→TCT)
PAK2009000133 × × Not done
PAK2009000136 × × Not done
PAK2009000139 × × Not done
PAK2009000148 × × Not done
PAK2009000149 × × Not done
PAK2009000154 × × Not done
PAK2009000157 × × Not done
PAK2009000158 × × Not done
PAK2009000159 × × Not done
PAK2009000160 × × Not done
PAK2009000161 × × Not done
PAK2009000169 × × Not done
PAK2009000170 × × Not done
PAK2009000171 × × Not done
PAK2009000172 × × Not done
239
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2009000173 × × Not done
PAK2009000174 × × Not done
PAK2010000197 × × Not done
PAK2010000198 × × Not done
PAK2010000199 × × Not done
PAK2010000200 × × Not done
PAK2010000202 × × Not done
PAK2010000203 × × Not done
PAK2010000204 × × Not done
PAK2010000205 × × Not done
PAK2010000206 × × Not done
PAK2010000207 × × Not done
PAK2010000208 × × Not done
PAK2010000210 × × Not done
PAK2010000211 × × Not done
PAK2010000214 × × Not done
PAK2010000218 × × Not done
PAK2010000219 × × Not done
PAK2010000221 × × Not done
PAK2011000088 × × Not done
PAK2011000215 × × Not done
PAK2011000222 × × Not done
PAK2011000223 × × Not done
PAK2011000224 × × Not done
PAK2011000225 × × Not done
PAK2011000226 × × Not done
PAK2011000227 × × Not done
PAK2011000228 × × Not done
240
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2011000229 × × Not done
PAK2011000230 × × Not done
PAK2011000231 × × Not done
PAK2011000232 × × Not done
PAK2011000233 × × Not done
PAK2011000234 × × Not done
PAK2011000235 × × No mutation
PAK2011000236 × × Not done
PAK2011000237 × × Not done
PAK2011000238 × × No mutation
PAK2011000239 × × Not done
PAK2011000240 × × Not done
PAK2011000241 × × Not done
PAK2011000242 × × Not done
PAK2011000243 × × Not done
PAK2011000244 × × Not done
PAK2011000245 × × Not done
PAK2011000246 × × Not done
PAK2011000247 Mobility shift × 65(TCC→TCT)
PAK2011000248 × × Not done
PAK2011000249 × × No mutation
PAK2011000250 × × Not done
PAK2011000251 × × Not done
PAK2011000252 × × Not done
PAK2011000253 × × Not done
PAK2011000254 × × Not done
PAK2011000255 Mobility shift × 65(TCC→TCT)
241
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2011000256 × × Not done
PAK2011000257 × × Not done
PAK2011000258 × × Not done
PAK2011000259 × × Not done
PAK2011000260 × × Not done
PAK2011000261 × × Not done
PAK2011000262 × × Not done
PAK2011000263 × × Not done
PAK2011000264 × × Not done
PAK2011000265 × × Not done
PAK2011000266 × × Not done
PAK2011000267 × × Not done
PAK2011000268 × × Not done
PAK2011000269 × × Not done
PAK2011000270 × × Not done
PAK2011000271 × × Not done
PAK2011000272 × × Not done
PAK2011000273 × × Not done
PAK2011000274 × × Not done
PAK2011000275 × × Not done
PAK2011000277 × × Not done
PAK2011000278 × × Not done
PAK2011000279 × × Not done
PAK2011000280 × × Not done
PAK2011000281 × × Not done
PAK2011000282 × × Not done
PAK2011000283 × × Not done
242
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2011000284 × × Not done
PAK2011000285 × × Not done
PAK2011000286 × × Not done
PAK2011000288 × × Not done
PAK2011000289 × × Not done
PAK2011000290 × × Not done
PAK2011000291 × × Not done
PAK2011000293 × × Not done
PAK2011000294 Mobility shift × 65(TCC→TCT)
PAK2011000295 × × Not done
PAK2011000296 × × Not done
PAK2011000297 × × Not done
PAK2011000298 × × Not done
PAK2011000299 × × Not done
PAK2011000401 × × Not done
PAK2011000402 × × Not done
PAK2011000403 × × Not done
PAK2011000404 Mobility shift × 76(ACT→CCT)
PAK2011000405 × × Not done
PAK2011000406 Mobility shift × 54(CCG→CTG)
PAK2011000407 × × Not done
PAK2011000408 × × Not done
PAK2011000409 × × Not done
PAK2011000410 × × Not done
PAK2011000411 × × Not done
PAK2011000412 × × Not done
PAK2011000413 × × Not done
PAK2011000414 × × Not done
243
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2011000415 × × Not done
PAK2011000416 × × Not done
PAK2011000417 × × Not done
PAK2011000418 × × Not done
PAK2011000419 × × Not done
PAK2011000420 × × Not done
PAK2011000421 × × Not done
PAK2011000422 × × Not done
PAK2011000423 × × Not done
PAK2011000424 × × Not done
PAK2011000425 Mobility shift × 65(TCC→TCT)
PAK2011000426 × × Not done
PAK2011000427 × × Not done
PAK2011000428 × × No mutation
PAK2011000429 × × Not done
PAK2011000430 × × Not done
PAK2011000431 × × Not done
PAK2011000432 × × Not done
PAK2011000433 × × Not done
PAK2011000434 × × Not done
PAK2011000435 × × Not done
PAK2011000436 × × Not done
PAK2011000441 × × Not done
PAK2011000442 × × Not done
PAK2011000443 × × Not done
PAK2011000444 × × Not done
PAK2011000445 × × Not done
244
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2011000450 × × Not done
PAK2011000455 × × Not done
PAK2011000456 × × Not done
PAK2011000458 × × Not done
PAK2011000459 × × Not done
PAK2011000460 × × Not done
PAK2011000461 × × Not done
PAK2011000462 × × Not done
PAK2011000463 × × Not done
PAK2011000464 × × Not done
PAK2011000465 × × Not done
PAK2011000466 × × Not done
PAK2011000467 Mobility shift × Not available
PAK2011000469 × × Not done
PAK2011000470 × × Not done
PAK2011000471 × × Not done
PAK2011000472 × × Not done
PAK2011000473 × × Not done
PAK2011000474 × × Not done
PAK2011000476 × × Not done
PAK2011000477 × × Not done
PAK2011000478 × × Not done
PAK2011000479 × × Not done
PAK2011000481 × × Not done
PAK2011000482 × × Not done
PAK2011000483 × × Not done
PAK2011000484 × × Not done
PAK2011000485 × × Not done
245
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2011000486 × × Not done
PAK2011000487 × × Not done
PAK2011000488 × × Not done
PAK2011000489 × × Not done
PAK2011000490 × × Not done
PAK2011000491 × × Not done
PAK2011000492 × × Not done
PAK2011000493 × × Not done
PAK2011000494 × × Not done
PAK2011000495 × × Not done
PAK2011000497 × × Not done
PAK2011000498 × × Not done
PAK2011000499 × × Not done
PAK2011000500 × × Not done
PAK2011000501 × × Not done
PAK2011000502 × × Not done
PAK2011000503 × × Not done
PAK2011000504 × × Not done
PAK2011000505 × × Not done
PAK2011000506 × × Not done
PAK2012000507 × × Not done
PAK2012000508 × × Not done
PAK2012000509 × × Not done
PAK2012000510 × × Not done
PAK2012000511 × × Not done
PAK2012000512 × × Not done
PAK2012000514 × × Not done
246
Key SSCP results of pncA1 segment
SSCP results of pncA2 segment
pncA gene sequencing
PAK2012000515 × × Not done
PAK2012000516 × × Not done
PAK2012000517 × × Not done
PAK2012000518 × × Not done
PAK2012000519 × × Not done
PAK2012000520 × × Not done
PAK2012000521 × × Not done
PAK2012000522 × × Not done
PAK2012000523 × × Not done
PAK2012000524 × × Not done
PAK2012000525 × × Not done
PAK2012000527 × × Not done
PAK2012000528 × × Not done
PAK2012000529 × × Not done
PAK2012000530 × × Not done
PAK2012000531 × × Not done
PAK2012000532 × × Not done
PAK2012000534 × × Not done
PAK2012000538 × × Not done
× stands for “no mobility shift”
247
DISCUSSION
Pakistan is a large and 6th most populated country of the world (area: 796,095
km2 and population: approximately over 186 million) where tuberculosis has always
remained a public health concern. It is situated in South East Asia that alone harbors
60% TB cases. The high incident rate (231/100,000 population) and increase of MDR
in the country demands efforts, focusing on various TB control strategies to accelerate
the progress to achieve the millennium development goal of WHO which is to halve
TB prevalence and to halve TB mortality by 2015 compared with their levels in 1990
(WHO, 2012).
4.1 M. tuberculosis strain diversity based on 43 format spoligotyping
We found CAS1-Delhi lineage to be the most prevalent one throughout the
country (69% of the genotyped isolates). These results are in concordance with earlier
studies from Pakistan (Ayaz et al., 2012; Hasan et al., 2006; Siddiqi et al., 2002;
Tanveer et al., 2008), India (Bhanu et al., 2002; Sankar et al., 2013; Sharma et al.,
2008; Varma-Basil et al., 2011) as well as from Bangladesh (Rahim et al., 2007). The
second largest lineage found was the ill-defined T family (8%) followed by Ural (6%)
and EAI (6%) lineages. This shows that EAI is of relative low prevalence as
compared to previous reports from Pakistan (Hasan et al., 2006; Tanveer et al., 2008)
where EAI lineage was found to be the second largest lineage of M. tuberculosis
isolates circulating in the population. This could be due to large sample size from
eastern part of the country (Lahore and Faisalabad) in our study as compared to that in
previous studies. The relative prevalence of different lineages can also be influenced
by immigrants or frequent travelers across the border areas. This is particularly true in
a country like Pakistan that hosts large number of immigrants and travelers from
neighboring countries where tuberculosis is highly endemic.
The presence of significantly high proportion of EAI strains [χ²(df=2)=8.4;
p=0.015; nLahore+Faisalabad=80; nKarachi=36; nRawalpindi=140] found in the eastern part of
the country as compared to the other parts is rational as Pakistan is sharing its
geographical border with India that has high proportion of EAI genotype after CAS
248
(Narayanan et al., 2008; Varma-Basil et al., 2011). It is interesting to mention that
clusters of M. tuberculosis lineages; Beijing, Haarlem, and African are associated
with outbreaks in different parts of the world (Brudey et al., 2006; Cadmus et al.,
2011; Gagneux and Small, 2007). Further these lineages have also been described as
predominant pathotypes in the world (Kato-Maeda et al., 2001). In contrast to this,
EAI and CAS lineages have remained endemic in East Asian countries (Narayanan et
al., 2008; Rajapaksa et al., 2008; Singh et al., 2004; Tanveer et al., 2008). All these
studies clearly show that various genotypes remain confined to the respective
geographical regions like CAS family has remained confined in this subcontinent with
minimum tendency to spread out. This might be due to the slow rate of genetic
diversion in M. tuberculosis and also difference in host ethinicity (Singh et al., 2004).
Despite the fact that Pakistan is sharing its geographical boundaries with
China where Beijing spoligotype is highly endemic, our study shows that the Beijing
strains (3%) are not playing an important role in disease transmission in Pakistan and
there is no outbreak of these strains. These results are in agreement with a previous
study (Tanveer et al., 2008) but are in contrast with that of Hasan et al., (2006). These
authors reported 7% prevalence of Beijing strains in Karachi, in contrast to only 3%
found in the present study. Beijing genotype had been reported from the northern and
central part of the country in previous studies while we found none. Hence,
prospective epidemiological studies including molecular analyses are needed to
confirm the genetic diversity of M. tuberculosis isolates in Pakistan with more
representative samples.
4.2 Discriminatory power of 68 format Spoligotyping
In the present study, use of 68 spacer format spoligotyping could not
appreciably increase the strain differentiation. Addition of 25 more spacers could split
only 3 clusters out of 13 clusters, obtained by the combination of 43 spacer format
spoligotyping and 24 MIRU-VNTR typing format. Analysis on the strain family scale
showed that only CAS and T families could achieve strain differentiation. Previous
studies (Brudey et al., 2004; Javed et al., 2007; van der Zanden et al., 2002) showed
249
that the introduction of additional 25 spacers can significantly improve the strain
differentiation particularly in human and large animal adopted MTBC PGG1
subspecies which is not the case with Haarlem (PGG2) strains. In 2010, Jian et al.,
showed that the use of 68 spacer format can provide better strain differentiation
particularly for the M. africanum, EAI and M. bovis while it could not provide
appreciable strain differentiation for the CAS. They suggested the use of this format
for the population-based molecular epidemiological studies in South East Asia where
the EAI clade is highly prevalent. In contrast to their study, we found no strain
differentiation in the EAI strains rather CAS family showed the highest level of strain
differentiation. These contrasting results might be due to the difference in number of
representative isolates belonging to each family in both the studies.
4.3 Genotyping using 24 MIRU-VNTR format
Our study highlights the usefulness of 24 MIRU-VNTR typing in screening
the M. tuberculosis isolates form Pakistan. Although a number of studies have been
reported on spoligotyping of M. tuberculosis strains from Pakistan but only very few
studies have used MIRU-VNTR for molecular typing of M. tuberculosis. All of these
studies have relied on the use of either 12 or 15 MIRU-VNTR format. However, it has
already been reported that the discriminatory power of 12 loci MIRU-VNTR typing is
less than that of IS6110 RFLP, a gold standard for genotyping of M. tuberculosis
isolates. Use of 24 loci format is superior to the 12 and 15 and may exceed the
discriminatory power of IS6110 RFLP typing when used in combination with
spoligotyping (Bidovec-Stojkovic et al., 2011; Christianson et al., 2010).
A previous study, where in five exact tandem repeats (ETR) were used to type
113 M. tuberculosis isolates only from Rawalpindi District of Pakistan, showed
clustering of one third of the isolates, which were further discriminated by an IS6110
based analysis (Gascoyne-Binzi et al., 2002). Ayaz et al., (2012) performed 15 loci
MIRU-VNTR typing on 41 isolates only from Karachi District of Pakistan, while Ali
et al., (2007) used standard 12 loci format to identify the alleles most discriminatory
for CAS1 family (n=178). All these studies didn’t represent the M. tuberculosis
250
population in the country. Although Ali et al., (2007) provided the discriminatory
powers of various loci but none of these studies provided the comparison of the
discriminatory powers of standard 12, 15 and 24 loci MIRU-VNTR typing formats for
the strains circulating in Pakistan.
M. tuberculosis isolates (n=225) in the present study had been differentiated
into 150 patterns, including 24 clusters with clustering rate of 0.228, by spoligotyping
while MIRU-VNTR typing differentiated 168 pattern, including 57 clusters with
clustering rate of 0.133. The discriminatory power of the 24 MIRU-VNTR typing was
found to be higher as compared to spoligotyping format which is in concordance with
previous studies (Chatterjee and Mistry, 2013; Martinez-Guarneros et al., 2013).
Although the combination of both techniques resulted in increased number of patterns
yet the discriminatory power remained very close to the 24 loci MIRU-VNTR typing
in contrast to the previous findings (Pitondo-Silva et al., 2013).
Valcheva et al., (2008) compared the use of 24, 15 and 12 loci to genotype 73
strains of M. tuberculosis and achieved a discriminatory index of 0.997, 0.996 and
0.994 respectively. Similarly, in the present study the 12 loci MIRU-VNTR had lesser
discriminatory power (0.9828) as compared to that of the 15 loci (0.992) and 24 loci
format (0.9971). This is in agreement with the previous finding (Christianson et al.,
2010) where the discriminatory power of the MIRU-VNTR typing was reported to be
proportional to the number of loci analyzed. However, Ali et al., (2007) reported
higher discriminatory power of 12 loci (0.999) as compared to what we found. This is
because their study was conducted to assess the alleles most discriminatory for CAS1
family.
4.4 Determination of “fast lane” screening markers
The usefulness of MIRU-VNTR loci to discriminate between strains varies in
different geographical settings depending upon the population of M. tuberculosis
(Chaoui et al., 2013; Chatterjee and Mistry, 2013; Chen et al., 2012; Dong et al.,
2012; Liu et al., 2013; Zhang et al., 2013). Therefore, it is important to determine the
most discriminatory loci for each country depending on the majority of the
251
representative M. tuberculosis strains of that region. In the present study, highly
discriminatory loci were found to be the Qub 26, MIRU 10, Mtub 04, MIRU 26 and
MIRU 31 (ETR E) while MIRU 16, Qub 4156, Mtub 21, ETR A, MIRU 39, Mtub 39,
Mtub 30, MIRU 24, Qub 11b, MIRU 40 and ETR C as moderately discriminative.
Other loci, including ETR B, MIRU 23, MIRU 04 (ETR D), Mtub 29, Mtub 34,
MIRU 27, MIRU 02 and MIRU 20 showed poor discriminatory power. We found that
the set of MIRU-VNTR loci comprising of Qub 26, MIRU 10, Mtub 04, MIRU 26,
MIRU 31 (ETR E), MIRU 16, Qub 4156 and Mtub 21 can be used as ‘fast lane’
screening markers for differentiation of M. tuberculosis isolates from Pakistan.
4.5 The transmission dynamics of tuberculosis
Our results showed a high diversity and relatively low clonality of M.
tuberculosis isolates as indicated by the RTI (15% by 100% identity and 23% by
SLV). This transmission rate is quite low when considering the high population
density of the country and recent studies involving highly endemic countries. For
instance, in Nigeria where the prevalence is expected to be 3 times lower than in
Pakistan (WHO, 2012), the RTI was of 21.5% when using the same calculation
method (100% identity at 24 MIRU-VNTR + spoligotyping pattern) and of 38% when
allowing for SLV (Tessema et al., 2013). Similarly, 24 MIRU-VNTR-clustered
isolates (a measure similar to RTI) accounted for 34% in Saudi Arabia and 45% in
North-West Ethiopia (Al-Hajoj et al., 2013; Lawson et al., 2012). If further confirmed
by prospective more representative studies, such a low transmission rate could suggest
that the reactivation of M. tuberculosis infection could be the driving force for high
disease burden in the Province. This would suggest that recent health policies in this
provice had a great impact on TB prevalence and transmission. We suggest that a
more comprehensive country-wide epidemiological study (at least 5,000 isolates
would have been necessary to faithfully characterize the diversity for the about
100,000 culture positive isolates of new cases detected each year) should be carried
out to know the true picture of disease transmission in the country.
252
The disease transmission index (RTI) was found to be higher for the
Rawalpindi district as compared to that of Lahore + Faisalabad. This might be due to
a large number of immigrants from Afghanistan, resident in the Rawalpindi district.
Unregulated movement of the Afghan immigrants across the porous Pakistan-
Afghanistan border is presenting a great challenge to tuberculosis control program in
the country providing a fertile ground where MDR strains can thrive. Such
populations require special focus for better case detection, follow up and treatment.
4.6 Assessment of freely available databases for lineage assignation
Assigning isolates to M. tuberculosis lineages using online tools is possible
using 3 different interfaces: TB-lineage, SITVITWEB that can handle spoligotype-
only data, and MIRU-VNTRPlus that is designed to use 24 MIRU-VNTR data.
Despite having been validated and being widely used, they all exhibited errors when
applied to our isolates. This uncovered the inability of all the databases in classifying
(mainly TB-lineage and SpolDB4/SITVITWEB) or giving wrong lineage assignation
(TB-Lineage and MIRU-VNTRplus). Another limit of these databases is in naming of
sublineages. This problem is because of the fact that these databases are not upgraded
regularly and hence give problems in deciding whether the lineage and sublineage
should be assigned according to old system or the system be upgraded regularly and
used accordingly? All databases choose to keep original naming, for instance, the
name of H4 sublineage, in fact, baptized into Ural since 2010, (Abadia et al., 2010;
Kovalev et al., 2005) is still used in SITVITWEB. However, this could have led to the
overestimation of prevalence of Haarlem sublineage in our isolates as Ural sublineage
is much more prevalent (6.5%) as compared to true Haarlem sublineage (0.8%). We
identified that TB-lineage gives inaccurate results when compared to the reference
assignation. SITVITWEB and MIRU-VNTRplus performed well, but lacked
appropriate or exact assignation for 20% of the isolates. All this highlights the need to
design new tools with higher performance in lineage assignation.
253
4.7 Low cost, in-house, reverse hybridization line blot assay
Early and accurate detection of the pathogen in clinical specimens and its drug
sensitivity can help in controlling the disease. Genotypic (unlike phenotypic) assays
do not require viable cultures but require the accurate knowledge of both the target
gene and the mutations associated with resistance. The first paper on detection of
mutations for screening of drug resistant tuberculosis was published in 1993 (Telenti
et al., 1993) and since then a wealth of data has been accumulated on the mutations
found in isolates resistant to specific drugs. In most of the cases, rifampicin resistance
is accompanied with resistance to other first line drugs like isoniazid. Hence,
rifampicin resistance can be used as surrogate marker for MDR-TB (Lin et al., 2004;
Namaei et al., 2006; Telenti et al., 1997).
Reverse hybridization line probe assay can screen a large number of isolates to
detect mutations in a single run. These assays use negatively charged Biodyne C
membrane to immobilize short stretches of oligonucleotides. However, these
oligonucleotides must be modified to have terminal amino group that on activation of
Biodyne C membrane with EDAC will make covalent bonding to the carboxyl group
present on the membrane. This strategy seems attractive and convenient yet is
expensive to adopt. Hence, we explored the possibility of using oligonucleotides
without amino group modification and used positively charged nylon membrane
which does not require EDAC activation. For effective binding of oligonucleotides,
poly (dT) tail was added at the 3´end to improve their binding. In our blots unequal
intensity of signals for wild type oligonucleotides was observed. This may be due to
the difference in optimum temperature for hybridization and washing steps for all the
oligonucleotides included. Efforts will be made to overcome this problem by
designing new probes.
Our in-house assay faithfully detected not only the substitution and deletion
mutations but also unknown mutations indirectly leading to the sensitivity and
specificity of 96% and 97%, respectively, when compared with DNA sequencing. The
assay also identified mixed infection in the clinical sample. Studies have shown that
culture can reduce the clonal complexity of the strains and in most samples (6/10),
254
after culture, only one strain will be identified in mixed infections (Martin et al.,
2010). This suggests that culture based diagnosis of TB can lead to the under
representation of the mixed infection. The detection of mixed infection could have
direct implication for the individual patient as well as spread of drug resistant strains
especially in high TB burden settings.
The time consuming phenotypic DST leads to delay in initiation of appropriate
treatment and transmission of drug resistant strains of M. tuberculosis to close
contacts. The turnaround time for the in-house assay developed in this study is 11
hours including DNA extraction from clinical specimens, PCR and hybridization.
This can contribute significantly in reducing the burden of MDR in country.
Our assay was found to be more cost effective (€3.16 per sample) when
compared with commercially available kits used to determine the rifampicin
resistance in M. tuberculosis. The RIFO assay costs €5.62 per sample when 10
samples are analyzed simultaneously and €4.18 per sample when 40 samples are
handled. The commercially available kit (INNOLiPa, Innogenetics) costs €35 per
test, excluding the costs for import and transport which vary from country to country
and are especially high in developing countries. The actual cost for this assay per
sample in the Netherlands is €35, in Italy €45, in Argentina €55 and in India €90
(Morcillo et al., 2002). The commercially available kit costs US$ 100 per test,
including the costs for import and transport in Pakistan. Hence, our assay could be
used as a low cost alternative to commercially available kits both for the research as
well as diagnostic purposes particularly in the resource poor and middle income
settings where cost is a major parameter to transfer of new technology.
4.8 Genotypic assessment of rifampicin resistance
Mutations in codon 531 of rpoB gene were the major contributor conferring
resistance to rifampicin followed by codon 526 and codon 516. These observations
are similar to the reports from other parts of the world (US, China, Georgia Argentina
(Cavusoglu et al., 2002; Gomgnimbou et al., 2012; Imperiale et al., 2013; Kapur et al.,
1994; Mani et al., 2001; Matsiota-Bernard et al., 1998; Tang et al., 2013) while in
255
contrast to the reports from Pakistan, (Ali et al., 2011; Farooqi et al., 2012) Hungary
(Bartfai et al., 2001), Morocco (Sabouni et al., 2008) or from Asian countries (Hirano
et al., 1999) where mutations at codon 516 are most prevalent.
An additional interesting finding was that some isolates showed novel
mutations outside the 81bp core region, along with or without mutations in the core
region. This finding is in agreement with other reports indicating geographic
variations in mutations (Bobadilla-del-Valle et al., 2001; Pozzi et al., 1999; Yuen et
al., 1999).
4.9 Dominance of mutation at codon 315 of katG in isoniazid resistant isolates
Resistance to isoniazid is mediated by mutations in several genes, most
commonly at codon 315 of katG gene and the promoter region of inhA gene (Hazbon
et al., 2006; Kiepiela et al., 2000; Mathuria et al., 2009; Ramaswamy and Musser,
1998). The mutation in inhA or its promoter region can cause 21-24% of INH
resistance; moreover, the promoter mutations (mainly at position -15 of promoter
region of inhA gene) is more common than the mutations in the structural gene
(Musser et al., 1996). In the present study we found that 72% and 23% of mutations
are in katG gene and in the inhA promoter region, respectively. Substitution mutation
Ser315Thr in the katG gene is found to be associated with relatively high level of
resistance to INH (Zhang et al., 2005) and high TB burden regions are found to have a
higher prevalence of this substitution compared to regions where the prevalence of TB
is intermediate or low (Hu et al., 2010; Mokrousov et al., 2002). The incidence (66%)
of the katG (Ser315Thr) alteration in the present study is not as high as those reported
in north eastern Russia (Mokrousov et al., 2002), Nepal (Poudel et al., 2013),
Bangladesh and Vietnam (Caws et al., 2006) but is higher than that reported in other
parts of the world including India and China (Guo et al., 2008; Hu et al., 2010;
Mathuria et al., 2009; Nusrath Unissa et al., 2008; Yuan et al., 2012) and also in a
previous study from Pakistan (Farooqi et al., 2012).
In promoter region of inhA gene -15 (C→T) substitution was predominant
(21%). These findings are similar to the study from China (Luo et al., 2010) while in
256
contrast to the one conducted in Argentina, China and the previous study in Pakistan
(Farooqi et al., 2012; Imperiale et al., 2013; Zhang et al., 2005). However, it remains
to be ascertained whether the novel mutations detected in this study are associated
with INH resistance or not. To assess their specific effects on katG function and
promoter of inhA gene, further studies are needed.
4.10 Unreliable standards of phenotypic drug susceptibility in the country
Our results identified unreliable standard of phenotypic drug sensitivity in the
country, since we found mutations for rifampicin or isoniazid in codons that are
already proven to be conferring resistance to these drugs. Moreover, 46% of
rifampicin and 52% of isoniazid resistant isolates by phenotypic DST were found to
have no mutation in genes frequently associated with drug resistance. The low
sensitivity and specificity of the phenotypic DST may be due to poor quality or extra
quantity of the antibiotics or laboratory errors. The poor standard of DST indicates the
need of external quality assessment for the maintenance and improvement of the
standard of the phenotypic DST since, it is used for the selection of effective regimens
to treat tuberculosis patients as well as for evaluation of efficiency of tuberculosis
control program and development of strategies to cope with the problem of drug
resistant tuberculosis.
Interestingly, phenotypic DST designated 29% isolates as RifR and 40% as
INHR, genotypic DST reduced this percentage to 17% and 21%, respectively. This
suggests that drug resistance may be overestimated by local hospitals. As a
consequence, prevalence of MDR-TB in Pakistan as published by WHO, may slightly
be overestimated.
4.11 Co-existence of resistance to rifampicin and isoniazid
Genotyping techniques designated 36% isolates as MDR, 26% as resistance to
only rifampicin while 38% for only isoniazid. On the other hand, phenotypic DST
results designated 61% isolates as MDR, 39% resistant for rifampicin only while
0.8% resistant for isoniazid only. Three, possible explanations could be given for
257
these contrasting observations. First, the rifampicin or isoniazid resistance
determining mutations either might be present outside the targeted hotspot regions of
the rpoB gene, katG or inhA genes for the other resistant isolates. This is supported by
the fact that some isolates, possessing mutations in codon 506 and 569 of rpoB gene
while in case of katG gene codon 412 and the AGCC insertion after codon 344 and -
20(C→T) in inhA gene could possibly justify the drug resistance in these isolates.
The evidence of new mutations in the present study indicates that mutations continue
to arise most probably because of the ability of the M. tuberculosis to adapt to the
drug exposure. This demands further investigation of resistant isolates form different
geographical settings with larger sample size. Secondly, mutations in kasA, ndh, and
the oxyR-ahpC intergenic region (Sajduda et al., 2004) might also be contributing in
development of isoniazid resistance. Substandard performance of phenotypic drug
sensitivity might be the third possible explaination.
4.12 Association of M. tuberculosis lineages with specific mutations
A few studies report that some lineages are associated with specific mutations
at the hotspot region of rpoB and katG gene. More specifically, Ali et al., (2009)
identified a higher prevalence of mutations at codon 526 of rpoB gene in CAS1-Dehli
isolates and of mutation 315 in katG gene in CAS isolates. No statistically significant
association could be detected in the present study for rpoB526 or katG315 suggesting
that previously reported association between lineage and mutations might be a chance
event.
4.13 Dominance of substitution mutations at codon 306 of embB gene
In the present study we found mutations in ethambutol resistance determining
region in 57% of EMBR isolates (by phenotypic DST) while 43% isolates did not
show any mutation in the targeted region. This suggests that other genes or
mechanisms might be contributing for ethambutol resistance in M. tuberculosis. It has
been reported that the embB306 mutants provide advantage to M. tuberculosis to
develop INH and/or RIF resistance, hence, patients possessing this mutation should be
258
carefully monitored for treatment failure and the possible emergence of MDR (Safi et
al., 2008).
4.14 Dominance of rpsL 43 and rrs 513 mutation in streptomycin resistant isolates
In the present study, we found that only 28% of the STRR isolates had a
mutation either in the rpsL or rrs genes which is quite contrasting to the results of
studies conducted in European countries and the USA that have reported higher
overall rates (37-67%) of STRR isolates with these mutations (Brzostek et al., 2004b;
Cooksey et al., 1996; Cuevas-Cordoba et al., 2013; Dobner et al., 1997; Perdigao et
al., 2008; Ramaswamy et al., 2004).The highest frequencies of mutations were
observed in Japan, China and Latvia with 77.8%, 85.2% and 85%, respectively
(Katsukawa et al., 1997; Shi et al., 2007; Tracevska et al., 2004). In contrast, no
mutation was detected in STRR isolates in Northern India (Siddiqi et al., 2002).
Regarding the genes associated with streptomycin resistance, we found that
57% of the isolates had mutations in the rpsL gene. The most frequent mutation was
substitution mutation at codon 43rpsL (46%) while no mutation was observed in the
codon 88rpsL. This observation is contrasting to the results of the earlier study
conducted in Pakistan (Khan et al, 2013) where mutations were detected both at
codon 43rpsL and 88rpsL in 50% of the isolates. This conflict might be due to the
difference in the isolates selected in both studies. The frequency of mutations at codon
43rpsL is comparable to the previous study (Jnawali et al., 2013b) while the
difference is remarkable in the studies from China and Japan where this mutation was
found with the frequency of 91% and 78%, respectively (Fukuda et al., 1999; Shi et
al., 2007).
The frequency of mutations in the rrs gene observed in the present study
(43%) is high compared with previous studies (ranging from 2.3% to 24%) (Dobner et
al., 1997; Jnawali et al., 2013b; Katsukawa et al., 1997; Shi et al., 2007; Sreevatsan et
al., 1996b; Tracevska et al., 2004; Tudo et al., 2010). The alterations located at
positions 512(C→T) (7%), 513(A→C) (21%) and 516(C→T) (4%) of rr sgene have
259
previously been reported in several studies (Cuevas-Cordoba et al., 2013; Dobner et
al., 1997; Katsukawa et al., 1997; Shi et al., 2007; Sreevatsan et al., 1996b) and have
also been included in the TB Drug Resistance Mutation Database, published in 2009
(Sandgren et al., 2009), however, to our knowledge, the alteration at position
282(G→T), 420(C→T) and 648(A→C) are novel.
In the present study we did not find any mutation in the 72% of the STRR
isolates. A lower proportion of genetic alteration in STRR isolates have reported in
other studies with 51% in Poland (Brzostek et al., 2004) and 53% in Japan (Fukuda et
al., 1999). This is much higher than the 14.8% reported in China (Shi et al., 2007),
23% in Mexico (Cuevas-Cordoba et al., 2013), 25% (Jnawali et al., 2013a) and 28%
(Jnawali et al., 2013b) in Korea and 33.3% in Portugal (Perdigao et al., 2008). Other
unknown mechanisms such as efflux pumps, the gibB gene (Spies et al., 2008) or
alterations in the cell envelope that lead to decreased permeability, reduced drug
uptake or enhanced efflux (Meier et al., 1996; Sharma et al., 2010) have been
suggested as possible explanation for the absence of mutations in these hotspots.
4.15 Low prevalence of mutations in targeted regions of pncA gene for pyrazinamide resistance
In the present study, we found very few isolates (4%) that showed the
mutations in the targeted coding regions of pncA gene and majority of these were
silent mutations. This might be due to the fact that in the present study, we couldn’t
target the whole gene and there is no “hotspot” region identified in pncA gene yet.
Further, pyrazinamide resistant isolates with normal pyrazinamidase activity and wild
type pncA gene have also been reported (Singh et al., 2006). Bhuju et al., (2013)
found lesser correlation between PZA resistance and mutations in pncA gene (45.7%).
This suggests that other resistance determining mechanisms might be involved such
as recently identified mutations in RpsA gene (Tan et al., 2013). Further studies are
needed to assess the mutations associated with pyrazinamide resistance covering the
newly identified targets to have the complete mutation spectrum for this geographical
setting.
260
4.16 Dominance of the mutations associated with low biological cost
The development of the resistance mutations often leads to the associated
biological cost in bacteria because mutations generally target essential highly
conserved genes (Borrell and Gagneux, 2009). Although acquisition of the mutations
is associated with the loss of fitness yet it has been reported that certain mutations e.g.
the mutation in codon 43 of the rpsL gene (Bottger and Springer, 2008), the mutation
(Ser→Thr) at codon 315 of katG gene (Pym et al., 2002) and the (Ser→Leu) mutation
of codon 531 of rpoB gene poses a relative fitness greater than or equal to 1.0, a
fitness considered equivalent to the susceptible M. tuberculosis strains (Billington et
al., 1999; Mariam et al., 2004). Spies et al., (2013) measured the biological cost of the
M. tuberculosis isolates in the presence of certain mutations. They found that strains
harboring mutations (Lys→Arg) at codon 43 of rpsL gene, (Ser→Leu) at codon 531
of rpoB gene and (Ser→Leu) at codon 315 of the katG gene grow faster than the
susceptible strains. The substitution mutation (Lys→Arg) at codon 43 of rpsL gene is
no cost mutation in Escherichia coli and Salmonella enterica subsp. Entericaserovar
Typhimurium too (Tubulekas and Hughes, 1993). Further, (Ser→Leu) substitution
mutation at codon 315 of the katG gene is known to have high degree of INH
resistance and is only katG mutation associated with successful transmission
(Gagneux et al., 2006a).
The dominance of all these mutations in the resistant isolates collected from
this particular geographical setting is of serious concern as these resistant strains
bearing the resistant determinants having no biological cost, can spread over time due
to natural selection resulting in epidemic. To prevent these epidemics of the resistant
strains, early and accurate diagnosis of the drug resistant strains should be ensured
which can lead to the timely treatment avoiding the occurrence and transmission of
the resistant strains in the community.
4.17 Usefulness of genotyping and SNP screening methods
Our in-house line probe assay is well suited for the SNP analysis. It showed
high sensitivity and specificity not only for the M. tuberculosis culture isolates but
261
also performed very well in clinical specimens. The rapid turnaround time and the low
cost of the assay make it suitable to be used in resource poor high TB burden settings
where rapid and efficient screening of the MDR can help improve TB control
program.
Use of 24 loci MIRU-VNTR analysis in duplex format performed very well in
the present study. Further, this typing technique is well suitable to this setting not only
because of its high discriminatory power (HGDI=0.99) but also because of the lower
cost and decreased turnaround time as compared to the simplex 24 loci MIRU-VNTR
typing.
Our results confirmed the high sensitivity and specificity of spoligoriftyping as
genotyping technique. Moreover, this technique furnishes information on rifampicin
sensitivity along with a pattern that can be used to assign a lineage or sublineage to M.
tuberculosis isolates. This assignation is interesting for a follow-up of tuberculosis
diversity as should be carried out in high-burden countries such as Pakistan.
262
Recommendations and future research directions
General recommendations:
• TB control programs should educate health-care providers in the community
about the need for prompt reporting of suspected cases. Health-care providers
should be educated about the signs and symptoms of TB, diagnostic methods,
prevention, and treatment which can lead to correct diagnosis and treatment,
decrease in the incidence of multidrug resistance, and consequently will stop
the spread of TB in the community.
• Steps should be taken to identify active TB cases so as to shorten the period of
infectivity and consequently to reduce the chances of disease transmission in
close contacts.
• There is need for prompt and effective contact investigation. Populations at
high risk for TB infection should be screened and provided therapy to prevent
progression to active TB.
• TB patients or those suspected to have TB should have an access to
comprehensive and affordable clinical TB services.
• Patients’ non-compliance to anti-TB drugs is also an important factor that
leads to development of MDR TB and XDR TB, hence, the research of
associated behavioral and social factors should be conducted to identify ways
to improve successful completion of prescribed regimen.
• DOTS program should be improved to increase the patient’s compliance to
anti-TB treatment. This will ensure successful treatment and help prevent
development of disease attributable to drug-resistant TB.
• Targeted tuberculin testing programs should be in place to identify the persons
who are at high risk for progression to active TB. These persons will benefit
by treatment of latent TB infection.
263
• Strategies that prevent reactivation of the disease should be implemented.
Specific recommendations
• New, rapid, and cost-effective diagnostic methods are needed to decrease the
number of point sources, hence substantially reducing disease transmission.
Implementation of the developed in-house assay in conjunction with
traditional DST assays could prove to be effective in this regard.
• The unreliable standard of phenotypic DST identified in the study pinpoints
the need for quality control and quality assurance. External quality assessment
at regular time intervals to improve phenotypic DST standards in the country
is also required.
• Genotypic drug susceptibility testing for AFB smear-positive sputum from TB
patients who are suspected to have drug-resistant disease or who are from a
region or population with a high prevalence of drug resistance should be
performed and the results should be used for “personalized treatment”.
• There is convincing evidence for the role of MTBC strain diversity in human
disease. Studies should be conducted to monitor the variability of M.
tuberculosis strains with the representative set of samples from each region of
the country at regular intervals, in order to have true picture about the genetic
diversity in particular geographical settings.
• National TB control program could be assisted with the use of high throughput
techniques like “Spoligotyping” and “TB-SPRINT” at the reference lab level
in order to provide the disease surveillance on the basis of genotyping and
drug sensitivity patterns simultaneously.
• There is need to develop new and effective drug regimens for the treatment of
TB, including drugs to cure MDR TB and XDR and to prevent development of
active disease among persons who are infected latently with drug-resistant M.
tuberculosis.
264
Future research directions
Tuberculosis control also requires research into new preventive measures,
diagnostic approaches, and drugs, which were beyond the scope of this dissertation.
• A broad concerted effort is urgently needed to develop operational-research
capacity, allocate appropriate resources, and encourage all sectors to work
together to promote operational research in TB control. The policy makers
should be taken on board to incorporate research as a priority to improve TB
control, as identified by the Global Plan to Stop TB 2011–2015.
• Epidemiologic studies that make use of genotyping tools are recommended to
elucidate disease transmission dynamics and risk factors for MDR and XDR
TB. There should be facilities to rapidly identify and respond to domestic and
international XDR TB outbreaks.
• Research is needed to advance understanding of genetics and growth
characteristics of M. tuberculosis, host-pathogen interaction and the
association of genotypic and biological markers with infection, disease, and
drug resistance. The reason for dominance of one particular strain in a
particular geographical setting has to be explored.
• Studies must be done to pinpoint specific factors important for reactivation of
the M. tuberculosis strains in the regions where the major driving force of
disease spread is reactivation.
• New tools with higher performance in lineage assignation to faithfully
describe M. tuberculosis diversity are needed. Further, existing online tools
should be upgraded to compare the disease transmission and virulence of
families and lineages, worldwide.
• Long term strategies include the development of prophylactic tool that could
prevent the infection and progression of the disease.
• Ultimately, an effective vaccine is needed to eliminate TB.
265
REFERENCES
Abadia, E., Zhang, J., dos Vultos, T., Ritacco, V., Kremer, K., Aktas, E., Matsumoto,
T., Refregier, G., van Soolingen, D., Gicquel, B., Sola, C., 2010. Resolving lineage
assignation on Mycobacterium tuberculosis clinical isolates classified by
spoligotyping with a new high-throughput 3R SNPs based method. Infect. Genet.
Evol. 10, 1066-1074.
Abbadi, S., Rashed, H.G., Morlock, G.P., Woodley, C.L., El Shanawy, O., Cooksey,
R.C., 2001. Characterization of IS6110 restriction fragment length polymorphism
patterns and mechanisms of antimicrobial resistance for multidrug-resistant isolates of
Mycobacterium tuberculosis from a major reference hospital in Assiut, Egypt. J. Clin.
Microbiol. 39, 2330-2334.
Achtman, M., Zurth, K., Morelli, G., Torrea, G., Guiyoule, A., Carniel, E., 1999.
Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia
pseudotuberculosis. Proc. Natl. Acad. Sci. U S A 96, 14043-14048.
Al-Hajoj, S., Varghese, B., Al-Habobe, F., Shoukri, M.M., Mulder, A., van
Soolingen, D., 2013. Current trends of Mycobacterium tuberculosis molecular
epidemiology in Saudi Arabia and associated demographical factors. Infect. Genet.
Evol. 16, 362-368.
Alderwick, L.J., Birch, H.L., Mishra, A.K., Eggeling, L., Besra, G.S., 2007. Structure,
function and biosynthesis of the Mycobacterium tuberculosis cell wall:
arabinogalactan and lipoarabinomannan assembly with a view to discovering new
drug targets. Biochem. Soc. Trans. 35, 1325-1328.
Ali, A., Hasan, R., Jabeen, K., Jabeen, N., Qadeer, E., Hasan, Z., 2011.
Characterization of mutations conferring extensive drug resistance to Mycobacterium
tuberculosis isolates in Pakistan. Antimicrob. Agents. Chemother. 55, 5654-5659.
266
Ali, A., Hasan, Z., Moatter, T., Tanveer, M., Hasan, R., 2009. M. tuberculosis Central
Asian Strain 1 MDR isolates have more mutations in rpoB and katG genes compared
with other genotypes. Scand. J. Infect. Dis. 41, 37-44.
Ali, A., Hasan, Z., Tanveer, M., Siddiqui, A.R., Ghebremichael, S., Kallenius, G.,
Hasan, R., 2007. Characterization of Mycobacterium tuberculosis Central Asian
Strain 1 using mycobacterial interspersed repetitive unit genotyping. BMC Microbiol.
7, 76.
Allix-Beguec, C., Harmsen, D., Weniger, T., Supply, P., Niemann, S., 2008.
Evaluation and strategy for use of MIRU-VNTRplus, a multifunctional database for
online analysis of genotyping data and phylogenetic identification of Mycobacterium
tuberculosis complex isolates. J. Clin. Microbiol. 46, 2692-2699.
Allix, C., Supply, P., Fauville-Dufaux, M., 2004. Utility of fast mycobacterial
interspersed repetitive unit-variable number tandem repeat genotyping in clinical
mycobacteriological analysis. Clin. Infect. Dis. 39, 783-789.
Ayaz, A., Hasan, Z., Jafri, S., Inayat, R., Mangi, R., Channa, A.A., Malik, F.R., Ali,
A., Rafiq, Y., Hasan, R., 2012. Characterizing Mycobacterium tuberculosis isolates
from Karachi, Pakistan: drug resistance and genotypes. Int. J. Infect. Dis. 16, e303-
309.
Baker, L., Brown, T., Maiden, M.C., Drobniewski, F., 2004. Silent nucleotide
polymorphisms and a phylogeny for Mycobacterium tuberculosis. Emerg. Infect. Dis.
10, 1568-1577.
Barlow, R.E., Gascoyne-Binzi, D.M., Gillespie, S.H., Dickens, A., Qamer, S.,
Hawkey, P.M., 2001. Comparison of variable number tandem repeat and IS6110-
restriction fragment length polymorphism analyses for discrimination of high- and
low-copy-number IS6110 Mycobacterium tuberculosis isolates. J. Clin. Microbiol. 39,
2453-2457.
267
Barnes, P.F., Cave, M.D., 2003. Molecular epidemiology of tuberculosis. N. Engl. J.
Med. 349, 1149-1156.
Barnes, P.F., Yang, Z., Preston-Martin, S., Pogoda, J.M., Jones, B.E., Otaya, M.,
Eisenach, K.D., Knowles, L., Harvey, S., Cave, M.D., 1997. Patterns of tuberculosis
transmission in Central Los Angeles. JAMA 278, 1159-1163.
Bartfai, Z., Somoskovi, A., Kodmon, C., Szabo, N., Puskas, E., Kosztolanyi, L.,
Farago, E., Mester, J., Parsons, L.M., Salfinger, M., 2001. Molecular characterization
of rifampin-resistant isolates of Mycobacterium tuberculosis from Hungary by DNA
sequencing and the line probe assay. J. Clin. Microbiol. 39, 3736-3739.
Bates, J.H., 1979. Diagnosis of tuberculosis. Chest. 76, 757-763.
Behr, M.A., Wilson, M.A., Gill, W.P., Salamon, H., Schoolnik, G.K., Rane, S., Small,
P.M., 1999. Comparative genomics of BCG vaccines by whole-genome DNA
microarray. Science 284, 1520-1523.
Bergmann, J.S., Woods, G.L., 1997. Reliability of mycobacteria growth indicator tube
for testing susceptibility of Mycobacterium tuberculosis to ethambutol and
streptomycin. J. Clin. Microbiol. 35, 3325-3327.
Bernstein, J., Lott, W.A., Steinberg, B.A., Yale, H.L., 1952. Chemotherapy of
experimental tuberculosis. V. Isonicotinic acid hydrazide (nydrazid) and related
compounds. Am. Rev. Tuberc. 65, 357-364.
Bhanu, N.V., van Soolingen, D., van Embden, J.D., Dar, L., Pandey, R.M., Seth, P.,
2002. Predominace of a novel Mycobacterium tuberculosis genotype in the Delhi
region of India. Tuberculosis (Edinb) 82, 105-112.
Bhuju, S., Fonseca Lde, S., Marsico, A.G., de Oliveira Vieira, G.B., Sobral, L.F.,
Stehr, M., Singh, M., Saad, M.H., 2013. Mycobacterium tuberculosis isolates from
268
Rio de Janeiro reveal unusually low correlation between pyrazinamide resistance and
mutations in the pncA gene. Infect. Genet. Evol. 19, 1-6.
Bidovec-Stojkovic, U., Zolnir-Dovc, M., Supply, P., 2011. One year nationwide
evaluation of 24-locus MIRU-VNTR genotyping on Slovenian Mycobacterium
tuberculosis isolates. Respir. Med. 105 Suppl 1, S67-73.
Billington, O.J., McHugh, T.D., Gillespie, S.H., 1999. Physiological cost of rifampin
resistance induced in vitro in Mycobacterium tuberculosis. Antimicrob. Agents.
Chemother. 43, 1866-1869.
Blessington, B., Beiraghi, A., 1990. Study of the stereochemistry of ethambutol using
chiral liquid chromatography and synthesis. J. Chromatogr. A 522, 195-203.
Bloom, B.R., Murray, C.J., 1992. Tuberculosis: commentary on a reemergent killer.
Science 257, 1055-1064.
Bobadilla-del-Valle, M., Ponce-de-Leon, A., Arenas-Huertero, C., Vargas-Alarcon,
G., Kato-Maeda, M., Small, P.M., Couary, P., Ruiz-Palacios, G.M., Sifuentes-
Osornio, J., 2001. rpoB Gene mutations in rifampin-resistant Mycobacterium
tuberculosis identified by polymerase chain reaction single-stranded conformational
polymorphism. Emerg. Infect. Dis. 7, 1010-1013.
Borrell, S., Gagneux, S., 2009. Infectiousness, reproductive fitness and evolution of
drug-resistant Mycobacterium tuberculosis. Int. J. Tuberc. Lung. Dis. 13, 1456-1466.
Bottger, E.C., Springer, B., 2008. Tuberculosis: drug resistance, fitness, and strategies
for global control. Eur. J. Pediatr. 167, 141-148.
Braden, C.R., Templeton, G.L., Cave, M.D., Valway, S., Onorato, I.M., Castro, K.G.,
Moers, D., Yang, Z., Stead, W.W., Bates, J.H., 1997. Interpretation of restriction
fragment length polymorphism analysis of Mycobacterium tuberculosis isolates from
a state with a large rural population. J. Infect. Dis. 175, 1446-1452.
269
Brandli, O., 1998. The clinical presentation of tuberculosis. Respiration 65, 97-105.
Brennan, P.J., Nikaido, H., 1995. The envelope of mycobacteria. Annu. Rev.
Biochem. 64, 29-63.
Brisson-Noel, A., Aznar, C., Chureau, C., Nguyen, S., Pierre, C., Bartoli, M., Bonete,
R., Pialoux, G., Gicquel, B., Garrigue, G., 1991. Diagnosis of tuberculosis by DNA
amplification in clinical practice evaluation. Lancet 338, 364-366.
Brosch, R., Gordon, S.V., Marmiesse, M., Brodin, P., Buchrieser, C., Eiglmeier, K.,
Garnier, T., Gutierrez, C., Hewinson, G., Kremer, K., Parsons, L.M., Pym, A.S.,
Samper, S., van Soolingen, D., Cole, S.T., 2002. A new evolutionary scenario for the
Mycobacterium tuberculosis complex. Proc. Natl. Acad. Sci. U S A 99, 3684-3689.
Brosch, R., Philipp, W.J., Stavropoulos, E., Colston, M.J., Cole, S.T., Gordon, S.V.,
1999. Genomic analysis reveals variation between Mycobacterium tuberculosis
H37Rv and the attenuated M. tuberculosis H37Ra strain. Infect. Immun. 67, 5768-
5774.
Brossier, F., Veziris, N., Truffot-Pernot, C., Jarlier, V., Sougakoff, W., 2006.
Performance of the genotype MTBDR line probe assay for detection of resistance to
rifampin and isoniazid in strains of Mycobacterium tuberculosis with low- and high-
level resistance. J. Clin. Microbiol. 44, 3659-3664.
Brudey, K., Driscoll, J.R., Rigouts, L., Prodinger, W.M., Gori, A., Al-Hajoj, S.A.,
Allix, C., Aristimuno, L., Arora, J., Baumanis, V., Binder, L., Cafrune, P., Cataldi, A.,
Cheong, S., Diel, R., Ellermeier, C., Evans, J.T., Fauville-Dufaux, M., Ferdinand, S.,
Garcia de Viedma, D., Garzelli, C., Gazzola, L., Gomes, H.M., Guttierez, M.C.,
Hawkey, P.M., van Helden, P.D., Kadival, G.V., Kreiswirth, B.N., Kremer, K.,
Kubin, M., Kulkarni, S.P., Liens, B., Lillebaek, T., Ho, M.L., Martin, C., Mokrousov,
I., Narvskaia, O., Ngeow, Y.F., Naumann, L., Niemann, S., Parwati, I., Rahim, Z.,
Rasolofo-Razanamparany, V., Rasolonavalona, T., Rossetti, M.L., Rusch-Gerdes, S.,
Sajduda, A., Samper, S., Shemyakin, I.G., Singh, U.B., Somoskovi, A., Skuce, R.A.,
270
van Soolingen, D., Streicher, E.M., Suffys, P.N., Tortoli, E., Tracevska, T., Vincent,
V., Victor, T.C., Warren, R.M., Yap, S.F., Zaman, K., Portaels, F., Rastogi, N., Sola,
C., 2006. Mycobacterium tuberculosis complex genetic diversity: mining the fourth
international spoligotyping database (SpolDB4) for classification, population genetics
and epidemiology. BMC Microbiol. 6, 23.
Brudey, K., Gutierrez, M.C., Vincent, V., Parsons, L.M., Salfinger, M., Rastogi, N.,
Sola, C., 2004. Mycobacterium africanum genotyping using novel spacer
oligonucleotides in the direct repeat locus. J. Clin. Microbiol. 42, 5053-5057.
Brzostek, A., Sajduda, A., Sliwinski, T., Augustynowicz-Kopec, E., Jaworski, A.,
Zwolska, Z., Dziadek, J., 2004b. Molecular characterisation of streptomycin-resistant
Mycobacterium tuberculosis strains isolated in Poland. Int. J. Tuberc. Lung. Dis. 8,
1032-1035.
Burgess, R.R., Erickson, B., Gentry, D., Gribstov, M., Hager, D., Lesley, S.,
Strickland, M., Thompson, N., 1987. Bacterial RNA polymerase subunits and genes.
Cold Spring Harbor, N.Y, New york, pp. 3-15.
Burman, W.J., Reves, R.R., Hawkes, A.P., Rietmeijer, C.A., Yang, Z., el-Hajj, H.,
Bates, J.H., Cave, M.D., 1997. DNA fingerprinting with two probes decreases
clustering of Mycobacterium tuberculosis. Am. J. Respir. Crit. Care. Med. 155, 1140-
1146.
Cadmus, S., Hill, V., van Soolingen, D., Rastogi, N., 2011. Spoligotype profile of
Mycobacterium tuberculosis complex strains from HIV-positive and -negative
patients in Nigeria: a comparative analysis. J. Clin. Microbiol. 49, 220-226.
Caminero, J.A., 2010. Multidrug-resistant tuberculosis: epidemiology, risk factors and
case finding. Int. J. Tuberc. Lung. Dis. 14, 382-390.
Camus, J.C., Pryor, M.J., Medigue, C., Cole, S.T., 2002. Re-annotation of the genome
sequence of Mycobacterium tuberculosis H37Rv. Microbiology 148, 2967-2973.
271
Carter, A.P., Clemons, W.M., Brodersen, D.E., Morgan-Warren, R.J., Wimberly,
B.T., Ramakrishnan, V., 2000. Functional insights from the structure of the 30S
ribosomal subunit and its interactions with antibiotics. Nature 407, 340-348.
Case, C., Kandola, K., Chui, L., Li, V., Nix, N., Johnson, R., 2013. Examining DNA
fingerprinting as an epidemiology tool in the tuberculosis program in the Northwest
Territories, Canada. Int. J. Circumpolar. Health. 72.
Cavusoglu, C., Hilmioglu, S., Guneri, S., Bilgic, A., 2002. Characterization of rpoB
mutations in rifampin-resistant clinical isolates of Mycobacterium tuberculosis from
Turkey by DNA sequencing and line probe assay. J. Clin. Microbiol. 40, 4435-4438.
Caws, M., Duy, P.M., Tho, D.Q., Lan, N.T., Hoa, D.V., Farrar, J., 2006. Mutations
prevalent among rifampin- and isoniazid-resistant Mycobacterium tuberculosis
isolates from a hospital in Vietnam. J. Clin. Microbiol. 44, 2333-2337.
CDC, 1993. Initial therapy for tuberculosis in the era of multidrug resistance.
Recommendations of the Advisory Council for the Elimination of Tuberculosis.
MMWR Recomm. Rep. 42, 1-8.
Chaisson, R.E., 2003. Treatment of chronic infections with rifamycins: is resistance
likely to follow? Antimicrob. Agents. Chemother. 47, 3037-3039.
Chaoui, I., Zozio, T., Lahlou, O., Sabouni, R., Abid, M., El Aouad, R., Akrim, M.,
Amzazi, S., Rastogi, N., El Mzibri, M., 2013. Contribution of spoligotyping and
MIRU-VNTRs to characterize prevalent Mycobacterium tuberculosis genotypes
infecting tuberculosis patients in Morocco. Infect. Genet. Evol. S1567-1348.
Chapman, A.L., Munkanta, M., Wilkinson, K.A., Pathan, A.A., Ewer, K., Ayles, H.,
Reece, W.H., Mwinga, A., Godfrey-Faussett, P., Lalvani, A., 2002. Rapid detection of
active and latent tuberculosis infection in HIV-positive individuals by enumeration of
Mycobacterium tuberculosis-specific T cells. AIDS 16, 2285-2293.
272
Chatterjee, A., Mistry, N., 2013. MIRU-VNTR profiles of three major
Mycobacterium tuberculosis spoligotypes found in western India. Tuberculosis
(Edinb) 93, 250-256.
Chauca, J.A., Palomino, J.C., Guerra, H., 2007. Evaluation of rifampicin and
isoniazid susceptibility testing of Mycobacterium tuberculosis by a
mycobacteriophage D29-based assay. J. Med. Microbiol. 56, 360-364.
Chaves, F., Yang, Z., el Hajj, H., Alonso, M., Burman, W.J., Eisenach, K.D., Dronda,
F., Bates, J.H., Cave, M.D., 1996. Usefulness of the secondary probe pTBN12 in
DNA fingerprinting of Mycobacterium tuberculosis. J. Clin. Microbiol. 34, 1118-
1123.
Chen, P., Bishai, W.R., 1998. Novel selection for isoniazid (INH) resistance genes
supports a role for NAD+-binding proteins in mycobacterial INH resistance. Infect.
Immun. 66, 5099-5106.
Chen, Y.Y., Chang, J.R., Huang, W.F., Kuo, S.C., Su, I.J., Sun, J.R., Chiueh, T.S.,
Huang, T.S., Chen, Y.S., Dou, H.Y., 2012. Genetic diversity of the Mycobacterium
tuberculosis Beijing family based on SNP and VNTR typing profiles in Asian
countries. PLoS One. 7, e39792.
Cheng, X., Zhang, J., Yang, L., Xu, X., Liu, J., Yu, W., Su, M., Hao, X., 2007. A new
Multi-PCR-SSCP assay for simultaneous detection of isoniazid and rifampin
resistance in Mycobacterium tuberculosis. J. Microbiol. Methods. 70, 301-305.
Christianson, S., Wolfe, J., Orr, P., Karlowsky, J., Levett, P.N., Horsman, G.B.,
Thibert, L., Tang, P., Sharma, M.K., 2010. Evaluation of 24 locus MIRU-VNTR
genotyping of Mycobacterium tuberculosis isolates in Canada. Tuberculosis (Edinb)
90, 31-38.
273
Chun, J.Y., Kim, K.J., Hwang, I.T., Kim, Y.J., Lee, D.H., Lee, I.K., Kim, J.K., 2007.
Dual priming oligonucleotide system for the multiplex detection of respiratory viruses
and SNP genotyping of CYP2C19 gene. Nucleic. Acids. Res. 35, e40.
Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon,
S.V., Eiglmeier, K., Gas, S., Barry, C.E., 3rd, Tekaia, F., Badcock, K., Basham, D.,
Brown, D., Chillingworth, T., Connor, R., Davies, R., Devlin, K., Feltwell, T.,
Gentles, S., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Krogh, A., McLean, J.,
Moule, S., Murphy, L., Oliver, K., Osborne, J., Quail, M.A., Rajandream, M.A.,
Rogers, J., Rutter, S., Seeger, K., Skelton, J., Squares, R., Squares, S., Sulston, J.E.,
Taylor, K., Whitehead, S., Barrell, B.G., 1998. Deciphering the biology of
Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537-
544.
Colice, G.L., 1995. Pulmonary tuberculosis. Is resurgence due to reactivation or new
infection? Postgrad. Med. 97, 35-38, 44, 47-38.
Comas, I., Homolka, S., Niemann, S., Gagneux, S., 2009. Genotyping of genetically
monomorphic bacteria: DNA sequencing in Mycobacterium tuberculosis highlights
the limitations of current methodologies. PLoS One 4, e7815.
Cooksey, R.C., Morlock, G.P., McQueen, A., Glickman, S.E., Crawford, J.T., 1996.
Characterization of streptomycin resistance mechanisms among Mycobacterium
tuberculosis isolates from patients in New York City. Antimicrob. Agents.
Chemother. 40, 1186-1188.
Cowan, L.S., Mosher, L., Diem, L., Massey, J.P., Crawford, J.T., 2002. Variable-
number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy
numbers of IS6110 by using mycobacterial interspersed repetitive units. J. Clin.
Microbiol. 40, 1592-1602.
274
Cruciani, M., Scarparo, C., Malena, M., Bosco, O., Serpelloni, G., Mengoli, C., 2004.
Meta-analysis of BACTEC MGIT 960 and BACTEC 460 TB, with or without solid
media, for detection of mycobacteria. J. Clin. Microbiol. 42, 2321-2325.
Cuevas-Cordoba, B., Cuellar-Sanchez, A., Pasissi-Crivelli, A., Santana-Alvarez, C.A.,
Hernandez-Illezcas, J., Zenteno-Cuevas, R., 2013. rrs and rpsL mutations in
streptomycin-resistant isolates of Mycobacterium tuberculosis from Mexico. J.
Microbiol. Immunol. Infect. 46, 30-34.
Daley, C.L., Small, P.M., Schecter, G.F., Schoolnik, G.K., McAdam, R.A., Jacobs,
W.R., Jr., Hopewell, P.C., 1992. An outbreak of tuberculosis with accelerated
progression among persons infected with the human immunodeficiency virus. An
analysis using restriction-fragment-length polymorphisms. N. Engl. J. Med. 326, 231-
235.
Damper, P.D., Epstein, W., 1981. Role of the membrane potential in bacterial
resistance to aminoglycoside antibiotics. Antimicrob. Agents. Chemother. 20, 803-
808.
Daniel, T.M., 2005. Robert Koch and the pathogenesis of tuberculosis. Int. J. Tuberc.
Lung. Dis. 9, 1181-1182.
Daniel, T.M., 2006. The history of tuberculosis. Respir. Med. 100, 1862-1870.
Dar, L., Sharma, S.K., Bhanu, N.V., Broor, S., Chakraborty, M., Pande, J.N., Seth, P.,
1998. Diagnosis of pulmonary tuberculosis by polymerase chain reaction for MPB64
gene: an evaluation in a blind study. Indian. J. Chest. Dis. Allied. Sci. 40, 5-16.
Das, S., Paramasivan, C.N., Lowrie, D.B., Prabhakar, R., Narayanan, P.R., 1995.
IS6110 restriction fragment length polymorphism typing of clinical isolates of
Mycobacterium tuberculosis from patients with pulmonary tuberculosis in Madras,
south India. Tuber. Lung. Dis. 76, 550-554.
275
David, H.L., 1970. Probability distribution of drug-resistant mutants in unselected
populations of Mycobacterium tuberculosis. Appl. Microbiol. 20, 810-814.
Davies, P.D., Pai, M., 2008. The diagnosis and misdiagnosis of tuberculosis. Int. J.
Tuberc. Lung. Dis. 12, 1226-1234.
De Wit, D., Steyn, L., Shoemaker, S., Sogin, M., 1990. Direct detection of
Mycobacterium tuberculosis in clinical specimens by DNA amplification. J. Clin.
Microbiol. 28, 2437-2441.
Deng, J.Y., Zhang, X.E., Lu, H.B., Liu, Q., Zhang, Z.P., Zhou, Y.F., Xie, W.H., Fu,
Z.J., 2004. Multiplex detection of mutations in clinical isolates of rifampin-resistant
Mycobacterium tuberculosis by short oligonucleotide ligation assay on DNA chips. J.
Clin. Microbiol. 42, 4850-4852.
Dever, L.A., Dermody, T.S., 1991. Mechanisms of bacterial resistance to antibiotics.
Arch. Intern. Med. 151, 886-895.
Di Perri, G., Bonora, S., 2004. Which agents should we use for the treatment of
multidrug-resistant Mycobacterium tuberculosis? J. Antimicrob. Chemother. 54, 593-
602.
Dickinson, J.M., Mitchison, D.A., 1981. Experimental models to explain the high
sterilizing activity of rifampin in the chemotherapy of tuberculosis. Am. Rev. Respir.
Dis. 123, 367-371.
Dobner, P., Bretzel, G., Rusch-Gerdes, S., Feldmann, K., Rifai, M., Loscher, T.,
Rinder, H., 1997. Geographic variation of the predictive values of genomic mutations
associated with streptomycin resistance in Mycobacterium tuberculosis. Mol. Cell.
Probes. 11, 123-126.
Doetsch, R.N., 1978. Benjamin Marten and his "New Theory of Consumptions".
Microbiol. Rev. 42, 521-528.
276
Dong, H., Shi, L., Zhao, X., Sang, B., Lv, B., Liu, Z., Wan, K., 2012. Genetic
diversity of Mycobacterium tuberculosis isolates from Tibetans in Tibet, China. PLoS
One 7, e33904.
Drobniewski, F., Nikolayevskyy, V., Balabanova, Y., Bang, D., Papaventsis, D.,
2012. Diagnosis of tuberculosis and drug resistance: what can new tools bring us? Int.
J. Tuberc. Lung. Dis. 16, 860-870.
Drobniewski, F.A., Wilson, S.M., 1998. The rapid diagnosis of isoniazid and
rifampicin resistance in Mycobacterium tuberculosis--a molecular story. J. Med.
Microbiol. 47, 189-196.
Ducasse-Cabanot, S., Cohen-Gonsaud, M., Marrakchi, H., Nguyen, M., Zerbib, D.,
Bernadou, J., Daffe, M., Labesse, G., Quemard, A., 2004. In vitro inhibition of the
Mycobacterium tuberculosis beta-ketoacyl-acyl carrier protein reductase MabA by
isoniazid. Antimicrob. Agents. Chemother. 48, 242-249.
Edlin, B.R., Tokars, J.I., Grieco, M.H., Crawford, J.T., Williams, J., Sordillo, E.M.,
Ong, K.R., Kilburn, J.O., Dooley, S.W., Castro, K.G., et al., 1992. An outbreak of
multidrug-resistant tuberculosis among hospitalized patients with the acquired
immunodeficiency syndrome. N. Engl. J. Med. 326, 1514-1521.
Eisenach, K.D., Cave, M.D., Bates, J.H., Crawford, J.T., 1990. Polymerase chain
reaction amplification of a repetitive DNA sequence specific for Mycobacterium
tuberculosis. J. Infect. Dis. 161, 977-981.
Eisenach, K.D., Crawford, J.T., Bates, J.H., 1988. Repetitive DNA sequences as
probes for Mycobacterium tuberculosis. J. Clin. Microbiol. 26, 2240-2245.
Escalante, P., Ramaswamy, S., Sanabria, H., Soini, H., Pan, X., Valiente-Castillo, O.,
Musser, J.M., 1998. Genotypic characterization of drug-resistant Mycobacterium
tuberculosis isolates from Peru. Tuber. Lung. Dis. 79, 111-118.
277
Fan, J.B., Chen, X., Halushka, M.K., Berno, A., Huang, X., Ryder, T., Lipshutz, R.J.,
Lockhart, D.J., Chakravarti, A., 2000. Parallel genotyping of human SNPs using
generic high-density oligonucleotide tag arrays. Genome. Res. 10, 853-860.
Fang, Z., Morrison, N., Watt, B., Doig, C., Forbes, K.J., 1998. IS6110 transposition
and evolutionary scenario of the direct repeat locus in a group of closely related
Mycobacterium tuberculosis strains. J. Bacteriol. 180, 2102-2109.
Farooqi, J.Q., Khan, E., Alam, S.M., Ali, A., Hasan, Z., Hasan, R., 2012. Line probe
assay for detection of rifampicin and isoniazid resistant tuberculosis in Pakistan. J.
Pak. Med. Assoc. 62, 767-772.
Feil, E.J., Spratt, B.G., 2001. Recombination and the population structures of bacterial
pathogens. Annu. Rev. Microbiol. 55, 561-590.
Ferro, B.E., Garcia, P.K., Nieto, L.M., van Soolingen, D., 2013. Predictive Value of
Molecular Drug Resistance Testing of Mycobacterium tuberculosis Isolates in Valle
del Cauca, Colombia. J. Clin. Microbiol. 51, 2220-2224.
Filliol, I., Driscoll, J.R., Van Soolingen, D., Kreiswirth, B.N., Kremer, K., Valetudie,
G., Anh, D.D., Barlow, R., Banerjee, D., Bifani, P.J., Brudey, K., Cataldi, A.,
Cooksey, R.C., Cousins, D.V., Dale, J.W., Dellagostin, O.A., Drobniewski, F.,
Engelmann, G., Ferdinand, S., Gascoyne-Binzi, D., Gordon, M., Gutierrez, M.C.,
Haas, W.H., Heersma, H., Kallenius, G., Kassa-Kelembho, E., Koivula, T., Ly, H.M.,
Makristathis, A., Mammina, C., Martin, G., Mostrom, P., Mokrousov, I., Narbonne,
V., Narvskaya, O., Nastasi, A., Niobe-Eyangoh, S.N., Pape, J.W., Rasolofo-
Razanamparany, V., Ridell, M., Rossetti, M.L., Stauffer, F., Suffys, P.N., Takiff, H.,
Texier-Maugein, J., Vincent, V., De Waard, J.H., Sola, C., Rastogi, N., 2002. Global
distribution of Mycobacterium tuberculosis spoligotypes. Emerg. Infect. Dis. 8, 1347-
1349.
Filliol, I., Motiwala, A.S., Cavatore, M., Qi, W., Hazbon, M.H., Bobadilla del Valle,
M., Fyfe, J., Garcia-Garcia, L., Rastogi, N., Sola, C., Zozio, T., Guerrero, M.I., Leon,
278
C.I., Crabtree, J., Angiuoli, S., Eisenach, K.D., Durmaz, R., Joloba, M.L., Rendon, A.,
Sifuentes-Osornio, J., Ponce de Leon, A., Cave, M.D., Fleischmann, R., Whittam,
T.S., Alland, D., 2006. Global phylogeny of Mycobacterium tuberculosis based on
single nucleotide polymorphism (SNP) analysis: insights into tuberculosis evolution,
phylogenetic accuracy of other DNA fingerprinting systems, and recommendations
for a minimal standard SNP set. J. Bacteriol. 188, 759-772.
Finken, M., Kirschner, P., Meier, A., Wrede, A., Bottger, E.C., 1993. Molecular basis
of streptomycin resistance in Mycobacterium tuberculosis: alterations of the
ribosomal protein S12 gene and point mutations within a functional 16S ribosomal
RNA pseudoknot. Mol. Microbiol. 9, 1239-1246.
Freixo, I.M., Caldas, P.C., Martins, F., Brito, R.C., Ferreira, R.M., Fonseca, L.S.,
Saad, M.H., 2002. Evaluation of Etest strips for rapid susceptibility testing of
Mycobacterium tuberculosis. J. Clin. Microbiol. 40, 2282-2284.
Fukuda, M., Koga, H., Ohno, H., Yang, B., Hirakata, Y., Maesaki, S., Tomono, K.,
Tashiro, T., Kohno, S., 1999. Relationship between genetic alteration of the rpsL gene
and streptomycin susceptibility of Mycobacterium tuberculosis in Japan. J.
Antimicrob. Chemother. 43, 281-284.
Gagneux, S., Burgos, M.V., DeRiemer, K., Encisco, A., Munoz, S., Hopewell, P.C.,
Small, P.M., Pym, A.S., 2006a. Impact of bacterial genetics on the transmission of
isoniazid-resistant Mycobacterium tuberculosis. PLoS. Pathog. 2, e61.
Gagneux, S., DeRiemer, K., Van, T., Kato-Maeda, M., de Jong, B.C., Narayanan, S.,
Nicol, M., Niemann, S., Kremer, K., Gutierrez, M.C., Hilty, M., Hopewell, P.C.,
Small, P.M., 2006b. Variable host-pathogen compatibility in Mycobacterium
tuberculosis. Proc. Natl. Acad. Sci. U S A 103, 2869-2873.
Gagneux, S., Small, P.M., 2007. Global phylogeography of Mycobacterium
tuberculosis and implications for tuberculosis product development. Lancet. Infect.
Dis. 7, 328-337.
279
Garnier, T., Eiglmeier, K., Camus, J.C., Medina, N., Mansoor, H., Pryor, M., Duthoy,
S., Grondin, S., Lacroix, C., Monsempe, C., Simon, S., Harris, B., Atkin, R., Doggett,
J., Mayes, R., Keating, L., Wheeler, P.R., Parkhill, J., Barrell, B.G., Cole, S.T.,
Gordon, S.V., Hewinson, R.G., 2003. The complete genome sequence of
Mycobacterium bovis. Proc Natl. Acad. Sci. U S A 100, 7877-7882.
Gascoyne-Binzi, D.M., Barlow, R.E., Essex, A., Gelletlie, R., Khan, M.A., Hafiz, S.,
Collyns, T.A., Frizzell, R., Hawkey, P.M., 2002. Predominant VNTR family of strains
of Mycobacterium tuberculosis isolated from South Asian patients. Int. J. Tuberc.
Lung. Dis. 6, 492-496.
Gascoyne-Binzi, D.M., Barlow, R.E., Frothingham, R., Robinson, G., Collyns, T.A.,
Gelletlie, R., Hawkey, P.M., 2001. Rapid identification of laboratory contamination
with Mycobacterium tuberculosis using variable number tandem repeat analysis. J.
Clin. Microbiol. 39, 69-74.
Gerhold, D., Rushmore, T., Caskey, C.T., 1999. DNA chips: promising toys have
become powerful tools. Trends. Biochem. Sci. 24, 168-173.
Githui, W.A., Kwamanga, D., Chakaya, J.M., Karimi, F.G., Waiyaki, P.G., 1993.
Anti-tuberculous initial drug resistance of Mycobacterium tuberculosis in Kenya: a
ten-year review. East. Afr. Med. J. 70, 609-612.
Godfrey-Faussett, P., Maher, D., Mukadi, Y.D., Nunn, P., Perriens, J., Raviglione, M.,
2002. How human immunodeficiency virus voluntary testing can contribute to
tuberculosis control. Bull. World. Health. Organ. 80, 939-945.
Golden, M.P., Vikram, H.R., 2005. Extrapulmonary tuberculosis: an overview. Am.
Fam. Physician. 72, 1761-1768.
Gomgnimbou, M.K., Abadia, E., Zhang, J., Refregier, G., Panaiotov, S., Bachiyska,
E., Sola, C., 2012. "Spoligoriftyping," a dual-priming-oligonucleotide-based direct-
280
hybridization assay for tuberculosis control with a multianalyte microbead-based
hybridization system. J. Clin. Microbiol. 50, 3172-3179.
Gomgnimbou, M.K., Hernandez-Neuta, I., Panaiotov, S., Bachiyska, E., Palomino,
J.C., Martin, A., Del Portillo, P., Refregier, G., Sola, C., 2013a. "TB-SPRINT:
TUBERCULOSIS-SPOLIGO-RIFAMPIN-ISONIAZID TYPING" an All-in-One
assay technique for surveillance and control of multi-drug resistant tuberculosis on
Luminex(R) devices. J. Clin. Microbiol. 51, 3527-34.
Gomgnimbou, M.K., Hernandez-Neuta, I., Panaiotov, S., Bachiyska, E., Palomino,
J.C., Martin, A., Del Portillo, P., Refregier, G., Sola, C., 2013b. Tuberculosis-
Spoligo-Rifampin-Isoniazid Typing: an All-in-One Assay Technique for Surveillance
and Control of Multidrug-Resistant Tuberculosis on Luminex Devices. J. Clin.
Microbiol. 51, 3527-3534.
Gordon, S.V., Brosch, R., Billault, A., Garnier, T., Eiglmeier, K., Cole, S.T., 1999.
Identification of variable regions in the genomes of tubercle bacilli using bacterial
artificial chromosome arrays. Mol. Microbiol. 32, 643-655.
Green, E., Obi, L.C., Okoh, A.I., Nchabeleng, M., de Villiers, B.E., Letsoalo, T.,
Hoosen, A.A., Bessong, P.O., Ndip, R.N., 2013. IS6110 restriction fragment length
polymorphism typing of drug-resistant Mycobacterium tuberculosis strains from
northeast South Africa. J. Health. Popul. Nutr. 31, 1-10.
Groenen, P.M., Bunschoten, A.E., van Soolingen, D., van Embden, J.D., 1993. Nature
of DNA polymorphism in the direct repeat cluster of Mycobacterium tuberculosis;
application for strain differentiation by a novel typing method. Mol. Microbiol. 10,
1057-1065.
Guo, J.H., Xiang, W.L., Zhao, Q.R., Luo, T., Huang, M., Zhang, J., Zhao, J., Yang,
Z.R., Sun, Q., 2008. Molecular characterization of drug-resistant Mycobacterium
tuberculosis isolates from Sichuan Province in china. Jpn. J. Infect. Dis. 61, 264-268.
281
Gutacker, M.M., Mathema, B., Soini, H., Shashkina, E., Kreiswirth, B.N., Graviss,
E.A., Musser, J.M., 2006. Single-nucleotide polymorphism-based population genetic
analysis of Mycobacterium tuberculosis strains from 4 geographic sites. J. Infect. Dis.
193, 121-128.
Gutacker, M.M., Smoot, J.C., Migliaccio, C.A., Ricklefs, S.M., Hua, S., Cousins,
D.V., Graviss, E.A., Shashkina, E., Kreiswirth, B.N., Musser, J.M., 2002. Genome-
wide analysis of synonymous single nucleotide polymorphisms in Mycobacterium
tuberculosis complex organisms: resolution of genetic relationships among closely
related microbial strains. Genetics. 162, 1533-1543.
Hasan, Z., Tanveer, M., Kanji, A., Hasan, Q., Ghebremichael, S., Hasan, R., 2006.
Spoligotyping of Mycobacterium tuberculosis isolates from Pakistan reveals
predominance of Central Asian Strain 1 and Beijing isolates. J. Clin. Microbiol. 44,
1763-1768.
Hauck, F.R., Neese, B.H., Panchal, A.S., El-Amin, W., 2009. Identification and
management of latent tuberculosis infection. Am. Fam. Physician. 79, 879-886.
Hawkey, P.M., Smith, E.G., Evans, J.T., Monk, P., Bryan, G., Mohamed, H.H.,
Bardhan, M., Pugh, R.N., 2003. Mycobacterial interspersed repetitive unit typing of
Mycobacterium tuberculosis compared to IS6110-based restriction fragment length
polymorphism analysis for investigation of apparently clustered cases of tuberculosis.
J. Clin. Microbiol. 41, 3514-3520.
Hazbon, M.H., Brimacombe, M., Bobadilla del Valle, M., Cavatore, M., Guerrero,
M.I., Varma-Basil, M., Billman-Jacobe, H., Lavender, C., Fyfe, J., Garcia-Garcia, L.,
Leon, C.I., Bose, M., Chaves, F., Murray, M., Eisenach, K.D., Sifuentes-Osornio, J.,
Cave, M.D., Ponce de Leon, A., Alland, D., 2006. Population genetics study of
isoniazid resistance mutations and evolution of multidrug-resistant Mycobacterium
tuberculosis. Antimicrob. Agents. Chemother. 50, 2640-2649.
282
Heifets, L., Lindholm-Levy, P., 1989. Comparison of bactericidal activities of
streptomycin, amikacin, kanamycin, and capreomycin against Mycobacterium avium
and M. tuberculosis. Antimicrob. Agents. Chemother. 33, 1298-1301.
Hermans, P.W., van Soolingen, D., Bik, E.M., de Haas, P.E., Dale, J.W., van
Embden, J.D., 1991. Insertion element IS987 from Mycobacterium bovis BCG is
located in a hot-spot integration region for insertion elements in Mycobacterium
tuberculosis complex strains. Infect Immun 59, 2695-2705.
Hirano, K., Abe, C., Takahashi, M., 1999. Mutations in the rpoB gene of rifampin-
resistant Mycobacterium tuberculosis strains isolated mostly in Asian countries and
their rapid detection by line probe assay. J. Clin. Microbiol. 37, 2663-2666.
Hirsh, A.E., Tsolaki, A.G., DeRiemer, K., Feldman, M.W., Small, P.M., 2004. Stable
association between strains of Mycobacterium tuberculosis and their human host
populations. Proc. Natl. Acad. Sci. U. S. A. 101, 4871-4876.
Hong, X., Hopfinger, A.J., 2004. Molecular modeling and simulation of
Mycobacterium tuberculosis cell wall permeability. Biomacromolecules. 5, 1066-
1077.
Hu, Y., Hoffner, S., Jiang, W., Wang, W., Xu, B., 2010. Extensive transmission of
isoniazid resistant M. tuberculosis and its association with increased multidrug-
resistant TB in two rural counties of eastern China: a molecular epidemiological
study. BMC Infect. Dis. 10, 43.
Hughes, A.L., Friedman, R., Murray, M., 2002. Genomewide pattern of synonymous
nucleotide substitution in two complete genomes of Mycobacterium tuberculosis.
Emerg. Infect. Dis. 8, 1342-1346.
Hunter, P.R., Gaston, M.A., 1988. Numerical index of the discriminatory ability of
typing systems: an application of Simpson's index of diversity. J. Clin. Microbiol. 26,
2465-2466.
283
Iademarco, M.F., Castro, K.G., 2003. Epidemiology of tuberculosis. Semin. Respir.
Infect. 18, 225-240.
Imperiale, B.R., Zumarraga, M.J., Di Giulio, A.B., Cataldi, A.A., Morcillo, N.S.,
2013. Molecular and phenotypic characterisation of Mycobacterium tuberculosis
resistant to anti-tuberculosis drugs. Int. J. Tuberc. Lung. Dis. 17, 1088-1093.
Iseman, M.D., 1994. Evolution of drug-resistant tuberculosis: a tale of two species.
Proc. Natl. Acad. Sci. U. S. A. 91, 2428-2429.
Iseman, M.D., 2002. Tuberculosis therapy: past, present and future. Eur. Respir. J.
Suppl. 36, 87s-94s.
Ishihama, A., 1988. Promoter selectivity of prokaryotic RNA polymerases. Trends.
Genet. 4, 282-286.
Jansen, R., van Embden, J.D., Gaastra, W., Schouls, L.M., 2002. Identification of a
novel family of sequence repeats among prokaryotes. OMICS 6, 23-33.
Jassal, M.S., Bishai, W.R., 2010. Epidemiology and challenges to the elimination of
global tuberculosis. Clin. Infect. Dis. 50 Suppl 3, S156-164.
Javed, M.T., Aranaz, A., de Juan, L., Bezos, J., Romero, B., Alvarez, J., Lozano, C.,
Mateos, A., Dominguez, L., 2007. Improvement of spoligotyping with additional
spacer sequences for characterization of Mycobacterium bovis and M. caprae isolates
from Spain. Tuberculosis. (Edinb) 87, 437-445.
Jnawali, H.N., Hwang, S.C., Park, Y.K., Kim, H., Lee, Y.S., Chung, G.T., Choe,
K.H., Ryoo, S., 2013a. Characterization of mutations in multi- and extensive drug
resistance among strains of Mycobacterium tuberculosis clinical isolates in Republic
of Korea. Diagn Microbiol. Infect. Dis. 76, 187-196.
Jnawali, H.N., Yoo, H., Ryoo, S., Lee, K.J., Kim, B.J., Koh, W.J., Kim, C.K., Kim,
H.J., Park, Y.K., 2013b. Molecular genetics of Mycobacterium tuberculosis resistant
284
to aminoglycosides and cyclic peptide capreomycin antibiotics in Korea. World. J.
Microbiol. Biotechnol. 29, 975-982.
Johnson, R., Streicher, E.M., Louw, G.E., Warren, R.M., van Helden, P.D., Victor,
T.C., 2006. Drug resistance in Mycobacterium tuberculosis. Curr. Issues. Mol. Biol.
8, 97-111.
Johnston, D.E. and McClure, W.R., 1976. Abortive initiation of in vitro RNA
synthesis on bacteriophage lambda DNA polymerase. Cold Spring Harbor
Laboratory, New York.
Kamerbeek, J., Schouls, L., Kolk, A., van Agterveld, M., van Soolingen, D., Kuijper,
S., Bunschoten, A., Molhuizen, H., Shaw, R., Goyal, M., van Embden, J., 1997.
Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for
diagnosis and epidemiology. J. Clin. Microbiol. 35, 907-914.
Kapur, V., Li, L.L., Iordanescu, S., Hamrick, M.R., Wanger, A., Kreiswirth, B.N.,
Musser, J.M., 1994. Characterization by automated DNA sequencing of mutations in
the gene (rpoB) encoding the RNA polymerase beta subunit in rifampin-resistant
Mycobacterium tuberculosis strains from New York City and Texas. J. Clin.
Microbiol. 32, 1095-1098.
Kato-Maeda, M., Rhee, J.T., Gingeras, T.R., Salamon, H., Drenkow, J., Smittipat, N.,
Small, P.M., 2001. Comparing genomes within the species Mycobacterium
tuberculosis. Genome. Res. 11, 547-554.
Katsukawa, C., Tamaru, A., Miyata, Y., Abe, C., Makino, M., Suzuki, Y., 1997.
Characterization of the rpsL and rrs genes of streptomycin-resistant clinical isolates
of Mycobacterium tuberculosis in Japan. J. Appl. Microbiol. 83, 634-640.
Khoo, K.H., Douglas, E., Azadi, P., Inamine, J.M., Besra, G.S., Mikusova, K.,
Brennan, P.J., Chatterjee, D., 1996. Truncated structural variants of
285
lipoarabinomannan in ethambutol drug-resistant strains of Mycobacterium smegmatis.
Inhibition of arabinan biosynthesis by ethambutol. J. Biol. Chem. 271, 28682-28690.
Kiepiela, P., Bishop, K.S., Smith, A.N., Roux, L., York, D.F., 2000. Genomic
mutations in the katG, inhA and aphC genes are useful for the prediction of isoniazid
resistance in Mycobacterium tuberculosis isolates from Kwazulu Natal, South Africa.
Tuber. Lung. Dis. 80, 47-56.
Kim, B.J., Lee, K.H., Park, B.N., Kim, S.J., Park, E.M., Park, Y.G., Bai, G.H., Kook,
Y.H., 2001. Detection of rifampin-resistant Mycobacterium tuberculosis in sputa by
nested PCR-linked single-strand conformation polymorphism and DNA sequencing.
J. Clin. Microbiol. 39, 2610-2617.
Kim, S.J., 2005. Drug-susceptibility testing in tuberculosis: methods and reliability of
results. Eur. Respir. J. 25, 564-569.
Kolk, A.H., Kox, L.F., Kuijper, S., Richter, C., 1994. Detection of Mycobacterium
tuberculosis in peripheral blood. Lancet. 344, 694.
Kolk, A.H., Schuitema, A.R., Kuijper, S., van Leeuwen, J., Hermans, P.W., van
Embden, J.D., Hartskeerl, R.A., 1992. Detection of Mycobacterium tuberculosis in
clinical samples by using polymerase chain reaction and a nonradioactive detection
system. J. Clin. Microbiol. 30, 2567-2575.
Kovalev, S.Y., Kamaev, E.Y., Kravchenko, M.A., Kurepina, N.E., Skorniakov, S.N.,
2005. Genetic analysis of Mycobacterium tuberculosis strains isolated in Ural region,
Russian Federation, by MIRU-VNTR genotyping. Int. J. Tuberc. Lung. Dis. 9, 746-
752.
Kremer, K., van Soolingen, D., Frothingham, R., Haas, W.H., Hermans, P.W., Martin,
C., Palittapongarnpim, P., Plikaytis, B.B., Riley, L.W., Yakrus, M.A., Musser, J.M.,
van Embden, J.D., 1999. Comparison of methods based on different molecular
epidemiological markers for typing of Mycobacterium tuberculosis complex strains:
286
interlaboratory study of discriminatory power and reproducibility. J. Clin. Microbiol.
37, 2607-2618.
Kurbatova, E.V., Kaminski, D.A., Erokhin, V.V., Volchenkov, G.V., Andreevskaya,
S.N., Chernousova, L.N., Demikhova, O.V., Ershova, J.V., Kaunetis, N.V.,
Kuznetsova, T.A., Larionova, E.E., Smirnova, T.G., Somova, T.R., Vasilieva, I.A.,
Vorobieva, A.V., Zolkina, S.S., Cegielski, J.P., 2013. Performance of Cepheid (R)
Xpert MTB/RIF (R) and TB-Biochip (R) MDR in two regions of Russia with a high
prevalence of drug-resistant tuberculosis. Eur. J. Clin. Microbiol. Infect. Dis. 32, 735-
743.
Kwara, A., Schiro, R., Cowan, L.S., Hyslop, N.E., Wiser, M.F., Roahen Harrison, S.,
Kissinger, P., Diem, L., Crawford, J.T., 2003. Evaluation of the epidemiologic utility
of secondary typing methods for differentiation of Mycobacterium tuberculosis
isolates. J. Clin. Microbiol. 41, 2683-2685.
Landry, J., Menzies, D., 2008. Preventive chemotherapy. Where has it got us? Where
to go next? Int. J. Tuberc. Lung. Dis. 12, 1352-1364.
Laraque, F., Griggs, A., Slopen, M., Munsiff, S.S., 2009. Performance of nucleic acid
amplification tests for diagnosis of tuberculosis in a large urban setting. Clin. Infect.
Dis. 49, 46-54.
Larsen, M.H., Vilcheze, C., Kremer, L., Besra, G.S., Parsons, L., Salfinger, M.,
Heifets, L., Hazbon, M.H., Alland, D., Sacchettini, J.C., Jacobs, W.R., Jr., 2002.
Overexpression of inhA, but not kasA, confers resistance to isoniazid and
ethionamide in Mycobacterium smegmatis, M. bovis BCG and M. tuberculosis. Mol.
Microbiol. 46, 453-466.
Lawson, L., Yassin, M.A., Thacher, T.D., Olatunji, O.O., Lawson, J.O., Akingbogun,
T.I., Bello, C.S., Cuevas, L.E., Davies, P.D., 2008. Clinical presentation of adults with
pulmonary tuberculosis with and without HIV infection in Nigeria. Scand. J. Infect.
Dis. 40, 30-35.
287
Lawson, L., Zhang, J., Gomgnimbou, M.K., Abdurrahman, S.T., Le Moullec, S.,
Mohamed, F., Uzoewulu, G.N., Sogaolu, O.M., Goh, K.S., Emenyonu, N., Refregier,
G., Cuevas, L.E., Sola, C., 2012. A molecular epidemiological and genetic diversity
study of tuberculosis in Ibadan, Nnewi and Abuja, Nigeria. PLoS One 7, e38409.
Lee, A.S., Tang, L.L., Lim, I.H., Bellamy, R., Wong, S.Y., 2002. Discrimination of
single-copy IS6110 DNA fingerprints of Mycobacterium tuberculosis isolates by
high-resolution minisatellite-based typing. J. Clin. Microbiol. 40, 657-659.
Lemus, D., Martin, A., Montoro, E., Portaels, F., Palomino, J.C., 2004. Rapid
alternative methods for detection of rifampicin resistance in Mycobacterium
tuberculosis. J. Antimicrob. Chemother. 54, 130-133.
Lemus, D., Montoro, E., Echemendia, M., Martin, A., Portaels, F., Palomino, J.C.,
2006. Nitrate reductase assay for detection of drug resistance in Mycobacterium
tuberculosis: simple and inexpensive method for low-resource laboratories. J. Med.
Microbiol. 55, 861-863.
Leung, A.N., 1999. Pulmonary tuberculosis: the essentials. Radiology. 210, 307-322.
Leung, E.T., Ho, P.L., Yuen, K.Y., Woo, W.L., Lam, T.H., Kao, R.Y., Seto, W.H.,
Yam, W.C., 2006. Molecular characterization of isoniazid resistance in
Mycobacterium tuberculosis: identification of a novel mutation in inhA. Antimicrob.
Agents. Chemother. 50, 1075-1078.
Lin, S.Y., Probert, W., Lo, M., Desmond, E., 2004. Rapid detection of isoniazid and
rifampin resistance mutations in Mycobacterium tuberculosis complex from cultures
or smear-positive sputa by use of molecular beacons. J. Clin. Microbiol. 42, 4204-
4208.
Lipshutz, R.J., Morris, D., Chee, M., Hubbell, E., Kozal, M.J., Shah, N., Shen, N.,
Yang, R., Fodor, S.P., 1995. Using oligonucleotide probe arrays to access genetic
diversity. Biotechniques. 19, 442-447.
288
Liu, R.X., Li, Q.Z., Xing, L.L., Peng, Z., Zhu, C.M., Yang, Z.H., 2013. Genotyping of
clinical Mycobacterium tuberculosis isolates based on eight loci of MIRU-VNTR. Int.
J. Tuberc. Lung. Dis. 17, 243-245.
Loiez, C., Willery, E., Legrand, J.L., Vincent, V., Gutierrez, M.C., Courcol, R.J.,
Supply, P., 2006. Against all odds: molecular confirmation of an implausible case of
bone tuberculosis. Clin. Infect. Dis. 42, e86-88.
Lok, K.H., Benjamin, W.H., Jr., Kimerling, M.E., Pruitt, V., Mulcahy, D., Robinson,
N., Keenan, N.B., Dunlap, N.E., 2002. Molecular typing of Mycobacterium
tuberculosis strains with a common two-band IS6110 pattern. Emerg. Infect. Dis. 8,
1303-1305.
Luo, T., Zhao, M., Li, X., Xu, P., Gui, X., Pickerill, S., DeRiemer, K., Mei, J., Gao,
Q., 2010. Selection of mutations to detect multidrug-resistant Mycobacterium
tuberculosis strains in Shanghai, China. Antimicrob. Agents. Chemother. 54, 1075-
1081.
Mahmoudi, A., Iseman, M.D., 1993. Pitfalls in the care of patients with tuberculosis.
Common errors and their association with the acquisition of drug resistance. JAMA
270, 65-68.
Maiden, M.C., 2000. High-throughput sequencing in the population analysis of
bacterial pathogens of humans. Int. J. Med. Microbiol. 290, 183-190.
Mani, C., Selvakumar, N., Narayanan, S., Narayanan, P.R., 2001. Mutations in the
rpoB gene of multidrug-resistant Mycobacterium tuberculosis clinical isolates from
India. J. Clin. Microbiol. 39, 2987-2990.
Manjunath, N., Shankar, P., Rajan, L., Bhargava, A., Saluja, S., Shriniwas, 1991.
Evaluation of a polymerase chain reaction for the diagnosis of tuberculosis. Tubercle.
72, 21-27.
289
Mariam, D.H., Mengistu, Y., Hoffner, S.E., Andersson, D.I., 2004. Effect of rpoB
mutations conferring rifampin resistance on fitness of Mycobacterium tuberculosis.
Antimicrob. Agents. Chemother. 48, 1289-1294.
Martin, A., Herranz, M., Ruiz Serrano, M.J., Bouza, E., Garcia de Viedma, D., 2010.
The clonal composition of Mycobacterium tuberculosis in clinical specimens could be
modified by culture. Tuberculosis. (Edinb) 90, 201-207.
Martinez-Guarneros, A., Rastogi, N., Couvin, D., Escobar-Gutierrez, A., Rossi, L.M.,
Vazquez-Chacon, C.A., Rivera-Gutierrez, S., Lozano, D., Vergara-Castaneda, A.,
Gonzalez, Y.M.J.A., Vaughan, G., 2013. Genetic diversity among multidrug-resistant
Mycobacterium tuberculosis strains in Mexico. Infect. Genet. Evol. 14, 434-443.
Mathuria, J.P., Nath, G., Samaria, J.K., Anupurba, S., 2009. Molecular
characterization of INH-resistant Mycobacterium tuberculosis isolates by PCR-RFLP
and multiplex-PCR in North India. Infect. Genet. Evol. 9, 1352-1355.
Matsiota-Bernard, P., Vrioni, G., Marinis, E., 1998. Characterization of rpoB
mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from
Greece. J. Clin. Microbiol. 36, 20-23.
McAdam, R.A., Hermans, P.W., van Soolingen, D., Zainuddin, Z.F., Catty, D., van
Embden, J.D., Dale, J.W., 1990. Characterization of a Mycobacterium tuberculosis
insertion sequence belonging to the IS3 family. Mol. Microbiol. 4, 1607-1613.
McNabb, S.J., Braden, C.R., Navin, T.R., 2002. DNA fngerprinting of
Mycobacterium tuberculosis: lessons learned and implications for the future. Emerg.
Infect. Dis. 8, 1314-1319.
Meier, A., Sander, P., Schaper, K.J., Scholz, M., Bottger, E.C., 1996. Correlation of
molecular resistance mechanisms and phenotypic resistance levels in streptomycin-
resistant Mycobacterium tuberculosis. Antimicrob. Agents. Chemother. 40, 2452-
2454.
290
Mitchison, D.A., 2000. Role of individual drugs in the chemotherapy of tuberculosis.
Int J. Tuberc. Lung. Dis. 4, 796-806.
Mitchison, D.A., Nunn, A.J., 1986. Influence of initial drug resistance on the response
to short-course chemotherapy of pulmonary tuberculosis. Am. Rev. Respir. Dis. 133,
423-430.
Mokrousov, I., Narvskaya, O., Otten, T., Limeschenko, E., Steklova, L., Vyshnevskiy,
B., 2002. High prevalence of KatG Ser315Thr substitution among isoniazid-resistant
Mycobacterium tuberculosis clinical isolates from northwestern Russia, 1996 to 2001.
Antimicrob. Agents. Chemother. 46, 1417-1424.
Morcillo, N., Zumarraga, M., Alito, A., Dolmann, A., Schouls, L., Cataldi, A.,
Kremer, K., van Soolingen, D., 2002. A low cost, home-made, reverse-line blot
hybridisation assay for rapid detection of rifampicin resistance in Mycobacterium
tuberculosis. Int. J. Tuberc. Lung. Dis. 6, 959-965.
Medical Research Council (MRC). 1950. TREATMENT of pulmonary tuberculosis
with streptomycin and para-aminosalicylic acid; a Medical Research Council
investigation. Br. Med. J. 2, 1073-1085.
Musser, J.M., Kapur, V., Williams, D.L., Kreiswirth, B.N., van Soolingen, D., van
Embden, J.D., 1996. Characterization of the catalase-peroxidase gene (katG) and inhA
locus in isoniazid-resistant and -susceptible strains of Mycobacterium tuberculosis by
automated DNA sequencing: restricted array of mutations associated with drug
resistance. J. Infect. Dis. 173, 196-202.
Namaei, M.H., Sadeghian, A., Naderinasab, M., Ziaee, M., 2006. Prevalence of
primary drug resistant Mycobacterium tuberculosis in Mashhad, Iran. Indian. J. Med.
Res. 124, 77-80.
291
Naqvi, S.A., Naseer, M., Kazi, A., Pethani, A., Naeem, I., Zainab, S., Fatmi, Z., 2012.
Implementing a public-private mix model for tuberculosis treatment in urban
Pakistan: lessons and experiences. Int. J. Tuberc. Lung. Dis. 16, 817-821.
Narayanan, S., Gagneux, S., Hari, L., Tsolaki, A.G., Rajasekhar, S., Narayanan, P.R.,
Small, P.M., Holmes, S., Deriemer, K., 2008. Genomic interrogation of ancestral
Mycobacterium tuberculosis from south India. Infect. Genet. Evol. 8, 474-483.
Neonakis, I.K., Gitti, Z., Krambovitis, E., Spandidos, D.A., 2008. Molecular
diagnostic tools in mycobacteriology. J. Microbiol. Methods. 75, 1-11.
Neu, H.C., 1992. The crisis in antibiotic resistance. Science 257, 1064-1073.
Nusrath Unissa, A., Selvakumar, N., Narayanan, S., Narayanan, P.R., 2008.
Molecular analysis of isoniazid-resistant clinical isolates of Mycobacterium
tuberculosis from India. Int. J. Antimicrob. Agents. 31, 71-75.
Pai, M., Kalantri, S., Pascopella, L., Riley, L.W., Reingold, A.L., 2005.
Bacteriophage-based assays for the rapid detection of rifampicin resistance in
Mycobacterium tuberculosis: a meta-analysis. J. Infect. 51, 175-187.
Pai, M., Zwerling, A., Menzies, D., 2008. Systematic review: T-cell-based assays for
the diagnosis of latent tuberculosis infection: an update. Ann. Intern. Med. 149, 177-
184.
Palomino, J.C., 2005. Nonconventional and new methods in the diagnosis of
tuberculosis: feasibility and applicability in the field. Eur. Respir. J. 26, 339-350.
Palomino, J.C., Martin, A., Portaels, F., 2007. Rapid drug resistance detection in
Mycobacterium tuberculosis: a review of colourimetric methods. Clin. Microbiol.
Infect. 13, 754-762.
292
Palomino, J.C., Martin, A., Von Groll, A., Portaels, F., 2008. Rapid culture-based
methods for drug-resistance detection in Mycobacterium tuberculosis. J. Microbiol.
Methods. 75, 161-166.
Palys, T., Nakamura, L.K., Cohan, F.M., 1997. Discovery and classification of
ecological diversity in the bacterial world: the role of DNA sequence data. Int. J. Syst.
Bacteriol. 47, 1145-1156.
Perdigao, J., Macedo, R., Joao, I., Fernandes, E., Brum, L., Portugal, I., 2008.
Multidrug-resistant tuberculosis in Lisbon, Portugal: a molecular epidemiological
perspective. Microb. Drug. Resist. 14, 133-143.
Pitondo-Silva, A., Santos, A.C., Jolley, K.A., Leite, C.Q., Darini, A.L., 2013.
Comparison of three molecular typing methods to assess genetic diversity for
Mycobacterium tuberculosis. J. Microbiol. Methods. 93, 42-48.
Poudel, A., Maharjan, B., Nakajima, C., Fukushima, Y., Pandey, B.D., Beneke, A.,
Suzuki, Y., 2013. Characterization of extensively drug-resistant Mycobacterium
tuberculosis in Nepal. Tuberculosis. (Edinb) 93, 84-88.
Poulet, S., Cole, S.T., 1995. Characterization of the highly abundant polymorphic
GC-rich-repetitive sequence (PGRS) present in Mycobacterium tuberculosis. Arch.
Microbiol. 163, 87-95.
Pozzi, G., Meloni, M., Iona, E., Orru, G., Thoresen, O.F., Ricci, M.L., Oggioni, M.R.,
Fattorini, L., Orefici, G., 1999. rpoB mutations in multidrug-resistant strains of
Mycobacterium tuberculosis isolated in Italy. J. Clin. Microbiol. 37, 1197-1199.
Purwar, S., Chaudhari, S., Katoch, V.M., Sampath, A., Sharma, P., Upadhyay, P.,
Chauhan, D.S., 2011. Determination of drug susceptibility patterns and genotypes of
Mycobacterium tuberculosis isolates from Kanpur district, North India. Infect. Genet.
Evol. 11, 469-475.
293
Pym, A.S., Brodin, P., Majlessi, L., Brosch, R., Demangel, C., Williams, A., Griffiths,
K.E., Marchal, G., Leclerc, C., Cole, S.T., 2003. Recombinant BCG exporting ESAT-
6 confers enhanced protection against tuberculosis. Nat. Med. 9, 533-539.
Pym, A.S., Saint-Joanis, B., Cole, S.T., 2002. Effect of katG mutations on the
virulence of Mycobacterium tuberculosis and the implication for transmission in
humans. Infect. Immun. 70, 4955-4960.
Quemard, A., Lacave, C., Laneelle, G., 1991. Isoniazid inhibition of mycolic acid
synthesis by cell extracts of sensitive and resistant strains of Mycobacterium aurum.
Antimicrob. Agents. Chemother. 35, 1035-1039.
Quemard, A., Sacchettini, J.C., Dessen, A., Vilcheze, C., Bittman, R., Jacobs, W.R.,
Jr., Blanchard, J.S., 1995. Enzymatic characterization of the target for isoniazid in
Mycobacterium tuberculosis. Biochemistry. 34, 8235-8241.
Quy, H.T., Cobelens, F.G., Lan, N.T., Buu, T.N., Lambregts, C.S., Borgdorff, M.W.,
2006. Treatment outcomes by drug resistance and HIV status among tuberculosis
patients in Ho Chi Minh City, Vietnam. Int. J. Tuberc. Lung. Dis. 10, 45-51.
Rahim, Z., Zaman, K., van der Zanden, A.G., Mollers, M.J., van Soolingen, D.,
Raqib, R., Begum, V., Rigouts, L., Portaels, F., Rastogi, N., Sola, C., 2007.
Assessment of population structure and major circulating phylogeographical clades of
Mycobacterium tuberculosis complex in Bangladesh suggests a high prevalence of a
specific subclade of ancient M. tuberculosis genotypes. J. Clin. Microbiol. 45, 3791-
3794.
Rajapaksa, U.S., Victor, T.C., Perera, A.J., Warren, R.M., Senevirathne, S.M., 2008.
Molecular diversity of Mycobacterium tuberculosis isolates from patients with
pulmonary tuberculosis in Sri Lanka. Trans. R. Soc. Trop. Med. Hyg. 102, 997-1002.
Ramaswamy, S., Musser, J.M., 1998. Molecular genetic basis of antimicrobial agent
resistance in Mycobacterium tuberculosis: 1998 update. Tuber. Lung. Dis. 79, 3-29.
294
Ramaswamy, S.V., Dou, S.J., Rendon, A., Yang, Z., Cave, M.D., Graviss, E.A., 2004.
Genotypic analysis of multidrug-resistant Mycobacterium tuberculosis isolates from
Monterrey, Mexico. J. Med. Microbiol. 53, 107-113.
Rastogi, N., Legrand, E., Sola, C., 2001. The mycobacteria: an introduction to
nomenclature and pathogenesis. Rev. Sci. Tech. 20, 21-54.
Rattan, A., Kalia, A., Ahmad, N., 1998. Multidrug-resistant Mycobacterium
tuberculosis: molecular perspectives. Emerg. Infect. Dis. 4, 195-209.
Raviglione, M.C., Narain, J.P., Kochi, A., 1992. HIV-associated tuberculosis in
developing countries: clinical features, diagnosis, and treatment. Bull. World. Health.
Organ. 70, 515-526.
Reed, M.B., Domenech, P., Manca, C., Su, H., Barczak, A.K., Kreiswirth, B.N.,
Kaplan, G., Barry, C.E., 3rd, 2004. A glycolipid of hypervirulent tuberculosis strains
that inhibits the innate immune response. Nature. 431, 84-87.
Reichman, L.B., 1991. Dealing with the resurgence of tuberculosis. Am. Fam.
Physician. 43, 448.
Rodrigues, C.S., Shenai, S.V., Almeida, D., Sadani, M.A., Goyal, N., Vadher, C.,
Mehta, A.P., 2007. Use of bactec 460 TB system in the diagnosis of tuberculosis.
Indian. J. Med. Microbiol. 25, 32-36.
Ross, B.C., Raios, K., Jackson, K., Dwyer, B., 1992. Molecular cloning of a highly
repeated DNA element from Mycobacterium tuberculosis and its use as an
epidemiological tool. J. Clin. Microbiol. 30, 942-946.
Rossau, R., Traore, H., De Beenhouwer, H., Mijs, W., Jannes, G., De Rijk, P.,
Portaels, F., 1997. Evaluation of the INNO-LiPA Rif. TB assay, a reverse
hybridization assay for the simultaneous detection of Mycobacterium tuberculosis
295
complex and its resistance to rifampin. Antimicrob. Agents. Chemother. 41, 2093-
2098.
Rozwarski, D.A., Grant, G.A., Barton, D.H., Jacobs, W.R., Jr., Sacchettini, J.C., 1998.
Modification of the NADH of the isoniazid target (InhA) from Mycobacterium
tuberculosis. Science. 279, 98-102.
Sabouni, R., Kourout, M., Chaoui, I., Jordaan, A., Akrim, M., Victor, T., Maltouf
Filali, K., El Mzibri, M., Lahlou, O., El Aouad, R., 2008. Molecular analysis of
multidrug resistant Mycobacterium tuberculosis isolates from Morocco. Ann.
Microbiol. 58, 749-754.
Sadiq Noor Khan, S.N., Niemann, N., Gulfraz, M., Qayyum, M., Siddiqi, S., Mirza,
Z. S., Tahsin, S., Ebrahimi-Rad, M., Khanum, A. 2013. Molecular Characterization of
Multidrug-Resistant Isolates of Mycobacterium tuberculosis from Patients in Punjab,
Pakistan. Pak. J. Zool. 45, 93-100.
Safi, H., Sayers, B., Hazbon, M.H., Alland, D., 2008. Transfer of embB codon 306
mutations into clinical Mycobacterium tuberculosis strains alters susceptibility to
ethambutol, isoniazid, and rifampin. Antimicrob. Agents. Chemother. 52, 2027-2034.
Sajduda, A., Brzostek, A., Poplawska, M., Augustynowicz-Kopec, E., Zwolska, Z.,
Niemann, S., Dziadek, J., Hillemann, D., 2004. Molecular characterization of
rifampin- and isoniazid-resistant Mycobacterium tuberculosis strains isolated in
Poland. J. Clin. Microbiol. 42, 2425-2431.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Cold Spring Harbour Laboratory
Press, Cold Spring Harbour, New York, 2nd ed. Cold Spring Harbour Laboratory
Press, Cold Spring Harbour, New York.
Sandgren, A., Strong, M., Muthukrishnan, P., Weiner, B.K., Church, G.M., Murray,
M.B., 2009. Tuberculosis drug resistance mutation database. PLoS. Med. 6, e2.
296
Sankar, M.M., Singh, J., Diana, S.C., Singh, S., 2013. Molecular characterization of
Mycobacterium tuberculosis isolates from North Indian patients with extrapulmonary
tuberculosis. Tuberculosis (Edinb) 93, 75-83.
Saribas, Z., Kocagoz, T., Alp, A., Gunalp, A., 2003. Rapid detection of rifampin
resistance in Mycobacterium tuberculosis isolates by heteroduplex analysis and
determination of rifamycin cross-resistance in rifampin-resistant isolates. J. Clin.
Microbiol. 41, 816-818.
Savine, E., Warren, R.M., van der Spuy, G.D., Beyers, N., van Helden, P.D., Locht,
C., Supply, P., 2002. Stability of variable-number tandem repeats of mycobacterial
interspersed repetitive units from 12 loci in serial isolates of Mycobacterium
tuberculosis. J. Clin. Microbiol. 40, 4561-4566.
Schluger, N.W., Harkin, T. J., Rom, W. N., 1996. 1st ed. Little, Brown and Company,
New York, NY, USA.
Schroeder, E.K., Basso, L.A., Santos, D.S., de Souza, O.N., 2005. Molecular
dynamics simulation studies of the wild-type, I21V, and I16T mutants of isoniazid-
resistant Mycobacterium tuberculosis enoyl reductase (InhA) in complex with NADH:
toward the understanding of NADH-InhA different affinities. Biophys. J. 89, 876-884.
Scior, T., Meneses Morales, I., Garces Eisele, S.J., Domeyer, D., Laufer, S., 2002.
Antitubercular isoniazid and drug resistance of Mycobacterium tuberculosis-a review.
Arch. Pharm. (Weinheim) 335, 511-525.
Scorpio, A., Lindholm-Levy, P., Heifets, L., Gilman, R., Siddiqi, S., Cynamon, M.,
Zhang, Y., 1997. Characterization of pncA mutations in pyrazinamide-resistant
Mycobacterium tuberculosis. Antimicrob. Agents. Chemother. 41, 540-543.
Scorpio, A., Zhang, Y., 1996. Mutations in pncA, a gene encoding
pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug
pyrazinamide in tubercle bacillus. Nat. Med. 2, 662-667.
297
Seth, P., Ahuja, G.K., Bhanu, N.V., Behari, M., Bhowmik, S., Broor, S., Dar, L.,
Chakraborty, M., 1996. Evaluation of polymerase chain reaction for rapid diagnosis
of clinically suspected tuberculous meningitis. Tuber. Lung. Dis. 77, 353-357.
Shabbeer, A., Cowan, L.S., Ozcaglar, C., Rastogi, N., Vandenberg, S.L., Yener, B.,
Bennett, K.P., 2012. TB-Lineage: an online tool for classification and analysis of
strains of Mycobacterium tuberculosis complex. Infect. Genet. Evol. 12, 789-797.
Shamputa, I.C., Lee, J., Allix-Beguec, C., Cho, E.J., Lee, J.I., Rajan, V., Lee, E.G.,
Min, J.H., Carroll, M.W., Goldfeder, L.C., Kim, J.H., Kang, H.S., Hwang, S., Eum,
S.Y., Park, S.K., Lee, H., Supply, P., Cho, S.N., Via, L.E., Barry, C.E., 3rd, 2010.
Genetic diversity of Mycobacterium tuberculosis isolates from a tertiary care
tuberculosis hospital in South Korea. J. Clin. Microbiol. 48, 387-394.
Sharma, P., Chauhan, D.S., Upadhyay, P., Faujdar, J., Lavania, M., Sachan, S.,
Katoch, K., Katoch, V.M., 2008. Molecular typing of Mycobacterium tuberculosis
isolates from a rural area of Kanpur by spoligotyping and mycobacterial interspersed
repetitive units (MIRUs) typing. Infect. Genet. Evol. 8, 621-626.
Sharma, P., Kumar, B., Singhal, N., Katoch, V.M., Venkatesan, K., Chauhan, D.S.,
Bisht, D., 2010. Streptomycin induced protein expression analysis in Mycobacterium
tuberculosis by two-dimensional gel electrophoresis & mass spectrometry. Indian. J.
Med. Res. 132, 400-408.
Sharma, S.K., Mohan, A., 2004. Extrapulmonary tuberculosis. Indian. J. Med. Res.
120, 316-353.
Sheen, P., Mendez, M., Gilman, R.H., Pena, L., Caviedes, L., Zimic, M.J., Zhang, Y.,
Moore, D.A., Evans, C.A., 2009. Sputum PCR-single-strand conformational
polymorphism test for same-day detection of pyrazinamide resistance in tuberculosis
patients. J. Clin. Microbiol. 47, 2937-2943.
298
Shi, R., Zhang, J., Li, C., Kazumi, Y., Sugawara, I., 2007. Detection of streptomycin
resistance in Mycobacterium tuberculosis clinical isolates from China as determined
by denaturing HPLC analysis and DNA sequencing. Microbes. Infect. 9, 1538-1544.
Shikama Mde, L., Silva, R.R., Martins, M.C., Giampaglia, C.M., Oliveira, R.S., Silva,
R.F., Silva, P.F., Telles, M.A., Martin, A., Palomino, J.C., 2009. Rapid detection of
resistant tuberculosis by nitrate reductase assay performed in three settings in Brazil.
J. Antimicrob. Chemother. 64, 794-796.
Shoeb, H.A., Bowman, B.U., Jr., Ottolenghi, A.C., Merola, A.J., 1985. Peroxidase-
mediated oxidation of isoniazid. Antimicrob. Agents. Chemother. 27, 399-403.
Siddiqi, N., Shamim, M., Hussain, S., Choudhary, R.K., Ahmed, N., Prachee,
Banerjee, S., Savithri, G.R., Alam, M., Pathak, N., Amin, A., Hanief, M., Katoch,
V.M., Sharma, S.K., Hasnain, S.E., 2002. Molecular characterization of multidrug-
resistant isolates of Mycobacterium tuberculosis from patients in North India.
Antimicrob. Agents. Chemother. 46, 443-450.
Siddiqi, S., Ahmed, A., Asif, S., Behera, D., Javaid, M., Jani, J., Jyoti, A., Mahatre,
R., Mahto, D., Richter, E., Rodrigues, C., Visalakshi, P., Rusch-Gerdes, S., 2012.
Direct drug susceptibility testing of Mycobacterium tuberculosis for rapid detection of
multidrug resistance using the Bactec MGIT 960 system: a multicenter study. J. Clin.
Microbiol. 50, 435-440.
Singh, P., Mishra, A.K., Malonia, S.K., Chauhan, D.S., Sharma, V.D., Venkatesan,
K., Katoch, V.M., 2006. The paradox of pyrazinamide: an update on the molecular
mechanisms of pyrazinamide resistance in Mycobacteria. J. Commun. Dis. 38, 288-
298.
Singh, U.B., Suresh, N., Bhanu, N.V., Arora, J., Pant, H., Sinha, S., Aggarwal, R.C.,
Singh, S., Pande, J.N., Sola, C., Rastogi, N., Seth, P., 2004. Predominant tuberculosis
spoligotypes, Delhi, India. Emerg. Infect. Dis. 10, 1138-1142.
299
Slayden, R.A., Barry, C.E., 3rd, 2000. The genetics and biochemistry of isoniazid
resistance in Mycobacterium tuberculosis. Microbes. Infect. 2, 659-669.
Small, P.M., Hopewell, P.C., Singh, S.P., Paz, A., Parsonnet, J., Ruston, D.C.,
Schecter, G.F., Daley, C.L., Schoolnik, G.K., 1994. The epidemiology of tuberculosis
in San Francisco. A population-based study using conventional and molecular
methods. N. Engl. J. Med. 330, 1703-1709.
Small, P.M., Shafer, R.W., Hopewell, P.C., Singh, S.P., Murphy, M.J., Desmond, E.,
Sierra, M.F., Schoolnik, G.K., 1993. Exogenous reinfection with multidrug-resistant
Mycobacterium tuberculosis in patients with advanced HIV infection. N. Engl. J.
Med. 328, 1137-1144.
Smith, N.H., Dale, J., Inwald, J., Palmer, S., Gordon, S.V., Hewinson, R.G., Smith,
J.M., 2003. The population structure of Mycobacterium bovis in Great Britain: clonal
expansion. Proc. Natl. Acad. Sci. U. S. A. 100, 15271-15275.
Smith, N.H., Kremer, K., Inwald, J., Dale, J., Driscoll, J.R., Gordon, S.V., van
Soolingen, D., Hewinson, R.G., Smith, J.M., 2006. Ecotypes of the Mycobacterium
tuberculosis complex. J. Theor. Biol. 239, 220-225.
Smithwick, D.W., 1976. Laboratory manual for acid-fast microscopy, second ed. U.S.
Department of Health, Education, and Welfare CDC Atlanta, Georgia.
Somoskovi, A., Parsons, L.M., Salfinger, M., 2001. The molecular basis of resistance
to isoniazid, rifampin, and pyrazinamide in Mycobacterium tuberculosis. Respir. Res.
2, 164-168.
Spies, F.S., da Silva, P.E., Ribeiro, M.O., Rossetti, M.L., Zaha, A., 2008.
Identification of mutations related to streptomycin resistance in clinical isolates of
Mycobacterium tuberculosis and possible involvement of efflux mechanism.
Antimicrob. Agents. Chemother. 52, 2947-2949.
300
Spies, F.S., von Groll, A., Ribeiro, A.W., Ramos, D.F., Ribeiro, M.O., Dalla Costa,
E.R., Martin, A., Palomino, J.C., Rossetti, M.L., Zaha, A., da Silva, P.E., 2013.
Biological cost in Mycobacterium tuberculosis with mutations in the rpsL, rrs, rpoB,
and katG genes. Tuberculosis (Edinb) 93, 150-154.
Sreevatsan, S., Escalante, P., Pan, X., Gillies, D.A., 2nd, Siddiqui, S., Khalaf, C.N.,
Kreiswirth, B.N., Bifani, P., Adams, L.G., Ficht, T., Perumaalla, V.S., Cave, M.D.,
van Embden, J.D., Musser, J.M., 1996a. Identification of a polymorphic nucleotide in
oxyR specific for Mycobacterium bovis. J. Clin. Microbiol. 34, 2007-2010.
Sreevatsan, S., Pan, X., Stockbauer, K.E., Connell, N.D., Kreiswirth, B.N., Whittam,
T.S., Musser, J.M., 1997. Restricted structural gene polymorphism in the
Mycobacterium tuberculosis complex indicates evolutionarily recent global
dissemination. Proc. Natl. Acad. Sci. U. S. A. 94, 9869-9874.
Sreevatsan, S., Pan, X., Stockbauer, K.E., Williams, D.L., Kreiswirth, B.N., Musser,
J.M., 1996b. Characterization of rpsL and rrs mutations in streptomycin-resistant
Mycobacterium tuberculosis isolates from diverse geographic localities. Antimicrob.
Agents. Chemother. 40, 1024-1026.
Steingart, K.R., Henry, M., Ng, V., Hopewell, P.C., Ramsay, A., Cunningham, J.,
Urbanczik, R., Perkins, M., Aziz, M.A., Pai, M., 2006. Fluorescence versus
conventional sputum smear microscopy for tuberculosis: a systematic review. The.
Lancet. Infec. Dis. 6, 570-581.
Sukkasem, S., Yanai, H., Mahasirimongkol, S., Yamada, N., Rienthong, D.,
Palittapongarnpim, P., Khusmith, S., 2013. Drug resistance and IS6110-RFLP patterns
of Mycobacterium tuberculosis in patients with recurrent tuberculosis in northern
Thailand. Microbiol. Immunol. 57, 21-29.
Sun, Z., Chao, Y., Zhang, X., Zhang, J., Li, Y., Qiu, Y., Liu, Y., Nie, L., Guo, A., Li,
C., 2008. Characterization of extensively drug-resistant Mycobacterium tuberculosis
clinical isolates in China. J. Clin. Microbiol. 46, 4075-4077.
301
Supply, P., Allix, C., Lesjean, S., Cardoso-Oelemann, M., Rusch-Gerdes, S., Willery,
E., Savine, E., de Haas, P., van Deutekom, H., Roring, S., Bifani, P., Kurepina, N.,
Kreiswirth, B., Sola, C., Rastogi, N., Vatin, V., Gutierrez, M.C., Fauville, M.,
Niemann, S., Skuce, R., Kremer, K., Locht, C., van Soolingen, D., 2006. Proposal for
standardization of optimized mycobacterial interspersed repetitive unit-variable-
number tandem repeat typing of Mycobacterium tuberculosis. J. Clin. Microbiol. 44,
4498-4510.
Supply, P., Lesjean, S., Savine, E., Kremer, K., van Soolingen, D., Locht, C., 2001.
Automated high-throughput genotyping for study of global epidemiology of
Mycobacterium tuberculosis based on mycobacterial interspersed repetitive units. J.
Clin. Microbiol. 39, 3563-3571.
Supply, P., Mazars, E., Lesjean, S., Vincent, V., Gicquel, B., Locht, C., 2000a.
Variable human minisatellite-like regions in the Mycobacterium tuberculosis genome.
Mol. Microbiol. 36, 762-771.
Supply, P., Warren, R.M., Banuls, A.L., Lesjean, S., Van Der Spuy, G.D., Lewis,
L.A., Tibayrenc, M., Van Helden, P.D., Locht, C., 2003. Linkage disequilibrium
between minisatellite loci supports clonal evolution of Mycobacterium tuberculosis in
a high tuberculosis incidence area. Mol. Microbiol. 47, 529-538.
Takayama, K., Kilburn, J.O., 1989. Inhibition of synthesis of arabinogalactan by
ethambutol in Mycobacterium smegmatis. Antimicrob. Agents. Chemother. 33, 1493-
1499.
Tan, Y., Hu, Z., Zhang, T., Cai, X., Kuang, H., Liu, Y., Chen, J., Yang, F., Zhang, K.,
Tan, S., Zhao, Y., 2013. Role of pncA and rpsA Gene Sequencing in Diagnosis of
Pyrazinamide Resistance in Mycobacterium tuberculosis Isolates from Southern
China. J. Clin. Microbiol. 52, 291-297.
Tanaka, M.M., Francis, A.R., 2006. Detecting emerging strains of tuberculosis by
using spoligotypes. Proc. Natl. Acad. Sci. U. S. A. 103, 15266-15271.
302
Tang, K., Sun, H., Zhao, Y., Guo, J., Zhang, C., Feng, Q., He, Y., Luo, M., Li, Y.,
Sun, Q., 2013. Characterization of rifampin-resistant isolates of Mycobacterium
tuberculosis from Sichuan in China. Tuberculosis (Edinb) 93, 89-95.
Tang, Y.-W., Stratton, C.W., 2007. In Advanced Techniques in Diagnostic
Microbiology Springer US, p. 387.
Tansuphasiri, U., Subpaiboon, S., Rienthong, S., 2001. Comparison of the resistance
ratio and proportion methods for antimicrobial susceptibility testing of
Mycobacterium tuberculosis. J. Med. Assoc. Thai. 84, 1467-1476.
Tanveer, M., Hasan, Z., Siddiqui, A.R., Ali, A., Kanji, A., Ghebremicheal, S., Hasan,
R., 2008. Genotyping and drug resistance patterns of M. tuberculosis strains in
Pakistan. BMC Infect. Dis. 8, 171.
Telenti, A., Honore, N., Bernasconi, C., March, J., Ortega, A., Heym, B., Takiff, H.E.,
Cole, S.T., 1997. Genotypic assessment of isoniazid and rifampin resistance in
Mycobacterium tuberculosis: a blind study at reference laboratory level. J. Clin.
Microbiol. 35, 719-723.
Telenti, A., Imboden, P., Marchesi, F., Lowrie, D., Cole, S., Colston, M.J., Matter, L.,
Schopfer, K., Bodmer, T., 1993. Detection of rifampicin-resistance mutations in
Mycobacterium tuberculosis. Lancet 341, 647-650.
Telenti, A., Persing, D.H., 1996. Novel strategies for the detection of drug resistance
in Mycobacterium tuberculosis. Res. Microbiol. 147, 73-79.
Tessema, B., Beer, J., Merker, M., Emmrich, F., Sack, U., Rodloff, A.C., Niemann,
S., 2013. Molecular epidemiology and transmission dynamics of Mycobacterium
tuberculosis in Northwest Ethiopia: new phylogenetic lineages found in Northwest
Ethiopia. BMC Infect. Dis. 13, 131.
303
Thierry, D., Brisson-Noel, A., Vincent-Levy-Frebault, V., Nguyen, S., Guesdon, J.L.,
Gicquel, B., 1990a. Characterization of a Mycobacterium tuberculosis insertion
sequence, IS6110, and its application in diagnosis. J. Clin. Microbiol. 28, 2668-2673.
Thierry, D., Cave, M.D., Eisenach, K.D., Crawford, J.T., Bates, J.H., Gicquel, B.,
Guesdon, J.L., 1990b. IS6110, an IS-like element of Mycobacterium tuberculosis
complex. Nucleic. Acids. Res. 18, 188.
Todar, K., 2009. Mycobacterium tuberculosis and Tuberculosis. In Todar’s Online
Textbook of Bacteriology.
Tracevska, T., Jansone, I., Nodieva, A., Marga, O., Skenders, G., Baumanis, V., 2004.
Characterisation of rpsL, rrs and embB mutations associated with streptomycin and
ethambutol resistance in Mycobacterium tuberculosis. Res. Microbiol. 155, 830-834.
Tubulekas, I., Hughes, D., 1993. Suppression of rpsL phenotypes by tuf mutations
reveals a unique relationship between translation elongation and growth rate. Mol.
Microbiol. 7, 275-284.
Tudo, G., Rey, E., Borrell, S., Alcaide, F., Codina, G., Coll, P., Martin-Casabona, N.,
Montemayor, M., Moure, R., Orcau, A., Salvado, M., Vicente, E., Gonzalez-Martin,
J., 2010. Characterization of mutations in streptomycin-resistant Mycobacterium
tuberculosis clinical isolates in the area of Barcelona. J. Antimicrob. Chemother. 65,
2341-2346.
Valcheva, V., Mokrousov, I., Narvskaya, O., Rastogi, N., Markova, N., 2008. Utility
of new 24-locus variable-number tandem-repeat typing for discriminating
Mycobacterium tuberculosis clinical isolates collected in Bulgaria. J. Clin. Microbiol.
46, 3005-3011.
Vall-Spinosa, A., Lester, W., Moulding, T., Davidson, P.T., McClatchy, J.K., 1970.
Rifampin in the treatment of drug-resistant Mycobacterium tuberculosis infections. N
Engl. J. Med. 283, 616-621.
304
van der Zanden, A.G., Kremer, K., Schouls, L.M., Caimi, K., Cataldi, A., Hulleman,
A., Nagelkerke, N.J., van Soolingen, D., 2002. Improvement of differentiation and
interpretability of spoligotyping for Mycobacterium tuberculosis complex isolates by
introduction of new spacer oligonucleotides. J. Clin. Microbiol. 40, 4628-4639.
van Embden, J.D., Cave, M.D., Crawford, J.T., Dale, J.W., Eisenach, K.D., Gicquel,
B., Hermans, P., Martin, C., McAdam, R., Shinnick, T.M., et al., 1993. Strain
identification of Mycobacterium tuberculosis by DNA fingerprinting:
recommendations for a standardized methodology. J. Clin. Microbiol. 31, 406-409.
van Embden, J.D., van Gorkom, T., Kremer, K., Jansen, R., van Der Zeijst, B.A.,
Schouls, L.M., 2000. Genetic variation and evolutionary origin of the direct repeat
locus of Mycobacterium tuberculosis complex bacteria. J. Bacteriol. 182, 2393-2401.
van Soolingen, D., de Haas, P.E., Hermans, P.W., Groenen, P.M., van Embden, J.D.,
1993. Comparison of various repetitive DNA elements as genetic markers for strain
differentiation and epidemiology of Mycobacterium tuberculosis. J. Clin. Microbiol.
31, 1987-1995.
van Soolingen, D., Qian, L., de Haas, P.E., Douglas, J.T., Traore, H., Portaels, F.,
Qing, H.Z., Enkhsaikan, D., Nymadawa, P., van Embden, J.D., 1995. Predominance
of a single genotype of Mycobacterium tuberculosis in countries of east Asia. J. Clin.
Microbiol. 33, 3234-3238.
Varma-Basil, M., Kumar, S., Arora, J., Angrup, A., Zozio, T., Banavaliker, J.N.,
Singh, U.B., Rastogi, N., Bose, M., 2011. Comparison of spoligotyping,
mycobacterial interspersed repetitive units typing and IS6110-RFLP in a study of
genotypic diversity of Mycobacterium tuberculosis in Delhi, North India. Mem. Inst.
Oswaldo. Cruz. 106, 524-535.
Verma, J.S., Rawat, D., Hasan, A., Capoor, M.R., Gupta, K., Deb, M., Aggarwal, P.,
Nair, D., 2010. The use of E-test for the drug susceptibility testing of Mycobacterium
tuberculosis - a solution or an illusion? Indian. J. Med. Microbiol. 28, 30-33.
305
Vilcheze, C., Jacobs, W.R., Jr., 2007. The mechanism of isoniazid killing: clarity
through the scope of genetics. Annu. Rev. Microbiol. 61, 35-50.
Viveiros, M., Leandro, C., Rodrigues, L., Almeida, J., Bettencourt, R., Couto, I.,
Carrilho, L., Diogo, J., Fonseca, A., Lito, L., Lopes, J., Pacheco, T., Pessanha, M.,
Quirim, J., Sancho, L., Salfinger, M., Amaral, L., 2005. Direct application of the
INNO-LiPA Rif.TB line-probe assay for rapid identification of Mycobacterium
tuberculosis complex strains and detection of rifampin resistance in 360 smear-
positive respiratory specimens from an area of high incidence of multidrug-resistant
tuberculosis. J. Clin. Microbiol. 43, 4880-4884.
Watterson, S.A., Wilson, S.M., Yates, M.D., Drobniewski, F.A., 1998. Comparison of
three molecular assays for rapid detection of rifampin resistance in Mycobacterium
tuberculosis. J. Clin. Microbiol. 36, 1969-1973.
Wengenack, N.L., Rusnak, F., 2001. Evidence for isoniazid-dependent free radical
generation catalyzed by Mycobacterium tuberculosis KatG and the isoniazid-resistant
mutant KatG(S315T). Biochemistry. 40, 8990-8996.
WHO, 2010. Treatment of tuberculosis, Guidlines. World Health Organization,
Geneva, Switzerland.
WHO, 2012. Global tuberculosis report 2012. World Health Organization, Avenue
Appia, 1211 Geneva 27, Switzerland.
WHO, 2013a. Global tuberculosis report 2013. World Health Organization, Avenue
Appia, 1211 Geneva 27, Switzerland.
WHO, 2013b. Global tuberculosis Report, 2013, Avenue Appia, 1211 Geneva 27,
Switzerland.
WHO, 2013c. Multidrug-resistant tuberculosis (MDR-TB) 2013 update. World Health
Organization, Geneva, Switzerland.
306
Wolucka, B.A., McNeil, M.R., de Hoffmann, E., Chojnacki, T., Brennan, P.J., 1994.
Recognition of the lipid intermediate for arabinogalactan/arabinomannan biosynthesis
and its relation to the mode of action of ethambutol on mycobacteria. J. Biol. Chem.
269, 23328-23335.
Wong, K.W., D'Amico, D.J., Oum, B.S., Baker, P.A., Kenyon, K.R., 1990.
Intraocular penetration of rifampin after oral administration. Graefes. Arch. Clin. Exp.
Ophthalmol. 228, 40-43.
Yagupsky, P.V., Kaminski, D.A., Palmer, K.M., Nolte, F.S., 1990. Cord formation in
BACTEC 7H12 medium for rapid, presumptive identification of Mycobacterium
tuberculosis complex. J. Clin. Microbiol. 28, 1451-1453.
Yajko, D.M., Madej, J.J., Lancaster, M.V., Sanders, C.A., Cawthon, V.L., Gee, B.,
Babst, A., Hadley, W.K., 1995. Colorimetric method for determining MICs of
antimicrobial agents for Mycobacterium tuberculosis. J. Clin. Microbiol. 33, 2324-
2327.
Yang, Z.H., Ijaz, K., Bates, J.H., Eisenach, K.D., Cave, M.D., 2000. Spoligotyping
and polymorphic GC-rich repetitive sequence fingerprinting of Mycobacterium
tuberculosis strains having few copies of IS6110. J. Clin. Microbiol. 38, 3572-3576.
Yew, W.W., 1999. Directly observed therapy, short-course: the best way to prevent
multidrug-resistant tuberculosis. Chemotherapy. 45 Suppl 2, 26-33.
Yew, W.W., Leung, C.C., 2008. Management of multidrug-resistant tuberculosis:
Update 2007. Respirology 13, 21-46.
Yuan, X., Zhang, T., Kawakami, K., Zhu, J., Li, H., Lei, J., Tu, S., 2012. Molecular
characterization of multidrug- and extensively drug-resistant Mycobacterium
tuberculosis strains in Jiangxi, China. J. Clin. Microbiol. 50, 2404-2413.
307
Yuen, L.K., Leslie, D., Coloe, P.J., 1999. Bacteriological and molecular analysis of
rifampin-resistant Mycobacterium tuberculosis strains isolated in Australia. J. Clin.
Microbiol. 37, 3844-3850.
Zabaleta-Vanegas, A.P., Llerena-Polo, C., Orjuela-Gamboa, D.L., Valbuena-Arias,
Y.A., Garcia-Gonzalez, L.M., Mejia-Restrepo, G., Bueno, J., Garzon-Torres, M.C.,
2013. Evaluation of BACTEC MGIT 960 and the nitrate reductase assay in the
National Laboratory Network of Colombia. Int. J. Tuberc. Lung. Dis. 17, 125-128.
Zainuddin, Z.F., Dale, J.W., 1989. Polymorphic repetitive DNA sequences in
Mycobacterium tuberculosis detected with a gene probe from a Mycobacterium
fortuitum plasmid. J. Gen. Microbiol. 135, 2347-2355.
Zhang, D., An, J., Wang, J., Hu, C., Wang, Z., Zhang, R., Wang, Y., Pang, Y., 2013.
Molecular typing and drug susceptibility of Mycobacterium tuberculosis isolates from
Chongqing Municipality, China. Infect. Genet. Evol. 13, 310-316.
Zhang, J., Abadia, E., Refregier, G., Tafaj, S., Boschiroli, M.L., Guillard, B.,
Andremont, A., Ruimy, R., Sola, C., 2010. Mycobacterium tuberculosis complex
CRISPR genotyping: improving efficiency, throughput and discriminative power of
'spoligotyping' with new spacers and a microbead-based hybridization assay. J. Med.
Microbiol. 59, 285-294.
Zhang, M., Yue, J., Yang, Y.P., Zhang, H.M., Lei, J.Q., Jin, R.L., Zhang, X.L., Wang,
H.H., 2005. Detection of mutations associated with isoniazid resistance in
Mycobacterium tuberculosis isolates from China. J. Clin. Microbiol. 43, 5477-5482.
Zhang, Y., Garbe, T., Young, D., 1993. Transformation with katG restores isoniazid-
sensitivity in Mycobacterium tuberculosis isolates resistant to a range of drug
concentrations. Mol. Microbiol. 8, 521-524.
Zhang, Y., Heym, B., Allen, B., Young, D., Cole, S., 1992. The catalase-peroxidase
gene and isoniazid resistance of Mycobacterium tuberculosis. Nature 358, 591-593.
308
Zhang, Y., Young, D., 1994. Molecular genetics of drug resistance in Mycobacterium
tuberculosis. J. Antimicrob. Chemother. 34, 313-319.
Zimhony, O., Vilcheze, C., Jacobs, W.R., Jr., 2004. Characterization of
Mycobacterium smegmatis expressing the Mycobacterium tuberculosis fatty acid
synthase I (fas1) gene. J. Bacteriol. 186, 4051-4055.
309
APPENDIX I
All chemicals used in this study were of analytical or molecular biology grade.
Acrylamide/bis-acrylamide stock (30:0.4)
Acrylamide 30g
Bis-acrylamide 0.4g
Double distilled water up to 100 mL
Both constituents were dissolved in 70 mL of water using magnetic stirring and the
volume was adjusted up to 100 mL with double distilled water.
10% Ammonium per sulphate
Ammonium per sulphate 0.1 g
Double distilled water up to 1mL
Ampicillin
Ampicillin 100 mg
Double distilled water 1 mL
Ampicillin was mixed insterile double distilled water and stored at -20°C in small
aliquots.
10X Blocking / Washing buffer (Fermantas Cat # K0662)
10X Blocking / Washing buffer 10 mL
Distilled water 90 mL
Once prepared it was stored at 4ºC for no longer than one week.
Blocking Solution (Fermantas Cat # K0662)
Blocking reagent 0.25 g
1X Blocking / washing buffer 25 mL
Blocking reagent was dissolved in the blocking/washing buffer. The suspension was
stirred on magnetic stirrer at 50-60°C until the blocking reagent got completely
dissolved. Once prepared, the blocking solution was stored at -20°C.
310
5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (Xgal)
Xgal 20 mg
DMSO 1 mL
Xgal was mixed thoroughly in DMSO, wrapped with foil and stored at -20°C in small
aliquots.
10X Buffer Q
950 mM Tris-HCl (pH 8.75) 2.1 mL
3M KCl 0.3 mL
2M (NH4)2SO4 0.5 mL
1M MgSO4 0.2 mL
1M MgCl2 0.15 mL
100X Triton 0.1 mL
Milli Q water up to 10 mL
All the reagents were mixed thoroughly and then final volume was adjusted to 10 mL
with MilliQ water.
Coupling of oligonucleotides
0.1mM Oligonucleotide 3 µL each
Microspheres 3.0 µL each
0.1M CaCl2
CaCl2 2.92 g
Double distilled water up to 200 mL
2.92 g of CaCl2 was dissolved in 180 mL of double distilled water. The volume was
adjusted to 200 mLwith double distilled water and autoclaved. CaCl2 solution was
always prepared fresh.
24:1 Chloroform/isoamyl alcohol
Chloroform 24 mL
Isoamyl alcohol 1.0 mL
311
24 mL of chloroform was mixed with 1 mL of isoamyl alcohol to prepare 24:1
chloroform/isoamyl alcohol.
CTAB/NaCl solution
Sodium chloride (NaCl) 4.1 g
CTAB
(N-cetyl-N,N,N,-trimethylammonium bromide) 10.0 g
4.1 g NaCl was dissolved in 80 mL of double distilled water. While stirring at 65°C,
10 g of CTAB was added. Volume was adjusted to 100 mL with distilled water and
then stored at room temperature for no longer than 6 months.
Deionized formamide
Formamide 50 mL
Mixed bed ion exchange resin (Amberlite® MB-1) 5 g
Whatman No.1 filter paper as required
Method
Amberlite® MB-1 was added in formamide and the mix was stirred using magnetic
stirrer for 30 min. After 30 minutes. formamide was filtered twice with Whatman No.
1 filter paper and was stored at -20oC in small aliquots till further use for no longer
than 6 months.
Detection buffer
10X Detection buffer 2.5 mL
Double distilled water 22.5 mL
This was 10 times dilution of 10Xdetection buffer in double distilled water. Once
prepared, it was stored at 4°C for no longer than one week.
50X Denhardt’s solution
Ficoll 400 10 g
Polyvinylpyrolidone 10 g
Bovine serum albumin (BSA) 10 g
312
All the constituents were mixed in 900 mL of double distilled water and the volume
was made up to 1000 mL. The solution was filtered through 0.2µm pore size filter and
stored at -20oC in aliquots.
Denaturing dye
Deionized formamide 48µL
Bromophenol Blue 0.025%
Deionized water 147µL
All these constituents were thoroughly mixed to form denaturation dye. It was always
prepared fresh.
Digestion buffer (for DNA extraction from blood)
Tris 6.05 g
0.5 M EDTA 400 µL
5 M NaCl l20 µL
10% SDS 1.0 mL
Water up to 10 mL
All the constituents were mixed and pH was adjusted to 9.0 with concentrated HCl.
Double distilled water was added to make a final volume of 10 mL. Digestion buffer
was always prepared fresh before use.
10X Digestion buffer (for liquefication of sputum)
Proteinase K (10 mg/mL) 100 µL
Tween 20 50 µL
Tris HCl (200 mM, pH 8.3) 850 mL
All the constituents were mixed thoroughly. Digestion buffer was always prepared
fresh.
Digestion solution (NaOH/N-acetyl-L-cysteine solution)
4% NaOH 50 mL
0.1 M Trisodium citrate 50 mL
N-acetyl-L-cysteine 1 g
313
All the above constituents were mixed and the solution was stored at room
temperature.
DNA Tracking Dye
Method 1
Bromophenol blue 0.025 %
Sucrose 40.0 %
Double distilled water up to 10 mL
All the ingredients were mixed in approximately 8 mL of water and then the final
volume was adjusted to 10 mLwith water.
Method 2
Bromophenol blue 0.009 g
Glycerol 6 mL
60 mM EDTA 1800 µL
Double distilled water up to 10 mL
All the ingredients were mixed in approximately 8 mL of water and then the final
volume was adjusted to 10 mL with water.
Drawing ink working solution
Drawing ink 10 µL
2X SSPE 990 µL
The solution was stored at room temperature for no longer than one year
0.5M Ethylenediaminetetraacetic acid (EDTA)
EDTA.2H2O 186.1 g
10 M NaOH ~50mL
Double distilled water up to 1000 mL
EDTA was dissolved in approximately 700 mL of double distilled water and pH was
adjusted to 8.0 with 10 M NaOH (~50mL). The final volume was made up to 1000
mL.
314
Equilibrated buffered phenol
1M Tris-HCl
Tris base 121 g
Conc. HCl 43 mL
Double distilled water up to 1000 mL
Tris-base was dissolved in 800 mL of double distilled water and the pH was adjusted
to 8.0 by adding ~43 mL of concentrated HCl. The final volume of the solution was
made up to 1000 mL and the solution was autoclaved.
8-hydroxy-quinoline 250 g
Phenol 250 mL
Method
Redistilled phenol was melted at 65-68oC in water bath. 250 mg of 8-
hydroxyquinoline was added in 250 mL of 1M Tris and stirred well. This solution was
added to phenol and mixed thoroughly for 2-3 hours. Phenol-Tris solution was
allowed to stand for half an hour. Upper aqueous phase was decanted and the pH was
checked. Equal volume (250 mL) of 1M Tris (pH 8.0) was added to the phenol, shook
thoroughly and allowed to stand for half an hour. The upper phase was decanted and
the pH was checked. 250 mL of 0.1M Tris was added to the solution and mixed
thoroughly and allowed to stand for 30-60 minutes. The pH was checked and the
upper phase was discarded and this step was repeated. 250 mL of 0.1 M Tris (pH 8.0)
with 0.2% β-mercaptoethanol was added and the solution was mixed and allowed to
stand for 1 hour. Final pH of the buffer should be 7.9. The buffered phenol was stored
at 4oC in dark brown bottle.
70% Ethanol
Absolute ethanol 70 mL
Double distilled water 30 mL
315
7 volumes of ethanol were mixed with 3 volumes of distilled water and stored at room
temperature.
Ethidium Bromide (10%w/v)
Ethidium bromide 0.2 g
Double distilled water up to 20 mL
Ethidium bromide was mixed in approximately 18 mL of double distilled water and
final volume was adjusted to 20 mL. Ethidium bromide is a carcinogen and should be
handled with care.
10% HCl
HCl 27 mL
Double distilled water up to 100 mL
81.9 mL HCl was mixed in water and volume was adjusted up to 100 mL to make
10% HCl solution.
1M Isopropyl Thio-beta-D-Galactoside (IPTG)
IPTG 0.23 g
Double distilled water up to 10 mL
IPTG was thoroughly mixed in 7 ml of water and final volume was made up to 10mL
with sterile double distilled water. Solution wasfilteredwith a 0.22micron syringe
filter and stored at -20°C in small aliquots.
Lowenstein Jenson medium
Lowenstein Jenson media 6.2 g
Glycerol 2 mL
Eggs 2
Double distilled water 100 mL
Method
6.2 g of LJ media was dissolved in 100 mL of water and 2 mL of glycerol was also
added in the solution. To homogenize the eggs, crystal beads were taken in another
glass flask. LJ medium flask, crystal beads flask and the McCartney vials were
316
autoclaved at 121°C for one hour and cooled to room temperature. Two eggs that
were not more than 7 days old were taken and cleaned by scrubbing thoroughly with a
hand brush in warm water and wiped with 70% ethanol. Eggs were cracked carefully
in the flask that contained crystal beads preventing the egg shells to drop in the flask.
Complete homogenization of the eggs was performed by stirring. Homogenized eggs
were added in the LJ medium slowly and mixed well. The slurry like medium was
poured in the McCartney vials and the vials were placed in the slanted position in pre-
warmed incubator at 80°C for 45 minutes. After coagulation, all the LJ slants were
incubated at 37°C for 14 hours to check the sterility of the media. The media vials
were labelled with date and stored in refrigerator.
Luria Bertani (LB) agar media
Bacto-tryptone 10 g
Yeast extract 5 g
NaCl 10 g
Agar 15 g
The above constituents were mixed in 800 mL of double distilled water and the pH
was adjusted to 7.5. 15g agar was added to it and the volume of the solution was made
up to 1000 mL. the solution was autoclaved and stored at room temperature.
Luria Bertani (LB) Broth
Bacto-tryptone 10 g
Yeast extract 5 g
NaCl 10 g
The above constituents were mixed in 800 mL of double distilled water and the pH
was adjusted to 7.5. Volume of the solution was made up to 1000 mLwith double
distilled water and autoclaved.
Lysis solution
NaOH 0.8 g
SDS 1.0 %
317
Both constituents were dissolved in 80 mL of double distilled water and the final
volume was adjusted to 100 mL. Solution was stored at room temperature.
Lysozyme solution
Lysozyme 100 mg
Double distilled water 10 mL
Lysozyme was added in double distilled water and mixed. Prepared solution was
stored in small aliquots at -20°C for no longer than one year.
0.1M MgCl2
MgCl2 1.90 g
Double distilled water up to 200 mL
1.90 g of MgCl2 was dissolved in 180 mL of double distilled water.Volume was
adjusted to 200 mL with double distilled water and autoclaved. MgCl2 solution was
always prepared fresh.
0.1M (MES)(2-(N-morpholinoethanesulfonic acid))(pH 4.5)
2.12 g of MES buffer was dissolved in 90 mL of water, pH was adjusted to 4.5 with
NaOH and final volume was made up to 100 mL with milliQ water.
N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide EDC (10mg/mL) 5.0 µL
0.02% Tween 20 1.0 mL
0.1% SDS 1.0 mL
TE (pH 8.0) 100 µL
Neutralization solution
Potassium acetate 147 g
Glacial acetic acid to adjust pH
Double distilled water up to 500 mL
318
147 g of potassium acetate was dissolved in 450 mL of double distilled water and the
pH was adjusted to 5. The volume of the solution was made up to 500 mL with sterile
double distilled water.
Phenol dye
Phenol dye 0.05 g
Double distilled water up to 100 mL
Phenol dye was dissolved in 80 mL of water and the volume of the solution was
adjusted to 100 mL with double distilled water.
Pre-hybridization solution
20X SSC 30 mL
50X Denhardt’s solution 10 mL
10% SDS 1.0 mL
Deionized formamide 50 mL
Distilled water up to 100 mL
All the ingredients were mixed and the final volume of the solution was adjusted up to
100 mL. The solution was stored at -20ºC in aliquots.
Resuspension solution
25 mM Tris HCl (pH 8.0) 2.5 mL
10 mM EDTA (pH 8.0) 2.0 mL
Glucose 0.98 g
Double distilled water up to 100 mL
Tris HCl and EDTA were mixed in 90 mL of double distilled water and autoclaved.
To this autoclaved solution was added 0.98 g of glucose and the volume of the
solution was adjusted to 100 mL with sterile double distilled water.
Salmon sperm DNA
Salmon sperm DNA (10 mg/mL) 50 µL
319
50 µL of Salmon sperm DNA was denatured at 100°C for 5 minutes and then chilled
on ice. Denatured DNA was added to 10 mL of pre-hybridization solution to get the
final concentration of 50µg/mL.
10% SDS
SDS 10 g
Double distilled water up to 100 mL
SDS was dissolved in 80 mL of double distilled water at 65°C. The volume was made
up to 100 mL with double distilled water and the solution was stored at room
temperature.
SDS/Proteinase K mix
Proteinase K (15 mg/mL) 3.0 µL
10% SDS 72.0 µL
3.0 µL of proteinase K (15 mg/mL) was added in 72 µL of 10 % SDS. 75 µL of this
solution was needed for each sample. This mixture was always prepared fresh before
use.
3 M sodium acetate (CH3COONa)
CH3COONa 246.03 g
Double distilled water up to 1000 mL
CH3COONa was dissolved in double distilled water and stored at room temperature.
5 M NaCl
NaCl 29.2 g
Double distilled water up to 100 mL
29.2 g NaCl was dissolved in 60 mL of water and the final volume was made up to
100 mL by double distilled water. The solution was autoclaved and stored at room
temperature.
20X SSC
NaCl 175.3 g
Tri-sodium citrate-dihydrate 88.2 g
320
NaCl and tri-sodium citrate were dissolved in 800 mL of distilled water and the pH
was adjusted to 7.0. Volume of the solution was adjusted to 1000 mL with distilled
water and autoclaved.
2X SSC
20X SSC 5.0 mL
Distilled water 45 mL
5.0 mL of 20XSSC was diluted in 45 mL of double distilled water to get 2XSSC.
2X SSC/0.1% SDS
20X SSC 100 mL
10% SDS 10 mL
Both constituents were mixed and volume was adjusted to 1000 mL by double
distilled water.
0.1X SSC/0.1% SDS
2X SSC 50 mL
10% SDS 10 mL
Both constituents were mixed and the volume was adjusted up to 1000 mL by double
distilled water
20X SSPE
Na2HPO4.2H2O 35.6 g
NaCl 210.24 g
EDTA 7.4 g
Double distilled water up to 1000 mL
All the ingredients were mixed in 800 mL of water. The pH was adjusted to 7.4 and
volume was made up to 1000 mL with double distilled water. The solution was
autoclaved and stored at room temperature for no longer than one year.
2X SSPE
20X SSPE 10 mL
Distilled water 90 mL
321
20XSSPE was diluted 10 times in double distilled water to get 2XSSPE.
Streptavidin-AP conjugate (Dilution)
Streptavidin-AP conjugate 2 µL
Blocking solution 10 mL
This solution was always prepared prior to use.
Substrate solution
50X BCIP/NBT 200 µL
1X detection buffer 9.8 mL
This was 50 times dilution of the 50XBCIP/NBT in 1X detection buffer. The
detection solution was always prepared fresh and used in dark.
1X TE
1M Tris-HCl (pH 8.0) 5.0 mL
0.5 M EDTA 1.0 mL
Double distilled water up to 500 mL
1.5X TMAC
5 M TMAC (Cat # Sigma T3411) 22.5 mL
20% Sarkosyl
(Sodium lauroyl sarcosinate) 188 µL
1M TrisHCl (pH 8.0) 1.875 mL
0.5M EDTA (pH 8.0) 300 µL
Milli Q water 137 µL
All the ingredients were mixed, the solution was filtered and stored at room
temperature till further use.
10X Tris borate EDTA Buffer (TBE)
Tris base 108 g
Boric acid 55 g
0.5M EDTA (pH 8.0) 40 mL
Double distilled water up to 1000 mL
322
All the ingredients were mixed in approximately 800 mL of water and then final
volume was adjusted to 1000 mL.
Triton-Tris lysis buffer (TT lysis buffer)
Triton X-100 1 mL
Tris HCl (pH 8.3) 2 mL
The volume was adjusted up to 100 mL with double distilled water and autoclaved.
