Protein-RNA and Protein-Protein Recognition by Dual KH1/2

Structure

Article

Protein-RNA and Protein-Protein Recognitionby Dual KH1/2 Domainsof the Neuronal Splicing Factor Nova-1Marianna Teplova,1,7 LucyMalinina,1,7,9 Jennifer C. Darnell,3,7 Jikui Song,1Min Lu,6 Ruben Abagyan,5 KiranMusunuru,3,4,8

Alexei Teplov,1 Stephen K. Burley,2,4,10 Robert B. Darnell,2,3 and Dinshaw J. Patel1,*1Structural Biology Program, Memorial Sloan-Kettering Cancer Center, New York, NY 10021, USA2Howard Hughes Medical Institute3Laboratory of Molecular Neuro-Oncology4Laboratory of Molecular Biophysics

Rockefeller University, New York, NY 10021, USA5Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037, USA6Biochemistry Department, Weill Medical College of Cornell University, New York, NY 10021, USA7CIC bioGUNE, Technology Park of Bizkaia, 48160 Derio-Bilbao, Spain8Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, MA 02138, USA9These authors contributed equally to this work10Present address: Research & Development, Eli Lilly & Co, Indianapolis, IN 46285, USA

*Correspondence: [email protected]

DOI 10.1016/j.str.2011.05.002

SUMMARY

Nova onconeural antigens are neuron-specific RNA-binding proteins implicated in paraneoplastic opso-clonus-myoclonus-ataxia (POMA) syndrome. Novaharbors three K-homology (KH) motifs implicated inalternate splicing regulation of genes involved ininhibitory synaptic transmission. We report the crys-tal structure of the first two KH domains (KH1/2)of Nova-1 bound to an in vitro selected RNA hairpin,containing a UCAG-UCAC high-affinity binding site.Sequence-specific intermolecular contacts in thecomplex involve KH1 and the second UCAC repeat,with the RNA scaffold buttressed by interactionsbetween repeats. Whereas the canonical RNA-binding surfaceofKH2 in theabovecomplexengagesin protein-protein interactions in the crystalline state,the individual KH2 domain can sequence-specificallytarget the UCAC RNA element in solution. Theobserved antiparallel alignment of KH1 and KH2domains in thecrystal structureof thecomplexgener-ates a scaffold that could facilitate target pre-mRNAlooping on Nova binding, thereby potentially explain-ing Nova’s functional role in splicing regulation.

INTRODUCTION

The generation of a versatile repertoire of functionally diverse

proteins is critically dependent on alternate splicing of pre-

mRNAs. Alternate splicing of the subunits of all the main neuro-

transmitter receptors can influence their localization, ligand-

binding, signal-transducing, and electrophysiological properties.

Aberrant splicing of mRNAs in highly specialized cells, such as

930 Structure 19, 930–944, July 13, 2011 ª2011 Elsevier Ltd All right

neurons, can impact proteins critical for neuronal function,

leading to the onset of neurological disease (Dredge and Darnell,

2003; Dredge et al., 2001; Licatalosi and Darnell, 2006). The

proteins of the Nova (neuro-oncological ventral antigen) family,

which are exclusively expressed in central nervous system

(CNS) neurons, are important regulators of neuronal RNAmetab-

olism. The Nova proteins are target antigens in the autoimmune

disorder paraneoplastic opsoclonus-myoclonus ataxia (POMA)

(Musunuru and Darnell, 2001). POMA is a neurodegenerative

syndrome that originates when systemic malignant tumors

express proteins normally sequestered in the central nervous

system (Albert and Darnell, 2004). The immune system recog-

nizes these antigens to be nonself, and the ensuing response

results in neuronal degeneration. Homozygous Nova-1 knockout

mice appear to exhibit normal gestation and development, but

the resulting litters show apoptosis of motor neurons in the brain

stem and spinal cord and become incapacitated by progressive

motor system failure (Jensen et al., 2000a).

K-homology (KH) domains are RNA-binding elements (Grishin,

2001; Siomi et al., 1993), identified in hnRNP proteins involved in

RNA stabilization and translational control (Burd and Dreyfuss,

1994; Ostareck-Lederer et al., 1998; Valverde et al., 2008).

Nova-1 and Nova-2 proteins each contain three proteolytically

stable KH domains (Figure 1A), connected by flexible linkers.

The crystallographic structures of Nova KH3 domains exhibit a

three-stranded antiparallel b sheet backed by three a helices

(Lewis et al., 1999). RNA targets for the Nova KH3 domain (and

adjacent C-terminal residues) have been identified by in vitro

selection experiments (Jensen et al., 2000b). The optimal RNA

target exhibits a YCAY tetranucleotide element (Y is a pyrimidine)

as part of an accessible 12-residue loop segment within the

context of a RNA hairpin. The crystal structure of this complex

has been determined at 2.4 A resolution, with the majority of

the intermolecular contacts restricted to the extended UCAC

segment of the RNA loop, which is pinioned between the

invariant Gly-X-X-Gly motif and a variable loop of the KH domain

s reserved

mailto:[email protected]

http://dx.doi.org/10.1016/j.str.2011.05.002

A

B

D

C

E

Figure 1. Sequences of Nova KH Domains

and RNA Hairpin Target and the Structure

of the Nova-1 KH1/2-RNA Hairpin Complex

in the Crystal

(A) Schematic of three KHdomains and intervening

linkers in Nova proteins. Red-colored numbers

indicate the length of linker segments in Nova-1.

(B) The Nova-1 KH1/2 construct used in the

current project.

(C) The sequence of the in vitro selected 25-mer

RNA hairpin. The tandem UCAN sites are colored

in gold (U9–G12) and cyan (U13–C16). Structural

studies were also undertaken on a sequence

containing a 5BrU2,A24 pair.

(D) Sequence and secondary structure (Lewis

et al., 1999) alignments of Nova KH1, KH2, and

KH3 domains, with conserved residues shown in

red. The GXXG motif and so-called variable loop,

are denoted as I and V, respectively.

(E) Ribbon representation of the structure of the

Nova-1 KH1/2-RNA hairpin complex in the crystal.

The stoichiometry is KH1/2:RNA hairpin of 2:2. The

color codes are RNA in green, KH1 in gold and KH2

in cyan. The UCAC motif interacting with KH1 is

colored inblue. See also Table 1 and FiguresS1–S3.

Structure

Structure of Nova-1 KH1/2-RNA Complex

(Lewis et al., 2000). This CA segment, which is most intolerant to

mutations, is recognized by Watson-Crick-like hydrogen bond-

ing patterns from protein residues, whereas the flanking nucleo-

tides are restricted to pyrimidine residues.

Full-length Nova proteins containing three KH domains have

beenshown to targetand regulatealternativesplicingeventswithin

neuronal pre-mRNAs that contain repeats of the (YCAY) binding

element (Buckanovich and Darnell, 1997; Dredge and Darnell,

2003; Dredge et al., 2005; Licatalosi et al., 2008; Ule et al., 2006;

Zhang et al., 2010). RNA aptamers generated against full length

Nova protein adopt a RNA hairpin loop scaffold containing

a conserved [YCAY-(N)0-2]3 sequence in the loop segment (Buck-

anovich andDarnell, 1997; Yang et al., 1998). The published struc-

ture of the Nova KH3-RNA hairpin complex (Lewis et al., 2000)

doesnot addresshowmultipleKHdomainsofNovaproteinsmight

cooperate in recognizing tandem YCAY repeat modules. To

address this issue in a systematicmanner, we set out to determine

the structure of aNovacomplex containing adjacent KH1andKH2

domains (designated KH1/2; Figure 1B) targeted to a pair of

tandem YCAY RNA sites. Such an opportunity was available

because in vitro selection experiments had identified an RNA

hairpin architecture (Figure 1C), containing a potential 15-mer

Structure 19, 930–944, July 13, 2011

loop within which is nestled an UCAG-

UCAC segment, which binds the Nova-1

KH1/2 construct (Figure 1B) with high

affinity (Musunuru and Darnell, 2004).

Mutagenic analysis established that both

CAstepswithin theUCAG-UCACsegment

aremost intolerant tomutations and there-

fore represent key residues involved either

inprotein recognition, and/or inbuttressing

the recognition interface.

We now report the crystal structure

of the Nova-1 KH1/2 construct bound to

the UCAG-UCAC segment-containing RNA hairpin. Strikingly,

the RNA hairpin is targeted solely by the KH1 domain, with

both loop UCAG and UCAC tetranucleotide sites contributing

to recognition. Both the crystal structure and binding studies

establish that the KH2 domain does not interact with the

UCAG-UCAC-containing RNA hairpin. In the crystal, the RNA-

binding surface of the KH2 domain instead engages in protein-

protein interactions with symmetry-related KH2 domain. By

contrast, Nuclear magnetic resonance (NMR) chemical shift

perturbations, gel-shift, and ITC binding studies demonstrate

that the KH2 domain does target UCAY tetranucleotide-contain-

ing RNAs in a sequence specificmanner in solution. Nova’s func-

tional role in splicing regulation could be explained by the

observed antiparallel alignment of KH1 and KH2 domains in

the crystal structure of the complex, thereby providing an ideal

scaffold to induce target pre-mRNA looping on Nova binding.

RESULTS

Crystallization and Structure Determination of ComplexA Nova-1 KH1/2-expression construct (Figure 1B) was engi-

neered lacking a 24-amino acid segment between the KH1 and

ª2011 Elsevier Ltd All rights reserved 931

Table 1. Crystal Data, Data Collection, and Refinement Statistics

for Nova-1 KH1/2-RNA Hairpin Aptamer Complex

Crystal data Type I Type II

Space group C 2 C 2

Unit cell parameters

a (A) 155.3 159.5

b (A) 37.2 37.9

c (A) 34.8 38.5

b� 94.4 96.6

Asymmetric unit

RNA bases 23 25

KH1+KH2 residues 148 155

Solvent: H2O / ion 77/3 (K+, 2Mg2+) 155/3 (K+, 2Mg2+)

Data collection

X-ray source

detector

APS, SBC - 19ID

APS-1 CCD

NSLS, X4A

Quantum IV

Wavelength (A) 1.0080 0.919826

Resolution (A)

Range 20–2.3 20–1.94

Last shell 2.38–2.30 2.00–1.94

Unique reflections 8981 (873) 16,202 (1,513)

Redundancy 3.44 6.55

Completeness (%) 99.7 (97.9) 94.2 (89.6)

Mosaicity 0.88 1.32

R–mergea 0.068 (0.44) 0.117 (0.49)

Refinement (F>0)

Work/free reflections 8551/430 15,372/830

R-factor/R-free 0.193/0.248 0.227/0.268

Rmsd

Bond lengths (A) 0.011 0.013

Bond angles (�) 1.335 1.682

Average B-factors (A2) 27.9 25.0

Values in parentheses correspond to the last resolution shell.a R-merge = ShklSiII(hkl)i - <I(hkl)>I/ShklSi<I(hkl)i> over i observations.

Structure


KH2 domains (Figure 1A, dashed line), which is encoded by an

alternatively spliced exon. The protein was expressed and puri-

fied as described in Supplemental Experimental Procedures

available online. RNA in vitro selection carried out previously

against this Nova-1 KH1/2 construct identified a RNA hairpin

composed of a 5-base pair stem and a 15-nucleotide loop con-

taining conserved 8-base UCAG-UCAC sequence (Figure 1C)

(Musunuru and Darnell, 2004).

We crystallized complexes of Nova-1 KH1/2 protein with two

25-nucleotide RNA aptamer hairpins, which differed at the

2,24 base pair position in the stem segment. One of the RNA

hairpins (type I) contained aG2,C24 pair (Figure 1C; Figure S1A),whereas the other (type II) contained a 5BrU2,A24 pair (Fig-

ure S1B). The complexes of Nova-1 KH1/2 with type I and type

II RNA hairpins were both crystallized in space group C2, with

similar unit cell dimensions, except for a 10.5% difference in

the unit cell c dimension (Table 1). Structures were determined

via molecular replacement (MR) using the published structure

of a KH domain from the Nova-2 KH3-RNA aptamer hairpin

complex (Lewis et al., 2000) as a search model (see Supple-


mental Experimental Procedures). The KH1 and KH2 domains

in the Nova-1 KH1/2-RNA hairpin complex adopt the same

baabba topology (Figure 1D), reported earlier for the KH3 domain

of Nova-1 and Nova-2 in the free state (Lewis et al., 1999) and in

the Nova-2 KH3-RNA hairpin complex (Lewis et al., 2000). The

superimposed Nova-1 KH1 and KH2 domains in the RNA bound

state exhibit a pair-wise Ca rmsd of 1.1 A for residues 6–79

(excluding residues 44–52 of the variable loop). The asymmetric

unit contains one KH1/2 molecule and one RNA molecule, with

similar overall packing arrangement for both complexes. The

differences in the structures of type I and type II complexes are

outlined in the Supplemental Experimental Procedures and

Figure S1.

Stoichiometry of Complex in Crystal and in SolutionThe crystal structure of two Nova-1 KH1/2-RNA hairpin complex

molecules related by 2-fold crystallographic symmetry is shown

in Figure 1E. The KH1 (gold) and KH2 (cyan) domains are aligned

in an antiparallel orientation. The UCAG-UCAC-containing RNA

hairpin (green) is targeted solely by the KH1 domain, whereas

the canonical RNA-binding surface of KH2 engages in protein-

protein interactions with symmetry-related KH2. The packing

arrangement of KH1/2-RNA hairpin complexes in the crystal

and the details of KH2-KH2 interface are outlined in the Supple-

mental Experimental Procedures and Figure S2.

In contrast, analytical ultracentrifugation measurements indi-

cate that KH1/2 exists as a monomer in solution at 10–200 mM

concentration range, and the KH1/2-RNA complex sediments

as a 1:1 complex under these conditions (for details see Supple-

mental Experimental Procedures and Figure S3).

RNA Hairpin Architecture in the Bound StateThe entire UCAG-UCAC-containing RNA hairpin (Figure 2A) can

be traced in the crystal structure of the type II complex, whereas

the 50-C1-G2 segment is disordered in the crystal structure of

the type I complex. The simulated annealing 2Fo-Fc omit map

of the UCAC RNA site at 1s level for the type I complex is shown

in Figure S1C. The conformation of the UCAG-UCAC is of great-

est interest, due to the potential of each tetranucleotide element

serving as a KH domain binding site. All four-hairpin residues

within the gold-colored U9 to G12 segment (Figure 2B) form

a stacked array. By contrast, residues U13 and C14 loop out,

whereas residues A15 and C16 form a stacked pair within the

cyan-colored U13 to C16 segment (Figure 2B). The conformation

of the bound RNA hairpin is shown in stereo in Figure 2C and

establishes extensive stacking interactions that propagate

from the paired stem segment into both arms of the hairpin,

with the stacking discontinuities restricted to the G12 to A15

segment.

The Watson-Crick paired stem of the RNA hairpin zippers up

through formation of G6,A20, G7,A19, and A8,C18 nonca-

nonical pairs (Figure 2D). The two noncanonical G,A pairs are

of the sheared type, whereas the A8,C18 noncanonical pair is

buckled and involves bifurcated and water-mediated hydrogen

bonds. The small twist angle at the G6-G7 step and the large

twist angle at the G7-A8 step, results in a pronounced cross-

strand stack between residues A8 and A19 (Figures 2E and

2F). This results in a continuous helical stack that spans G25 to

A19 and A8 to G12. The other continuous helical stack spans

s reserved

A B

C

13

14

15

16

12

1110

9

13

1415

16

12

11109

13

1415

16

12

11109

Mg++

K+

G6

G7

Mg++

Mg++

K+

G6

G7

Mg++

G

G7 A19

D

A8 C18

W

G6 A20

C5

G6

G7

A8

G21

A20

A19

C18

intrastrand stack

interstrand stack

E

F

Figure 2. RNA Hairpin Architecture, In-

cluding Hydrogen-Bonding, Stacking, and

Cation Coordination in the KH1/2-RNA

Hairpin Complex

(A) The RNA hairpin portion of the final l2Fo-Fcl

electron density map at 1s level.

(B) The same view of the bound RNA hairpin in

a ribbons-and-stick representation. Gold and

cyan sticks correspond to U9–G12 and U13–C16

segments.

(C) Stereo view of the bound RNA hairpin in the

complex. Note unusual positioning of one phos-

phate group (C14–A15 step).

(D) Pairing alignments of noncanonical A8,C18,

G7,A19, and G6,A20 pairs.

(E) Base stack overlap patterns looking down the

helical stem axis, highlighting intrastrand and

interstrand overlap patterns.

(F) Cross-strand stacking between A8 and A19

within the zippered-up stem in the complex. See

also Figure S1.

(G) Stereo pair highlighting hydrated Mg2+ and K+

cations positioned within the major groove of the

zippered up stem segment. The cations are shown

as large silver spheres while the water oxygens

and O6 groups of G6 and G7 are shown as small

red spheres. Hydrogen bonds are shown as black

dashed lines, while ion coordination are shown as

silver bonds.

Structure


C1 to G7 and C18 to A15. The zippered-up helical segment

involving the three noncanonical pairs, is further stabilized by a

pair of hydrated divalent Mg2+ ions and a monovalent K+ ion

(with partial occupancies), as shown in stereo in Figure 2G.

Structure of Interface between Nova KH1and KH2 Domains in ComplexThe KH1 and KH2 domains align in an antiparallel orientation

across the KH1/2 interface, with interdomain contacts involving

segments of a3 and b1 within each domain (Figure 3A, pink). The

three-stranded antiparallel b sheets are on the same side of the

protein, thereby forming a continuous six-stranded b sheet (Fig-

ure 3B). The b1 strands are highly twisted relative to each other

and the resultant b sheet between them is stabilized by NH,,Omain chain hydrogen bonds involving Ile11(KH2),,Lys9(KH1)and Leu11(KH1),,Lys9(KH2) (Figure 3C). The KH1/2 interface

Structure 19, 930–944, July 13, 2011

buries 1720 A2 of protein surface, with

the interface dominated by van der Waals

contacts between conserved hydro-

phobic and aromatic residues, plus a

salt bridge between the side chains of

Glu53(KH1) and Arg4(KH2).

The linker segment (residues 81–99)

connecting KH1 and KH2 is disordered

in the crystal structure of the KH1/2-

RNA complex, consistent with its sensi-

tivity to proteases (Lewis et al., 1999).

Pronase cleaves the linker at the Ser90-

Ile91 step permitting comparative gel

shift studies of complex formation for

intact and cleaved KH1/2 with the

UCAG-UCAC-containing RNA hairpin (Figure 3D). These studies

establish that complex formation is independent of the cleavage

status of the linker connecting KH1 and KH2, suggestive of

linker-independent association across the KH1/2 interface.

Surface Interaction Propensities of Nova KH DomainsTo independently evaluate the interaction propensity of the

surface regions of Nova KH domains (Figures 3E–3G), we

applied the ‘‘Optimal Docking Area’’ (ODA) algorithm (Fernan-

dez-Recio et al., 2005). The calculated energy changes reflect

the effect of replacing the water environment for a lower dielec-

tric (but still polar) medium, such as the surface of another

protein. The highest protein-protein interaction propensities

span adjoining b1/a3 elements for Nova KH1 (Figure 3E) and

KH3 (Figure 3G) domains. These results are consistent with

the b1/a3 elements of Nova KH1 forming contacts with KH2


V8

Q77

I76I73

I11

I10

P62

V69

Y6

I76

H69

N66L65

I62

L8

L11

NC

CN

α3

α3

α1

α2α3

α1

α2

α3

β1

β1

β2β1

E70

K9

K9

E53

R4

KH1-KH2

KH1 KH2

KH1KH2

N

C

CN

β1

β2β3

β1

β3β2

M.M. s

tanda

rts

KH1/KH2 cu

t

KH1/KH2

KH1/KH2 +

RNA

KH1/KH2 cu

t + R

NA

RNA

protein staining RNA staining

SDS-PAGE native PAGE

free RNA

complex

10 -

15 -20 -25 -30 -40 -

KH1/KH2 +

RNA

KH1/KH2 cu

t + R

NA

RNA

VSILQPQKH1 KH2

pronase

β2β3

β3α1

α2

α3

β2β1

KH3

β3β1

A B

C D

E F G

Figure 3. Ribbon Representations of KH1/2 Interface in the KH1/2-RNA Hairpin Complex and Distribution of the Protein-Protein Interaction

Propensities over the Surface of Nova KH Domains

(A) A global overview of the KH1(gold)/KH2(cyan) interface, with the segments constituting the interface, colored in pink.

(B) The three-stranded b sheets of the KH1 and KH2 domains form a continuous twisted six-stranded b sheet.

(C) Details of the KH1/2 interface, highlighting interactions between side chains of residues involved in interfacial contacts.

(D) SDS-PAGE electrophoresis (left) showing pronase cleavage resulting in two protein fragments (cleavage at Ser90-Ile91 step) with molecular mass of �9 and

10 kDa. Native PAGE (middle and right) establishing complex formation between KH1/KH2 and RNA, regardless of cleavage of the linker.

Structure


934 Structure 19, 930–944, July 13, 2011 ª2011 Elsevier Ltd All rights reserved

A11

C14

A15

R54L41

I39

Q32

w1

w2

α1

α2G24

G18

U13

R54C14

S44K45

G12

A11

C10

K43A15Q32

w3

w2

w1

K40 C16

U9

1716

15

10

11

9

12

13

14

CC C

U

STEM

A AC

UG

U13

O2'O3'

O5' C16

VDWK23

K40G22

G18

A

B

C D

Figure 4. KH1-RNA Interactions in Complex

(A) Overview of interactions between RNA hairpin loop (U9–G12 in gold and

the U13–C16 in cyan; see inset) and the N-terminal half of the KH1 domain

(Tyr15–Lys45 in gold, encompassing a1, loop I, a2, and b2 segments). Bridging

water molecules at the interface are labeled w1, w2, and w3.

(B) Details of intermolecular contacts involving the C14-A15 segment of the

RNA, and amino acids Arg54, Lys41, and Gln32 of the KH1 domain. Note

buttressing interactions between the base and sugar of A11 and C14. The side

chain of Lys40 is removed for clarity.

(C) Details of intermolecular contacts involving U13 base and sugar hydroxyl

group of the RNA, and backbone atoms of amino acids Gly18, Gly22, and

Lys23 of the KH1 domain.

(D) Intermolecular contacts between the Watson-Crick edge of C16 and the

side chain amine (hydrogen bonding) and methylene groups (van der Waals)

of Lys40.

Structure


(Figures 3A) in the Nova KH1/2-RNA hairpin complex, and with

the b1/a3 elements of Nova KH3 forming contacts with

symmetry-related KH3 in the crystal (Lewis et al., 2000). By

contrast, the highest surface interaction propensities span

adjoining b2/a2 elements, the loop between a1- and a2-helices,

and the C terminus of a1-helix for Nova KH2 (Figure 3F). These

elements are located on the canonical RNA-binding surface of

KH domains and it is this surface of KH2 that participates in

protein-protein interactions with symmetry-related KH2 in the

crystal (Figure S2B).

Recognition between KH1 Domain of Nova KH1/2and RNA HairpinProtein-RNA recognition in the Nova-1 KH1/2-RNA hairpin

complex involves only one of the two KH domains and both

UCAG-UCAC tetranucleotide elements within the RNA hairpin.

Specifically, the KH1 domain primarily targets the U13 to C16

segment, and the C10 base of the preceding U9 to G12 segment

(Figure 4A), with C14 and A11 buttressing each other through

hydrogen bonding interactions (Figure 4B). The U13 base loops

out of the hairpin and interacts with the KH1 domain through

both its base and sugar residues (Figure 4A). The U13 base stacks

over theGly18-Ser19peptidebond,withO4ofU13 formingvander

Waals contact with Cb of Ser19 and O2 of U13 forming a weak

hydrogen bond with main chain NH of Lys23 (Figure 4C). In addi-

tion, the 20-OH of the U13 sugar forms a bifurcated hydrogen

bond with the main chain O atoms of Gly18 and Gly22. The C14

base forms two hydrogen bonds through its Watson-Crick edge

with the guanidinium group of Arg54, with C14 buttressed in posi-

tion through a network of base-sugar/sugar-base-phosphate

hydrogen bondswith A11 of the adjacent U9 toG12 segment (Fig-

ure 4B). The next residue, A15 forms a pair of hydrogen bonds to

themain chainNHandOatomsof Leu41, and is further buttressed

in place by a bifurcated water-mediated hydrogen bond from its

base (N3) and sugar (20-OH) atoms to the side chain of Gln32.

The network of hydrogen bonds and water-mediated bridges

(w1 and w2) that direct the observed intermolecular recognition

and buttressing events, are specific for cytosine at position 14

and adenine residues at positions 15 and 11 in the complex (Fig-

ure 4B). The Lys40 and Lys43 side chains are directed toward

the C16 and C10 bases, with the specific intermolecular contacts

involving these lysine side chains differing between the type I and

type II complexes (Figure 4A). The Lys43 3-amino group forms

a hydrogen bond with either N3 atom of C16 or O2 atom of C10.

When Lys43 is occupied in the interaction with C10, the N3 atom

of C16 is hydrogen bonded to the Lys40 3-amino group, with the

rest of the Lys40 side chain forming van der Waals contacts with

O2 atom of C16 (Figure 4D).

Binding of Nova KH1/2 Domainsto UCAG-UCAC-Containing RNA HairpinWe have used filter-binding assays to measure the binding

affinities of the individual KH2 and KH3 domains, KH1/2 dual

(E–G) Distribution of the protein-protein interaction propensities over the protein surface as calculated by the optimal docking area (ODA) approach for three

different KH domains. Ribbon representation of KH1 (E) (this study), KH2 domains of the Nova-1 KH1/2 protein (F) (this study), and Nova-2 KH3 domain (G)

(Lewis et al., 2000). Structures are colored by the absolute magnitude of the ODA signal from the strongest in red, through medium in orange and weak in yellow,

to the weakest in white. See also Figure S5.

Structure 19, 930–944, July 13, 2011 ª2011 Elsevier Ltd All rights reserved 935

1 101 102 103 104

0

20

40

60

80

100

1 10 102 103 104

1 101 102 103 104

0

20

40

60

80

100

1 10 102 103 104 1 10 102 103 104

KH1/2 RNA KH1/2 RNA

KH1/2 WT

K40,43Q S14E

Nova KH1/2 Nova KH2 Nova KH3

KH1/2 RNA KH3 RNA

KH1/2/3 RNA KH1/2 RNA KH3 RNA

KH1/2/3 RNA

KH1/2 KH2 KH3

KH1/2/3

KH1/2 RNA KH3 RNA

KH1/2/3 RNA

kc1

% to

tal R

NA

boun

d

[protein], nM [protein], nM

[protein], nM

% to

tal R

NA

boun

d

3'5'GAGGA

CUCCC

CC

A UG A

U

CAC

KH3RNA hairpin

C3'5'

GCGCGGA

GCGCGAAC

UC

G CU

A

CCA

KH1/2RNA hairpin

G3'5'

ACUC

AC

G

CUGAG

AAC

UC

UC

U

A

UU

C UA

GG

C

CA

KH1/2/3RNA hairpin

A B C

D E

F G H

Figure 5. Filter Binding Assays for Nova KH

Domain-RNA Complexes

(A) The sequence of the Nova-2 KH3-binding

20-nt RNA hairpin containing a single UCAN site

(Lewis et al., 2000).

(B) The sequence of the Nova-1 KH1/2-binding

25-nt RNA hairpin containing a (UCAN)2 site (Mu-

sunuru and Darnell, 2004) that was used in this

study.

(C) The sequence of the Nova-1 KH1/2/3-binding

32-nt RNA hairpin containing a (UCAN-N)3 site

(Buckanovich and Darnell, 1997).

(D) Filter-binding assays for complex formation of

Nova KH1/2/3 (open circles), KH1/2 (black

circles), KH2 (red circles), and KH3 (green circles)

with KH1/2 RNA hairpin containing a (UCAN)2site (B).

(E) Filter-binding assays for complex formation of

wild-type Nova KH1/2 (black circles), Ser14Glu

mutant (green circles), and Lys40Gln, Lys43Gln

dual mutant (red circles) with KH1/2 RNA hairpin

containing a (UCAN)2 site (B).

(F) Filter-binding assays for complex formation of

Nova KH1/2 with RNA hairpins containing a single

UCAN site (A) (red circles), (UCAN)2 site (B) (black

circles), and (UCAN-N)3 site (C) (green circles).

(G) Filter-binding assays for complex formation of

Nova KH2 with RNA hairpins containing a single


circles), (UCAN-N)3 site (C) (green circles), and

a RNA hairpin specific for FMRP KH2 domain

(open circles).

(H) Filter-binding assays for complex formation of

Nova KH3 with RNA hairpins containing a single


circles), and (UCAN-N)3 site (C) (green circles).

Structure


domains, and full-length KH1/2/3 Nova protein to a panel of

three RNA hairpin targets. These include the KH3-binding RNA

aptamer containing a single UCAC site (Figure 5A), the KH1/2-

binding RNA aptamer containing a UCAG-UCAC site (Figure 5B),

and the KH1/2/3-binding RNA aptamer containing a (YCAY-N)3site (Figure 5C). Thus, although the intact KH1/2/3 Nova protein

(Figure 5D, open circles) and KH1/2 dual domains (Figure 5D,

black circles) bind the UCAG-UCAC-containing RNA aptamer

target (Figure 5B) with mM affinity, the KH3 domain (Figure 5D,

green circles) exhibits reduced binding affinity, whereas the

KH2 domain (Figure 5D, red circles) exhibits no measurable

binding affinity.

We have used filter-binding assays to compare the binding

affinities of wild-type (KD of 0.42 ± 0.11 mM; Figure 5E, black

circles) and mutant KH1/2 dual domains for the KH1/2-binding

UCAG-UCAC-containing RNA hairpin (Figure 5B). Replacement

of Ser14 in KH1 by its Glu counterpart observed at this position in

KH3, within the context of the KH1/2 construct, resulted in an

�4-fold decrease in RNA hairpin binding affinity to 1.6 ±

0.2 mM (Figure 5E, green circles). Replacement of Lys40 and

Lys43 in KH1 by their Gln counterparts observed at these posi-

tions in KH2, within the context of the KH1/2 construct, resulted

in no measurable RNA hairpin binding affinity (Figure 5E, red

circles).


Binding of Nova KH Domains to (YCAY)n-ContainingRNA HairpinsFilter-binding assays have also been used to measure the

binding affinities of the KH2 and KH3 individual domains (KH1

is unstable as an individual domain) and KH1/2 dual domains

to RNA aptamer hairpin targets containing (YCAY)n sites, where

n = 1,2,3 (Figures 5A–5C). The KH1/2 dual domains bind most

tightly to the RNA aptamers containing UCAG-UCAC (KD =

0.42 ± 0.11 mM; Figure 5F, black circles) sites and (YCAY-N)3(KD = 1.9 ± 0.3 mM; Figure 5F, green circles), with weaker binding

affinity to the RNA aptamer containing a single UCAC site (Fig-

ure 5F, red circles).

The KH2 domain binds very weakly to all three RNA aptamers

(Figure 5G), with the residual binding observed for the RNA

aptamer containing a (YCAY-N)3 site (Figure 5G, green circles)

being nonspecific, because a similar binding curve is observed

for an unrelated FMRP KH2 domain-binding RNA aptamer, kc1

(Figure 5G, open circles).

Finally, the KH3 domain binds most tightly to its own RNA

aptamer containing a single UCAC site (KD = 0.58 ± 0.09 mM;

Figure 5H, red circles), less tightly to the RNA aptamer containing

a (YCAY-N)3 site (KD = 3.4 ± 0.6 mM; Figure 5H, green circles),

and weakest to the RNA aptamer containing a UCAG-UCAC

site (Figure 5H, black circles).

s reserved

1H (ppm)

15N

(pp

m)

7.95 7.90 7.85 7.80 7.75

125.5

125.0

124.5 V28f

1H (ppm)7.95 7.90 7.85 7.80 7.75

125.5

125.0

124.5 V28f

V28c

1H (ppm)7.95 7.90 7.85 7.80 7.75

125.5

125.0

124.5

V28c

(ppm

)av

eδΔ

0

0.2

0.4

0.6

0.8

1

1.2α3β3α1 α2 β2β1

6 9 14 17 20 23 27 30 33 36 39 42 46 49 53 56 59 63 66 69 72 75 79

N

C

β1β3

β2α2

α1

Figure 8

N

C

β1β3

β2

α2

α1

KH2 KH1

KH2

A

B

C

Figure 6. NMR-Monitored Complexation

Shifts in Nova-1 KH2 Domain on Addition

of UCAC RNA Tetranucleotide

(A) Selected regions of 1H,15N-HSQC of Nova-1

KH2 in presence of various amount of UCAC RNA

tetranucleotide (1:0 left; 1:4 middle; 1:36 right).

Cross peaks of V28 in free (V28f) and RNA-bound

state (V28c) are shown.

(B) Histogram outlining the magnitude of the

average chemical shift perturbation of the 15N and1H backbone amide resonances of Nova-1 KH2

on complex formation with UCAC RNA tetranu-

cleotide. The average chemical shift difference

Ddave between the free and RNA-bound forms of

KH2 was calculated using a correlation:

Ddave =ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiDd2H + 0:1Dd2N

q;

where DdH is the chemical shift of amide proton

and DdN is the chemical shift of amide nitrogen.

Protein secondary structure elements are indi-

cated on the top.

(C) Comparison of the residues involved in KH2-

UCAC interactions indicated by the average amide

chemical shift perturbations (left) with the residues

involved indirectKH1-UCAC interactionsobserved

in the crystal structure of KH1/2-RNA hairpin com-

plex (right). The RNA is shown in green, the KH1

residues directly contacting U13-C14-A15-C16

segment are shown in redon theKH1domainback-

bone (right), with the magnitude of the KH2 com-

plexation shifts on RNA binding color-coded on

the KH2 domain backbone with red representing

the largest and gray the smallest shifts (left).

See also Figure S4.

Structure


NMR Chemical Shift Mapping of RNA-Binding Surfaceof Nova KH2 DomainStructural similarities between all three Nova-1 KH domains, as

well as the conservation of a key recognition residue Arg54, sug-

gests that the KH2 domain could recognize the YCAY sequence

in a manner similar to that observed for KH1 (this study) and KH3

(Lewis et al., 2000) domains in their respective crystal structures.

Nevertheless, we detect no binding of the KH2 domain to

(YCAY)n-containing RNA hairpins in either crystal (Figure 1E) or

solution (Figure 5G) states.

To elucidate whether Nova-1 KH2 is capable of YCAY-con-

taining single-stranded RNA binding, we performed chemical

shift perturbation studies of the KH2 domain in the free state

and bound to the UCAC RNA tetranucleotide by NMR spectros-

copy. We could assign 96% of backbone residues (excluding

prolines) in a 1H-15N-HSQC spectrum of the complex, with

Structure 19, 930–944, July 13, 2011

slow exchange observed between free

and bound states (Figure 6A). The largest

weighted 1H/15N chemical shift changes

on complex formation map to the b2

and b3 strands and their connecting

loop, as well as to the residues located

on the a1 and a2 helices near the GXXG

loop (Figure 6B). These changes when

mapped onto the backbone structure of

the KH2 domain (Figure 6C), show that

KH2 residues Arg54, Leu41, Lys40, Gly22, Ser19, and Gly18,

whose KH1 equivalents mediate intermolecular contacts with

13-UCAC-16 motif in the crystal structures of KH1/2-RNA

complexes (Figure 4), are located either within or adjacent to

these regions (Figure 6C).

Nova Tandem and Single KH Domains Bindto [UCAU(N)2]3 MotifIn view of the observation that the KH2 domain is able to spe-

cifically recognize an isolated UCAC tetranucleotide RNA

sequence, we next studied binding of tandem KH1/2 and single

KH2 to in vivo Nova-1 target—an intronic UCAU repeat element

of glycine receptor a2 (GlyRa2) pre-mRNA (Figure 7A). Previous

studies have identified that Nova-1 binds to the GlyRa2 50-nt

sequence in vitro with �20 nM affinity via the [UCAU(N)2]3 motif

(Buckanovich and Darnell, 1997), and enhances utilization of an


Res

idua

ls

-0.040.000.04

41.0 42.0 43.0 44.0

-1.2

-0.8

-0.4

0.0

0.4

ln A

294

nm

Radius squared (cm2)

KH222 krpm17.1 kDa

GlyR 20

Complex

[KH1/2]:[GlyR20] [KH2]:[GlyR20]0 0.5 1 2 0 0.5 1 2 3 4 83

GlyR20 UCUCAUCAUCAUUUUCAUUU

0.0 0.5 1.0 1.5

-50

-40

-30

-20

-10

0

-0.4

-0.3

-0.2

-0.1

0.0

-10 0 10 20 30 40 50 60 70 80

Time (min)

µcal

/sec

kcal

/mol

e of

inje

ctan

t

0.0 0.5 1.0 1.5

-40

-30

-20

-10

0-0.4

-0.3

-0.2

-0.1

0.0

-10 0 10 20 30 40 50 60 70 80Time (min)

µcal

/sec

kcal

/mol

e of

inje

ctan

t

0.0 0.5 1.0 1.5 2.0-40

-30

-20

-10

0-0.5

-0.4

-0.3

-0.2

-0.1

0.0

0.1-10 0 10 20 30 40 50 60 70 80

Time (min)

µcal

/sec

[GlyR20]/[KH1/2] [GlyR20]/[KH2] [GlyR20]/[KH3]

kcal

/mol

e of

inje

ctan

t

n (sites)

0.89

0.43

0.38

Protein

KH1/2

KH2

KH3

RNA

GlyR20

GlyR20

GlyR20

0.13 0.01

0.30 0.02

0.78 0.02

KD (μM)

-38.5 0.1

-45.6 0.3

-49.5 0.5

ΔH (kcal mol-1)

-98

-125

-136

0.86KH1/2 RNA 0.59 0.04 -40.0 0.3 -106KH1/2

ΔS (cal K-1 mol-1)

A

B

D

G

E F

C

Figure 7. Binding of Nova-1 Tandem KH1/2 and Single KH2 and KH3 Domains to UCAU Repeat Element of GlyRa2 pre-mRNA

(A) RNA sequence of an intronic 20-nt UCAU repeat element of GlyRa2 pre-mRNA used in binding experiments. Three nonoverlapping UCAU repeats (underlined)

separated by two nucleotides represent potential binding sites for individual Nova-1 KH domains.

(B) Electrophoreticmobility gel shift data for binding of KH1/2 to GlyR20 establishing 1:1 stoichiometry of the complex (left); and of KH2 to GlyR20 establishing 2:1

stoichiometry of the complex (right).

(C) Analytical ultracentrifugation data of a 30 mM sample of KH2 at 20�C and 22,000 rpm in 25 mM Tris-HCl (pH 7.5) and 500 mM KCl.

(D–F) Isothermal titration calorimetry (ITC) binding curves of GlyR20 binding to KH1/2 (D), KH2 (E), and KH3 (F) domains. A thermogram as a result of titration is

shown in the top panel, and a plot of the total heat released as a function of themolar RNA/protein ratio is shown in the bottom panel. Solid lines indicate nonlinear

least-squares fit to a theoretical titration curve usingMicrocal software, withDH (binding enthalpy kcal mol�1),KD (association constant), and n (number of binding

sites per monomer) as variable parameters.

(G) Summary of ITC-based energetic parameters for tandem and single KH-RNA complexes.

Structure


adjacent 30-splice site of an alternatively spliced exon in vivo

(Jensen et al., 2000a). KH1/2 binds GlyRa2 20-nt RNA element

(designated GlyR20; Figure 7A) with 1:1 stoichiometry, whereas

KH2 binds this RNA with 2:1 stoichiometry, as determined

by electrophoretic mobility shift (gel-shift) assay (Figure 7B).

According to analytical ultracentrifugation measurements over

a 10-fold range of protein concentrations, the apparent molec-

ular mass of KH2 in the free state (10–100 mM concentration

range) is 17.1 kDa (Figure 7C), indicating that KH2 forms a dimer

in solution. Consistently, the gel-filtration column elution volume


of KH2 also indicates that it is dimeric in solution (data not

shown). Single RNA band shifts observed on KH1/2 binding at

1:1 protein/RNA molar ratio and KH2 binding at 2:1 protein/

RNA molar ratio (Figure 7B) suggest similar modes of KH1/KH2

intramolecular pseudodimer and of KH2/KH2 homodimer

binding to GlyR20, with each KH domain of the dimer bound to

one of three UCAU motifs of the RNA. We have monitored the

binding affinities of Nova-1 KH1/2, KH2, or KH3 to GluR20 by

isothermal titration calorimetry (ITC). The dissociation constant

(KD) values are 0.13 mM for the KH1/2 (Figures 7D and 7G),

s reserved

Structure


0.78 mM for the KH2 (Figures 7E and 7G) and 0.30 mM for the KH3

(Figures 7F and 7G) complexes with GlyR20. The n value (a

number of binding sites per protein monomer) estimated from

ITC curves using a single site binding model is 0.89 for the

KH1/2-RNA complex, whereas n = 0.43 for KH2-RNA complex,

consistent with 1:1 and 2:1 protein/RNA stoichiometries of these

respective complexes (Figures 7D, 7E, and 7G). The n value of

0.38 estimated from ITC curve (Figures 7F and 7G) for the

KH3-RNA complex indicates that stoichiometry of KH3-GlyR20

complex is either 2:1 or 3:1. These experiments demonstrate

that individual Nova KH2 and KH3 domains bind [UCAU(N)2]3motif of single stranded RNA with comparable (2.6-fold differ-

ence) binding affinity, while dual KH1/2 domain binds this ssRNA

with 6-fold higher affinity compared to a single KH2 domain.

We have also monitored binding of KH1/2 to GlyR20 RNA by

NMR spectroscopy. We observed significant chemical shift

perturbations between free and RNA-bound states (Figure S4A).

The number of KH1/2 resonances that experienced chemical

shift changes is at least twice the number observed for individual

KH2 (Figure 6B), suggesting that both KH2 and KH1 domains are

bound to GlyR20 in the complex. For example, in addition to

Gly22 and Gly25 of KH2 domain, there are two other cross-

peaks in the same region of the KH1/2 1H-15N-HSQC spectrum

that undergo significant chemical shift changes on RNA binding

(compare the selected regions of the spectra of KH2 and KH1/2

in Figures S4B and S4C, respectively).

DISCUSSION

KH domains, which constitute one of the most abundant RNA-

binding motifs (Messias and Sattler, 2004), are of particular

interest because of their role in regulating gene expression at

both transcriptional and translational levels, in alternate splicing,

and in the maturation of mRNA (Valverde et al., 2008). Eukary-

otic KH domains bind their mRNA targets with sequence spec-

ificity and affinities spanning the mM to nM range, and target tet-

ranucleotide sequences where the first and last bases are

pyrimidines, with structures of complexes available where the

third base is an adenine or cytosine. Our current understanding

of the principles underlying KH-RNA recognition emerged

following determination of the crystal structure of Nova-2 KH3

domain bound to a UCAC element within the hairpin segment

of a RNA stem-loop (Lewis et al., 2000), the NMR structure of

the STAR (signal transduction and activation of RNA) member

KH domain augmented by a QUA1 (quaker homology 1) domain

of SF1 (splicing factor 1) bound to a UAAC segment in a single-

stranded RNA context (Liu et al., 2001), the complex between

NusA, a key regulator of bacterial antitermination, and RNAs

derived from the antitermination region (Beuth et al., 2005),

and the crystal structures of KH1 domain of poly(C)-binding

protein 2 (PCBP2) bound to C-rich telomeric DNA and RNA

(Du et al., 2007). In each case, the RNA tetranucleotide is grip-

ped in a molecular vise composed of a hydrophobic a-helix/

b strand platform, an invariant GXXG motif and a variable

loop, thereby aligning the Watson-Crick edge of the adenine

at the third position for hydrogen-bonding with the peptide

backbone.

The current contribution reports the crystal structure of dual

eukaryotic KH domains of Nova-1 targeted to tandemRNA tetra-

Structure 19,

nucleotide repeats, where KH1 and KH2 domains form an intra-

molecular pseudodimer, with KH1 solely involved in RNA recog-

nition and KH2 involved in protein-protein contacts. These

results highlight the ability of KH domains to participate in

protein-RNA and protein-protein recognition and outline how

RNA-RNA buttressing interactions expand on our current under-

standing of KH-RNA tetranucleotide recognition events.

Comparison of Nova KH1/2 Interface with Other KH-KHInterfacesOur structure of the complex establishes that KH1 and KH2 have

extensive interdomain interactions, forming an intramolecular

pseudodimer. Two recently reported structures revealed a

similar arrangement of tandem KH domains in the RNA-free

state: the NMR structure of KH1/2 domains of human PCBP2

(Figure S5A) (Du et al., 2008), and the crystal structure of IMP1

mRNA-Binding Protein 1 (also called ZBP1) KH3/4 domains

(Figure S5B), whereas three other structures of tandem KH

domains in the free state revealed different modes of arrange-

ment of their respective KH domains (Figures S5C–S5E) (Diaz-

Moreno et al., 2010; Gopal et al., 2001; Valverde et al., 2007;

Worbs et al., 2001). A detailed comparison of the Nova KH1/2

interface with these KH-KH interfaces is given in the Supple-

mental Information.

Nova KH1/2-RNA Recognition Involving TandemYCAY RepeatsThe three KH domains of Nova proteins have been shown to

target [YCAY-(N)2]3 sites in natural a-2 glycine receptor subunit,

GABAA and Nova-1 pre-mRNAs (Buckanovich and Darnell,

1997; Dredge and Darnell, 2003; Dredge et al., 2005) and

[YCAY-(N)0-2]3 sites in RNA hairpin aptamers identified through

in vitro selection (Buckanovich and Darnell, 1997). Nevertheless,

it was not clear whether individual KH domains target one or

more tandem YCAY sites or whether one or more KH domains

target a single YCAY site. The structure of the Nova-1 KH1/2-

RNA hairpin complex reported in the present study addresses

this issue by revealing a novel recognition mode, where the

KH1 domain differentially recognizes adjacent tandem UCAG

and UCAC sites, mediated by specific buttressing interactions

between the two sites. The intermolecular interactions are pri-

marily between the KH1 domain and all four nucleotides of the

second UCAC tetranucleotide (U13–C16) site, with a few addi-

tional interactions with C10 and its phosphate of the first

UCAG tetranucleotide (U9–G12) site in the complex (Figure 4A).

Both UCAG and UCAC sites are involved in sculpting the RNA

scaffold due to the extensive base-sugar and base-phosphate

interactions associated with the mutual buttressing of A11 of

the first tetranucleotide repeat and C14 of the second tetranu-

cleotide repeat in the complex (Figure 4B).

The recognition elements between the KH1 domain and the

second UCAC tetranucleotide (U13–C16) site in the Nova-1

KH1/2-RNA hairpin complex reported in this study are very

similar to those reported previously between the KH3 domain

and the single UCAC site in the Nova-2 KH3-RNA hairpin com-

plex (Lewis et al., 2000). In both complexes, the sequential uracil,

cytosine and adenine residues of the UCAC segment are posi-

tioned atop an a/b platform and pinioned in place by interactions

with the invariant Gly-X-X-Gly motif and the variable loop. The

930–944, July 13, 2011 ª2011 Elsevier Ltd All rights reserved 939

K33 K33

K75

W38KH3

KH1

KH2 KH2

K23

K23

K45

K45

K43K43

R54

K40

K40

K23K23

K44K44

K29

Q43

Q40

K9

R54

K9

R54

W38

K67

K29

Q43Q40

K75

R54

K26

R75

K23

R52

K44

K43

R54E14

R38

K89

R83

Q40

R55

K5

R38

K23

R52

K44

K43

R54E14

K89R83

C3'5'

GCGCGGA

GCGCGAAC

UC

G CU

A

CCA

3'5'GAGGA

CUCCC

CC

A UG A

U

CAC

KH1/2RNA hairpin

KH3RNA hairpin

A B

C D

E F H

G

Figure 8. Two Perpendicular Views of the

Electrostatic Surface of Nova KH1 (with

Bound RNA), KH2, and KH3 (with Bound

RNA) Domains

(A and B) Two alternate views of KH1 domain of

KH1/2 complexed with RNA hairpin containing

tandem UCAN-sites within the loop segment.

(C and D) Two alternate views of KH2 domain of

KH1/2, that does not form a complex with RNA

hairpin.

(E and F) Two alternate views of KH3 domain

complexed with RNA hairpin containing single

UCAC site (Lewis et al., 2000; PDB entry 1EC6).

Blue and red patches are associated with posi-

tively- and negatively-charged KH surface seg-

ments. The RNA backbone is shown in a ribbon

and the bases in a slab representation. The slabs

are colored as follows: U, blue; C, magenta; A, red;

G, yellow.

(G) The sequence of the Nova-1 KH1/2-binding

25-nt RNA hairpin containing a (UCAN)2 site (Mu-

sunuru and Darnell, 2004) that was used in this

study.

(H) The sequence of the Nova-2 KH3-binding

20-nt RNA hairpin containing a single UCAN site

(Lewis et al., 2000).

Structure


cytosine pairs with R54 usingWatson-Crick-like hydrogen bond-

ing alignments and the adenine pairs with the backbone using

Watson-Crick-like hydrogen bonding alignments (Figure 4B).

We highlight below a common intermolecular recognition

feature that has been observed in the eukaryotic Nova-2 KH3-

RNA hairpin (Lewis et al., 2000) and Nova-1 KH1/2-RNA hairpin

(this study) complexes, as well as in the splicing factor 1-intron

branch site RNA complex (Liu et al., 2001) and the bacterial

NusA KH1/2 complex with a GAACUCAAUAG RNA sequence

(Beuth et al., 2005). All these complexes have one key element

in common, namely that the main chain of the b2-strand forms

two hydrogen bonds with the Watson-Crick edge of the adenine

base (Figure 4B). A more detailed comparison of Nova KH1/2-

RNA hairpin and NusA KH1/2-ssRNA complexes is provided in

the Supplemental Experimental Procedures.

Comparison of RNA Hairpin Topologies in Nova KH1/2and KH3 ComplexesThe Nova KH1/2 and KH3 domains bind preferentially their re-

spective RNA hairpin aptamers, whereas they bind each other’s

aptamers significantly weaker (Figures 5F and 5H), implying that

not only the presence of primary UCAY recognition site but also

the RNA hairpin loop structure determine binding affinity and

specificity of individual Nova KH domains. The charge distribu-

tions are somewhat different on the canonical RNA-binding

940 Structure 19, 930–944, July 13, 2011 ª2011 Elsevier Ltd All rights reserved

surfaces of the three Nova KH domains

(Figure 8). The electrostatics of the

RNA-binding KH1 surface in the KH1/2-

RNA hairpin complex (Figures 8A and

8B) appears to be designed to favor

binding by a compact RNA loop (contains

nine bases), as reflected in a sharp turn

facilitated by the Lys45 side chain. The conformation of the

primary U13-C14-A15-C16 target site (Figure 4A, cyan) together

with the sharp turn results in the mutual buttressing of C14 by

A11 of the neighboring site (Figure 4B). At the same time, two

appropriately located positively charged residues Lys40 and

Lys43, which adopt finger-like conformations, recognize cyto-

sine bases C16 and C10, respectively (Figure 4A). This network

of intermolecular and buttressing interactions results in both

the primary UCAC target site and the CA step of the preceding

U9-C10-A11-G12 site participating in KH1 domain recognition

and stabilization.

The electrostatics of the RNA-binding KH3 surface in the

KH3-RNA hairpin complex (Lewis et al., 2000) appears to be

designed to favor a less-restrictive RNA loop (contains 10 bases)

topology, as reflected in no sharp turns in the loop trajectory (Fig-

ure 8E). Two important differences between the electrostatics of

the RNA-binding surfaces of KH1 (Figure 8A) and KH3 (Figure 8E)

are the presence of Glu14 and Lys44 in the latter complex. This

distribution of charged amino acids appears to contribute to

the separation of the 50- and 30-halves of the loop in the KH3

complex, such that the loop topology adopts a more gradual

turn trajectory (Figure 8E). The positively charged residues

Arg83 and Arg52 together with the negatively charged Glu14

side chain direct the RNA backbone toward the C terminus of

the KH3 domain (Figure 8E). No buttressing interactions are

Structure


observed across the loop in the KH3-RNA hairpin complex, due

to the increased separation between the opposite sides of

the loop.

The importance of the electrostatics of the RNA interacting

surface of the Nova KH domains to recognition is reinforced

from the observed reduction in binding affinities associated

with the KH1/2-RNA hairpin complex for the KH1 Ser14Glu

single mutant and the KH1 Lys40,43Gln dual mutant (Figure 5E).

In the single mutant, neutral serine in KH1 is replaced by nega-

tively-charged glutamate observed at this position in KH3,

whereas in the dual mutant, positively-charged lysines observed

at these positions in KH1 are replaced by neutral glutamines

observed at these positions in KH2.

The KH2 domain does not participate in RNA recognition in the

Nova-1 KH1/2-RNA hairpin complex (Figure 1E), and it does not

appear to bind either UCAG-UCAC- or UCAC-containing RNA

hairpin aptamers with high affinity and binds very weakly to a

RNA hairpin containing (YCAY-N)3 sites (Figure 5G). The charge

distributions are somewhat different on the canonical RNA-

binding face of the KH2 domain (Figures 8C and 8D), due to

Gln40 and Gln43 replacing their lysine counterparts in the KH1

domain (Figures 8A and 8B). We attempt to explain why the

canonical RNA-binding surface of the KH1 domain as part of

a KH1/2 construct (Figure 5D, black circles), but not the KH2

domain (Figure 5D, red circles), targets the Nova-1 KH1/2-RNA

hairpin. We put forward two potential contributors to such

discriminative recognition following a detailed structural analysis

of protein-RNA contacts in the complex, as outlined in the

Supplemental Experimental Procedures.

All Nova KH Domains Bind UCAY RepeatSingle-Stranded RNAWe demonstrated that all three Nova-1 KH domains bind

[UCAU(N)2]3 repeats of a single-stranded RNA, with comparable

binding affinities between individual KH2 and KH3 domains (Fig-

ure 7). NMR chemical shift perturbation studies (Figures 6A and

6B) establish that Nova KH2 binds the UCAC RNA tetranucleo-

tide in slow exchange, a feature characteristic of a tightly bound

complex in solution. These results on a single-stranded RNA that

spans the KH domain binding pocket contrasts with no measur-

able binding when the same tetranucleotide element, or its

tandem repeats, is part of the loop segment of RNA hairpins (Fig-

ure 5G). The chemical shift changes in the KH2 domain on UCAC

binding are mainly distributed within the nucleic acid-binding

channel (Figure 6C), and their magnitude is in the range reported

for Nova KH3 binding to ssRNA pentanucleotide sequences

containing UCAN (N is either pyrimidine or purine) elements

(Beuth et al., 2007).

The ability of KH2 to recognize UCAC motif is fully expected

based on structural similarity of its RNA-binding surface to that

of the other two Nova KH domains, as well as the conservation

of a key recognition residue Arg54. A 2.6-fold lower binding

affinity of KH2 than KH3 for [UCAU(N)2]3 repeat ssRNA is consis-

tent with less positively charged RNA binding surface of KH2

domain compared to that of KH3 domain (Figures 8C–8F). We

have established that KH2 domain in an isolated state forms

a dimer in solution. Because hydrophobic interactions dominate

the KH1/KH2 interface of the dual KH1/2 domain, the KH2

domain in the absence of KH1 binding partner likely forms the

Structure 19,

KH2/KH2 homodimer through the same hydrophobic b1/a3

surface. Such very similar dimeric interfaces have been previ-

ously observed between KH1 domains of PCBP2 in the crystal

structures of its complexes with poly(C) nucleic acids (Du

et al., 2007) and between the tandem KH1 and KH2 domains

of the protein (Du et al., 2008) (Figure S5A). Therefore, it is

possible that KH2/KH2 homodimer and KH1/KH2 intramolecular

pseudodimer bind RNA in a similar way, such that each KH

domain of a dimer bind the two terminal UCAU motifs of

GlyR20, consistent with 1:1 (RNA/dimer) stoichiometry deter-

mined for each complex. The NMR chemical shift perturbations

observed for the intramolecular KH1/2 pseudodimer on binding

GlyR20 (Figure S4) are also consistent with the involvement of

both KH domains in the interaction with the RNA. This model is

stereochemically possible as the 8 nucleotide intervening

sequence is of sufficient length to connect the two terminal

UCAU motifs simultaneously bound by the two KH domains of

a dimer.

Nova KH Domain Surface Mimicry Associatedwith Protein and RNA RecognitionThe same canonical RNA-binding surface of the KH domain

participates in protein-protein interactions in the crystal (KH2

domain) (Figure 9A, top left) or in RNA recognition (KH1 domain)

(Figure 9B, top left) in the Nova-1 KH1/2-RNA hairpin complex.

A competing molecular recognition duality has also been re-

ported for the Y14 protein, whose canonical RNA-binding

surface, is also involved in protein-protein interactions with

Mago, with both Y14 and Mago being components of the exon

junction complex (Fribourg et al., 2003; Lau et al., 2003; Shi

and Xu, 2003).

Equally striking is the extension of the structural mimicry to an

element of the interacting partner. Thus, the indole ring of a Trp

residue mediates the protein-protein contacts involving KH2

domains in the crystal (Figure 9A), whereas the purine ring of

the key adenine base occupies the same interfacial position in

the KH1-RNA interaction (Figure 9B) in the Nova-1 KH1/2-RNA

hairpin complex.

Alternate Models Involving RNA Looping on the Surfaceof Nova-1 KH1/2Our ultracentrifugation studies imply that Nova-1 KH1/2 forms

a monomer in the free state (Figure S3A) and when bound to

its RNA aptamer target (Figure S3B) in dilute solution. The KH1

and KH2 domains interact with each other through an extensive

interface (Figures 3A and 3C), thereby positioning their canonical

RNA-binding surfaces at opposite ends of the molecule and

accessible for recognition. Thus, an RNA containing a pair of

sequence elements capable of targeting KH1 (with high affinity)

and KH2 (most likely with lower affinity) and separated by a linker

segment of sufficient length, should be capable of complex

formation through a RNA looping mechanism (Figure 9C), as

initially proposed for splicing regulation from the structure of

tandem RNA-binding domains RBD3/4 of polypyrimidine tract-

binding protein bound to RNA (Oberstrass et al., 2005). An

RNA looping mechanism has also been proposed for RNA

recognition based on the structure of tandem zinc-finger

domains of Muscleblind-like protein bound to RNA (Teplova

and Patel, 2008), KH1/2 domains of polyC-binding protein in


38 Å 5’3’ 56 Å 5’3’

KH2

α2

α1

KH2

W38M32

α2

α1

Q32 A15

KH1

RNA

KH1 KH2 KH1 KH2 KH1KH2

A B

C D

Figure 9. Models for Interaction of Nova

KH1/2 Domains with Wild-Type RNA

Targets through aRNA LoopingMechanism

(A) The KH2-KH2 interaction between symmetry-

related molecules in the crystal of the KH1/2-RNA

hairpin complex. Note the juxtaposition of Met32

and Trp38within van derWaals contact across the

interface.

(B) The KH1 (gold)-RNA (green) interface in the

KH1/2-RNA hairpin complex. Note the juxtaposi-

tion of Gln32 on KH1 and A15 on the RNA within

van der Waals contact across the intermolecular

interface.

(C) Model where Nova-1 KH1/2 monomer (based

on ultracentrifugation data in solution) is targeted

by a RNA containing a pair of sequence elements

capable of targeting KH1 (with high affinity) and

KH2 (most likely with lower affinity) and separated

by a linker segment of sufficient length. The

stoichiometry of this complex is 1:1 Nova-1

KH1/2:RNA.

(D) Model of Nova-1 KH1/2 based on the X-ray

structure of the complex (Figure 2A), where the

RNA-binding surfaces of the KH2 domains pack

against each other in the crystal lattice. The target

RNA contains a pair of sequence elements

capable of targeting KH1 with high affinity and

separated by a longer linker segment of sufficient

length. The stoichiometry of this complex is 2:1

Nova-1 KH1/2:RNA.

Structure


the free state (Du et al., 2008) and KH3/4 domains of IMP1

protein in the free state (Chao et al., 2010).

An alternate possibility for an RNA looping mechanism is

based on the X-ray structure of the complex (Figure 1E), where

the RNA-binding surfaces of the KH2 domains pack against

each other in the crystal lattice. Thus, an RNA containing a pair

of sequence elements capable of targeting KH1 and separated

by a linker segment of sufficient length, could also be capable

of complex formation through an RNA looping mechanism

(Figure 9D).

We have no definitive evidence differentiating between

models of RNA looping between the 1:1 KH1/2-RNA complex

shown in Figure 9C and the 2:1 KH1/2-RNA complex shown in

Figure 9D, especially in the context of full-length Nova protein

containing KH1/2/3 domains and under cellular conditions,

where additional binding proteins could modulate the recogni-

tion process. These models are proposed in the spirit of stimu-

lating further research in this area.

Biological ImplicationsNova proteins can either enhance or inhibit exon inclusion

depending on the position of its binding sites relative to the

regulated exon (Ule et al., 2006). If the KH domains of Nova

bind intronic YCAY clusters, it could enhance exon inclusion,

whereas if it binds YCAY clusters located within the exon or

within intronic region immediately adjacent to an alternative

exon, it could inhibit exon inclusion. Our structural models of


target pre-mRNA looping induced by Nova binding (Figures 9C

and 9D) could provide one explanation of Nova’s function in

splicing regulation. Looping of the intron induced by Nova

binding might help to bring 50 and 30 splice cites in close prox-

imity and thereby enhance spliceosome assembly and exon

inclusion (Figure 10A). By contrast, looping out an entire exon

or adjacent regions could prevent assembly of the spliceosome

components on pre-mRNA, subsequently resulting in exon

skipping (Figure 10B).

The current structural data provides a satisfying mechanistic

explanation for the functional interaction maps generated that

describe Nova actions on target pre-mRNAs (Licatalosi and Dar-

nell, 2010; Licatalosi et al., 2008; Ule et al., 2006). The looping

model discussed above not only suggests explanations for these

position-dependent interactions, but may be extended in several

additional directions. Hints of a Nova-dependent positional map

in which regulation of alternative polyadenylation (Licatalosi

et al., 2008) may have analogous explanations in the looping

model described. Moreover, we have found that Nova has func-

tional interactions with other RNABPs. These include inhibitory

interactions with PTBP2 (Polydorides et al., 2000), suggesting

that some protein-protein interactions may inhibit Nova-RNA-

looping bridges from forming. In contrast, interactions with the

Fox1/2 RNA binding protein (Zhang et al., 2010) are agonistic,

suggesting that dimer/heterodimer formation may indeed play

an important role providing sufficient RNA binding affinities to

allow loop formation.

s reserved

splicing enhancem ent

U1U2

U2U1

splicing repression

1 2

3

E x o n

1 2

3

5 ’

5 ’

3 ’

3 ’

U1U2

A

B

Figure 10. Models of RNA Looping Induced by Nova KH1-3 Domains

Binding to Splicing Enhancers and Splicing Silencers Predicted by

Nova RNA Map of Splicing Regulation

(A) Model based on the examples of Nova upregulation of exon inclusion by

binding to intronic splicing enhancer elements (red circles) to enhance

spliceosome assembly.

(B) Model based on the examples of Nova inhibition of exon inclusion by

binding to exonic splicing silencing element (blue circle) and blocking U1

snRNP (U1) assembly on the pre-mRNA, and Nova inhibition of exon inclusion

by binding to intronic splicing silencing element immediately upstream of

alternative exon by blocking recognition of the 30 splice site by U2 snRNP (U2).

KH1, KH2, and KH3 are colored gold, cyan, and purple, respectively. The

linkers between KH1 and KH2, and between KH2 and KH3 are represented by

the dotted gray lines. The green line represents RNA loop.

Structure


EXPERIMENTAL PROCEDURES

Detailed procedures for protein and RNA preparation, ITC measurements,

crystallization and data collection, structure determination and refinement,

NMR sample preparation, NMR spectroscopy and chemical shift assign-

ments, NMR relaxation measurements, gel electrophoretic mobility shift

binding assays, and filter binding assays are listed in the Supplemental Exper-

imental Procedures.

ACCESSION NUMBERS

Atomic coordinates and structure factors for the type I and type II Nova-1 KH1/

KH2-RNA hairpin complexes have been deposited in the Protein Data Bank

(www.rutgers.edu/pub) under accession codes 2ANN and 2ANR, respectively.

SUPPLEMENTAL INFORMATION

Supplemental Information includes Supplemental Experimental Procedures

and five figures and can be found with this article online at doi:10.1016/j.str.

2011.05.002.

Structure 19,

ACKNOWLEDGMENTS

D.J.P. received support from NIH grant CA49982, J.C.D. from NIH grant

HD40647, R.B.D. from NIH grant NS34389, and K.M., S.K.B., and R.B.D.

from NIH grant NS40955 and the Howard Hughes Medical Institute. K.M.

received support from the Weill Cornell/Rockefeller/Sloan-Kettering Tri-Insti-

tutional MD-PhD program and NIH MSTP grant GM07739.

Received: February 1, 2011

Revised: April 29, 2011

Accepted: May 2, 2011

Published: July 12, 2011

REFERENCES

Albert, M.L., and Darnell, R.B. (2004). Paraneoplastic neurological degenera-

tions: keys to tumour immunity. Nat. Rev. Cancer 4, 36–44.

Beuth, B., Pennell, S., Arnvig, K.B., Martin, S.R., and Taylor, I.A. (2005).

Structure of a Mycobacterium tuberculosis NusA-RNA complex. EMBO J.

24, 3576–3587.

Beuth, B., Garcia-Mayoral, M.F., Taylor, I.A., and Ramos, A. (2007). Scaffold-

independent analysis of RNA-protein interactions: the Nova-1 KH3-RNA

complex. J. Am. Chem. Soc. 129, 10205–10210.

Buckanovich, R.J., and Darnell, R.B. (1997). The neuronal RNA binding protein

Nova-1 recognizes specific RNA targets in vitro and in vivo. Mol. Cell. Biol. 17,

3194–3201.

Burd, C.G., and Dreyfuss, G. (1994). Conserved structures and diversity of

functions of RNA-binding proteins. Science 265, 615–621.

Chao, J.A., Patskovsky, Y., Patel, V., Levy, M., Almo, S.C., and Singer, R.H.

(2010). ZBP1 recognition of beta-actin zipcode induces RNA looping. Genes

Dev. 24, 148–158.

Diaz-Moreno, I., Hollingworth, D., Kelly, G., Martin, S., Garcia-Mayoral, M.,

Briata, P., Gherzi, R., and Ramos, A. (2010). Orientation of the central domains

of KSRP and its implications for the interaction with the RNA targets. Nucleic

Acids Res. 38, 5193–5205.

Dredge, B.K., and Darnell, R.B. (2003). Nova regulates GABA(A) receptor

gamma2 alternative splicing via a distal downstream UCAU-rich intronic

splicing enhancer. Mol. Cell. Biol. 23, 4687–4700.

Dredge, B.K., Polydorides, A.D., and Darnell, R.B. (2001). The splice of life:

alternative splicing and neurological disease. Nat. Rev. Neurosci. 2, 43–50.

Dredge, B.K., Stefani, G., Engelhard, C.C., and Darnell, R.B. (2005). Nova

autoregulation reveals dual functions in neuronal splicing. EMBO J. 24,

1608–1620.

Du, Z., Lee, J.K., Fenn, S., Tjhen, R., Stroud, R.M., and James, T.L. (2007).

X-ray crystallographic and NMR studies of protein-protein and protein-nucleic

acid interactions involving the KH domains from human poly(C)-binding

protein-2. RNA 13, 1043–1051.

Du, Z., Fenn, S., Tjhen, R., and James, T.L. (2008). Structure of a construct of

a human poly(C)-binding protein containing the first and second KH domains

reveals insights into its regulatory mechanisms. J. Biol. Chem. 283, 28757–

28766.

Fernandez-Recio, J., Totrov, M., Skorodumov, C., and Abagyan, R. (2005).

Optimal docking area: a new method for predicting protein-protein interaction

sites. Proteins 58, 134–143.

Fribourg, S., Gatfield, D., Izaurralde, E., and Conti, E. (2003). A novel mode

of RBD-protein recognition in the Y14-Mago complex. Nat. Struct. Biol. 10,

433–439.

Gopal, B., Haire, L.F., Gamblin, S.J., Dodson, E.J., Lane, A.N.,

Papavinasasundaram, K.G., Colston, M.J., and Dodson, G. (2001). Crystal

structure of the transcription elongation/anti-termination factor NusA from

Mycobacterium tuberculosis at 1.7 A resolution. J. Mol. Biol. 314, 1087–1095.

Grishin, N.V. (2001). KH domain: one motif, two folds. Nucleic Acids Res. 29,

638–643.


http://www.rutgers.edu/pub

http://dx.doi.org/doi:10.1016/j.str.2011.05.002

http://dx.doi.org/doi:10.1016/j.str.2011.05.002

Structure


Jensen, K.B., Dredge, B.K., Stefani, G., Zhong, R., Buckanovich, R.J., Okano,

H.J., Yang, Y.Y., and Darnell, R.B. (2000a). Nova-1 regulates neuron-specific

alternative splicing and is essential for neuronal viability. Neuron 25, 359–371.

Jensen, K.B., Musunuru, K., Lewis, H.A., Burley, S.K., and Darnell, R.B.

(2000b). The tetranucleotide UCAY directs the specific recognition of RNA

by the Nova K-homology 3 domain. Proc. Natl. Acad. Sci. USA 97, 5740–5745.

Lau, C.K., Diem, M.D., Dreyfuss, G., and Van Duyne, G.D. (2003). Structure of

the Y14-Magoh core of the exon junction complex. Curr. Biol. 13, 933–941.

Lewis, H.A., Chen, H., Edo, C., Buckanovich, R.J., Yang, Y.Y., Musunuru, K.,

Zhong, R., Darnell, R.B., and Burley, S.K. (1999). Crystal structures of Nova-

1 and Nova-2 K-homology RNA-binding domains. Structure 7, 191–203.

Lewis, H.A., Musunuru, K., Jensen, K.B., Edo, C., Chen, H., Darnell, R.B., and

Burley, S.K. (2000). Sequence-specific RNA binding by a Nova KH domain:

implications for paraneoplastic disease and the fragile X syndrome. Cell 100,

323–332.

Licatalosi, D.D., and Darnell, R.B. (2006). Splicing regulation in neurologic

disease. Neuron 52, 93–101.

Licatalosi, D.D., and Darnell, R.B. (2010). RNA processing and its regulation:

global insights into biological networks. Nat. Rev. Genet. 11, 75–87.

Licatalosi, D.D., Mele, A., Fak, J.J., Ule, J., Kayikci, M., Chi, S.W., Clark, T.A.,

Schweitzer, A.C., Blume, J.E., Wang, X., et al. (2008). HITS-CLIP yields

genome-wide insights into brain alternative RNA processing. Nature 456,

464–469.

Liu, Z., Luyten, I., Bottomley, M.J., Messias, A.C., Houngninou-Molango, S.,

Sprangers, R., Zanier, K., Kramer, A., and Sattler, M. (2001). Structural basis

for recognition of the intron branch site RNA by splicing factor 1. Science

294, 1098–1102.

Messias, A.C., and Sattler, M. (2004). Structural basis of single-stranded RNA

recognition. Acc. Chem. Res. 37, 279–287.

Musunuru, K., and Darnell, R.B. (2001). Paraneoplastic neurologic disease

antigens: RNA-binding proteins and signaling proteins in neuronal degenera-

tion. Annu. Rev. Neurosci. 24, 239–262.

Musunuru, K., and Darnell, R.B. (2004). Determination and augmentation of

RNA sequence specificity of the Nova K-homology domains. Nucleic Acids

Res. 32, 4852–4861.

Oberstrass, F.C., Auweter, S.D., Erat, M., Hargous, Y., Henning, A.,Wenter, P.,

Reymond, L., Amir-Ahmady, B., Pitsch, S., Black, D.L., and Allain, F.H. (2005).


Structure of PTB bound to RNA: specific binding and implications for splicing

regulation. Science 309, 2054–2057.

Ostareck-Lederer, A., Ostareck, D.H., and Hentze, M.W. (1998). Cytoplasmic

regulatory functions of the KH-domain proteins hnRNPs K and E1/E2. Trends

Biochem. Sci. 23, 409–411.

Polydorides, A.D., Okano, H.J., Yang, Y.Y., Stefani, G., and Darnell, R.B.

(2000). A brain-enriched polypyrimidine tract-binding protein antagonizes

the ability of Nova to regulate neuron-specific alternative splicing. Proc. Natl.

Acad. Sci. USA 97, 6350–6355.

Shi, H., and Xu, R.M. (2003). Crystal structure of the Drosophila Mago nashi-

Y14 complex. Genes Dev. 17, 971–976.

Siomi, H., Matunis, M.J., Michael, W.M., and Dreyfuss, G. (1993). The pre-

mRNA binding K protein contains a novel evolutionarily conserved motif.

Nucleic Acids Res. 21, 1193–1198.

Teplova, M., and Patel, D.J. (2008). Structural insights into RNA recognition by

the alternative-splicing regulator muscleblind-like MBNL1. Nat. Struct. Mol.

Biol. 15, 1343–1351.

Ule, J., Stefani, G., Mele, A., Ruggiu, M., Wang, X., Taneri, B., Gaasterland, T.,

Blencowe, B.J., andDarnell, R.B. (2006). An RNAmap predicting Nova-depen-

dent splicing regulation. Nature 444, 580–586.

Valverde, R., Pozdnyakova, I., Kajander, T., Venkatraman, J., and Regan, L.

(2007). Fragile X mental retardation syndrome: structure of the KH1-KH2

domains of fragile X mental retardation protein. Structure 15, 1090–1098.

Valverde, R., Edwards, L., and Regan, L. (2008). Structure and function of KH

domains. FEBS J. 275, 2712–2726.

Worbs, M., Bourenkov, G.P., Bartunik, H.D., Huber, R., andWahl, M.C. (2001).

An extended RNA binding surface through arrayed S1 and KH domains in

transcription factor NusA. Mol. Cell 7, 1177–1189.

Yang, Y.Y., Yin, G.L., and Darnell, R.B. (1998). The neuronal RNA-binding

protein Nova-2 is implicated as the autoantigen targeted in POMA patients

with dementia. Proc. Natl. Acad. Sci. USA 95, 13254–13259.

Zhang, C., Frias, M.A., Mele, A., Ruggiu, M., Eom, T., Marney, C.B., Wang, H.,

Licatalosi, D.D., Fak, J.J., and Darnell, R.B. (2010). Integrative modeling

defines the Nova splicing-regulatory network and its combinatorial controls.

Science 329, 439–443.

s reserved

Documents

Protein-RNA and Protein-Protein Recognition by Dual KH1/2