Production, purification and characterization of

Republic of Iraq

Ministry of Higher Education

and Scientific Research

Al-Nahrain University

College of Science

Biotechnology Department

Production, purification and

characterization of biosurfactant from

Geobacillus thermoleovorans and

studying its antimicrobial and antitumor

activity

A Dissertation

Submitted to the Council of College of Science / Al-Nahrain University as a

partial fulfillment of the requirements for the degree of Doctorate of

Philosophy of Science in Biotechnology

By

Heba Mansour Naser

B.Sc. Biotechnology/ College of Science/ Al-Nahrain University, 2002

M.Sc. Biotechnology/ College of Science/ Al-Nahrain University, 2005

Supervised by

Dr. Majed Hussein Al-Gelawi

(Professor)

July 2015 Shawal 1436

البحث تم دعمه ماليا من قبل وزارة

التعليم العالي والبحث العلمي /دائرة

البحث والتطوير/ قسم ادارة

المشاريع الرياديت

وتوكل على الله وكفى بالله وكيل

(3ورة الأحزاب )س

http://www.google.iq/url?url=http://z1z9.com/%D8%A8%D8%B3%D9%85_%D8%A7%D9%84%D9%84%D9%87_%D8%A7%D9%84%D8%B1%D8%AD%D9%85%D9%86_%D8%A7%D9%84%D8%B1%D8%AD%D9%8A%D9%85_%D8%A8%D8%A7%D9%84%D8%AE%D8%B7%D9%88%D8%B7_%D8%A7%D9%84%D8%B9%D8%B1%D8%A8%D9%8A/&rct=j&frm=1&q=&esrc=s&sa=U&ved=0CBUQ9QEwAGoVChMIl4HUjtaFxgIVY47bCh3SFQDB&usg=AFQjCNE_dsFne3RaNh4V9uebjx3EtzALCQ

javascript: void(0)

http://www.google.iq/url?url=http://z1z9.com/%D8%A8%D8%B3%D9%85_%D8%A7%D9%84%D9%84%D9%87_%D8%A7%D9%84%D8%B1%D8%AD%D9%85%D9%86_%D8%A7%D9%84%D8%B1%D8%AD%D9%8A%D9%85_%D8%A8%D8%A7%D9%84%D8%AE%D8%B7%D9%88%D8%B7_%D8%A7%D9%84%D8%B9%D8%B1%D8%A8%D9%8A/&rct=j&frm=1&q=&esrc=s&sa=U&ved=0CBUQ9QEwAGoVChMIl4HUjtaFxgIVY47bCh3SFQDB&usg=AFQjCNE_dsFne3RaNh4V9uebjx3EtzALCQ

javascript: void(0)

Supervisor Certification

We, certify that this dissertation entitled “Production, purification and

characterization of biosurfactant from Geobacillus thermoleovorans and

studying its antimicrobial and antitumor activity” was prepared by “Heba

Mansour Naser” under our supervision at the College of Science/ Al-Nahrain

University as a partial fulfillment of the requirements for the degree of

Doctorate of Philosophy of Science in Biotechnology.

Signature:

Name: Dr. Majed Hussein Al-Gelawi

Scientific Degree: Professor

Date:

In view of the available recommendations, I forward this dissertation

for debate by the examining committee.

Signature:

Name: Dr. Hameed M. Jasim


Title: Head of Biotechnology Department.

Committee Certification

We, the examining committee certify that we have read this dissertation

entitled "Production, purification and characterization of

biosurfactant from Geobacillus thermoleovorans and studying its

antimicrobial and antitumor activity " and examined the student "

Heba Mansour Naser '' in its contents and that in our opinion, it is

accepted for the Degree of Doctorate of Philosophy in Science

(Biotechnology). .

Signature:

Name: Dr. Nihdal A. Muhaiman


Date: / / 2016 (Chairman)

Signature: Signature:

Name: Dr. Ghazi M. Aziz Name: Dr. Amina N.AL- Thwani

Scientific Degree: Proffesor Scientific Degree: Proffesor

Date: / / 2016 Date: / / 2016 (Member) (Member)

Signature: Signature:

Name: Dr. Hameed M. Jasim Name: Dr. Intisar M. Juma

Scientific Degree: Proffesor Scientific Degree:AssistantProffesor

Date: / / 2016 Date: / / 2016 (Member) (Member)

Signature:

Name: Dr. Majed H. Al-Jelawi


Date: / / 2016

( (Member/ Supervisor ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ ـــــــــــــــــــ ـــــــــــــــــــــــــــــــــــــــــــــــ

I, here by certify upon the decision of the examining committee

Signature:

Name: Dr. Hadi M. A. Abood

Scientific Degree: Assistant Professor

Title: Dean of the Science College

Date: / / 2016

الاهداء

كانت قدوة وفخرا لنالى الروح التي ا

ابي الغالي

واعبائي الى من تحمل مشواري

زوجي الحبيب

الى التي ساعدتني بما يعجز الق لب عن وصفها

مي الحبيبها

تي واخوتي وكل من ساندنيذالى ف ل

اهدي ثمرة جهدي المتواضع

Acknowledgement

Praise is to Allah, Lord of the whole creation. Mercy and Peace are to the Prophet Mohammad and his relatives and companions.

Special thanks and deepest gratitude introduced to my supervisor prof. Dr. Majed H. AL-Gelawi for his guidance, continuous support and valuable advice during the whole period of research.

My deep gratitude and appreciation to prof. Dr. Ghazi M. Aziz for offering the help and advice during the period of research

Sincere gratitude is also extended to Prof. Dr. Haris Stamatis, Dr. Maria, Dr. Kostas, Dr. Angliki and Dr. Petros, Athena, Michaela (Staph of biotechnology department at Ioaninna university/Greec) for their help and encouragement particularly in times of difficulty. Indeed, I express my sincere

gratitude to all colleagues who were working at this university.

Thanks to all the staff members inside or outside Al- Nahrain University for their appreciable help, specially to Dr. Salman Dr. Sanad, Dr. Ali Abd Al-Rahman, Dr. Nihdal Abdul Muhaiman, Dr. Mayada Salal, Dr Shayma, Dr. Asmaa Ali and

’

Mr. Zaid and all my colleagues.

Finally I would like to thank my special uncle Dr. Asaad Ismail for encouragement throughout all my life, which have been

sources of inspiration and moral support.

For all of them, I said "Thank you all"……

Heba

I

Summary

The ten bacterial isolates used in this study have the ability to utilize

crude oil and aromatic compounds. They were isolated in the previous

study and considered as a novel group of aromatic hydrocarbon degrading

extreme thermophillic bacteria. These isolates were screened for their

ability to produce biosurfactant depending on the emulsification index

(E24%), surface tension measurement (mN/m) and emulsification activity

(E.A) using crude oil as a carbon source. The results showed that all

isolates were able to produce biosurfactant and Geobacillus

thermoleovorans Ir1 (JQ912239) was the most efficient one.

The optimum conditions for biosurfactant production by G.

thermoleovorans Ir1 (JQ912239) were determined. The results indicated

that these conditions are growing this bacterium in mineral salt medium

(pH7) containing 1% crude oil as a sole carbon source and 0.3%

ammonium chloride as a nitrogen source, incubated in shaker incubator

at 60 ºC, with 200 rpm for 10 days.

Biosurfactant was extracted using three methods. The results showed

that the extraction with acetone gave maximum biosurfactant activity.

The biosurfactant was purified using silica gel column chromatography,

three peaks were obtained and gave emulsification activity.

The chemical composition of biosurfactant revealed that it consists of

37.7% lipids, 26.2% carbohydrate and 10.7% protein.

The partial and /or purified biosurfactant of G. thermoleovorans Ir1

(JQ912239) was subjected to fourier transform infrared

spectrophotometer (FTIR), High Performance Liquid Chromatography

(HPLC), gas chromatography (GC)and Nuclear magnetic resonance

(NMR) to complete the chemical characterization. The result of FTIR

revealed that the biosurfactant contains lipid, carbohydrate and protein.

While the HPLC results indicated that the fatty acid components of

II

biosurfactant were palmitic acid, stearic acid and oleic acid, the

carbohydrates were xylose, mannose and maltose. While the amino acids

were aspartic acid, glutamic acid and glutamine.

Gas chromatography analysis of the main part (lipid) of biosurfactant

showed that it consists the high percentage of palmitic acid methyl ester

(C16:0), Stearic acid (C18:0) and Oleic acid (C18:1n9C), and less

percentage of other fatty acids.

The 1H Nuclear magnetic resonance spectrum showed that the partial

purified biosurfactant consists of two compounds: the main was

triglycerides and the second may be attributed to fatty acid. The results of

purified biosurfactant (the three peaks which obtained with silica gel

column chromatography) revealed that all contain only triglycerides and

this study may be the first one which is carried out in Iraq, which

elucidates the ability of thermophilic bacteria to produce biosurfactant.

In order to determine the antitumor activity of the purified

biosurfactant, three cell lines (MCF7, Hut78 and Jurkat) were exposed to

different concentrations of the biosurfactant. The results showed that the

effect was dependent on the type of tumor cell line, biosurfactant

concentration, and exposure time. The highest effect (most sensitive) was

MCF7 cell line and 100 µg/ml caused 66.55 % inhibition of cell line

growth after 72hrs. (incubation period).

MCF7 cell line was subjected to cytotoxicity study. The result showed

that 50 and 100µg/ml of purified biosurfactant caused a significant

decrease of cell count, with significant increase in cell permeability,

releasing cytochrome C from mitochondria, nucleus intensity and a

significant reduction in mitochondrial membrane potential.

The antimicrobial activity of purified biosurfactant of G.

III

thermoleovorans Ir1 (JQ912239) was applied against some

microorganisms, the biosurfactant inhibited the growth of bacteria

(Staphylococcus aureus, Streptococcus sp., Pseudomonas aeruginosa)

and fungi (Candida albicans).

Some physical and chemical properties of biosurfactant were studied. It

was found that the biosurfactant was active in a wide range of pH values,

thermostable at a high temperatures and stable in a wide range of salt

concentrations of NaCl, CaCl2 and KCl.

In an attempt to detect the gene(s) responsible for biosurfactant

produced by G. thermoleovorans, genomic DNA of this bacterium and B.

subtilis was extracted and amplified using specific primer for sfp gene

(coded for biosurfactant of Bacillus spp.). The results showed that the

amplification product (675bp) was obtained with B. subtilis but not with

G. thermoleovorans Ir1, that means this gene is not responsible for

biosurfactant production in G. thermoleovorans Ir1.

I

List of Contents

Page

No.

Content Item

I List of Contents

VI List of Tables

VII List of Figures

XI List of Abbreviations

Chapter One: Introduction and Literature Review

1 Introduction 1.1

4 Literature Review 1.2

4 Thermophillic bacteria 1.2.1

5 Geobacillus 1.2.2

6 Surfactants 1.2.3

7 Biosurfactant 1.2.4

10 Bioemulsifier 1.2.5

11 Important of bioemulsifier 1.2.6

11 Classification of biosurfactant 1.2.7

11 Types of biosurfactant 1.2.8

12 Glycolipid biosurfactant 1.2.8.1

14 Rhamnolipids 1.2.8.1.1

14 Trehalolipids 1.2.8.1.2

14 Sophorolipids 1.2.8.1.3

15 Fatty acids biosurfactant 1.2.8.2

15 Phospholipids 1.2.8.3

15 Particulate biosurfactant 1.2.8.4

16 Lipopeptide biosurfactant 1.2.8.5

16 Polymeric biosurfactant 1.2.8.6

18 Methods used to detect biosurfactant producing

microorganisms

1.2.9

II

19 Drop collapse test 1.2.9.1

19 Blood haemolysis test 1.2.9.2

12 Emulsification index 1.2.9.3

12 Emulsification activity 1.2.9.4

20 Surface tension 1.2.9.5

11 Recovery and purification of biosurfactant 1.2.10

12 Techniques used for biosurfactant characterization 1.2.11

23 Fourier transform infrared spectrophotometer(FTIR)

1.2.11.1

23 High Performance Liquid Chromatography(HPLC)

1.2.11.2

24 Analysis of biosurfactant by gas chromatography(GC)

1.2.11.3

25 Nuclear magnetic resonance (NMR) for biosurfactant

analysis

1.2.11.4

25 The main applications of surface active compounds

1.2.12

25 The antitumor activity 1.2.12.1

27 Antimicrobial activity 1.2.12.2

29 Antiadhesion 1.2.12.3

22 Food application 1.2.12.4

21 Environmental applications 1.2.12.5

21 Biosynthesis of biosurfactant 1.2.13

23 Genetics of biosurfactant biosynthesis 1.2.14

and MethodsChapter Two: Materials

25 Materials 2.1

25 Equipments and Apparatus 2.1.1

26 Chemicals 2.1.2

32 Reagents and Solutions 2.1.3

32 Primer 2.1.4

33 Culture media 2.1.5

33 Readymade culture media 2.1.5.1

33 Laboratory prepared media 2.1.5.2

35 Kits used in this study 2.1.6

37 Microorganisms 2.1.7

38 Cell lines 2.1.8

III

38 Methods 2.2

38 Sterilization methods 2.2.1

38 Maintenance of bacterial isolates 2.2.2

42 Identification of bacterial isolates 2.2.3

42 Microscopic and morphological examination 2.2.3.1

41 Biochemical tests 2.2.3.2

41 Screening the bacteria for biosurfactant production.

2.2.4

41 Biosurfactant production 2.2.4.1

41 Determination of biosurfactant compounds

2.2.4.2

42 Optimization condition for biosurfactant production 2.2.5

42 Effect of carbon sources 2.2.5.1

42 Effect of carbon source concentration 2.2.5.2

43 Effect of temperature 2.2.5.3

43 Effect of different nitrogen sources 2.2.5.4

43 Effect of nitrogen source concentration 2.2.5.5

43 Effect of Ph 2.2.5.6

44 Effect of aeration 2.2.5.7

44 Effect of incubation period 2.2.5.8

44 Extraction of biosurfactant compound 2.2.6

45 Purification of biosurfatant compound 2.2.7

46 Chemical composition of biosurfactant compound.

2.2.8

46 Estimation of the lipid concentration 2.2.8.1

47 Estimation of the protein concentration 2.2.8.2

52 Estimation of the carbohydrate concentration 2.2.8.3

51 Characterization of partial purified biosurfactant

compound

2.2.9

51 Red nfraI ransformT ourierFAnalysis with 2.2.9.1

51 Analysis with High Performance Liquid

Chromatography( HPLC)

2.2.9.2

54 Analysis of the lipid part with Gas chromatography

(GC)

2.2.9.3

54 Analysis the lipid part with NMR 2.2.9.4

54 Effect of biosurfactant on tumor cell line 2.2.10

54 Cell lines 2.2.10.1

IV

55 Preparation of cells for MTS assay 2.2.10.2

55 Harvest and count cells 2.2.10.3

56 Preparation testing plate (96-well) 2.2.10.4

56 Adding MTS to the 96-well plate 2.2.10.5

56 Multiparameter Cytotoxicity Assay 2.2.11

57 Cell Preparation 2.2.11.1

57 Treatment of cell within 96-well microplate 2.2.11.2

58 Antimicrobial activity of biosurfactant 2.2.12

62 Determination of some physical properties of

biosurfactant.

2.2.13

62 Determination colour and solubility of biosurfactant

2.2.13.1

62 Determination of melting point 2.2.13.2

61 Determination the effect of some chemical factors on

biosurfactant activity.

2.2.14

61 Biosurfactant concentration for emulsification of

sunflower oil

2.2.14.1

61 Effect of temperature 2.2.14.2

61 Effect of some mineral salts 2.2.14.3

61 Effect of Ph 2.2.14.4

61 Detection of gene(s) coded for biosurfactant

production .

2.2.15

61 Extraction of genomic DNA 2.2.15.1

62 Measurement of DNA concentration and purity 2.2.15.2

62 Amplification of biosurfactant gene(s) 2.2.15.3

63 Agarose gel electrophoresis 2.2.15.4

Chapter Three: Results and Discussion

64 Bacterial isolates 3.1

65 Screening the bacteria for biosurfactant production

3.2

66 Emulsification activity (E.A) 3.2.1

67 Emulsification index (E24%) and surface tension 3.2.2

68 Optimization of culturel conditions for biosurfactant

production

3.3

72 Effect of carbon sources 3.3.1

V

71 Effect of crude oil concentration 3.3.2

71 Effect of temperature 3.3.3

72 Effect of nitrogen sources 3.3.4

74 Effect of nitrogen source (NH₄Cl) concentration 3.3.5

74 Effect of pH 3.3.6

76 Effect of aeration 3.3.7

77 Effect of incubation period 3.3.8

78 Extraction and purification of biosurfactant 3.4

81 Chemical composition of biosurfactant 3.5

82 Characterization of G. thermoleovorans biosurfactant

3.6

82 Fourier Transform Infrared Spectrometry 3.6.1

83 High performance liquid chromatography 3.6.2

86 Gas chromatography for lipid part (fatty acid) analysis

3.6.3

88 NMR for lipid part (fatty acid) analysis 3.6.4

121 The biological activity of biosurfactant against tumor

cell line .

3.7

125 Cytotoxic effect of biosurfactant on cancerous cell

lines.

3.8

112 Antimicrobial effect of biosurfactant 3.9

116 Effect of some physical and chemical factors on

partial purified biosurfactant activity

3.10

116 The physical properties of biosurfactant 3.10.1

117 Effect of different concentrations of biosurfactant on

emulsification activity

3.10.2

118 Effect of temperature on biosurfactant activity 3.10.3

112 Effect of some salts on biosurfactant activity 3.10.4

111 Effect of pH on biosurfactant activity 3.10.5

113 Detection of gene(s) coded for biosurfactant

production

3.11

113 Isolation of genomic DNA 3.11.1

114 Amplification of gene coded for biosurfactant

3.11.2

Chapter Four:Conclusions and Recommendations

117 Conclusions

118 Recommendation

References

Appendices

VI

List of Tables

Page

No.

Title of table No. of table

8 The main surfactant classifications 1-1

13 Major biosurfactant classes and microorganisms

involved

1-2

33 Industrial applications of chemical surfactants

and biosurfactant

1-3

48 Preparation of different bovine serum albumin

concentrations

2-1

61 Preparation of different glucose concentrations 2-2

65 Morphological, physiological and biochemical

characteristics of thermophillic bacterial isolates

3-1

121 Inhibitory effect of different concentrations of

purified biosurfactant against MCF7cell line with

different incubation period

3-2


purified biosurfactant against Jurkat cell line and


3-3


purified biosurfactant against Hut78 cell line with


3-4

126 Effect of different concentrations of purified

biosurfactant on cell count of MCF7 cell line

3-5


biosurfactant on cell permeability of MCF7 cell

line

3-6


biosurfactant on cytochrome c of MCF7 cell line

3-7


biosurfactant on mitochondrial membrane

potential change of MCF7 cell line

3-8


biosurfactant on nucleus intensity of MCF7 cell

line

3-9

VII

List of Figures

Page

No.

Title of figure No. of

figure

18 Structure of cyclic lipopeptide surfactin produced

by Bacillus subtilis

1- 1

18 Emulsan Structure, produced by Acinetobacter

calcoaceticus, in which fatty acids are linked to a

heteropolysaccharide backbone

1-2

47 Standard curve of lipid determining by Kaufmann

and Brown (2008) method

2-1

52 Standard curve of Bovine Serum Albumin (BSA)

by Bradford method for determination protein

concentration of biosurfactant produced by G

.thermoleovorans

2-2

51 Standard curve of glucose by Dubois et al method

for glucose determination

2-3

64 Microscopically examination of the G. thermoleovorans bacterial isolates under large

objective lens.

3-1

66 Emulsification activities (E.A) of the ten

thermophillic bacterial isolates, cultured in mineral

salt medium (pH 7) containing 1% crude oil, at 55

ºC in shaker incubator (180 rpm) for 7 days

3-2

67 Emulsification index (E24%) and surface tension

of the ten thermophillic bacterial isolates, cultured

in mineral salt medium (pH 7) containing 1%

crude oil, at 55 ºC in shaker incubator (180 rpm)

for 7 days.

3-3

72 Effect of different carbon sources on biosurfactant

production by G. thermoleovorans (Ir1), grown in

mineral salt medium (pH7) containing 0.4%

ammonium chloride, at 55 ºC in shaker incubator

(180 rpm) for 7 days

3-4

71 Effect of different concentrations of crude oil on

biosurfactant production by G. thermoleovorans

(Ir1), grown in mineral salt medium (pH 7),

containing 0.4% ammonium chloride, at 55 ºC in

shaker incubator (180 rpm) for 7 days

3-5

VIII

72 Effect of incubation temperature on biosurfactant


mineral salt medium (pH 7) with 1% crude oil and

0.4% ammonium chloride, in shaker incubator

(180 rpm) for 7 days

3-6

73 Effect of nitrogen sources (0.4%) on biosurfactant


mineral salt medium (pH7) with 1% crude oil, at

60 ºC in shaker incubator (180 rpm) for 7 days

3-7

75 Effect of ammonium chloride concentration on

biosurfactant production by G. thermoleovorans

(Ir1), grown in mineral salt medium (pH7) with

1% crude oil, at 60 ºC in shaker incubator (180

rpm) for 7 days

3-8

76 Effect of pH value on biosurfactant production by

G. thermoleovorans (Ir1), grown in mineral salt

medium with 1% crude oil, and 0.3% ammonium

chloride at 60 ºC in shaker incubator (180 rpm) for

7 days

3-9

77 Effect of rpm value on biosurfactant production by

G. thermoleovorans, grown in mineral salt

medium (pH 7) with 1% crude oil, and 0.3%

ammonium chloride at 60 ºC for 7 days

3-10

78 Effect of incubation period on biosurfactant


mineral salt medium (pH 7) with 1% crude oil and

0.3% ammonium chloride in shaker incubator

(200rpm) at 60 ºC

3-11

82 Methods used for extraction biosurfactant

produced by G. thermoleovorans.

3-12

81 Silica gel column chromatography with sequential

elution system and flow rate 30ml/hrs., fraction

volume 30ml/hrs., fraction volume 3ml/tube.

3-13

83 FTIR spectrum of partial purified biosurfactant

produced by G. thermoleovorans (Ir1), 50 scan for

each spectrum

3-14

84 HPLC analysis of fatty acids components of partial

purified biosurfactant produce by G.

thermoleovorans (Ir1), equipped with binary

delivery pump model LC -10A shimadzu, the

eluted peak was monitored by SPD 10A VP

detector

3-15

IX

85 HPLC analysis of the carbohydrate components of

partial purified biosurfactant produce by G.

thermoleovorans (Ir1), equipped with binary

delivery pump model LC -10A

3-16

86 HPLC analysis of the amino acid components of

partial purified biosurfactant produce by G.

thermoleovorans (Ir1), with flow rate 1 ml/min

3-17

87 GC analysis of fatty acid sample of partial purified

biosurfactant produce by G. thermoleovorans

using helium as a carrier gas on a Shimadzu 17-A

GC

3-18

88 Selective region of H-NMR spectra of partial

purified biosurfactant produce by G.

thermoleovorans (Ir1), in CDCL3 at 298K, at 500

MHz

3-19

122 Overlap of selective region of H-NMR spectra of

biosurfactant produce by G. thermoleovorans

(Ir1). [black color] partial purified, [red color]

purified band 1, [green color] purified band 2 and

[blue color] purified band 3, in CDCL3 at 298K,

500 MHz

3-20

111 The cytotoxic effect of different concentrations of

purified biosurfactant on MCF7 cell.

3-21

115 Antibacterial activity of purified biosurfactant

produced by G. thermoleovorans(Ir1) against S.

aureus grown on Muller Hinton agar incubated at

37 º C for 24hrs

3-22

115 Antifungal activity of purified biosurfactant

produce by G. thermoleovorans (Ir1) against C.

albicans grown on Muller Hinton agar incubated

at 28 º C for 5 days

3-23

117 The effect of different concentrations of G.

thermoleovorans (Ir1) biosurfactant on

emulsification index (E24%) of sunflower oil

3-24

118 The effect of temperature on stability of

biosurfactant produce by G. thermoleovorans for

30 min

3-25

111 The effect of different salts (NaCl, CaCl2 and

KCl)) concentrations on stability of biosurfactant

produced by G. thermoleovorans (Ir1)

3-26

X

112 The effect of different pH values on activity of

biosurfactant produced by G. thermoleovorans

(Ir1)

3-27

114 Gel electrophoresis for genomic DNA of G.

thermoleovorans (Ir1), gel electrophoresis was

performed on 1% agarose gel and run with 5V/cm

for 1.5 hrs. Lane (M) is 10000 bp ladder, Lane: (1)

genomic DNA of G. thermoleovorans, Lane: (2)

genomic DNA of B. subtilis

3-28

115 Gel electrophoresis for amplification of sfp gene

using specific primers of sfp. Electrophoresis was

performed on 1.5% agarose gel and run with

5V/cm for 1hr. Lane (M) DNA ladder (1kb), Lane

(1): Amplification of G. thermoleovorans, Lane

(2): Amplification of Bacillus subtilis

3-29

List of Abbreviation

XI

Full Name Abbreviation

Base pair Bp

Dimethyl sulfoxide DMSO

Deoxyribonucleic acid DNA

Distilled water D.W

Emulsification index E24%

Exopolysaccharide EPS

Enzyme-linked immuonoabsorbent assay ELISA

Fourier Transform Infrared FTIR

Gas chromatography GC

High performance liquid chromatography HPLC

Luria – Bertani LB

Mineral salts medium MSM

National center for biotechnology

information

NCBI

Polymerase Chain Reaction PCR

concentration of Hydrogen ion pH

Surface tension S.T

Phenyl isothiocyanate PTIC

Critical micelle concentration CMC

Mass spectroscopy MS

Retention time RT

Mannosylerythritol lipid MEL

https://en.wikipedia.org/wiki/Phenyl_isothiocyanate

https://en.wikipedia.org/wiki/Phenyl_isothiocyanate

Chapter one

Introduction

And Literatures review

Chapter one Introduction and literatures review

1

1. Introduction and Literatures review

1.1 Introduction:

Biosurfactant are surface active compounds having both hydrophilic and

hydrophobic domains that allows them to exist preferentially at the interface

between polar and non-polar media, thereby reducing surface and interface tension

(Banat et al., 2010).

Biosurfactant are amphiphilic biological compounds produced extracellularly or

as part of the cell membranes by a variety of yeast, bacteria and filamentous fungi

from various substances, including sugars, oils and wastes (Femi-Ola et al.,

2015).These molecules comprise complex structures which are grouped either as

low (glycolipids and lipopeptides) or high (polymeric biosurfactant) molecular

weight compounds (Cameotra et al., 2010). The major classes of biosurfactant

include glycolipids, lipopeptides and lipoproteins, phospholipids and fatty acids,

polymeric surfactants and particulate surfactants (Cameotra and Makkar, 2004;

Salihu et al., 2009).

Recently much attention has been attributed towards biosurfactant over

chemically synthesized surfactants due to their ecological acceptance, low

toxicity and biodegradable nature, effectiveness at extreme temperatures or pH

values and widespread applicability (Mnif and Ghribi, 2015).

During the last decade, biosurfactant have been used as alternatives for synthetic

surfactants and are expected to find many industrial and environmental

applications such as enhanced oil recovery, crude oil drilling, lubrication,

bioremediation of pollutants, foaming, detergency, wetting, dispersing and


2

solubilization. The application of biosurfactant also increased in cosmetic, health

care and food processing industries (Dhasayan et al., 2014).

Biosurfactant displayed important biological activities including antimicrobial,

insecticidal, immune-modulative and antitumoral activities (Cao et al., 2009; Liang

et al., 2014).

New trials for cancer treatment have been performed by many researchers in

various countries, including Iraq; these trials included using gene therapy,

immunotherapy, biological therapy and bacterial byproducts (Al-Saffar, 2010).

However, biosurfactant produced by thermophilic bacteria, including Geobacillus

thermoleovorans as a new trial for cancer treatments and cytotoxic effect have not

been tested previously.

Identifying and characterizing new genes involved in the degradation of

hydrocarbons and production of surfactants, which have the potential to develop a

bioremediation strategy are thus promising and representing an important subject

of the research (Oliveira et al., 2015).

Aim of the study:

According to what's mentioned above and because of how rare the studies are

about the production of biosurfactant of thermophilic bacteria, only one study

reported G. thermoleovorans (Feng and Jin, 2009), this study aimed to:

- Screening some isolates of thermophillic bacteria (isolated in the previous

study) for their ability to produce biosurfactant and select the most efficient

one.

- Optimization of cultural conditions for biosurfactant production by the

efficient isolate.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Oliveira%20JS%5Bauth%5D


3

- Extraction and purification of biosurfactant by using appropriate

chromatographic methods.

- Characterization and determination the properties of biosurfactant produced

by the efficient isolate by using analytical methods (FTIR, HPLC, GC and

NMR).

-Study the biological activity of biosurfactant as antitumor and antimicrobial.


4

1.2 Literatures review

1.2.1 Thermophillic bacteria:

A thermophile is an organism — a type of extremophile — that thrives at

relatively high temperatures, between 45 and 122 °C (113 and 252 °F) (Madigan

and Martino, 2006; Takai et al., 2008). Many thermophiles are archaea. While

thermophilic eubacteria are suggested to have been among the earliest bacteria

(Horiike et al., 2009).

Thermophilic bacteria offer crucial advantages over mesophilic or psychrophilic

bacteria, especially when they are applied to ex-situ bioremediation processes.

Limited biodegradation of hydrophobic substrates caused by low water solubility

at moderate temperature conditions can be overcome if the reaction temperature

could be increased enough (Kato et al., 2009). Besides their biotechnological

importance, thermophilic microorganisms maintain interesting features useful for

studying evolution of life. Microorganisms living under extremely high

temperature condition, such as hyperthermophilic archaea and hyperthermophilic

bacteria, share the cellular mechanisms with not only bacteria but also eukaryotes

(Rashid et al., 1995).

One theory suggests that the thermophiles were among the first living things on

this planet, developing and evolving during the primordial birthing of the earth

when surface temperatures were quite hot. One theory suggested that the

thermophiles were among the first living things on this planet, developing and

evolving during the primordial birthing days of earth when surface temperatures

were quite hot, and thus had been called the ―Universal Ancestor‖ (Doolittle,

1999)

http://en.wikipedia.org/wiki/Extremophile

http://en.wikipedia.org/wiki/Archaea

http://en.wikipedia.org/wiki/Eubacteria


5

1.2.2 Geobacillus :

The members of the Gram-positive endospore-forming bacteria that made up

the genus Bacillus have been gradually subdivided, during the last few years, into a

number of new genera such as Alicyclobacillus, Aneuribacillus, Brevibacillus,

Gracilibacillus, Paenibacillus, Salibacillus, Ureibacillus, and Virgibacillus

(Marchant and Banat, 2010). Nazina et al. (2001) created the genus Geobacillus

based around Bacillus (now Geobacillus) stearothermophilus DSM22 as the type

strain.

The isolation of aerobic highly thermophilic bacteria from various cold soil

environments both in Northern Ireland and worldwide (Marchant et al., 2002).

Nazina et al. (2001) proposed two new species that they had isolated from deep oil

reservoirs. Since that original description of the genus with eight species a further

nine, from a variety of sources. These include G. toebii from composting plant

material (Sung et al., 2002), while G. debilis from temperate soil environments

(Banat et al., 2004), also Geobacillus pallidus which was originally proposed as

Bacillus pallidus by Scholz et al. (1987) and reassigned by Banat et al. (2004),

and G. vulcani proposed as Bacillus vulcani from marine geothermal sources

(Caccamo et al., 2000) and transferred to Geobacillus by Nazina et al. (2004) and

G. tepidamans (Schaffer et al., 2004) in Austria and Yellowstone National Park.

The genus Geobacillus was established in 2001 with the following key

characteristics: rod shaped cells producing one endospore per cell, cells may be

single or in short chains and may have peritrichous flagella. Cells have a gram-

positive cell wall structure. Chemo-organotrophs, which are aerobic or

facultatively anaerobic using oxygen as the terminal electron acceptor, replaced by

nitrate in some species (Marchent et al., 2002).

http://link.springer.com/search?dc.title=Paenibacillus&facet-content-type=ReferenceWorkEntry&sortOrder=relevance

http://link.springer.com/search?facet-author=%22R.+Marchant%22

http://link.springer.com/search?facet-author=%22I.+M.+Banat%22


6

Geobacillus spp. are obligately thermophillic with a growth range of 37–75ºC

and optima of 55–65ºC, and they are neutrophilic with a growth range of pH 6.0 –

8.5 (Nazina et al., 2001). And the vegetative bacilli are large (0.5 ×1.2 µm to 2.5

×10 µm) and straight. One of the key characteristics of the genus Geobacillus is its

ability to produce endospores, and in mesophilic bacilli endospores represent a

potent survival mechanism under adverse conditions. It is relatively easy to

differentiate vegetative cells and spores in mesophilic bacilli through selective

killing with heat or chemical agents. This has not proved possible with Geobacilli

due to the resistance to killing by these agents shown by vegetative cells and active

evolution of species still taking place (Marchant and Banat, 2010).

Endospores formation is affected by some factors including the temperature of

growth, the pH, aeration, presence of minerals, presence of certain carbon or

nitrogen compounds and the concentration of the carbon or nitrogen source, in

some circumstances a starvation for phosphorus source, population density, cell

cycle ( Piggot and Hilbert, 2004; Goesselsberger et al., 2009).

Geobacillus thermoleovorans previously (Bacillus thermoleovorans) B23, from

a deep-subsurface oil reservoir in Japan (Kato et al., 2001; Nazina et al., 2001)

Strain B23 effectively degraded alkanes at 70°C with the carbon chain longer than

twelve, dodecane. Since tetradecanoate and hexadecanoate or pentadecanoate and

heptadecanoate were accumulated as degradation intermediates of hexadecane or

heptadecane, respectively, it was indicated that the strain B23 degraded alkanes by

a terminal oxidation pathway, followed by β-oxidation pathway (Kato et al., 2009).

1.2.3 Surfactants:

Surfactants are amphiphilic compound consisting of a hydrophobic and a

hydrophilic domains. They are active ingredients found in soaps and detergents

with the ability to concentrate at the air- water interface and are commonly used to


7

separate oily materials from a particular media due to the fact that they are able to

increase aqueous solubility of non-aqueous phase liquids (NAPLS) by reducing

their surface/ interfacial tension at air–water and water–oil interfaces (Yin et al.,

2009).

Surfactants, widely used for industrial, agricultural, food, cosmetics and

pharmaceutical application however most of these compounds are synthesized

chemically and potentially cause environmental and toxicology problem due to the

recalcitrant and persistent nature of these substances (Makkar and Rockne, 2003).

In English the term surfactant (short for surface-active-agent) designates a

substance which exhibits some superficial or interfacial activity. In other languages

such as French, German or Spanish the word "surfactant" does not exist, and the

actual term used to describe these substances is based on their properties to lower

the surface or interface tension, e.g. tensioactif (French), tenside (German),

tensioactivo (Spanish). This would imply that surface activity is strictly equivalent

to tension lowering, which is not absolutely general, although it is true in many

cases (Salager, 2002).

Almost all surfactants are chemically derived from petroleum, however, the

interest in microbial surfactants has been steadily increasing due to their diversity,

environmentally friendly nature, the possibility of their production through

fermentation, and their potential applications in the environmental protection,

crude oil recovery, health care, and food-processing industries (Banat, 1995 a,b),

and this class of surfactants known as microbial, or biosurfactants, which have

some very interesting and complicated structures, although being expensive to

produce compared to chemically synthesized surfactants (Lang, 2002).

The main classes of surfactants according to hydrophilic group are (Salager,

2002) table (1-1) :

Anionic : hydrophilic head is negatively charged.


8

Cationic : hydrophilic head is positively charged.

Nonionic : hydrophilic head is polar but not fully charged.

Amphoteric : Molecule has both potential positive and negative charge

depends on pH of the medium.

1.2.4 Biosurfactant:

Biosurfactant are surface active agents of microbial origin (bacteria and fungi),

that consiste of a hydrophobic and a hydrophilic domains (Okoliegbe and Agarry,

2012), therefor, they have a unique property of lowering the interfacial tension

between two liquids (Sekhon et al., 2011) because of theire ability to accumulate

between it (Cunha et al., 2004). They remain either adherent to microbial cell

surfaces or are secreted in the culture broth (Olivera et al., 2009; Fathabad, 2011).

Biosurfactants have several advantages over the chemical surfactants, such as

lower toxicity; higher biodegradability, better environmental compatibility, higher

foaming, high selectivity and specific activity at extreme temperatures, pH, and

salinity, and the ability to be synthesized from renewable feed stocks (Fracchia et

al., 2012; Silva et al., 2014).

Recently, much attention has been given to biosurfactant due to their broad range

of functional properties as in food. In bakery and ice-cream formulations,

biosurfactant act by controlling the consistency, slowing staling and solubilizing

the flavour oils, while the therapeutic and biomedical applications of biosurfactant

act as antimicrobial activity, anticancer activity, anti-human immunodeficiency

virus and sperm immobilizing activity, agents for respiratory failure(Gautam

andTyagi , 2005), agents for the stimulation of skin fibroblast metabolism(Borzeix

and Frederique, 2003), and anti-adhesive agents in surgary (Chakrabarti, 2012).


9

Table (1-1): The main surfactant classifications (Schramm et al.,2003):

Class

Examples Structures

Anionic Na stearate

Na dodecyl sulfate

Na dodecyl benzene sulfonate

CH3(CH2)16COO¯Na_

CH3(CH2)11SO4¯Na_

CH3(CH2)11C6H4SO3¯Na_

Cationic Laurylamine hydrochloride

Trimethyl dodecylammonium

chloride

Cetyl trimethylammonium

bromide

CH3(CH2)11NH_Cl_

C12H25N_(CH3)3Cl_

CH3(CH2)15N_(CH3)3Br_

Non-ionic Polyoxyethylene alcohol

Alkylphenol ethoxylate

Polysorbate 80

w _x _ y _ z 20

R (C17H33)COO

Propylene oxide-modified

polymethylsiloxane

(EO ethyleneoxy, PO

propyleneoxy)

CnH2n_1(OCH2CH2)mOH

C9H19–C6H4 (OCH2CH2)nOH

Zwitterionic Dodecyl betaine

Lauramidopropyl betaine

Cocoamido-2-hydroxypropyl

sulfobetaine

C12H25N_(CH3)2CH2COO_

C11H23CONH(CH2)3N_(CH3)2CH2COO_

CnH2n_1CONH(CH2)3N_(CH3)2CH2CH(OH)CH2SO3

_

Although, most biosurfactant are considered to be secondary metabolites, some

may play essential roles for the survival of biosurfactant – producing


10

microorganisms through facilitating nutrients uptake or microbial – host

interactions or by acting as biocide agents or promoting the swarming motility of

microorganisms and participate in cellular physiological processes of signaling and

differentiation (Kearns and Losick, 2003; Das et al., 2008). Rhamnolipids, for

example, are essential to maintain the architecture of the biofilms and are

considered as one of the virulence factors in Pseudomonas sp. (Van - Hamme et al.,

2006; Arutchelvi et al., 2009).

1.2.5 Bioemulsifier:

Petroleum is a complex mixture of hydrocarbons, organic solvents and heavy

metals. Bacteria have designed strategic approaches to overcome the harsh effects

of organic solvents and heavy metals in contaminated soil by producing

exopolysaccharides / bioemulsifiers, which are amphipathic polysaccharides,

proteins, lipopolysaccharides, lipoproteins, or complex mixtures of these

biopolymers that stabilize oil-in-water emulsions (Robinson et al., 1996). It can

reduce the surface tension, interfacial tension of bacteria and increase the cell

surface hydrophobicity of bacteria there by enhancing the dispersal, emulsification

and degradation of hydrocarbon pollutants in the contaminated site (Al_ Tahhan et

al., 2000).

Bioemulsifiers are produced by many microorganisms. Acenitobacter

caicoaceticus RAG-1 producing emulsan, an extracellular polymeric bioemulsifier

has shown great application in oil industry (Fiechter, 1992). While liposan is a

bioemulsifier produced by Candida lipolytica, primarily composed of carbohydrate

(Amaral, 2006).The potential commercial applications of bioemulsifiers include

bioremediation of oil-polluted soil and water (Banat et al., 2000; Christofi and

Ivshina, 2002), enhanced oil recovery and the formation of stable oil-in-water

emulsions for the food and cosmetic industries (Klekner and Kosaric, 1993).


11

Also the natural role of bioemulsifier is in the formation of biofilms, increasing

the bioavailability of water insoluble substrates, regulating the attachment-

deatachment of microorganism to and from surface. Bioemulsifiers also have an

antimicrobial activity (Ron and Rosenberg, 2001). In addition, bioemulsifiers are

involved in cell-to-cell interactions such as bacterial pathogenesis, quorum sensing

and biofilm formation, maintenance and maturation. Some

biosurfactants/bioemulsifiers enhance the growth of bacteria on hydrophobic water-

insoluble substrates by increasing their bioavailability, presumably by increasing

their surface area, desorbing them from surfaces and increasing their apparent

solubility (Ron and Rosenberg, 2001; Van Hamme et al., 2006).

1.2.6 Importantce of bioemulsifier:

Microorganisms produce exopolysaccharide to perform diverse functions such

as biofilm formation (Kreft and Wimpenny, 2001), tolerance to hydrocarbons

(Aizawa et al., 2005), cryoprotectants (Kim and Yim, 2007), shield against

antimicrobials (Kumon et al., 1994), aggregation (Adav and Lee, 2008), biofouling

(Jain et al., 2007) and bioleaching of metals (Michel et al., 2009). Bioemulsifier

minimize health hazards of oil spills by bioremediation of specific microorganisms

(Kokare et al., 2007).

1.2.7 Classification of biosurfactant:

Unlike the chemically synthesized surfactants that are generally categorised on

the basis of the type of polar group present, biosurfactant are in general classified

chiefly by their chemical composition and microbial origin.

Rosenberg and Ron (1999) suggested that biosurfactant could be divided into

low molecular mass molecules that efficiently lower surface and interfacial

tension, and large molecular- mass polymers that are more efficient as emulsion-


12

stabilizing agents. The major classes of low – mass surfactants include

glycolipids, lipopeptides and phospholipids whereas high – mass surfactants

include polymeric and particulate surfactants, that classified according to their

structure: glycolipids, lipopeptides, fatty acids, phospholipids and polymeric

biosurfactant. While Healy et al. (1996) group biosurfactant into four main

categories namely, glycolipids, phospholipids, lipoproteins / lipopeptides and

polymeric biosurfactant. A further way to classify microbial surface active

compound is by the nature of hydrophilic part of the surface active compound such

as the carboxylate group of fatty acid, the glycerol of the glycerolipids, the

carbohydrate of glycolipids (Cooper and Zajic, 1980). While other distinguished

between different location of surface active compound in term which either adhere

to cell surface or are extracellulary in the growth medium (Kadhim et al., 2008).

Lastly, the biosurfactant can be divided into different kinds according to the

organism produced it, as shown in table (1-2).

1.2.8 Types of biosurfactant:

There are many types of biosurfactant that produced by various

microorganisms, the following are some of the various types of biosurfactant:

1.2.8.1 Glycolipid biosurfactant:

The most known biosurfactant are glycolipids, which are carbohydrates in

combination with long-chain aliphatic acids or hydroxyl aliphatic acids, the linkage

is by means of either ether or an ester group.


13

Table (1-2): Major biosurfactant classes and microorganisms involved (Chakrabarti, 2012).

Microorganism

Surfactant class

Glycolipids :

Pseudomonas aeruginosa Rhamnolipids

Rhodococcus erithropolis

Arthobacter sp. Trehalose lipids

Candida bombicola, C. apicola Sophorolipids

C. antartica Mannosylerythritol lipids

Ustilago zeae, U. maydis

Cellobiolipids

Lipopeptides :

Bacillus subtilis Surfactin/iturin/fengycin

P. fluorescens Viscosin

B. licheniformis Lichenysin

Serratia marcescens Serrawettin

Surface-active antibiotics:

Brevibacterium brevis Gramicidin

B. polymyxa Polymixin

Myxococcus xanthus Antibiotic TA

Fatty acids/neutral lipids :

Corynebacterium insidibasseosum Corynomicolic acids

C. lepus Fatty acids

Nocardia erythropolis Neutral lipids

Acinetobacter sp.

Corynebacterium lepus

Thiobacillus thiooxidans

Phospholipids

Polymeric surfactants:

Acinetobacter calcoaceticus Emulsan

A. radioresistens Alasan

C. lipolytica C. tropicalis

Lipomanan

Particulate biosurfactants :

A. calcoaceticus Vesicles and fimbriae

Cyanobacteria

(variety of bacteria)

Whole microbial cells


14

The fatty acid component usually has a composition similar to that of

phospholipids of the same microorganisms (Chen et al., 2007), while the

carbohydrate moiety is consist of mono- , di- , tri – and tetrasaccharides which

include glucose, mannose, galactose, glucuronic acid, rhamnose and galactose

sulphate (Veenanadig et al., 2000). Glycolipid biosurfactant consists of many type

as follow:

1.2.8.1.1 Rhamnolipids:

Are exoproducts of the opportunistic pathogen P. aeruginosa (Abdel-Mawgoud

et al., 2010). They composed of one or two molecules of rhamnose linked to one

or two molecules of β-hydroxydecanoic acid usually, but other fatty acids may be

found depending on the Pseudomonas species or growth conditions (Desai and

Banat, 1997).

Rhamnolipids from Pseudomonas spp. have been demonstrated to lower the

interfacial tension against n-hexadecane, they also emulsify alkanes and stimulate

the growth of P. aeruginosa on hexadecane. Also two unusual rhamnolipids,

designated myxotyrosides A and B, have been isolated from a Myxococcus sp.,

they have a rhamnose unit linked to tyrosine and hence to a fatty acid (Ohlendorf

et al., 2008).

1.2.8.1.2 Trehalolipids:

Several structural types of microbial trehalolipid biosurfactant have been

reported. These are known to be produced by microorganisms belonging to

mycolates group, such as Mycobacteria, Corynebacteria, Arthrobacter, Nocardia,

Gordonia and specially Rhodococcus.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Abdel-Mawgoud%20AM%5Bauth%5D


15

Most of the trehalose lipids synthesized by this group are bound the cell

envelope and are produced mainly when microorganisms are grown on

hydrocarbons probably as strategy to overcome the low solubility of hydrocarbons

and enhance their transport. Trehalolipids from different organisms differ in the

size and structure of mycolic acid, the number of carbon atoms, and the degree of

unsaturation (Desai and Banat, 1997). They are composed of trehalose (is a non-

reducing disaccharide ).

Most of the trehalose lipids synthesized by this group are bound to the two

glucose units which linked together either to mycolic acids in the Mycobacterium

and most species of Corynebacterium and Nocardia (Gautam and Tyagi, 2006) or

to corynomycolic or nocardomycolic in the case of rest species of

Corynebacterium and Nocardia (Shimakata and Minatogawa, 2000).

1.2.8.1.3 Sophorolipids:

These biosurfactant are a mixture of at least six to nine different hydrophobic

sophorosides. Consist of a dimeric carbohydrate sophorose linked to a long-chain

hydroxy fatty acid. They are produced mainly by yeasts such as T. bombicola,

T.petrophilum and T. apicola (Cooper and Paddock, 1984).

Torulopsis petrophilum produced sophorolipids on water-insoluble substrates

such as alkanes and vegetable oils. The sophorolipid, which were chemically

identical to those produced by T. bombicola, did not emulsify alkanes or vegetable

oils. Although sophorolipids can lower surface and interfacial tension, they are not

effective emulsifying agents (Desai and Banat, 1997).


16

1.2.8.2 Fatty acids biosurfactant:

Biosurfactant under this category are produced from alkane as a result of

microbial oxidations (Okoliegbe and Agarry, 2012). These fatty acids are either

straight chain acids, or complex fatty acids containing OH groups and alkyl

branches such as corynomucolic acids (Kretschner et al., 1982). But the most

active saturated fatty acids in lowering surface and interfacial tensions are in the

range of C12-C14 because the hydrophilic or lipophilic balance of fatty acids is

related to the length of the hydrocarbon chain (Rosenberg and Ron, 1999).

1.2.8.3 Phospholipids:

They form major components of microbial membranes, however, their level can

be increased greatly when certain hydrocarbon degrading bacteria or yeast were

grown on alkane substrate.

The quantitative production of phospholipids has also been detected in some

Aspergillus spp. and Arthrobacter strain AK-19 and T. thiooxidans and P.

aeruginosa 44T1, accumulate up to 40 to 80 % (wt/wt) of such lipids when

cultivated on hexadecane and olive oil(Desai and Banat, 1997).

1.2.8.4 Particulate biosurfactant:

Surface activity in most hydrocarbon- degrading micro-organisms are attributed

to several cell surface constituents, which includes extracellular membrane vesicles

partition hydrocarbons forming micro emulsion which play an essential role in

alkane uptake by microbial cells (Okoliegbe and Agarry, 2012). There are other

structures such as M protein and lipoteichoic acid in group A Streptococci, protein

A in S. aureus, layer A in A. salmonicida, prodigiosin in Serratia spp., gramicidins

in B. brevis spores and thin fimbriae in A. calcoaceticus )Singh et al., 2011).


17

The vesicles of Acinetobacter sp. strain HO1-N with a diameter of 20–50 nm

are composed of protein, phospholipids and lipopolysaccharide (Muthusamy et al.,

2008).

1.2.8.5 Lipopeptide biosurfactant:

A large number of cyclic lipopetides including decapeptide antibiotics

(gramicidins) and lipopeptide antibiotics (polymyxins), produced by B. brevis and

B. polymyxa, possess remarkable surface-active properties (Okoliegbe and Agarry,

2012). These consist of a lipid attached to a polypeptide chain. Other examples are

orinithine lipids, Iturin with surfactin being the best studied (Muthusamy et al.,

2008).

Biosurfactant are produced from several species of the genus Bacillus that can

be classified into three families (Ongena and Jacques, 2008):

Lipopeptides of the surfactin family

Lipopeptides of the iturin family

Fengycins and various lipopeptides.

The lipopeptide surfactin produced by B. subtilis, is one of the most powerful

biosurfactant. It lowers the surface tension from 72 to 27 mN/m (Jazeh et al., 2012)

figure (1- 1).

1.2.8.6 Polymeric biosurfactant:

Most of these biosurfactant are polymeric heterosaccharide containing proteins.

The best studied polymeric biosurfactant are emulsan, liposan, mannoprotein and

polysaccharide protein complexes (Okoliegbe and Agarry, 2012), which are

mainly produced by A. calcoacetius, C. lipolytica, S. cerevisiae, S.

malanogramma, U. maydis and Pseudomonas Spp. (Singh et al., 2011).


18

.

Figure (1-1): Structure of cyclic lipopeptide surfactin produced by B. subtilis ( Muthusamy

et al., 2008).

Figure (1-2): Emulsan Structure , produced by A.calcoaceticus, in which fatty acids are

linked to a heteropolysaccharide backbone (Desai and Banat, 1997).

Extracellular membrane vesicles partition hydrocarbons to form a microemulsion

play an important role in alkane uptake by microbial cells (Mukherjee et al., 2006;

Monteiro et al., 2007).


19

Acintobacter. calcoaceticus RAG-1 produces a potent polyanionic amphipathic

heteropolysaccharide bioemulsifier called emulsan (Dasai and Banat, 1997) figure

(1-2).

Geobacillus pallidus was able to grow on various hydrocarbons and produce

bioemulsfier with complex carbohydrates, lipid and protein (Zheng et al., 2011).

1.2.9 Methods used to detect biosurfactant producing microorganisms:

There are many methods used to screen and detect potential biosurfactant

producing microorganisms. These methods were as follows:

1.2.9.1 Drop collapse test:

The drop collapse test was performed to screen the biosurfactant production. It

is one of the qualitative methods.

Crude oil was applied to the well regions delimited on the covers of 96-well

microplates and these were left to equilibrate for 24 hrs. The supernatant

containing biosurfactant was transferred to the oil-coated well regions and a drop

size was observed after 1 min with the help of a magnifying glass. The result was

considered to be positive when the diameter of the drop was increased by 1mm

from that which was produced by distilled water already taken as the negative

control (Youssef et al., 2004).

1.2.9.2 Blood haemolysis test:

The biosurfactant producing isolate can be detected by blood heamolysis test

through fresh single colonies of the isolated cultures that were taken and streaked

on blood agar plates. These plates were incubated for 48 to 72 hrs. at 37 °C. The

plates were then observed and the presence of a clear zone around the colonies


20

indicated the presence of biosurfactant producing organisms (Anandaraj and

Thivakaran, 2010).

1.2.9.3 Emulsification index:

The emulsification index was carried out using petroleum (Jazeh et al., 2012),

five ml of hydrocarbon i.e., petrol was taken in a test tube to which 5 ml of cell

free supernatant obtained after centrifugation of the culture, was added and

vortexed for two minutes to ensure a homogenous mixing of both the liquids.

The emulsification index was observed after 24 hrs. and it was calculated by using

the formula:

E24% = total high of the emulsified layer / total high of the liquid layer X 100.

The calculations were done for all the cultures individually and their

emulsification activities were compared with each other

1.2.9.4 Emulsification activity:

The biosurfactant activity can determined by measuring the emulsification

activity, 0.5 ml of cell free supernatant was added to 7.5 ml of Tris-Mg buffer and

0.1 ml of dodecanese and mixed with a vortex for 2 min. The tubes were left for 1

hr. and absorbency was measured at 540 nm. Emulsification activity was defined

as the measured optical density, blank was Tris-Mg, dodecanese and mineral salt

broth without culture (Patel and Deasi, 1997).

1.2.9.5 Surface tension:

Surface tension measured by a du Nouy ring-type tensiometer is one of the

simplest techniques used. Biosurfactant activities can be determined by measuring

the changes in surface and interfacial tensions.


21

Surface tension at the air/water and oil/water interfaces can easily be measured

with a tensiometer. The surface tension of distilled water is 72 mN/m, and addition

some kind of surfactant lowers this value. When a surfactant is added to air/water

or oil/water systems at increasing concentrations, a reduction of surface tension is

observed up to a critical level (Satpute et al., 2010).

1.2.10 Recovery and purification of biosurfactant:

Most of the biosurfactant can be easily recovered from the culture medium by

using a combination of traditional techniques (Sen and Swaminathan, 2005).

Generally, a number of impurities are often co-extracted during the extraction

along with several structural types of the target biosurfactant, which are produced

in varying quantities. These may need to be evaluated by separating and removing

the impurities.

The selection of a method for purification and recovery of surfactants depends

on the nature of their charge, solubility characteristics, whether the product is

intracellular or extracellular, also on the economics of recovery and downstream

processing, physicochemical properties of the desired biosurfactant (Shaligram and

Singhal, 2010).

Different method used for biosurfactant/Bioemulsfier purification, include

precipitation, adsorption–desorption, ion exchange chromatography,

centrifugation, crystallization, filtration and precipitation, foam fractionation,

isoelectric focusing, solvent extraction, ultrafiltration, dialysis (Satpute et al.,

2010).

Many precipitation procedures are used such as, acetone precipitation which

has been used by several workers, to purify biosurfactant (Rosenberg et al., 1979),

while Phetrong et al. (2008) found that precipitation of emulsifier from A.

calcoaceticus subsp. Anitratus SM7 with ethanol was the most efficient method,


22

also acid precipitation method is easy, inexpensive and readily available to

recover crude biosurfactant such as surfactin, lipopeptides, glycolipids.

Acid hydrolysis is carried out by using concentrated HCl to bring down the pH,

so biosurfactant becomes insoluble at lower pH (Mukherjee et al., 2006). Some

biosurfactants molecules can adsorb and desorb from Amberlite XAD 2 or 16

polystyrene resins and therefore, this interaction is used for the purification of

biosurfactants. This process offers good examples of continuous recovery of BS

from fermentation broth as well as from concentrated foam, through an in situ

method that avoids end product inhibition (Satpute et al., 2010).

The foam fractionation is the technique, in which foam is allowed to overflow

from the bioreactor through a fractionation column, resulting in a highly

concentrated product, due to the outstanding features of this technique, such as

high effectiveness, high purity of product, low space requirements and

environmentally friendly. There are a number of reports that presented foam

fractionation as one of the most efficient methods in biosurfactant recovery (Noah

et al., 2002; Chen et al., 2006; Sarachat et al., 2010).

Separation of biological molecules using ultrafiltration membrane systems has

been very popular. Biosurfactant molecules are also characterized by their ability

to form micelles or miceller aggregates at concentrations higher than the critical

micelle concentration (CMC) and hence can easily retained by high molecular

weight cut-off ultrafiltration membranes (Chtioui et al., 2005 ).

In addition, column chromatography is a relatively inexpensive method that can

be used to purify biosurfactant. Itoh et al. (1971) used this technique for the

excessive carbon sources such as fatty acids and other impurities that are

coextracted with the glycolipids can be removed, while Kiran et al. (2009) used

column chromatography with a step wise elution for the purification of

biosurfactant.

http://www.intechopen.com/books/progress-in-molecular-and-environmental-bioengineering-from-analysis-and-modeling-to-technology-applications/improving-biosurfactant-recovery-from-pseudomonas-aeruginosa-fermentation#B15





23

1.2.11 Techniques used for biosurfactant characterization:

1.2.11.1 Fourier transform infrared spectrophotometer (FTIR):

The activity of biosurfactant depends on their structural components, the types

of hydrophilic and hydrophobic groups and their spatial orientation (Bonmatin et

al., 1994). Surfactin, lichenysin and rhamnolipids have been characterized by the

FTIR technique (Das et al., 2008). Also the Alkyl, carbonyl, ester compounds of

biosurfactant are detected clearly (Tuleva et al., 2002). FT-IR spectra of the

purified bioemulsifier, which exhibited the typical feature characteristics of

heteropolysaccharide, in which abroad band was observed around 3428 cm and a

weak C–H stretching band at 2923 cm which attributed to the characteristic for O–

H content, typical of polysaccharide.

1.2.11.2 High Performance Liquid Chromatography:

High-performance liquid chromatography (HPLC) is a type of liquid

chromatography used to separate and quantify compounds that have been dissolved

in solution. HPLC is used to determine the amount of a specific compound in a

solution. In HPLC and liquid chromatography, where the sample solution is in

contact with a second solid or liquid phase, the different solutes in the sample

solution will interact with the stationary phase. The differences in interaction with

the column can help separate different sample components from each other

(Kupiec, 2004). Since the compounds have different motilities, they exit the

column at different times, they have different retention times, Rt.

The retention time is the time between injection and detection. There are

numerous detectors which can be used in liquid chromatography. It is a device that

senses the presence of components different from the liquid mobile phase and

converts that information to an electrical signal. For a qualitative identification one

must rely on matching retention times of known compounds with the retention


24

times of components in the unknown mixture (Brown et al., 1997; Holler and

Saunders, 1998). High performance liquid chromatography (HPLC) is not only

appropriate for the complete separation of different biosurfactant, but can also be

coupled with various detection devices (UV, MS, evaporative light scattering

detection, ELSD) for identification and quantification of biosurfactant (Heyd et al.,

2008). S. marcescens can cause biodegradation for palmarosa oil (green oil); the

compounds have been identified by HPLC, the HPLC of palmarosa oil shows three

peaks, it indicates that oil contains three compounds (Mohanan et al., 2007).

1.2.11.3 Analysis of biosurfactant by gas chromatography:

Gas chromatography (GC), is a common type of chromatography used in

analytical chemistry for separating and analyzing compounds that can be vaporized

without decomposition. Typical uses of GC include testing the purity of a

particular substance, or separating the different components of a mixture (the

relative amounts of such components can also be determined). In some situations,

GC may help in identifying a compound. In preparative chromatography, GC can

be used to prepare pure compounds from a mixture (Pavia et al., 2006).

The chemical analysis uses gas chromatography (GC) and mass spectroscopy

(MS): This consists of a GC column and a mass interface. The ionization source is

electron impact or chemical. The mass analyzer magnetic sector has a quadrapole,

iron trap, time of flight and mass detector. It is provided with the software MS

facility which acts as a gas chromatograph. MS measures the molecular weight of a

compound. Separate peaks arising in the GC column and enter in MS. The heat

transfer line keeps the compound in the gaseous phase as they enter in the MS. In

the ionization chamber, and under a high voltage, the filament is heated up and

http://en.wikipedia.org/wiki/Chromatography

http://en.wikipedia.org/wiki/Analytical_chemistry

http://en.wikipedia.org/wiki/Separation_process

http://en.wikipedia.org/wiki/Vaporized

http://en.wikipedia.org/wiki/Chemical_decomposition

http://en.wikipedia.org/wiki/Preparative_chromatography


25

provides an electron source. Peaks get transferred to a mass analyzer via focused

charged plates and they focus the ions (Satpute et al., 2010).

1.2.11.4 Nuclear magnetic resonance (NMR) for biosurfactant analysis:

Nuclear magnetic resonance (NMR) is a spectroscopic technique that detects the

energy absorbed by changes in the nuclear spin state. NMR spectroscopy is the

only method that allows the determination of three-dimensional structures of

proteins molecules in the solution phase. The principle of NMR spectroscopy in

which the atomic nuclei with odd mass numbers has the property spin, this means

they rotate around a given axis. The nuclei with even numbers may or may not

have this property. A spin angular momentum vector characterizes the spin. The

nucleus with a spin is in other words a charged and spinning particle, which in

essence is an electric current in a closed circuit, well known to produce a magnetic

field. The magnetic field developed by the rotating nucleus is described by a

nuclear magnetic moment vector, which is proportional to the spin angular moment

vector. The strength of the applied magnetic field has a significant impact on the

quality of the recorded spectra. The NMR spectrum was used to show the

exopolysaccharide (Kumar et al., 2004). While Smyth et al. (2010) used NMR

methodology to analyses glycolipid biosurfactant.

1.2.12 The main applications of surface active compounds:

1.2.12.1 The antitumor activity:

The problems of systemic toxicity and drug resistance in cancer chemotherapy

urge the continuing discovery of new anticancer agents. It explore the specific

anticancer activity from microbial metabolites to find new compounds. One of the

most thrilling results that have been recently reported for biosurfactant its potential


26

ability to act as anti-tumour agents interfering with some cancer progression

processes (Rodrigues, 2011; Fracchia et al., 2012).

Chiewpattanakul et al. (2010) mentioned that monoolein biosurfactant from E.

dermatitidis has the most prominent antiproliferative effect against the cervical

cancer (HeLa) and leukemia (U937) cell lines in a dose-dependent manner, while

Kim et al. (2007) evaluated the anti tumer activity of lipopeptid biosurfactant

(surfactin) on the human colon carcinoma cell line LoVo, they found that the

lipopeptide has a strong growth inhibitory activity by inducing apoptosis and cell

cycle arrest.

Furthermore Duarte et al. (2014) indicated that the apoptosis of breast cancer

cell line is due to the disturbance of the cellular fatty acid composition by

lipopeptides.

In addition viscosin, an effective surface-active cyclic lipopeptide, recovered

from P. libanensis M9-3, inhibited of the metastatic prostate cancer cell line PC-

3M without visible toxicity effects (Saini et al., 2008).

The reactive oxygen species (ROS) and Ca2+

have an impact on mitochondria

permeability transition pore (MPTP) activity, and MCF-7 cell apoptosis induced by

surfactin. Surfactin initially induce the ROS formation, leading to the MPTP

opening accompanied with the collapse of mitochondrial membrane potential

which leads to an increase in the cytoplasmic Ca2+

concentration. In addition,

cytochrome C has been released from mitochondria to cytoplasm through the

MPTP which activated caspase-9, eventually inducing apoptosis (Cao et al., 2011).

In addition MEL was also reported to markedly inhibit the growth of mouse

melanoma B16 cells in a dose-dependent manner. Moreover, MEL exposure

stimulated the expression of differentiation markers of melanoma cells, such as

tyrosinase activity and the enhanced production of melanin, which is an indication

that MEL triggered both apoptotic and cell differentiation mechanisms.


27

Isoda et al. (1995) investigated the biological activities of seven extracellular

microbial glycolipids, including MEL-A, MEL-B, polyol lipid, rhamnolipid, SL

and succinoyl trehalose lipids STL-1 and STL-3, except for rhamnolipid, all the

other glycolipids tested induced cell differentiation instead of cell proliferation in

the human promyelocytic leukaemia cell line HL60.

The serratamolide AT514, cyclic depsipeptide from S. marcescens, belonging to

the group of serrawettins, has also been reported to be a potent inducer of apoptosis

of several cell lines derived from various human tumors and B-chronic

lymphocytic leukemia cells, it primarily involvs the mitochondria-mediated

apoptotic pathway and interference with Akt/NF-kB survival signals (Matsuyama

et al., 2010).

1.2.12.2 Antimicrobial activity:

One useful property of many biosurfactant was their antimicrobial activity

(Rahman and Ano, 2009). Some biosurfactant are a suitable alternative to

synthesized medicines and may be used as safe and effective therapeutic

agents, as they have a strong antibacterial, antifungal and antiviral activity (Irfan et

al., 2015).

The biosurfactant was produced by marine B. circulans that had a potent

antimicrobial activity against Gram-positive and Gram-negative pathogenic and

semi-pathogenic microbial strains including multidrug resistance (MDR) strains

(Das et al., 2009). Also Rodrigues et al. (2004) evaluated the antimicrobial

activity of two biosurfactant obtained from probiotic bacteria, L. lactis 53 and S.

thermophilus A, against a variety of bacterial and yeast strains isolated from

explanted voice prostheses.

http://www.scialert.net/asci/result.php?searchin=Keywords&cat=&ascicat=ALL&Submit=Search&keyword=antimicrobial+activity

http://scialert.net/fulltext/?doi=ajdd.2011.58.69&org=10#526711_ja




28

The rhaminolipids are highly valued for their antimicrobial activity with lesser

toxicity when compared to their chemical counterparts (Kulakovskaya, 2003; Haba

et al., 2003).

As well as the MEL-A and MEL-B produced by C. antarctica strains have also

been reported to exhibit antimicrobial action against Gram-positive bacteria

(Kitamoto et al., 1993).

Similarly bioactive fractions from the marine B.circulans biosurfactant had an

antimicrobial action against various Gram-positive and Gram negative pathogenic

and semi-pathogenic bacteria including M. flavus, B. pumilis, M. smegmatis, E.

coli, S. marcescens, P. vulgaris, C. freundii, P. mirabilis, A. faecalis, A.

calcoaceticus, B. bronchiseptica, K. aerogenes and E. cloacae (Das et al., 2008).

Fernandes et al. (2007) investigated the antimicrobial activity of biosurfactant

from B. subtillis R14 against 29 bacterial strains, they demonstrated that

lipopeptides have a broad spectrum of action, including antimicrobial activity

against microorganisms with multidrug-resistant profiles. B. pumilis cells were

found to produce pumilacidin A, B, C, D, E, F and G, which exhibited antiviral

activity against HSV-1 and inhibitory activity against H+, K+-ATPase, and were

also found to be protective against gastric ulcers, probably through the inhibition

of microbial activity contributing to these ulcers (Naruse et al.,1990).

The production of an extracellular, low molecular weight, protease-resistant

thermostable glycolipid fungicide from the yeast P. fusiformata (Ustilaginales),

this fungicide was active against >80 % of the 280 yeast and yeast-like species

tested under acidic conditions (pH 4.0) at 20–30 ºC (Golubev et al., 2001). The

cellobiose lipid flocculosin isolated from P. flocculosa, was shown to display in

vitro antifungal activity against several pathogenic yeasts, associated with human

mycoses, including C. lusitaniae, C. neoformans, T. asahii and C. albicans (Mimee

et al., 2005). And Nielsen et al., (1999) reported viscosinamide, a cyclic




29

depsipeptide, to be a new antifungal surface-active agent produced by

Pseudomonas fluorescens, with different properties compared with the

biosurfactant viscosin, known to be produced from the same species and shown to

have an antibiotic activity .

The appearance of the antiviral activity of some lipopeptides therefore may take

place as a result of the viral lipid envelope and capsid disintegration due to ion

channels formation, with consequent loss of the viral proteins involved in virus

adsorption and/or penetration (Jung et al., 2000; Seydlová and Svobodová, 2008).

In addition the high molecular weight biosurfactant the massetolides A–H, and

cyclic depsipeptides, were isolated from the Pseudomonas species, derived from a

marine habitat, and found to exhibit in vitro antimicrobial activity against M.

tuberculosis and M. avium-intracellulare (Gerard et al., 1997).

1.2.12.3 Antiadhesion:

Biosurfactant have been found to inhibit the adhesion of pathogenic organisms

to solid surfaces or to infection sites, making them useful for treating many

diseases as therapeutic and probiotic agents.

Pre-coating vinyl urethral catheters by running the surfactin solution through

them before inoculation with media resulted in a decrease in the amount of biofilm

formed by S. typhimurium, S. enterica, E. coli and P. mirabilis (Rodrigues et al.,

2004).

Heinemann et al. (2000) showed that L. fermentum RC-14 releases surface-

active components that can inhibit adhesion of uropathogenic bacteria, including E.

faecalis.

The pulmonary surfactant is a lipoprotein complex synthesized and secreted by

the epithelial lung cells into the extracellular space, where it lowers the surface

tension at the air–liquid interface of the lung and represents a key factor against




30

infections and inflammatory lung diseases (Wright, 2003). The important feature

that the biosurfactant obtained from S. thermophilus A was more effective against

R. dentocariosa GBJ 52/2B, which is one of the strains responsible for valve

prosthesis failure (Rodrigues et al., 2006a).

Precursors and degeneration products of sphingo lipid biosurfactant were found

to inhibit the interaction of S. mitis with buccal epithelial cells and S. aureus with

nasal mucosal cells (Bibel and Aly, 1992).

1.2.12.4 Food application:

In addition to other application of biosurfactant, food line have been given many

enhancements by decrease surface and interfacial tension, thus facilitating the

formation and stabilization of emulsions. In addition to control the aggregation of

fat globules, stabilization of aerated systems, improvement of texture and shelf-

life of products containing starch, modification of rheological properties of wheat

dough and improvement of constancy and texture of fat-based products (Shoeb et

al., 2013). They are also utilized as fat stabilizers and anti spattering agent during

cooking of oil and fats (Kosaric, 2001).

The improvement in the stability of dough, volume, texture and conservation of

bakery products is obtained by the addition of rhamnolipid surfactants (Van

Haesendonck and Vanzeveren, 2004). Moreover L-Rhamnose which already has

an industrial application as precursor of high-quality flavor components like

furaneol is obtained by hydrolyzing rhamnolipid surfactants produced by P.

aeruginosa (Linhardt et al., 1989).


31

1.2.12.5 Environmental applications:

Bioremediation, dispersion of oil spills, enhanced oil recovery and transfer of

crude oil are some examples of environmental applications of biosurfactant

(Shafiei et al., 2014).

Heavy crude oil recovery, facilitated by microorganisms, was suggested in the

1920s and received growing interest in the 1980s as microbial enhanced oil

recovery (MEOR), although there were not many reports on productive microbial

enhanced oil recovery project using biosurfactant and microbial biopolymers. In

MEOR processes, the microbes are applied for the enhanced recovery of oil from

the oil reservoirs and can be considered as applied processes of in situ

bioremediation (Van Hamme et al., 2003).

Emulsification properties of biosurfactant make them potentially useful tools

for oil spill pollution-control by enhancing hydrocarbons degradation in the

environment (Bertrand et al., 1994). The biosurfactant are involved in

bioremediation in two ways: by increasing the surface area of hydrophobic water

insoluble substrate and by increasing the bioavailability of hydrophobic water

insoluble substances. The bioremediation of some contaminated sites are limited

due to the low water-solubility of many hydrocarbons, which reduce their

availability to micro-organisms. It has been assumed that surfactants can be used to

enhance the bioavailability of hydrophobic compounds (Atlas and Cerniglia,

1995).

Thermophilic and halophilic bacteria capable of the living at 80 to 110 ˚C under

anaerobic conditions hold a promise to be used in the system (Margesin and

Schinner, 2001), and the respective isolates potentially useful for microbial

enhanced oil recovery have been described (Yakimov et al.,1997).


32

Marchant et al. (2002) examined the ability Geobacillus isolates in soil and oil

contamination remediation throughout the utilization of a wide range of alkanes.

Also biosurfactant have many other application as shown in table (1-3).

1.2.13 Biosynthesis of biosurfactant :

Amphiphilic structure, the hydrophobic moiety is either a long-chain fatty acid,

a hydroxy fatty acid, or a-alkylb- hydroxy fatty acid, and the hydrophilic moiety

may be a carbohydrate, carboxylic acid, phosphate, amino acid, cyclic peptide, or

alcohol. Two primary metabolic pathways, namely, hydrocarbon and carbohydrate,

are involved in the synthesis of their hydrophobic and hydrophilic moieties,

respectively. The pathways for the synthesis of these two groups of precursors

are diverse and utilize specific sets of enzymes. In many cases, the first enzymes

for the synthesis of these precursors are regulatory enzymes (Hommel and

Ratledge, 1993).

Kinetics of biosurfactant production can be grouped in four main types (Desai

and Banat, 1997).

The first type is the production under growth-limiting conditions; this has been

extensively demonstrated in P. aeruginosa with an overproduction of biosurfactant

in limitation of nitrogen and production of bioemulsifier by C. tropicalis IIP-4 and

the synthesis of the glycolipid by Nocardia strain SFC-D seems to follow this

pattern too.

The second one is a growth- associated production in which there is a

relationship among growth, substrate utilization and biosurfactant production. This

behaviour has been observed in the production of rhamnolipids by some strains of

Pseudomonas and in the biosynthesis of biodispersan.


33

Table (1-3) Industrial applications of chemical surfactants and biosurfactant (Muthusamy

et al., 2008).

Industry

Application

Role of surfactants

Petroleum

Enhanced oil recovery

Improving oil drainage into well bore; stimulating release of oil

entrapped by capillaries; wetting of solid surfaces; reduction of oil

viscosity and oil pour point; lowering of interfacial tension;

dissolving of oil

De-emulsification

De-emulsification of oil emulsions; oil solubilization; viscosity

reduction, wetting agent

Environmental

Bioremediation

Emulsification of hydrocarbons; lowering of interfacial tension;

metal sequestration

Soil remediation and flushing

Emulsification through adherence to hydrocarbons; dispersion;

foaming agent; detergent; soil flushing

Food

Emulsification and

de-emulsification

Emulsifier; solubilizer; demulsifier; suspension, wetting, foaming,

defoaming, thickener, lubricating agent

Functional ingredient Interaction with lipids, proteins and carbohydrates, protecting

agent

Biological

Microbiological

Physiological behaviour such as cell mobility, cell communication,

nutrient accession, cell–cell competition, plant and animal

pathogenesis

Pharmaceuticals and therapeutics

Antibacterial, antifungal, antiviral agents; adhesive agents;

immunomodulatory molecules; vaccines; gene therapy;

microbubble preparation

Agricultural

Biocontrol

Facilitation of biocontrol mechanisms of microbes such as

parasitism, antibiosis, competition, induced systemic resistance

and hypovirulence

Bioprocessing

Downstream

processing

Biocatalysis in aqueous two-phase systems and microemulsions;

biotransformations; recovery of intracellular products; enhanced

production of extracellular enzymes and fermentation products

Cosmetic

Health and beauty products

Emulsifiers, foaming agents, solubilizers, wetting agents,

cleansers, antimicrobial agent, mediators of enzyme action


34

The productions of glycoprotein AP-6 by P. fluorescens surface-active agent

by B. cereus IAF 346, and biodispersan by Bacillus sp. strain IAF-343 are all

examples of growth-associated biosurfactant production (Persson et al.,1988).

Emulsan-like substance accumulates on the cell surfaces during the exponential

phase of growth and is released into the medium when protein synthesis decreases

(Shabtai and Gutnick, 1985 ).

The third production is by resting or immobilized cells is a type of biosurfactant

production in which there is no cell multiplication. The cells nevertheless continue

to utilize the carbon source for the synthesis of biosurfactant and

mannosylerythritol lipid production by C. antarctica (Kitamoto et al.,1993),

sophorolipid production by T. bombicola.

The fourth the production is done with precursor supplementation in which the

addition of biosurfactant precursors to the growth medium causes both qualitative

and quantitative changes in the product. Similarly, increased production of

biosurfactant containing different mono-, di-, or trisaccharides was reported to

occur in A. paraffineus DSM 2567( Li et al., 1984).

1.2.14 Genetics of biosurfactant biosynthesis:

There are numerous reports on the isolation of mutants deficient in biosurfactant

production with a contaminant loss in the ability to grow on water-insoluble

substrates (Gervasio et al., 2009).

Ochsner et al. (1994) have extensively studied the genetics of rhamnolipid

biosynthesis in P. aeruginosa. The rhI ABR gene cluster was found to be

responsible for the synthesis of RhIR regulatory protein and a rhamnosyl

transferase, both essential for rhamnolipid synthesis, but in the E. coli active

rhamnosyl transferase was synthesized but rhamnolipid were not produced

(Ochsner et al., 1995).


35

The organization of the biosynthetic gene cluster of surfactin was published in

the early 1990s by different researcher groups (Cosmina et al., 1993; Fuma et al.,

1993). It suggested the involvement of three chromosomal genes (sfp, srf A,and

comA) in biosynthysis of the surfactin production suggested (Nakano et al., 1992;

Nakano and Zuber, 1993).

The detailed knowledge of the genetics of microbial surfactant production

should be used to produce organisms giving higher production with better product

characteristics. The molecular genetics of biosynthesis of alasan and emulsan

by Acinetobacter species and of the fungal biosurfactant such as

mannosylerythritol lipids (MEL) and hydrophobins have been deciphered (Das et

al., 2008).

Rusansky et al. (1987) described the isolation and partial characterization of an

oil-degrading microorganism, A. calcoaceticuis RA57 was found to contain four

plasmids. Evidence referred that one of the plasmids, pSR4 (20 kilobases [kb]), is

required for optimal growth on crude oil in liquid culture. While Pines and

Gutnick, (1986) demonstrated that the mutant A. Calcoaceticus RAG1 strain l lacks

its ability to grow on crude oil.

Chapter two

Materials

And Methods

Chapter two Materials and methods

36

2. Materials and Methods:

2.1 Materials:

2.1.1 Equipments and Apparatus:

The following equipments and apparatus were used throughout this study:

Equipment

Company (origin)

Agarose gel tank with power supply BioRad - Germany

Autoclave GallenKamp - England

Balance Ohans - France

Cooling centrifuge Hettich - Germany

Compound light microscope Olympus - Japan

Distillator GFL – Germany

Eppendrof centrifuge Eppendorf - Germany

Elisa reader Awareness - USA

Fourier Transform Infra –Red Shimadzu - Japan

Fluorescence microscope Olympus

Flask of tissue culture :plastic

disposable Iwaki – Japan

Freeze –Dryer (lyophilizer) Labcon – USA

Gas chromatography Shimadzu

Hot plate with magnetic stirrer Gallenkamp

HPLC Shimadzu

Incubator Gyromax – USA

Incubator with CO2 supply Thermo electron corporation - USA

Laminer air flow Heraeus – Germany

Micropipettes Eppendorf - Germany


37

2.1.2 Chemicals: The following chemicals were used in this study:

Material Company(Origin)

Agar-agar Hi media - India

Acetic acid Riedel-Dehaeny - Germany

Acetone Sigma – USA

Agarose Sigma

Alcohol BDH - England

Ammonium chloride- NH4Cl Sigma

Ammonium sulphate- (NH4 )2SO4 Sigma

Ammonium nitrate (NH4NO3) Sigma

96 Well microtiter plate, 6 well plate BD falcon – USA

Millipore filter paper unit Millipore corp - USA

Nanodrop spectrophotometer Bio rad

Nuclear magnetic resonance Bruker – UK

Oven Memmert - Germany

pH-meter Crison – Spain

Sensitive balance Sartorius - Germany

Shaker incubator GallenKamp

Tensiometer Kruss – Germany

Thermo cycle T-5000 Biometra – England

Spectrophotometer Aquarius – UK

UV- transiluminator Ultraviolet products - USA

Water bath Memmert - Germany


38

Boric acid Sigma

Bovine serum albumin BDH - England

n-Butanol BDH

Calcium chloride- CaCl2 Sigma – USA

Chloroform Sigma

Coomassie Brilliant Blue G-250 Sigma

Copper sulphate pentahydrate CuSO4

.5H2O

Sigma

Crude oil Al- Durra refinery - Iraq

Diethyl ether GCC - Germany

Dimethyle- α-naphthylamine Sigma

Dipotassium hydrogen phosphate

(K2HPO4) BDH

Disodium hydrogen phosphate

(Na2HPO4) BDH

Ethyl acetate Sigma

Ethylene diamine tetra acetic acid

(EDTA) Sigma

Fructose Sigma

Glucose Sigma

Hexane Sigma

Hydrochloric acid Sigma

Hydrogen peroxide (H2O2) BDH

Iodine BDH

Magnesium sulphate(MgSO4,

MgSO4.4H2O) Sigma


39

Manganese sulphate (MnSO4.4 H2O,

MnSO4. 7H2O) Sigma

Manganese chloride

monohydrate(MnCl.H2O) Sigma

Methanol Sigma

Peptone Sigma

Phenol Riedel-Dehaeny - Germany

Phosphate buffer saline(PBS) Sigma

Phosphoric acid Sigma

Potassium dihydrogen

phosphate(KH2PO4) BDH

Potassium chloride (KCl) BDH

Potassium nitrate (KNO3) BDH

Sillica gel 60 BDH

Sodium chloride (NaCl) Sigma

Sodium nitrate (NaNo3) BDH

Sulfanilic acid Sigma

Sulfuric acid (H2SO4) Analar – England

Sun flower oil Commercialy

Tris-HCL BDH

Tris-base BDH

Trypan blue Sigma

Urea Sigma

Vanillin Sigma

Yeast extract Sigma

http://en.wikipedia.org/wiki/Potassium


40

2.1.3 Reagents and Solutions:

2.1.3.1 Phosphate buffer saline (PBS 1 %):

It was prepared by dissolving 10 gm of PBS in 1 liter of sterilized D.W.

2.1.3.2 Catalase reagent:

Hydrogen peroxide (H2O2) 3 % was prepared for detection the catalase production

(Atlas et al., 1995).

2.1.3.3 Oxidase reagent:

One gm of tetra methyl – p – phenylenediamine dihydrochloride was dissolved in

100 ml of distilled water (D.W) and kept in dark bottle at 4 °C (the reagent should be

used fresh). This reagent was used for detection the oxidase production (Benson,

2002).

2.1.3.4 Nitrate test reagent (Atlas et al., 1995).

This reagent consists of two solutions:

Solution A: it was prepared by adding 0.8 gm of sulfanilic acid to 5 N acetic acid up

to 100 ml.

Solution B: it was prepared by adding 0.5 gm of dimethyle- α-naphthylamine to 5 N

acetic acid up to 100 ml.

Equal volumes of solution A and solution B were immediately mixed before use.


41

2.1.3.5 Trace element solution (Kadhim et al., 2008):

It was prepared by dissolve the following component in D.W.:

Component Weight(gm)

ZnSO4.7 H2O 2.32

MnSO4.4H2O 1.78

CuSO4.5H2O 1

Boric acid 0.56

EDTA 1

NiCl2.6H2O 0.004

KI 0.66

All components were dissolved in 950 ml of D.W, then volume was completed to

1000 ml in volumetric flask, pH was adjusted to 7 and sterilized by filtration.

2.1.3.6 Tris – Mg solution:

Composed of 20 mM (Tris - HCl, pH 7) and 10 mM (MgSO4) (Bach et al., 2003).

2.1.3.7 Tris – HCl solution ( 0.1 M ) and ( 0.2 M ):

* For preparing 0.1 M of Tris – HCl, 7.88 gm was dissolved in 100 ml then

complet the volume to 500 ml with D.W, pH was adjusted to 7.5.

* Tris – HCl (0.2 M) was prepared by dissolving 4.73 gm of Tris –HCl in 100

ml then complet the volume to 150 ml with D.W, pH was adjusted to 7.5 (Maneerat

and Dikit, 2007).

2.1.3.8 Tris – base solution (0.2 M):


42

This buffer was prepared by dissolving 1.211 gm of Tris-base in 10 ml then

complet the volume to 50 ml with D.W, pH was adjusted to 8, 9 and 10 (Maneerat

and Dikit, 2007).

2.1.3.9 Salts solutions:

Different salts included: NaCl, KCl and CaCl2 were prepared at different

concentrations (2%, 4%, 8%, 12%, 16% and 20%), by dissolving these salts in 0.1 M

of Tris-HCl (pH 7).

2.1.3.10 Solutions for lipid estimation:

The following solutions were used for estimation the total lipid (Kaufmann and

Brown, 2008):

Sulfuric acid (98 %).

Vanillin – phosphoric acid reagent :

It was prepared by dissolving 600 mg vanillin in 100 ml deionized hot water, then

400 ml of 85 % phosphoric acid was added and stored in dark.

2.1.3.11 Solutions for protein estimation (Bradford, 1976):

Bovine serum albumin (BSA) stock solution :

It was prepared by dissolved 1 mg of bovine serum albumin in 1 ml of D.W to

obtain final concentration 1000 µg /ml (stock solution). Different concentrations of

BSA (0-130 µg/ml) were prepared from the stock solution for making standard curve.

Bradford reagent:

It was prepared by dissolving 100 mg Coomassie Brilliant Blue (G-250) in 50 ml

of 95 % ethanol, then 100 ml of 85 % (w/v) phosphoric acid was added. The volume


43

was completed to 1 L with sterile D.W., when the dye was completely dissolved,

filtered through Whatman #1 paper just before use.

2.1.3.12 Solutions for carbohydrate estimation:

The following solutions were used for estimation of total carbohydrate by phenol –

sulfuric acid method (Dubois et al., 1956):

Stock solution of glucose:

This solution was prepared by dissolving 100 mg of glucose in 100 ml of sterile

D.W., to obtain a final concentration of 1000 µg/ml. Different concentrations of

glucose (0-1000 µg/ml) were prepared to obtain the standard curve of glucose.

Phenol solution (5 %):

A weight of (5) gm of phenol crystal was dissolved in 10 ml of D.W., the volume

was completed to 100 ml.

Sulfuric acid (98 %).

2.1.3.13 Heat inactivated fetal bovine serum:

It was prepared according to Wang et al. (2007) by incubating fetal bovine serum

in the water bath at 56 ºC for 30 min.

2.1.4 Primer:

The following primer was used in this study:

Primer name Primer sequence 5’----3’ Uses References

Sfp F ATGAAGATTTACGGAATTTA Bacillus

Sekhon et al.

(2011) Sfp R TTATAAAAGCTCTTCGTACG


44

2.1.5 Culture media:

2.1.5.1 Ready made culture media:

Culture media

Company (Origin)

Muller – Hinton broth BDH –England

Muller –Hinton agar BDH

Nutrient agar

Fluka- Germany

Nutrient broth

Fluka

These media were prepared as recommended by the manufacturing company and

sterilized by autoclaving at 121 ºC for 15 min.

2.1.5.2 Laboratory prepared media:

Luria-Bertani (LB) medium (Nazina et al., 2001).

This medium was prepared by dissolving tryptone (10 gm), yeast extract (5 gm)

and NaCl (5 gm) in 950 ml D.W., pH was adjusted to 7, the volume was completed to

1L, sterilized by autoclaving, cooled to 45 ºC then 1 ml of (0.1 M) MnCl.H2O

(autoclaved separately) was added.

Nitrate medium :

This medium was composed of 5 gm peptone supplemented with 0.2 gm KNO3 in

1L of D.W., pH was adjusted to 7, and distributed in tubes, then sterilized by

autoclaving (Atlas et al., 1995).


45

Mineral salt medium (MSM):

Chemically defined medium was prepared according to the method described by

Yakimov et al. (1995) with modification:

Component Weight (gm)

NH4Cl 4

NaCl 4

KH2PO4 3

Na2HPO4 6

MgSO4 0.1

These components were dissolved in 950 ml distilled water, and 2.5 ml trace

element solution prepared as in item (2.1.3.5) was added, pH was adjusted to 7, and

the volume was completed to 1000 ml then sterilized by autoclave. This medium was

used to detect the ability of bacterial isolates to produce biosurfactant.

RPMI 1640 medium(Sigma- USA):

This medium was enriched with 10 % heat inactivated fetal bovin serum (item

2.1.3.13),100U/ml penicillin and 100 µg/ml streptomycin.

EMEM medium(Thermo- USA):

It contains the following supplements: 10 % of fetal bovine serum, 1 mM of

sodium pyruvate, 1X non-essential amino acids, 100 units/ml of penicillin and 100

μg/ml streptomycin. This medium was used for the cytotoxicity test.


46

2.1.6 Kits used in this study:

Extraction of genomic DNA:

The genomic DNA was extracted from different bacterial isolates using Wizard

Genomic DNA purification Kit (Promega, USA). It consists of the following:

Cell Lysis Solution, Nuclei Lysis Solution, RNase Solution, Protein Precipitation

Solution, DNA Rehydration Solution.

PCR master mix (2 X):

It was supplied by Promega company, USA. The solutions were composed of the

following:

PCR master mix (2 X) (Promega)

DNA polymerase (5 U/μl)

DNTPs

PCR reaction buffer

MgCl2

Cell titer 96 non- radioactive cell proliferation assay (MTS assay, promega-

USA):

- A weight of 1.90 mg /ml of tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-

5 (3 carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt, MTS].

- 300 µM of an electron coupling reagent (phenazine ethosulfate) PES.

- Dissolving in Dulbecco´s phosphate- buffered saline (pH 6.0).


47

Multiparameter Cytotoxicity kit (Thermo- USA) :

- Kit contents:

Contents Volume

Cytochrome C Primary Antibody 75 µl

DyLight TM

649 Conjugated Goat-Mouse Antibody 72 µl

Mitochondrial Membrane Potential Dye 1 µl

Permeability Dye 25 µl

Hoechst Dye 30 µl

Wash Buffer ( 10 X Dulbeccos PBS ) 100 ml

Permeabilization Buffer ( 10 X Dulbecco's PBS with 1% Triton X-100) 100 ml

Blocking Buffer ( 10 X ) 85 ml

Thin Plate Seal Assembly 7/ pack

Solutions for multiparameter cytotoxicity test:

The following solutions were prepared for cytotoxicity test:

Solution Preparation

A- 1X Wash Buffer

20 ml of 10X Wash Buffer was added to 180 ml

ultrapure water, buffer was stored at 4 ᵒC for up to 7

days.

B- Fixation Solution

3 ml of 16% paraformaldehyde solution was added to

9 ml of 1X wash buffer just before used.

C-1XPermeabilization Buffer

1.5 ml of 10X Permeabilization Buffer was added to

13.5 ml of the 1X wash buffer. This buffer was stored

at 4 ᵒC for up to 7 days

D- 1X Blocking Buffer

5 ml of 10X Blocking Buffer was added to 44 ml of

1X wash buffer. This buffer was stored at 4 ᵒC for up

to 7 days.

E- Primary Antibody

Solution

15 μl of the Cytochrome C Primary Antibody was

added to 6 ml of 1X blocking buffer. Solution was

prepared just before each assay.


48

F- Secondary Antibody/

Staining Solution

0.6 μl of Hoechst Dye and 12 μl of the Dye Light 649

Goat Anti-Mouse were added to 6 ml of 1X Blocking

Buffer. Solution was prepared just before each assay.

G- Live Cell Staining

Solution

117 μl of DMSO was added to the Mitochondrial

Membrane Potential Dye to make a 1 mM stock

solution. Then add 2.1 μl of Permeability Dye and 21

μl of Mitochondrial Membrane Potential Dye were

added to 6 ml complete medium pre-warmed to 37

ᵒC.

2.1.7 Microorganisms:

The following microorganisms were used in this study:

Microorganisms Source

Geobacillus thermoleovorans Ir1 (JQ912239)

Department of Biotechnology,

Al-Nahrain University

Anoxybacillus rupiensis Ir2 (JQ912240)

Anoxybacillus rupiensis Ir3 (JQ912241)

Anoxybacillus sp.

Staphylococcus aureus

Streptococcus sp.

Pseudomonas aeruginosa

Proteus mirabilis

E. coli

Aspergillus niger

Penicillium

Candida albicans

Six non identified thermophillic bacteria (9SM,

12SM, 13SM, 14SM, 21SM, 34SM)

http://int.search.tb.ask.com/search/GGmain.jhtml?ts=1452375980637&p2=%5EBBQ%5Exdm007%5EYYA%5Eiq&n=781B87A1&ss=sub&st=hp&ptb=5053A49D-5E01-443F-8B7E-062211825D88&si=CObTlLjZucYCFagKwwodc98HLQ&tpr=sc&searchfor=proteus+mirabilis&ots=1452376282280


49

2.1.8 Cell lines:

Different cell lines were used in this study:

Cell lines Source

Breast cancer(MCF7)

Department of biotechnology /Ioannina

University, Greece.

Jurkat cells

Hut 78 cells

Normal Kidney (HEK)

2.2 Methods:

2.2.1 Sterilization methods (Atlas et al., 1995):

Three methods of sterilization were used

- Moist heat sterilization (autoclaving):-

Media and solutions were sterilized by autoclaving at 121 ºC (15 Ib/in2) for 15

minutes.

- Dry heat sterilization

Electric oven was used to sterilize glassware at 160 ºC for 3 hrs. and 180 ºC for 2

hrs.

- Membrane sterilization (filtration)

Millipore filtering was used to sterilize heat sensitive solutions by millipore filter

paper (0.22 µm in diameter).

2.2.2 Maintenance of bacterial isolates (Green and Sambrook, 2012):

Maintenance of bacterial isolates was performed as follow:


50

- Short term storage:

Bacterial isolates were maintained for few weeks on different agar slants,

they were tightly wrapped with parafilm, and then stored at 4 ºC.

-Medium- term storage:

Bacterial isolates were maintained as stab cultures for months. Such cultures were

prepared in small screw- capped bottles containing 2-3 ml of LB, nutrient agar the

vials were wrapped with parafilm and stored at 4 °C.

Long term storage: -

Single colonies were cultured in nutrient broth and incubated for 24 hrs., at 55 °C,

then 8.5 ml of bacterial culture was mixed with 1.5 ml of glycerol, and stored for a

long time at -20 °C.

- Preservation in silica gel (Al - Azawi, 1982):

A little amount of silica gel was sterilized in autoclave, and dried in oven at 60-70

°C for 24 - 48 hrs., The sterilized silica gel was inoculated with 0.1 – 0.2 ml of

bacterial culture and stored at room temperatures in parafilm wrapped eppendrof

tubes.

2.2.3 Identification of bacterial isolates:

2.2.3.1 Microscopic and morphological examination:

Morphological features of bacterial isolates grown on LB, nutrient agar medium

were studied included shape, size, margin, color, arrangement and other features. On

the other hand microscopic examination was done by transferred a loop full of single

colony to clean slide. The smear was stained with crystal violet, treated with iodine,

decolorized with 95 % alcohol, and counterstained with safranine, then examined by a

microscope (Atlas et al., 1995).


51

2.2.3.2 Biochemical tests:

Catalase test :

A loop full of bacterial growth on nutrient agar was placed on a clean glass slide,

mixed with a drop of 3 % H₂O₂ (2.1.3.2) and the result was reported. The appearance

of bubbling indicates a positive catalase test (Prescott, 2002).

Oxidase test :

Filter paper was saturated with oxidase reagent (2.1.3.3), a colony of bacteria was

transferred on the filter paper with a sterile wooden applicator stick. An immediate

change of the color to deep blue indicates a positive result (Benson, 2002).

Nitrate reduction test :

A single colony of each bacterial isolate was used to inoculate 5 ml of

nitrate media (2.1.5.2), and then test tubes were incubated at 55 ºC for 24 hrs. After

incubation, 0.1 ml of the test reagent (2.1.3.4) was added to each tube. The immediate

formation of red color indicates a positive result (Atlas et al., 1995).

2.2.4 Screening the bacteria for biosurfactant production:

2.2.4.1 Biosurfactant production:

To determine the capability of bacterial isolates to produce biosurfactant, 50 ml of

mineral salt medium (2.1.5.2) was despised in 250 ml Erlenmeyer flasks. The flasks

were sterilized, and then 1% of crude oil (sterilized by tyndrazation) was added as

carbon source. The flasks were inoculated with 1% of fresh bacterial growth (18 hrs.)

and incubated under shaking (180 rpm) at 55 ᵒC for 7 days. Then, the cultures were

centrifuged at 4 ᵒC, 10000 rpm, for 15 min. Production of biosurfactant was

investigated in cell –free supernatant.


52

2.2.4.2 Determination of biosurfactant compounds:

Determination of emulsification activity (E.A):

The emulsification activity was determined by taking 0.5 ml of the cell free

supernatant from cultured mineral salt medium, and added to 7.5 ml of Tris-Mg

buffer (2.1.3.6) plus 0.1 ml of dodecane, then mixed with vortex for 2 min. The tubes

were left for 1 hr.

The absorbency was measured at 540 nm. Emulsification activity was defined as the

measured optical density, while the blank was Tris-Mg, dodecane and mineral salt

broth without culture (Sifoure et al., 2007).

Determination of emulsification index (E 24 %):

One ml of cell free supernatant was added to 1 ml of sun flower oil (equal volumes

v/v), mixed with vortex for 2 min., and left for 24 hrs. at room temperature, The

height of emulsifier layer was measured.

The emulsification index was given as a percentage of the height of the emulsified

layer (mm) to the total height of the liquid column (mm) multiplied by 100

(Tabatabaee et al., 2005).

Surface tension (S.T):

The surface tension reduction was determined by a K6 tensiometer using the du

Nouy ring method. A volume (20 ml) of cell free supernatant was placed into 50 ml

clean glass beaker then left to equilibrating for 15 min.

Before measuring, the tensiometer must calibrate with D.W (72 mN/m). The

tensiometer is an instrument incorporating aprecision microbalance, platinum wire

ring with a defined geometry and precision mechanism to vertically move sample

liquid in a glass beaker. The ring hanging from the balance hook is first immersed


53

into the liquid surface and then carefully pulled up, the micro balance records the

force applied on the ring while pulling through the surface. The surface tension is the

maximum force needed to detach the ring from the liquid surface. Between each pair

of measurement, the platinum wire ring was rinsed three times with water, three times

with acetone and allowed to dry (Abouseoud et al ., 2008; Sekhon et al., 2011).

2.2.5 Optimization condition for biosurfactant production:

Optimization experiments were done in an Erlenmyer flask containing 50 ml of

mineral salt medium (2.1.5.2) with 1 % of crude oil inoculated with 1 % of fresh

bacterial culture (G. thermoleovurance Ir1 (JQ912239)). The flasks were incubated in

a shaker incubator (180 rpm) at 55 ºC. After incubation period, emulsification index

and surface tension were measured.

2.2.5.1 Effect of carbon source:

Different carbon sources (fructose, glucose, manitol, sucrose, diesel, date extract,

crude oil and sunflower oil) were used to determine the optimum source for

biosurfactant production, each of these sources was added to the medium in a

concentration 1 % separately. Then, pH was adjusted to 7.0, and inoculated with

bacterium then incubated in shaker incubator (180 rpm) at 55 °C for 7 days.

Emulsification index and surface tension were measured and the optimal carbon

source was employed later on.

2.2.5.2 Effect of carbon source concentration:

Different concentrations (0.25%, 0.5%, 0.75%, 1%, 2%, 3% and 4 %) of crude oil

were used to grow the bacterium in order to determine the optimum


54

concentration for biosurfactant production. After the pH adjustment to 7.0, flasks

were incubated in shaker incubator (180 rpm) at 55 °C for 7 days.

2.2.5.3 Effect of temperature:

In order to determine the optimum temperature for biosurfactant production,

mineral salt medium (pH 7), after inoculated with bacterium flasks were incubated in

a shaker incubator (180 rpm) at different temperatures (40, 50, 55, 60, 65 and 70 °C)

for 7 days, Then the optimal temperature was subsequently employed.

2.2.5.4 Effect of different nitrogen sources:

Different nitrogen sources ((NH₄)2SO4, NH₄Cl, yeast extract, KNO₃, NH4NO3 and

urea) were used to determine the optimum condition for the biosurfactant production

by the bacterial strain. These nitrogen sources were added to the mineral salt medium

in a concentration 0.4 %, and pH was adjusted to 7.0. Then after inoculation the flasks

were incubated in a shaker incubator with 180 rpm at 60 ºC for 7 days. Optimal

nitrogen source was selected and employed later on.

2.2.5.5 Effect of nitrogen source concentration:

The optimal nitrogen source (NH4Cl) was added in gradual concentration (0.05%,

0.1%, 0.2%, 0.3%, 0.4% and 0.5%) to the mineral salt medium. pH was adjusted to

7.0, then inoculated with the bacterial strain and incubated in shaker incubator (180

rpm) at 60 °C for 7 days. Then the optimal concentration was employed.

2.2.5.6 Effect of pH:

Mineral salt medium was adjusted with different pH values (5, 6, 6.5, 7, 8 and 9) to

determine the suitable value. The flasks after inoculation with bacterial strain were


55

incubated in a shaker incubator with 180 rpm at 60 ºC for 7 days. And the better pH

value was employed in later experiment.

2.2.5.7 Effect of aeration:

Different rpm values (120, 150, 180, 200 and 220 rpm) were examined to

determine the optimum shaking required to obtain the high biosurfactant activity. The

flasks after inoculated with bacterial strain were incubated at 60 °C for 7 days and the

optimal aeration was used in a later experiment.

2.2.5.8 Effect of incubation period:

Mineral salts media broth contain an optimum carbon concentration source and

nitrogen source with pH 7 was inoculated with bacterial strain and incubated at 60 ºC

with shaking at 200 rpm for (2–11) days, after each incubation period E24% and

surface tension were estimated.

2.2.6 Extraction of biosurfactant compound:

One litter of mineral salt medium (pH7) containing crude oil (1%) as carbon

source, and ammonium chloride (0.3%) as a nitrogen source, inoculated with 1% of

fresh culture of G. thermoleovorans Ir1(JQ912239) and incubated in a shaker

incubator (200 rpm) at temperature 60 ºC for 10 days.

After incubation, supernatant of bacterial culture was obtained by centrifugation at

10000 rpm for 15 min at 4 °C. The supernatant subjected to extraction with different

methods as follows:

1- Extraction with Acetone: biosurfactant was extracted by precipitating

metabolic cell-free liquid with acetone 1:1 (v/v) and allowed to stand for 24

hrs. at 4 °C, and then it was centrifuged (4000 rpm) for 15 min, at 5 °C. The


56

supernatant was discarded and the isolated biosurfactant was submitted to

dialysis against deionized water for 72 hrs., at 5 °C, and was subjected to

change every 3 hrs. The biosurfactant was collected and freeze dried (Jara et

al., 2013).

2- Extraction with Chloroform – methanol: The supernatant was acidified by

adding 6 N HCL to pH 2 and incubated over night at 4 °C, a flocculated

precipitate was formed and collected by centrifugation (10000 rpm), at 4 °C

for 10 min. Then extracted with chloroform – methanol (2:1 v/v). The aqueous

layer at the bottom of the separation funnel was removed and the emulsifier

layer was collected in a glass petri dish and dried in an oven (40 – 45 °C))

Tahzibi et al., 2004; Sifour et al., 2007; Das et al., 2008).

3- Extraction with diethyl ether: Equal volumes of cell free supernatant and

diethyl ether were mixed in a separating funnel. The aqueous layer was

removed and the emulsifier layer was collected in a sterilized glass petri dish

and dried in oven (40 – 45 °C) (Nadaling et al., 2000 ).

2.2.7 Purification of biosurfatant compound:

A portion of the crude extract was re- dissolved in distilled water and purified from

the remain impurities by dialyzed with dialysis membrane (12 kDa cut-off) for 24

hrs., by using distilled water and change every 3 hrs. (Joshi et al., 2008).

For further purification of biosurfactant column chromatography with fallowing

dimension (2.5*40) cm was used, filled with silica 60 gel. It was packed tightly by a

continuous flow of hexane, then the column was washed with hexane. Sample

dissolved in 6 ml chloroform was loaded in column until majority of the solvent is

absorbed. Then eluted the column with sequential polar solvent: hexane, chloroform,

ethyl acetate, methanol and collected the fraction (3 ml) for each.


57

All eluted fractions were collected and tested for their emulsification activity as

previously described (2.2.4.2) (Thanomsub et al., 2004).

2.2.8 Chemical composition of biosurfactant compound:

2.2.8.1 Estimation of the lipid concentration:

The lipid concentration of partial purified biosurfactant was determined according

to Kaufmann and Brown (2008) as follows:

One mg of commercial vegetable oil was dissolved in 1 ml of chloroform

(1000µg/ml).

The standard curve was prepared by preparing a serial amount of lipid (50-

600µg).

The previous solution was added as the following 50, 100, 200, 400 and 600

µl separately to each glass tube in triplicate.

These glass tubes were placed in a heating block at 90-110 ºC to evaporate the

solvent.

Two hundred microliter of sulfuric acid (98%) was added to each tube

separately and heated for 10 min at 90-110 ºC.

Vanillin reagent was prepared as (2.1.3.10) was added to 5 ml level and mixed.

The tubes were removed from heating block and allowed to cool.

The absorbance at 625 nm was measured.

The lipid amount of unknown sample was treated in the same manner by

dissolving 1 mg of biosurfactant in 1 ml of chloroform with mixing and the

lipid was determined according to the standard curve (figure 2-1).


58

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

0.5

0 100 200 300 400 500 600 700

Ab

sorb

ance

at(

62

5)n

m

(µg) lipid

Figure (2-1): Standard curve of lipid determining by Kaufmann and Brown (2008) method.

2.2.8.2 Estimation of the protein concentration:

Bradford method was used for estimation of the protein concentration of partial

purified biosurfactant depending on bovine serum albumin (BSA) standard curve

(Bradford, 1976) as follows:

A volume of 200 µl of different concentrations (0 -130 µg /ml) of BSA was

prepared from stock solution of bovine serum albumin (1 mg/ml) (2.1.3.11) table (2-

1).

Eight hundred microliters of Bradford reagent (2.1.3.11) was added to each tube .

The solution was vortexed and left to stand for 10 min.

The optical density (O.D) was measured at 595 nm.

The curve was drown to show the relationship between the optical density (O.D)

and the protein concentration to obtain the standard curve for the BSA, figure (2-2).

The unknown protein samples were treated in the same manner by dissolving 1 mg

of biosurfactant in 1 ml of Tris – HCl by mixing with magnetic stirrer and the protein

concentration was determined according to the standard curve.


59

Table (2-1): Preparation of different bovine serum albumin concentrations:

Tube No. Volume of

BSA solution(µl)

Volume of

D.W (µl)

Final concentrations

(µg /ml )

1* 0 200 0

2 2 198 10

3 4 196 20

4 6 194 30

5 8 192 40

6 10 190 50

7 12 188 60

8 14 186 70

9 16 184 80

10 18 182 90

11 20 180 100

12 22 178 110

13 24 176 120

14 26 174 130

Tube (1*) represents the blank solution.


60

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0 20 40 60 80 100 120 140

Ab

sorb

ance

at

(59

5 n

m)

Concentration of bovine serume albumin (µg/ml)

Figure (2-2): Standard curve of Bovine Serum Albumin (BSA) by Bradford method for

determination protein concentration of biosurfactant produced by G. thermoleovorans.

2.2.8.3 Estimation of the carbohydrate concentration:

The carbohydrate content of the partially purified biosurfactant sample was

determined by the preparation of glucose standard curve (Dubois et al., 1956) as

follow:

Different concentrations ranged from (0-1000 µg /ml) were prepared from glucose

stock solution (2.1.3.12). The final volume was 1 ml, as shown in table (2-2).

One ml of phenol solution (2.1.3.12) was added to each tube with shaking.

Five ml of concentrated sulphuric acid (98%) was added to the mixture, mixed

well and left to cool at room temperature.


61

Table (2-2): Preparation of different glucose concentrations.

Tube No. volume of Sugar

solution(ml)

Volume of D.W

(ml)

Final concentrations

( µg /ml )

1* 0 1 0

2 0.1 0.9 100

3 0.2 0.8 200

4 0.3 0.7 300

5 0.4 0.6 400

6 0.5 0.5 500

7 0.6 0.4 600

8 0.7 0.3 700

9 0.8 0.2 800

10 0.9 0.1 900

11 1 0 1000

Tube (1*) represents the blank solution.

The absorbency (O.D) was measured for each tube at 490 nm.

The curve of glucose was demonstrated the relationship between absorbency

(O.D) and glucose concentration as shown in the figure (2-3).

The unknown samples used for carbohydrate estimation were prepared by

dissolving 1mg of biosurfactant powder in 1ml of Tris – Mg or Tris – HCl with

mixing with a magnetic stirrer.


62

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

0 200 400 600 800 1000 1200

Ab

sorb

ance

(4

90

)nm

Glucose concentration(µg/ml)

Figure (2-3): Standard curve of glucose by Dubois et al. method for glucose determination.

2.2.9 Characterization of partial purified biosurfactant compound:

2.2.9.1 Analysis with Fourier Transform Infra Red:

The basic functional groups of the partial purified biosurfactant from G. thermoleovorans

(JQ912239) were analyzed qualitatively by Fourier Transform Infra red (FTIR) (Aparnaa et

al., 2012).

Fourier transform infra red spectroscopy of the biosurfactant sample was obtained

by using (shimadzu) spectrophotometer, in which the 2 mg of partial purified sample

was mixed with 150 mg KBr and pressed into a tablet form in a dry atmosphere.

The FT-IR spectra measurement was done in the frequency range of 400–4000

wavenumbers (cm⁻') with resolution of 2 cm, 50 scans (Yalçın and Çavuşoğlu, 2010).

2.2.9.2 Analysis with High Performance Liquid Chromatography (HPLC):

The partial purified biosurfactant was analyzed into main components by using

the HPLC:


63

1- Fatty acids:

The main components (fatty acids) within the sample were detected by using

HPLC as follow:

- Preparation of sample:

The 100 mg of partial purified biosurfactant mixed with 20 ml ionized water, then

the fat separation was carried out according to ISO-IDF (2001), to the previous

mixture 20 ml of (0.1M) ammonium hydroxide was added. Follow with the addition

of 20 ml from the following mixture (50:50 v/v), n- pentane and diethyl ether, then

taking the extracted fatty acid.

- Tested the sample:

Ten microliter of previously prepared solution was injected in C-8DB column, 3

µm particle size, the test was done by using acetonitrile:tetrahydrofuran (THF): 0.1%

of phosphoric acid in THF(50.4: 21.6: 28v/v) as a mobile phase, with a flow rate of

1.5 ml/min at 40 ºC and UV detector at 215 nm, then the observed retention time for

each fatty acid was determine and compared to the standard retention time

respectively.

2- Amino acids:

- Treatment the sample:

In order to prepare the sample for protein analysis by HPLC, the partial purified

biosurfactant sample was hydrolyzed with 6 N HCL at 110 ºC for 24 hrs., (Huang et

al., 2012), then the samples were derivatization by mixing 10 µl of each of standard

and biosurfactant sample separately with 10 µl of PTIC reagent and after 1 min, 50 µl

of (0.1 M) sodium acetate was added. The samples were shaked and agitated in

ultrasonic bath for 10 min, the extract was filtered on disposable filters (0.2 µm).


64


The amino acids were determined by injected 20 µl of each standard and

previously treated samples on the shimpack XR-ODS (3 um particle size) column,

with 1 ml/min a flow rate and UV detector at 254 nm gradient were formed between

two solvents.

- Solvent A: 5 % methanol in 0.1 N sodium acetate buffer.

- Solvent B: methanol, linear gradient from 0-20 minutes.

The data were processed and analyzed by RC-6A data processing, and the

concentration for each compound was quantitatively determined by comparison the

peak area of the standard to the sample.

3-Carbohydrates:

- Sample preparation:

In order to detect the sugars components of the partial purified biosurfactant,

sample was hydrolyzed with (1N) HCL and incubated at 90 ºC for 3 hrs., then the

solution was filtered through a single use 0.22µm filter.


A volume of 20 µl from the above solution sample and the standard were injected

separately in an anion exchange shimpack A1 column, 3 µm particle size, and NaOH

(15 mM) spiked with 1mM barium acetate used as a mobile system, and run at a flow

rate of 1.5 ml/min with RD-6A refractive index detector. The temperature was

adjusted to 40 ºC. Under these conditions, the observed retention time for each sugar

was determined and compared to the standard retention time respectively (Cataldi et

al., 2000).


65

2.2.9.3 Analysis of the lipid part with Gas chromatography (GC):

Lipids were analyzed to their fatty acids components using gas chromatography

(GC) (Zheng et al., 2011). Fatty acids composition was investigated as follows. Acid

methyl ester was prepared by dissolving 10 mg of partial and purified biosurfactant

with 1 ml of sulpheric acid - methanol at 90 ºC for 15 hrs., and 1 ml of hexane was

added with mixing, then hexane phase was taken after evaporated the sulfuric acid .

To the hexane phase, 1 ml of D.W was added with mixing. The fatty acid methyl ester

was extracted with hexane and subjected to an analysis with GC, by using helium as

carrier gas on a Shimadzu 17-A GC equipped with an fused silica capillary column

(30 m × 0.25 mm, 0.25 μm film thickness).

2.2.9.4 Analysis the lipid part with NMR:

Lipid part of partial and purified biosurfactant was analyzed with 1H NMR

spectrum by using Bruker Avance-II 500 spectrometer at 298 k, 500 MHz.

A weight of (20 mg) of partial and purified biosurfactant was dissolved in 600 µl of

the CDCL3. Then the mixture was mixed in vortex for 2 min and placed in ultrasonic

bath for 15 min. The mixture was centrifuged for 15 min at 4000 rpm, 25 ºC. The

supernatant was collected and placed in an NMR tube. The sediment was allowed to

settle in order to have a better NMR spectrum.

2.2.10 Effect of biosurfactant on tumor cell line:

2.2.10.1 Cell lines:

Different mobile and attach cell lines (2.1.8) were used to show the inhibitory

effect of the purified biosurfactant.


66

2.2.10.2 Preparation of cells for MTS assay:

Cells were regenerated from cryogenic.

Cells were recovered by a rapid thawing at 37 ºC in water bath and centrifuged at

800 rpm for 10 min at a room temperature, then resuspended in culture medium

(2.1.5.2).

Cells were splitted to T-25 three tissue culture flasks.

Flasks were incubated in a humidified atmosphere with 5 % CO2 and 95 % air at

37 ºC.

Cells were grown for 24-36 hrs., and whenever the cells reached high growth

under microscope, the media was changed with fresh one until the number of cells

reached approximately 4-6 million in each plate.

2.2.10.3 Harvest and count cells (Wang et al., 2007):

The two cell line Hut78 and jurkate were subcultured routinely every 24-36 hrs., to

maintain cell culture in an exponential growth in the RPMI 1640 medium (2.1.5.2).

Then they were incubated in a humidified atmosphere with 5 % CO2 and 95 % air at

37 ºC. The flask was investigated under a microscope daily until the cells reach the

optimum growth. While the (MCF7) and kidney cells line were subcultured routinely

whenever the cell in the flask formed a confluent monolayer. The cells were

harvested by washing the flasks twice with PBS (2.1.3.1) followed by detaching cell

from flask surface with adding 2 ml trypsin solution for each flask and kept for

about 10 min at 5 % CO2 and 95 % air at 37 ºC until the cell rounded up. Trypsin

suspension was inactivated by adding 10 ml cold RPMI media and transferred into

blue cap centrifuge tube, then centrifuged at 200 rpm for 10 min. The cell pellet was

diluted with RPMI medium and cell were counted with hemacytometer. Cells were

splitted to T-25 three tissue culture flasks.


67

2.2.10.4 Preparation testing plate (96-well):

The 96 well microtiter plate were seeded with a cell line for cell viability study

(MTS) and incubated for 24-72 hrs., to a final concentration of 20000 cells per well

according to the cell’s counting. Then they were treated with different concentrations

of biosurfactant (10, 20, 30, 40, 50, 60, 100 µg/ml) dissolved with RPMI media

(2.1.5.2) and 0.1 % DMSO, then incubated from 24 -72 hrs., at 37 ᵒC.

2.2.10.5 Adding MTS dye to the 96-well plate:

MTS dye solution was added with the volume 20 µl to each of 96 well microtiter

plates that contain 100 µl of treated cells or blank. The plate was incubate with an

aluminum foil at 37 ºC for 1–4 hrs. in a humidified 5 % CO2 atmosphere, and record

the absorbance at 490 nm at every 30 minutes within the incubation period.

The controls and test compounds were assayed for each concentration. The data of

the optical density taken from plate reader were then subjected to analysis by using

the cell inhibition rate (%) and calculated according to Wang et al. (2007):

Cell inhibition rate (%) = [(average absorbance of control cell – average

absorbance of treated cell) /average absorbance of control cells)] x100.

Data were analyzed with ANOVA- test.

2.2.11 Multiparameter Cytotoxicity Assay:

In order to determine the cytotoxic effect of biosurfactant many assays were done

(Vivek et al., 2008) as follows:

2.2.11.1 Cell Preparation:


68

MCF7 cells were splited when they reached 90% confluenced at a dilution of 1:4.

Cells at a passage number ≤ 10 were used.

MCF7 cells were harvested by trypsinization, diluted into EMEM complete

medium (2.1.5.2) and cell density was determined. Cells were diluted to 7.5 × 104

cells/ml in EMEM complete medium.

The cell suspension (100 μl) was added to each well of a 96-well microplate to

achieve 7500 cells/well.

Cells were incubated overnight at 37 ºC in 5 % CO2.

2.2.11.2 Treatment of cell within 96-well microplate:

A volume 25 μl of doxorobin at a concentration of 50 µg/ml and purified

biosurfactant at concentration 50, 100 µg/ml were added separately to cells. Cells

were incubated at 37°C for 24 hours.

Live cell staining solution (50 μl) (2.1.6G) was added to each well and the cells

were incubated at 37 ºC for 30 minutes.

The medium and the staining solution were gently aspirated and 100 μl/well of

fixation solution (2.1.6 B) was added. The plate was incubated for 20 minutes at room

temperature.

The fixation solution previously prepared was gently aspirated and 100 μl/well of

1X wash buffer (2.1.6A) was added.

Wash buffer was removed and 100 μl/well of 1X permeabilization buffer (2.1.6C)

was added. The plate was incubated for 10 minutes at room temperature and

protected from light.

Permeabilization buffer was aspirated and plate was washed twice with 100

μl/well of 1X Wash buffer.


69

Wash buffer was aspirated and 100 μl of 1X blocking buffer (2.1.6 D) was added

and the plate was incubated for 15 minutes at room temperature.

Blocking buffer was aspirated and 50 μl/well of primary antibody solution

(2.1.6E) was added. Plate was incubated for 60 minutes, protected from light at room

temperature.

Primary antibody solution was aspirated and the plate was washed three times with

100 μl/well 1X Wash Buffer.

Wash buffer was aspirated and 50 μl/well of Secondary antibody/staining solution

(2.1.6 F) was added. The plate was incubated for 60 minutes, protected from light at

room temperature.

Secondary antibody/staining solution were aspirated and plate was washed three

times with 100 μl/well of 1X Wash Buffer.

Wash buffer (100 μl/well) was added.

The plate was sealed and evaluated on the Array Scan HCS Reader.

2.2.12 Antimicrobial activity of biosurfactant:

The antimicrobial activity of biosurfactant was examined against some bacteria and

fungi:

It was evaluated by an agar disc diffusion method (Rodrigues et al., 2006b). The

bacteria and fungi (2.1.7) were cultured in Muller Hinton broth and incubated over

night at 37, 28 ºC, serial dilutions were prepared. Samples (0.1 ml) from appropriate

dilutions of each of bacterial and fungal strain were swabbed on the plates of Muller

Hinton ager, and wells were made with cork borer.

Different concentrations (100, 75, 50, 25 mg/ml) of purified biosurfactant was

prepared, and one hundred microliter of each concentration was added into wells.


70

For the bacteria the plates were incubated at 37 °C for 24 hrs., while the fungi were

incubated at 28 °C for 5 days. The clear zone marked the antimicrobial activity of

biosurfactant. And calculated to determine the actual zone diameter (Yalcin and

Ergene, 2009).

2.2.13 Determination of some physical properties of biosurfactant:

The following physical properties of biosurfactant were studied:

2.2.13.1 Determination colour and solubility of biosurfactant:

Colour and the solubility of biosurfactant produced by G. thermoleovorans Ir1

(JQ912239) in different solvents (water, buffers, chloroform, methanol and butanol)

were studied.

2.2.13.2 Determination of melting point:

The sample must be in a fine powder form to fill a capillary tube with it, the open

end of the capillary was pressed gently into the substance (biosurfactant) several

times. The powder was then pushed to the bottom of the tube by repeatedly pounding

the bottom of the capillary against a hard surface, and then the sample were put in the

heat block and as the temperature increased, the sample was observed to determine

when the phase change occurs from solid to liquid. The operator or the machine

recorded the temperature range starting with the initial phase change temperature and

ending with the completed phase change temperature. The temperature range

determined could then be averaged to gain the melting point of the sample being

examined.


71

2.2.14 Determination the effect of some chemical factors on biosurfactant

activity:

2.2.14.1 Biosurfactant concentration for emulsification of sunflower oil:

Different concentrations of dried biosurfactant were prepared by dissolving 2, 3, 4,

5, 6, 7, 8 and 9 mg in 1 ml of 0.1 M Tris-HCl (2.1.3.7) (wt /v) with vortex, pH was

adjusted to 7 and 1 ml of sunflower oil was added, E24% (2.2.4.2) was measured.

2.2.14.2 Effect of temperature :

To determine the stability of the biosurfactant with different temperatures. Glass

tubes containing 7mg biosurfactant (2.2.14.1) in 1 ml of 0.1M tris-HCl (2.1.3.7) were

exposed to different temperatures (20, 40, 60, 80, 100 and 120 ºC) for 30 minutes,

then they were cooled and E24% with sun flower was measured (Maneerat and Dikit,

2007).

2.2.14.3 Effect of some mineral salts:

To investigate the effect of salt concentration and type, different salts (NaCl, KCl

and CaCl2) were used at concentrations of 2% , 4%, 8 %, 12 %, 16% and 20%.

Then 7 mg of biosurfactant was dissolved in each concentration of salt, mixed well,

left for 30 min., and E24% was measured with a sun flower oil(Amiriyan et al .,

2004).

2.2.14.4 Effect of pH:

In order to determine the stability of biosurfactant in different pH values, the pH of

the biosurfactant was adjusted to different values (2, 3, 4, 5, 6, 7, 8, 9 and 10) using

tris-HCl (2.1.3.7) or Tris-base (2.1.3.8). Then the activity of biosurfactant was

determined, by dissolved 7 mg of biosurfactant in 1 ml of different pH solutions for

30 min., the E24% with sunflower was measured (Maneerat and dikit, 2007).


72

2.2.15 Detection of gene(s) coded for biosurfactant production:

2.2.15.1 Extraction of genomic DNA:

Genomic DNA was isolated from G. thermoleovorans Ir1 (JQ912239) and B.

subtilis according to the kit (2.1.6) as follows:

One milliliter of an overnight culture was added to a 1.5 ml microcentrifuge tube.

The cells suspension was centrifuged at 13000 g for 2 min. And the supernatant

was removed.

Nuclei lysis solution (600 μl) was added. Pipetted it gently until the cells were

resuspended, and incubated at 80 °C for 5 min to lyse the cells; then cooled at room

temperature.

RNase Solution (3 μl) was added to the cell lysate. Then, the tubes were inverted

2–5 times to mix. The tube was incubated at 37 °C for 15–60 min. Cool the sample at

room temperature.

Protein precipitation solution (200 μl) was added to the RNase-treated cell lysate

and vortex vigorously at high speed for 20 seconds to mix the protein precipitation

solution with the cell lysate.

The sample was incubated on ice for 5 min. and centrifuged at 13000 g for 3 min.

Supernatant containing the DNA was transfered to a clean 1.5 ml microcentrifuge

tube containing 600 μl of isopropanol.

The tube was mixed gently by inversion until the thread-like strands of DNA

formed a visible mass, then centrifuged at 13000 g for 2 min.

The supernatant was carefully poured off and the tube was drained on a clean

absorbent paper. 600 μl of 70 % ethanol was added and the tube were gently inverted

several times to wash the DNA pellet.

The tube was centrifuged at 13000 g for 2 min., carefully aspirate the ethanol.


73

One hundred microliter of DNA rehydration solution was added to the tube and the

DNA was rehydrated by incubation at 65 ºC for 1hrs.

2.2.15.2 Measurement of DNA concentration and purity:

In order to determine the concentration and the purity of the DNA, a Nanodrop

spectrophotometer was used, 1µl of DNA solution was measured according to the

nanodrop spectrophotometer manual, then the absorbency at 260 and 280 nm was

measured after calibration with D.W. or TE buffer at 260 nm and 280 nm respectively

(Green and Sambrook, 2012).

2.2.15.3 Amplification of biosurfactant gene(s):

Genomic DNA (template) of G. thermoleovorans Ir1 (JQ912239) and B. subtilis

were used to amplified Spf gene of Bacillus subtilis by using a specific primer

for this gene (2.1.4) (Sekhon et al., 2011). The PCR reaction was performed by

adding the following:

PCR reaction 50μl Rxn

2x PCR master mix solution 25μl

Template DNA(genomic DNA) 2 μl

Primer (F:10 pmol/μl) 1μl

Primer (R: 10 pmol/μl) 1 μl

Deionized distilled water 21μl

Total reaction volume 50μl


74

Amplification was carried out according to the following conditions:

cycling condition: Temp. Time Cycle No.

Initial denaturation 94 ºC 3 min 1

Denaturation 94 ºC 30 sec

35 Annealing 55 ºC 30 sec

Extension 72 ºC 1 min

Final extension 72 ºC 10 min 1

2.2.15.4 Agarose gel electrophoresis (Green and Sambrook, 2012):

Agarose gel (0.7-1.5 %) was utilized to detect the genomic DNA bands and PCR

products. The gel was run horizontally in 1 X TBE buffer. Electrophoretic buffer was

added to cover the gel. Samples of DNA were mixed with a loading buffer (1:10 v/v)

and loaded into the wells and run for 1-3 hours at 5 V/cm, and then agarose gel was

stained with an ethidium bromide by immersing them in distilled water containing the

dye at a final concentration of 0.5 µg/ml for 30-45 min. DNA bands were visualized

by UV transilluminator. The gel was de-stained using distilled water for 30- 60 min.

to get rid of background before photographing of DNA bands.

Chapter three

Results

And

Discussion

Chapter three Results and discussion

57

3. Results and discussion

3.1 Bacterial isolates:

The ten bacterial isolates used in this study were isolated in the previous study

and considered as a novel group of aromatic hydrocarbon degrading extreme

thermophillic bacteria. All these isolates belonged to the family Bacillaceae, and

four of them were molecularly identified, and reported for the first time as

carbazole utilizing bacteria (Al-Jailawi et al., 2013).

Mahdi (2013) referred that these ten isolates could produce biosurfactant

compounds when they utilize crude oil, that is why these isolates were chosen for

this study.

All isolates were subjected to morphological, biochemical and physiological

tests in order to confirm their identification. Results showed that these isolates

were gram positive with variable shape from the short to the long rod (figure 3-1).

They were positive for oxidase, with variable results for catalase and nitrate

reductase, and able to grow at high temperatures between 50-70 ºC, as shown in

table (3-1).

Figure (3-1): Microscopically examination of the G. thermoleovorans bacterial isolates

under large objective lens.


57

Table (3-1): Morphological, physiological and biochemical characteristics of thermophillic

bacterial isolates

Growth at

Nitrate

reducates

Oxidase

Catalase

Cell

Shape

Gram

stain

Thermophillic bacteria 70 ºC 60 ºC 55 ºC

+++ +++ +++ + + - Long

rod +ve

Geobacillus

thermoleovorans

Ir1

(JQ912239)

+++ +++ +++ + + + Long

rod +ve

Anoxybacillus rupiensis

Ir2 (JQ912240)

+++ +++ +++ + + + Long

rod +ve

Anoxybacillus rupiensis

Ir3 (JQ912241)

+++ +++ +++ + + + Long

rod +ve Anoxybacillus sp.

- ++ +++ - + - Short

rod

+ve 9SM

+++ +++ +++ + + + Short

rod +ve 12SM

- ++ +++ - + - Short

rod +ve 13SM

- + +++ _ + + Long

rod +ve 14SM

++ ++ +++ _ + - Short

rod +ve 21SM

++ ++ +++ _ + + Short

rod +ve 34SM

(+): positive result and moderate growth. (-): negative result. (+++): excellent growth

(++): good growth (-): no growth.

3.2 Screening the bacteria for biosurfactant production:

In order to screen the previously isolated thermophillic bacteria for their ability

to produce biosurfactant, the ten bacterial isolates were grown in mineral salt


55

medium as in item (2.1.5.2) containing 1% crude oil as a carbon source to induce

them to produce biosurfactant. The supernatants of the ten bacterial isolates were

subjected to three screening methods:

3.2.1 Emulsification activity (E.A):

Emulsification activity (E.A) for the supernatant of the ten bacterial isolates

were determined. The results presented in figure (3-2) show that the E.A ranged

between 0.1 to 0.34, with the maximum E.A (0.34) was recorded by Geobacillus

thermoleovorans Ir1 (JQ912239), followed by E.A (0.32) which recorded by

13SM isolate with lowest E.A (0.1) value attributed to 34SM isolate. The

measurement of E.A is an indicator of the activity of biosurfactant production

(Jazeh et al., 2012).

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

Ir1 Ir2 Ir3 6A 9SM 12SM 13SM 14SM 21SM 34SM

Emu

lsif

icat

ion

act

ivit

y (5

40

nm

)

Bacterial isolates

Figure (3-2): Emulsification activities (E.A) of the ten thermophillic bacterial isolates,

cultured in mineral salt medium (pH 7) containing 1% crude oil, at 55 ºC in shaker

incubator (180 rpm) for 7 days.

Ir1: G. thermoleovorans (JQ912239). Ir2: A. rupiensis (JQ912240). Ir3: A. rupiensis (JQ912241). 6A:

Anoxybacillus sp.

The emulsification activity of Yansan bioemulsifier of Y. lipolytica was 2.63

when using toulen as a carbon source (Amaral et al., 2006). On the other hand


57

Camargo de Morais et al. (2006) noticed that the E.A of bioemulsifier produced by

P. citrinum was 0.20 when using olive oil.

3.2.2 Emulsification index (E24%) and surface tension:

The further detection of biosurfactant production was done by the measurement

of emulsification index and reduction of the surface tension.

The results indicated in figure (3-3) show that all isolates were able to produce

biosurfactant with a variable emulsification index, and surface tension. The strain

(G. thermoleovorans Ir1) and13SM isolate showed the highest E24% (68% and

61% respectively) with highest reduction of surface tension (53 and 56 mN/m

respectively). While 34SM gave lowest E24%(32%) and highest surface tension

(67mN/m).

Figure (3-3): Emulsification index (E24%) and surface tension of the ten thermophillic

bacterial isolates, cultured in mineral salt medium (pH 7) containing 1% crude oil, at 55 ºC

in shaker incubator (180 rpm) for 7 days.

Ir1: G. thermoleovorans (JQ912239). Ir2: A. rupiensis (JQ 912240). Ir3: A. rupiensis (JQ 912241). 6A:

Anoxybacillus sp.


57

Bacteria generally prefer to metabolize substrates present in the aqueous phase;

they also can take up the substrate if they are in a close contact with the insoluble

phase of the hydrocarbons (Abbasnezhad, 2009).

Priya and Usharani (2009) indicated that the highest E24% value (60 %) was

observed with B. subtilis when using vegetable oil as carbon source. While Kalyani

et al. (2014) found that the of biosurfactant produced by Actinomycetes has an

emulsification index of 57.31% when grown in medium containing olive oil as the

sole source of carbon.

The ability of the thermophillic bacteria to reduce the surface tension revealed a

correlation between the molecular weight of biosurfactant and the reduced surface

tension. Zheng et al. (2011) reported that G. pallidus does not reduce the surface

tension below 40 mN/m when growing on media supplemented with different

hydrocarbons.

Mulligan (2005) reported that the low molecular weight biosurfactant are able to

reduce the surface tension below 40 mN/m, while the high molecular weight

bioemulsifiers can form and stabilize emulsions without remarkable surface tension

reduction (Batista et al., 2006).

The above results showed that all isolates were able to produce biosurfactant

compounds and G. thermoleovorans (Ir1) was the most efficient one. Thus, this

isolate was selected for a subsequent study.

3.3 Optimization of culturel conditions for biosurfactant production:

Several factors were studied to determine the optimal conditions for biosurfactant

production by G. thermoleovorans (Ir1):


78

3.3.1 Effect of carbon sources:

There is a correlation between biosurfactant production and growth on

hydrocarbons; therefore, several kinds of carbon source were investigated for the

biosurfactant production.

Results indicated in figure (3-4) show that the E24% (68%) and surface tension

(53mN/m) were achieved when crude oil was used as the sole source of carbon and

energy, followed by sunflower with E24% and surface tension 50% and 59 mN/m

respectively. While the lowest activity was obtained when date extract (9%and 68

mN/m) was used. These results demonstrated the ability of this bacterium to

degrade a wide range of carbon sources and biosurfactant production. Pines and

Gutnick (1986) demonstrated that the production of bioemulsifier by A.

calcoaceticus RAG-1was induced by the addition of hydrocarbons or oils.

0

10

20

30

40

50

60

70

80

0

10

20

30

40

50

60

70

80

fructose Manitol sucrose deisel dateextract

crude oil Sunflower

glucose

E24

%

Carbon sources

Emulsification index

Surfacetension

Surf

ace

ten

sio

n(m

N/m

)

Figure(3-4):Effect of different carbon sources on biosurfactant production by G.

thermoleovorans (Ir1), grown in mineral salt medium (pH7) containing 0.4% ammonium

chloride, at 55 ºC in shaker incubator (180 rpm) for 7 days.


78

The crude motor oil enhanced the biosurfactant production from P. aeruginosa

PBSC1 with a surface tension 30.98 mN/m and an emulsification index of

74.32±0.52% (Joice and Parthasarathi, 2014).

While Noudeh et al. (2007) found that the B. licheniformis PTCC produced

biosurfactant when growing on almond, castor and olive oil as sole carbon source,

but the maximum yield was achieved with olive oil. Also Gudiña et al.

(2015a) mentioned that the surfactin production by B. subtilis 573 was evaluated

using the corn steep liquor as an alternative low-cost culture medium.

Also Solaiman et al. (2004) on the other hand used soy molasses and oleic acid

as co-substrates for the production of sophorolipids by C. bombicol. The quality

and quantity of biosurfactant production are affected and influenced by the nature

of the carbon substrate (Rahman and Gakpe, 2008). .

3.3.2 Effect of crude oil concentration:

Different concentrations of the optimal carbon source (crude oil) were used to

determine the optimum for the biosurfactant production by G. thermoleovorans

(Ir1).

Result showed in figure (3-5) indicate that the gradual increase of carbon source

concentration was accompanied by an increase in the emulsification index and

dropping of surface tension, which was an indicator of biosurfactant

production, till the optimum carbon concentration, these dramatic changes in

emulsification index and surface tension reached to its better values 68% and 53

mN /m respectively at a concentration of 1%.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gudi%26%23x000f1%3Ba%20EJ%5Bauth%5D


78

0

10

20

30

40

50

60

70

80

0

10

20

30

40

50

60

70

80

0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5

Surf

ace

te

nsi

on

(mN

/m)

E24

%

Crude oil concentrations

Emulsificationindex

surface tension

Figure (3-5): Effect of different concentrations of crude oil on biosurfactant production by

G. thermoleovorans (Ir1), grown in mineral salt medium (pH 7), containing 0.4%

ammonium chloride, at 55 ºC in shaker incubator (180 rpm) for 7 days.

The low concentration of crude oil may support the growth of this bacterium and

induced it to produce a biosurfactant, while the higher concentration of crude oil

may have a toxic effect on the bacterial growth and/or not induce bacterium to

produce biosurfactant. The higher concentration of carbon source may reflect the

toxic effect to the producing organisms (Johnson et al., 1992).

Abu-Ruwaida et al. (1991) mentioned that hydrocarbon concentration plays an

important role in synthesizing the biosurfactant by microorganisms.

3.3.3 Effect of temperature:

The temperature is one of the most important parameters affecting the production

of biosurfactant, so different incubation temperatures were used.

Result (figure 3-6) showed that the optimal temperature for biosurfactant

production was 60 ºC with an emulsification index 70 % and a surface tension 52

mN/ m followed by 55 ºC (the optimal growth temperature for this bacterium).

The E24% values were dropped, and surface tension increased with other


78

temperatures. These results were in accordance with Zheng et al. (2011) who

demonstrated that the 60 ᵒC was the optimum temperature for biosurfactant

production by G. pallidus. .

0

10

20

30

40

50

60

70

80

0

10

20

30

40

50

60

70

80

35 40 45 50 55 60 65 70 75 80

Surf

ace

ten

sio

n(m

N/m

)

E24

%

Temperture(ᵒC)

Emulsificationindex

Surface tension

Figure (3-6): Effect of incubation temperature on biosurfactant production by G.

thermoleovorans (Ir1), grown in mineral salt medium (pH 7) with 1% crude oil and 0.4%

ammonium chloride, in shaker incubator (180 rpm) for 7 days.

Maximum enzymatic activation can only be obtained at an optimum

temperature (Nakata and Kurane,1999).

Saharan et al. (2011) observed that the growth of C. bombicola reached a

maximum at a temperature of 30 ºC, while 27 ºC was the best temperature for the

production of its biosurfactant. While Kitamoto et al. (2001) observed that the

highest mannosylerythritol lipid production was at 25 ᵒC and this temperature was

used for both growing and resting cells. .

3.3.4 Effect of nitrogen sources:

In order to determine the effect of different types of nitrogen sources on

biosurfactant production by G. thermoleovorans (Ir1), six nitrogen sources were

used. .

Results (figure 3-7) declared that the production of biosurfactant varies with


78

different nitrogen sources ((NH4)2SO₄, NH₄NO₃, NH₄Cl, KNO₃, Yeast extract and

urea), the highest E24% (70%) with low surface tension of (52 mN/m) were

obtained when an ammonium chloride (NH4Cl) was used, and this may attributed

to the simplicity of NH4Cl as a nitrogen source and easy to uptake by bacterium.

0

10

20

30

40

50

60

70

80

0

10

20

30

40

50

60

70

80

NH₄NO₃ NH₄Cl Yeast ext. KNO₃ (NH4)₂SO4 Urea

E24

%

Nitrogen source

EmulsificationindexSurfce tension(mN/m)

Surf

ace

ten

sio

n(m

N/m

)

Figure(3-7):Effect of nitrogen sources (0.4%) on biosurfactant production by G.

thermoleovorans (Ir1), grown in mineral salt medium (pH7) with 1% crude oil, at 60 ºC in

shaker incubator (180 rpm) for 7 days.

Okoliegbe and Agarry (2012) mentioned that the bacteria require nitrogen to

complete its metabolic pathways and it is essential for the microbial growth as

protein and enzyme syntheses depend on it.

Abu-Rawaida et al. (1991) and Guerra-Santos et al. (1986) detected that the

ammonium salts and urea preferred nitrogen sources for biosurfactant production

by A. paraffineus, whereas nitrate supported the maximum surfactant production by

P. aeruginosa and Rhodococcus sp. However, Johnson et al. (1992) found that the

potassium nitrate support the maximum production of biosurfactant by the yeast R.

glutinis IIP30.


77

3.3.5 Effect of nitrogen source (NH₄Cl) concentration:

Different concentrations of ammonium chloride were used to determine the

optimum concentration for biosurfactant production by G. thermoleovorans (Ir1).

Result illustrated in figure (3-8) show that the maximum E24% (77%) and

minimum surface tension (49 mN / m), were obtained when NH₄Cl was added in a

concentration of 0.3% (w/v). The results also showed a reduction in emulsification

index and increased in surface tension when the concentration of NH₄Cl was above

or below 0.3%.

Dastgheib et al. (2008) referred that the 2% sodium nitrate is the best nitrogen

source for emulsifier production by B. licheniformis. While Saharan et al. (2011)

detected that the production of biosurfactant often occurs when the nitrogen source

is depleted in the culture medium, during the stationary phase of cell growth, as an

example the biosurfactant production increased by P. aeruginosa, C. tropicalis

IIP-4 and Nocardia strain SFC-D due to the nitrogen limitation (Kosaric et al.,

1990; Singh et al., 1990).

3.3.6 Effect of pH:

To investigate the effect of initial medium pH on biosurfactant production by G.

thermoleovorans (Ir1), mineral salt medium was adjusted to different pH values.

The obtained results (figure 3-9) indicate that the highest emulsifying index (77%)

and lowest surface tension (49 mN/m) occurred with pH value 7. It was also shown

that a good activity was recorded with pH values between 6.5 to 9.


77

10

20

30

40

50

60

70

80

0

10

20

30

40

50

60

70

80

90

0 0.1 0.2 0.3 0.4 0.5 0.6

Surf

ace

te

nsi

on

(mN

/m)

E24

%

Nitrogen concentration

Emulsificationindex

surfacetension

Figure(3-8): Effect of ammonium chloride concentration on biosurfactant production by

G. thermoleovorans (Ir1), grown in mineral salt medium (pH7) with 1% crude oil, at 60 ºC

in shaker incubator (180 rpm) for 7 days.

This result pointed that pH 7 was optimum for the bacterial growth (Mahdi,

2013), and for the biosurfactant production.

The synthesis of the biosurfactant decreased without the pH control, indicating

the importance of maintaining it throughout the fermentation process (Bednarski et

al., 2004).

Environmental factors and growth conditions such as pH effect on biosurfactant

production through their effects of cellular growth or activity.

Zinjarde and Pant (2002) reported the effect of the initial pH in the production of

a biosurfactant by Y. lipolytica. They found that the maximum biosurfactant

production was obtained at pH 8.0.

Saharan et al. (2011) demonstrated that when the pH is maintained at 5.5, the

production of glycolipids reaches a maximum by C. antarctica and C. apicola.

Rhamnolipid production by Pseudomonas spp. reached its maximum at a pH 7


75

(Sifour et al., 2007)

Figure(3-9): Effect of pH value on biosurfactant production by G. thermoleovorans (Ir1),

grown in mineral salt medium with 1% crude oil, and 0.3% ammonium chloride at 60 ºC in

shaker incubator (180 rpm) for 7 days.

3.3.7 Effect of aeration:

The aeration represents another important factor influencing the biosurfactant

production by G. thermoleovorans (Ir1). To evaluate the effect of the aeration, the

cultures were incubated at different agitation speed (rpm) values ranging between

120-220 rpm.

The results illustrated in figure (3-10) indicate that maximum E24% (80%) with

reduction in surface tension (47mN/m) was obtained at 200 rpm.

This result was in agreement with Zheng et al. (2011) who noticed that the

optimum agitation speed was 200 rpm when the biosurfactant was produced by

thermophillic G. pallidus. Priya and Usharani (2009) declared that biosurfactant

production by B. subtilis and P. aeruginosa was optimized in a shaker operating at

120 rpm. Sheppard and Cooper (1990) had concluded that oxygen transfer was one

of the key parameters for the process optimization and scale-up of surfactin

production in Bacillus subtilis. While Ghayyomi et al. (2012) detected the


77

optimum rpm for biosurfactant production by Bacillus sp. was150 rpm.

0

10

20

30

40

50

60

70

80

90

0

10

20

30

40

50

60

70

80

90

100 120 140 160 180 200 220 240

Surf

ace

te

nsi

on

(mN

/m)

E24

%

Aeration (rpm)

Emulsificationindex

Surface tension

Figure (3-10): Effect of rpm value on biosurfactant production by G. thermoleovorans,

grown in mineral salt medium (pH 7) with 1% crude oil, and 0.3% ammonium chloride at

60 ºC for 7 days.

3.3.8 Effect of incubation period:

Different incubation periods (2-11 days) were examined in order to determine its

effect on biosurfactant production. Result (figure 3-11) showed that the maximum

E24% (87%) and the lowest surface tension (43mN/m) were in the tenth day of

incubation. E24% was dropped after ten days of incubation and this may attributed

to the interference between the metabolites and the formation of emulsion. Bonilla

et al. (2005) mentioned that biosurfactant biosynthesis stopped, probably due to the

production of secondary metabolites which could interfere with emulsion

formation and the adsorption of surfactant molecules at the oil–water interface.

Rosenberg et al. (1979) also reported a maximum emulsan production by A.

calcoaceticus RAG-1 during the stationary growth phase. While Persson et al.

(1988) showed that the biosurfactant biosynthesis using olive oil occurred

predominantly during the exponential growth phase, suggesting that the


77

biosurfactant was produced as a primary metabolite accompanying cellular

biomass formation (growth-associated kinetics).

Bidlan et al. (2007) pointed that biosurfactant produced by S. marcescens DT-1P

increased with incubation time and the production started at early stationary phase

and reached maximum in day 8, beyond both growth and biosurfactant production

decrease. On the other hand biosurfactant production by G. pallidus needed 14

days (Zheng et al., 2011). While Pseudomonas sp. strain LP1 produced

biosurfactant when growing in medium containing heavy oil with the highest

emulsification index (E24%) for the biosurfactant production was 80.33 ± 1.20, on

day 8 of incubation, the biosurfactant production is growth-associated (Obayori et

al., 2009).

0

10

20

30

40

50

60

70

80

0

10

20

30

40

50

60

70

80

90

100

0 2 4 6 8 10 12

Surf

ace

te

nsi

on

(mN

/m)

E24

%

Incubation period(days)

Emulsificationindex

Surfacetension

Figure (3-11): Effect of incubation period on biosurfactant production by G.

thermoleovorans (Ir1), grown in mineral salt medium (pH 7) with 1% crude oil and 0.3%

ammonium chloride in shaker incubator (200rpm) at 60 ºC.

3.4 Extraction and purification of biosurfactant:

Geobacillus thermoleovorans (Ir1) was grown in a mineral salt medium (pH7)

containing 1% crude oil as a sole carbon source and 0.3% ammonium chloride as a

nitrogen source, at 60 ºC, with shaking (200 rpm) for 10 days. After that,


78

biosurfactant was extracted using three different methods as illustrated in (2.2.6)

and the extraction with acetone gave a better biosurfactant activity as in figure(3-

12).

0%

10%

20%

30%

40%

50%

60%

70%

80%

Aceton Chloroform-methanol Diethyl ether

Emu

lsif

icat

ion

ind

ex(

E2

4%

)

Extraction methods

Emulsificationindex(E24%)

Figure(3-12):Methods used for extraction biosurfactant produced by G. thermoleovorans.

In order to obtain a purified biosurfactant, silica gel column chromatography was

used, by loading the column with partial purified biosurfactant which was

dissolved in chloroform. All eluted fractions were collected, then the emulsification

activity for each one was measured. By drawing the relation between

emulsification activity and fraction number as in figure (3-13), three peaks

appeared, two of them appeared when eluted with chloroform, in which the first

peak appeared in tubes number (38-45), while the second one at tubes number (46-

56) and the third one appeared with ethyl acetate with tubes number (82-94).

Results also indicated that the second peak gave the higher emulsification

activity (E.A= 0.48), while the third peak, which eluted with ethyl acetate gave E.A

= 0.43.


78

Silica gel column chromatography was used in several studies to purify

biosurfactant compounds, Zhao et al. (2013) used silica gel column

chromatography to purify rhaminolid produced by P. aeruginosa.

Thanomsub et al. (2006) also used silica gel column chromatography to purify

the rhamnolipids produced by P. aeruginosa B189 with sequential washing by

hexane, chloroform, ethyl acetate and methanol.

0

0.1

0.2

0.3

0.4

0.5

0.6

0 20 40 60 80 100 120 140

Em

uls

ific

ati

on

acti

vity

(5

40

nm

)

Fraction number

ChloroformEthyl acetate

Figure (3-13): Silica gel column chromatography with sequential elution system and flow

rate 30ml/hrs., fraction volume 3ml/tube.

3.5 Chemical composition of biosurfactant:

There was no completed idea about the chemical composition of biosurfactant

produce by G. thermoleovorans, only one study by Feng and Jin (2009) who

referred that the bioemulsifier consists of lipid, carbohydrate and protein.

Hence, the partial purified biosurfactant produce by G. thermoleovorans (Ir1)

was analyzed to determine their composition of lipid, carbohydrate and protein.


78

The results showed that the lipid content of partially purified biosurfactant was

37.7% according to the lipid standard curve. According to the dobies standard

curve the carbohydrate was 26.2%. And analyzed the absorbance of the protein

with Bradford standard curve revealed that the concentration of the protein was

10.7%.

The result revealed that the main part of the biosurfactants produced by G.

thermoleovorans (Ir1) was lipids followed by carbohydrate, and low concentration

of the protein.

These values were comparable with Feng and Jin (2009) who reported that the

bioemulsifier produced by G. thermoleovorans 5366T consisted the highest ratio of

lipid (35.8%), then carbohydrate (29.4%), and protein (15.8%).

While Zheng et al. (2011) mentioned that the bioemulsifier produced by G.

pallidus consisted of carbohydrate as the main part (68.6%), then lipid (22.7%),

and protein (8.7%).

Luna-Velasco et al. (2007) demonstrated that the main part of bioemulsifier

produced by Penicillium sp. was the lipid part with a ratio of 67%, carbohydrates

(11%), and protein (7%). Also the composition of bioemulsifier produced by

A. pallidus YM-1 was a complex of carbohydrates (41.1 %), lipids (47.6 %) and

proteins (11.3 %) (Zheng et al., 2011).

Jagtab et al. (2010) found that the bioemulsifier of B. stearothermophilus

consists of protein (46 %), carbohydrate (16 %), and lipid (10 %).

While Amaral et al. (2006) demonstrated that the chemical characterization of

Yansan from Y. lipolytica IMUFRJ 50682 consists of a polysaccharide–protein

complex with a low lipid content and the protein content of this polymer plays an

important role in the emulsification activity. And Sarrubbo et al. (2001) produced a

bioemulsifier, from Y. lipolytica in the presence of glucose as carbon source; this

biosurfactant consisted of 47 % protein, 45 % carbohydrate and 5 % lipids.


78

Jagtap et al. (2010) revealed that the chemical analysis of bioemulsifier from

Acinetobacter was proteoglycan with protein (53 %), polysaccharide (43 %), and

lipid (2 %). In comparisons, Kokare et al. (2007) mentioned that the bioemulsifier

produced by marine Streptomyces sp. S1 consisted of 82 % protein, 17 %

polysaccharide and 1 % reducing sugar.

3.6 Characterization of G. thermoleovorans biosurfactant:

In an attempt to complete the chemical characterization of biosurfactant

produced by G. thermoleovorans (Ir1). The partial and/or purified biosurfactant

was subjected to IR, HPLC, GC, HNMR analysis.

3.6.1 Fourier Transform Infrared Spectrometry:

The IR spectrum of partial purified biosurfactant produced by the bacterium

(figure 3-14) showed a broad band at 3282 cm⁻¹ and another band at 2922 cm⁻¹ this

may be attributed to the O-H groups of polysaccharide. This result was in

accordance with Singh et al. (2011) who demonstrated the presence of a broadly

stretching intense peak at around 3428 cm⁻¹ which is characteristic of hydroxyl

groups and a weak C–H stretch band at around 2928 cm⁻¹ of hetropolysaccharides

of biosurfactant produced by B. licheniformis. The results (figure 3-14) also

showed a strong band at 1654 cm⁻¹, 1537cm⁻¹ and 1432 cm⁻¹, those may be

attributed to the C=O, N-H and C-N respectively. In the study of Beech et al.

(1999) they demonstrated a band at 1655 cm⁻¹ which represented C- O stretching

of carboxyl group and/or protein related band of amide I, also a band at 1427 cm⁻¹,

which belonged to the protein group.


78

FTIR spectrum (figure 3-14) also showed a band at 1000 cm⁻¹ belonging to the

polysaccharide. It was revealed that the region from 1200–950 cm⁻¹ is associated

with (C–O–C) stretching of polysaccharides (Dean et al., 2010).

The above IR spectra results of biosurfactant produced by G. thermoleovorans

(Ir1) was in comparable with IR spectra of bioemulsifier produced by A. pallidus

YM-1 (Zheng et al., 2011). While Sharma et al. (2015) revealed the composition of

biosurfactant from Enterococcus faecium using FTIR spectrum was lipid and

polysaccharide fractions.

0 1000 2000 3000 4000 5000

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0.40

B

A

Figure (3-14): FTIR spectrum of partial purified biosurfactant produced by G.

thermoleovorans (Ir1), 50 scan for each spectrum.

A: 1/cm. B: Absorbance.

3.6.2 High performance liquid chromatography:

For further characteristics of the biosurfactant high performance liquid

chromatography (HPLC) was used for detecting the components of fatty acids,

carbohydrates and protein found in partial purified biosurfactant produced by G.


77

thermoleovorans (Ir1) depending on standard samples of fatty acids, sugars and

proteins.

The (HPLC) result (figure 3-15) revealed that there were many peaks of fatty

acid components (lipid part) for biosurfactant. The first peak was palmitic acid

(34.1µg/ml), the second peak was stearic acid (35.79 µg/ml), the third peak was

oleic acid (34.61µg/ml).

Figure (3-15): HPLC analysis of fatty acids components of partial purified biosurfactant

produce by G. thermoleovorans (Ir1), equipped with binary delivery pump model LC -10A

shimadzu, the eluted peak was monitored by SPD 10A VP detector.

While the results of carbohydrate content showed three peaks. The first peak

revealed xylose (20.5 µg/ml), the second peak was mannose (41.7 µg/ml), and the

third one was maltose (21.84 µg/ml), when compared to standard carbohydrate

(figure 3-16).


77

The results also showed three peaks for amino acid components of

biosurfactant, the first one was aspartic acid with a concentration of 11.55 µg/ml,

while the second was glutamic acid (20.60 µg/ml ) and glutamine with

concentration 15.7 µg/ml as shown in figure (3-17).

Feng and Jin (2009) mentioned that the carbohydrate in the bioemulsifier

produced by G. thermoleovorans 5366T mainly was D-mannose, and main amino

acids were glutamic acid, aspartic acid, alanine. While Adamu et al. (2015)

revealed that the biosurfactant produced by B. sphaericus EN3 was

phospholipid and made up of palmitic acid, leucine, alanine, serine, and

arginine. Similarly, B. azotoformans EN16 produced phospholipid with the

following components: glutamine, stearic acid, oleic acid glycine, valine and

arginine.

Figure (3-16): HPLC analysis of the carbohydrate components of partial purified

biosurfactant produce by G. thermoleovorans (Ir1), equipped with binary delivery pump

model LC-10A.

Retention time

Inte

nsi

ty


75

Figure (3-17): HPLC analysis of the amino acid components of partial purified

biosurfactant produce by G. thermoleovorans (Ir1), with flow rate 1 ml/min.

In addition Satpute et al. (2010) used the HPLC for separation of rhamnolipid

biosurfactant to its components.

3.6.3 Gas chromatography for lipid part (fatty acid) analysis:

As mentioned before (item 3-5) and according to the above result, it was

revealed that the main part of the biosurfactant produce by G. thermoleovorans

(Ir1) was lipids. So lipid part of the partial and purified biosurfactant were further

analyzed by gas chromatography.

Results (figure 3-18) showed that partial purified biosurfactant produced by this

bacterium consists of a high percentage (58.9%) of palmitic acid methyl

ester(C16:0), Stearic acid (C18:0), Oleic acid (C18:1n9C). Besides there are many

other fatty acids with a less percentage.

In comparison, the results of the purified biosurfactant also showed that it

mainly consists (high percentage) of palmitic acid mythel ester (C16-0) with

Retention time

Inte

nsi

ty


77

following ratio (23%, 44.4%, 30.3%) for the first, second and third band

respectively.

Feng and Jin (2009) analyzed the lipid part of biosurfactant from G.

thermoleovorans 5366T by gas chromatograph and mentioned that the main

component were hexadecanoic acid, octadecenoic acid, octadecanoic acid.

The gas chromatography analysis of the lipid fraction of bioemulsifier

synthesized by Penicillium sp. revealed that myristic (C-14), stearic (C-18), and

oleic (C-18:1) were the major acids that account of 41% of total fatty acids (Luna-

Velasco et al., 2007). While Shamra et al. (2015) found the gas chromatography

and mass spectroscopy data of the fatty acid produced by E. faecium was

hexadecanoic acid.

Figure (3-18): GC analysis of fatty acid sample of partial purified biosurfactant produce by

G. thermoleovorans using helium as a carrier gas on a Shimadzu 17-A GC.

The GC-MS analysis of the lipid fraction of bioemulsifier produced by A.

pallidus YM-1showed that the hexadecanoic acid and octadecanoic acid were the

major fatty acids that account for 94.4 % of the total fatty acids. Other fatty


77

acids determined at a lower extent were dodecanoic acid and tetradecanoic acid

(Zheng et al., 2011).

3.6.4 NMR for lipid part (fatty acid) analysis:

The NMR spectrum (figure 3-19) showed many signals of the partial purified

biosurfactant produced by G. thermoleovorans (Ir1) and the main signal was

attributed to triglycerides.

The partial purified biosurfactant consisted of two compounds, one of them may

be one of fatty acid, and the second one was triglycerides.

Figure (3-19): Selective region of H-NMR spectra of partial purified biosurfactant produce

by G. thermoleovorans (Ir1), in CDCL3 at 298K, at 500 MHz.

When comparing the results (NMR spectra) of partial and purified (purified

previously with silica gel column chromatography as in item (3-4)) biosurfactant,

(1)


888

the results revealed that all purified bands contain only triglycerides without the

other compounds as in figure (3-20).

Singh et al. (2011) analyzed exopolysaccharide produced by B. licheniformis

using H NMR spectrum, they noticed seventeen anomeric signals, depicting

complex and heterogeneous nature. While Amaral et al. (2006) indicated that the H

NMR signals for bioemulsifier produced by Y. lipolytica was attributed to

polysaccharide at 3.2–4.4 ppm, and the rest of the spectrum referred the presence

of low levels of protein.

Figure (3-20): Overlap of selective region of H-NMR spectra of biosurfactant produce by G.

thermoleovorans (Ir1). [black color] partial purified, [red color] purified band 1, [green

color] purified band 2 and [blue color] purified band 3, in CDCL3 at 298K, 500 MHz.

Gudiña et al. (2015b) used NMR to detected the bioemulsifier produced by

Paenibacillus sp. as a low molecular weight oligosaccharide-lipid complex in



888

which the fatty acids and oligosaccharides were structurally associated involving

either covalent or non-covalent bonds.

3.7 The biological activity of biosurfactant against tumor cell line:

In order to determine the antitumor activity of the purified biosurfactant

produced by G. thermoleovorans (Ir1), three different tumor cell lines (MCF7,

Jurkate, and Hut78) were exposed to different concentrations of purified

biosurfactant for three incubation periods (24, 48, and 72 hrs.).

MTS test was used for determining the number of viable cells in proliferation

cell with an absorbance at 490 nm (Duarte et al., 2014).

Results showed that the biosurfactant had an inhibitory effect on proliferation of

human breast cancer cell line (MCF7) during all periods of exposure as in table (3-

2) and appendix (5).

With respect to subjecting cell line to different concentrations with different

incubation periods, the inhibitory percent seemed to be increasing with the

increasing the concentration. Also the results showed a highly significant effect

were accounted among different concentrations in all incubation times except the

non – significant effect between 30 µg/ml with 20 µg/ml and 20 µg/ml with 10

µg/ml (table 3-2 and appendix 5).

For the 24 hrs. exposure time there was no pronounced effect on cell viability,

especially at the lower biosurfactant concentrations. For the highest exposure times

(48 and 72 hrs.), the number of viable cells were found to decrease significantly.

Result indicated in appendix (5) show a high significant inhibition p<0.01 effect

with all periods of incubation, and exposure to biosurfactant for 72 hrs. with high

concentration (100µg/ml) leding to significant inhibition activity. So, the effect


888

was dose and time dependent manner and this may be attributed to the

biosurfactant which have properties of detergent like. Cell proliferation may be

affected by different manners as mentioned by Fracchia et al. (2010) who

demonstrated the effect of surfactin of B. subtillus against the MCF7 cell line.

They found that at low concentrations, surfactin penetrates rapidly into the cellular

membrane forming micelles together with phospholipids, at moderate

concentrations, surfactin can induce pore formation on the lipid bilayers, and at

high concentrations, the detergent like effect prevails resulting in total membrane

loss.

Table (3-2): Inhibitory effect of different concentrations of purified biosurfactant against

MCF7cell line with different incubation period.

Concentration

(µg/ml)

Inhibitions %

MCF7 cells

24 hrs. 48 hrs. 72 hrs.

Mean± S.D. Mean± S.D. Mean± S.D.

0 0.000 ±0.00 0.000±0.00 0.000±0.00

100 33.75±15.19 59.00±3.960 66.55±0.919

60 24.60±1.414 48.35±0.495 57.20±13.294

50 13.70±3.960 39.70±4.525 40.90±11.455

40 9.100±2.121 20.15±9.405 28.45±5.303

30 5.200±1.838 8.95±0.495 15.40±9.475

20 0.000±6.25 6.25±3.323 6.45±2.899

10 0.000±0.00 1.45±1.485 2.300±1.273


888

The results of inhibitory effect illustrated in table (3-3) of purified biosurfactant

produced by G. thermoleovorans (Ir1) against lymphoblastic leukemia cells (Jurkat

cell) showed that the original readings of inhibition percent seemed to be

propagated with increasing level of concentrations. The results revealed that the

differences obtained for all biosurfactant concentrations, studied were of a

statistically highly significant, while a significant effect (P<0.05)was found

between 60µg/ml with 50µg/ml, 40µg/ml with 20µg/ml, 20µg/ml with 10µg/ml.

No significant (P>0.05) effect between 50µg/ml with 40µg/ml, 40µg/ml with

30µg/ml, and 30µg/ml with 20µg/ml.

The result illustrated in appendix (6), also indicate that the inhibition percentage

of cells treated was significantly increased with the increase of time, so it is the

time dependent manner, as increased with prolonged incubation, this may be due to

the dead cells release intracellular component, which caused toxicity increase and

induced more cells to die.

While the studied inhibitory effect of biosurfactant produced by G.

thermoleovorans (Ir1) against Human T cell lymphoma (Hut78) (table 3-4 and

appendix 7) showed a low inhibitory effect at low concentration, and a highly

significant effect (P<0.01) with most concentrations. The significant effect

(P<0.05) also shown in concentration 50µg/ml with 40µg/ml, 40µg/ml with

30µg/ml and no significant effect (P>0.05) for 60µg/ml with 50µg/ml and 20µg/ml

with 10µg/ml. With respect to the studied periods the results showed significant

(P<0.05) differences between different incubation periods.

The results (table 3-4) showed a low inhibitory effect at low concentrations even

with long incubation periods.

As shown in appendix (7) the inhibitory effect was time and dose dependent

manner.


888

The result showed that the inhibitory effect increased with the prolonged

incubation period.

The sensitivity of cell line to biosurfactant varied with type of these cells, since

the breast cancer cell line (MCF7 cell line) was more sensitive than Jurkat and

Hut78, when treated with purified biosurfactant and this variable in sensitivity may

be due to differences in metabolic pathway for different cell lines. Kim et al.

(2007) found that the metabolic pathways in response to each treatment differed

from one line to another.


Jurkat cell line and different incubation period.

Concentration

(µg/ml)

Inhibition %

Jurkat

24 hrs. 48 hrs. 72 hrs.


0 0.000±0.000 0.000±0.000 0.000±0.000

100 54.200±0.000 56.350±2.758 60.650±455

60 29.750±11.526 40.750±4.455 51.350±2.192

50 21.700±0.000 30.300±1.414 42.250±3.182

40 19.550±5.728 25.700±1.273 27.000±18.809

30 13.800±6.364 22.450±1.763 23.000±12.445

20 8.500±6.364 19.800±6.505 20.100±1.131

10 0.800±0.566 7.900±6.223 12.700±7.071

In order to find the effect of biosurfactant on normal kidney cell line, the result

revealed that no effect on this cell line even with high concentrations this may be


887

attributed to the metabolism of tumor cell which differ from the metabolism of

normal cell. Folkman (2000) mentioned that there was a selective toxicity towards

malignant cell lines and this was due to the differences in the malignant cellular

physiology such as the presence of some metabolic factors that found in the cancer

cell lines but not found in normal cells.


Hut78 cell line with different incubation period.

Concentration

(µg/ml)

Inhibitions %

Hut78

24 hrs. 48 hrs. 72 hrs.


0 0.000±0.000 0.000±0.000 0.000±0.000

100 19.400±0.000 28.250±4.879 36.700±3.253

60 11.300±9.758 27.300±4.525 26.800±0.566

50 5.000±0.849 22.500±1.414 24.700±4.525

40 1.210±0.849 13.000±3.253 22.800±0.566

30 0.600±0.849 9.550±10.677 13.350±4.313

20 0.000±0.000 0.120±0.000 2.910±3.946

10 0.000±0.000 0.000±0.000 0.000±0.000

Since the MCF7 cell line showed high inhibitory activity, so it was chosed for

subsequent cytotoxicity studies.


887

3.8 Cytotoxic effect of biosurfactant on cancerous cell lines:

The cytotoxic effect of purified biosurfactant was studied against breast cancer

(MCF7) cell line by using the thermo Scientific Cellomics Multi parameter

cytotoxicity 3 Kits, which enabled simultaneous measurement of many orthogonal

cell- health parameters: cell loss, released cytochrome C from mitochondria and

nucleus intensity, cell membrane permeability and mitochondria membrane

permeability when compared with control and positive control(Doxorobicin)..

The results illustrated in appendix (8) and table (3-5) indicate that the viability

(cell count) of cancer cells (MCF7) treated with different concentrations of purified

biosurfactant was highly significant decreased as compared with control and

significant effect when compared with positive control. The viablity of MCF7

were (928 ± 33.234 and 688± 9.90) after treatement with 50 and 100 µg/ml of

purified biosurfactant respectively.

The result illustrated in appendix (9) and table (3-6) also show that the

permeability of MCF7 cells were significantly increased when treated with 50 and

100 (µg/ml) of purified biosurfactant and the values of cell permeability were

increased from 31.35 to 36.3 and 56.6 for concentrations 50 µg/ml and 100 µg/ml

respectively.

The cytotoxic effect of purified biosurfactant on MCF7 cells line may be

attributed to the cell shrinkage membrane blebbing, loss of cell adhesion and

interaction with cell membrane lipids. Gudinã et al. (2013) mentioned that the

new therapeutic strategies may be designed, considering that, the use of

biosurfactant can alter lipid content to fluidize rigid cancerous

tissues and to modulate interfacial properties. While Janek et al. (2013) found that

the ability of biosurfactant to disrupt cell membranes, leading to a sequence of


885

events that include lysis, increased membrane permeability, and metabolite

leakage, have also been suggested as a probable mechanism of antitumor

activity.

Table (3-5): Effect of different concentrations of purified biosurfactant on cell count of

MCF7 cell line:

Treatment (µg / ml) Cell count (mean ± SE)

Control 1082± 79.195

Doxorubicin 50 76.00± 12.727

100 688± 9.90

50 928± 33.234

P-value 0.000 (HS)

HS= highly significant (p value <0.01).

Table (3-6): Effect of different concentrations of purified biosurfactant on cell permeability

of MCF7 cell line:


Treatment (µg / ml) Cell permeability(mean ± SE)

Control 31.35±5.020

Doxorubicin 50 87.7± 10.748

100 56.6± 8.902

50 36.3± 3.181

P value 0.0006(HS)


887

The result elucidated in appendix (10) and table (3-7) declare that the purified

biosurfactant caused a highly significant increase in cytochrome C releasing from

mitochondria of MCF-7 cells in concentrations 50 and 100 (µg/ml).

Table (3-7): Effect of different concentrations of purified biosurfactant on cytochrome c of

MCF7 cell line.

Treatment (µg / ml) cytochrome C (mean ± SE)

Control 99.98 ±2.969

Doxorubicin 50 132.0 ± 8.343

100 123.545± 3.026

50 106.68± .975

P value 0.007 HS


Appendix (11) and table (3-8) show that 50 and 100 (µg/ml) of purified

biosurfactant caused significant changes in the mitochondrial membrane potential.

This may be attributed to the release of cytochrome C, and that is in accordance

with Cao et al. (2011) who showed that surfactin induces ROS formation,

leading to mitochondrial permeability and membrane potential collapse that

ultimately results in an increase of calcium ion concentration in the

cytoplasm afterwards, cytochrome C released

from mitochondria to the cytoplasm activates caspase-9

eventually inducing apoptosis.


887

Results (appendix 12 and table 3-9) revealed that the nuclear size of the MCF-7

cell was highly and significantly affected by purified biosurfactant. Different

concentrations can cause a nuclear condensation induced at a higher concentration

(100µg/ml) from 393.6 to 454.97.

Table (3-8): Effect of different concentrations of purified biosurfactant on mitochondrial

membrane potential change of MCF7 cell line.

S= significant.

The apoptotic process may be attributed to nuclear condensation and DNA

fragmentation. This result was in accordance with Chiewpattanakul et al. (2010)

who detected the anticancer activity of biosurfactant produced by the dematiaceous

fungus Exophiala dermatitidis SK80 against cervical cancer (HeLa) and leukemia

(U937) cell lines. This effect is commonly associated with the apoptotic process,

in which the DNA is cleaved into fragments of 180 nucleosomal units by the

Lemastersensation. and nucleus cond endogenous endonuclease, caspase enzymes

nduction of the permeability transition pore can imentioned that the (2009) et al.

through apoptosis or necrosis cell death lead to mitochondrial swelling and

a sequence of apoptotic events depending on the particular biological setting

Treatment (µg / ml) mitochondrial membrane potential change

(MMP)(mean ± SE)

Control 32.56 ±5.10

Doxorubicin 50 21.2 ± 2.262

100 15.12± 0.120

50 23.31± 2.842

P value 0.022 S

http://en.wikipedia.org/wiki/Cell_death


888

chromatin and DNA including the condensation of ,was observed

inducing potential of MELs in -apoptosis ing thefragmentation, thus confirm

protein kinase C (PKC) might be associated with he activity ofT .these cells

events ctivation of PKC is one of the firstapoptosis induced by MELs. The a

esponses. cellular r ion that leads to a multiplicity of in the signal transduct

control factors in cell differentiation, family are key members of the PKCIndeed,

.and cell deathgrowth, of

While the activity of Succinoyl trehalose lipid against human monocytoid

waseffect, but like-detergentleukemic cell line (U937) was not caused by a simple

., 1995). et al(Isoda plasma membrane attributed to a specific interaction with the

Table (3-9): Effect of different concentrations of purified biosurfactant on nucleus

intensity of MCF7 cell line.

Treatment (µg / ml) Cell count(intensity) (mean ± SE)

Control 393.6±1.131371

Doxorubicin 50 497.5±16.68772

100 454.97±14.11

50 408.6 ±8.202439

P value 0.003 HS


The High Content Screening test evaluated the cytotoxic effect of biosurfactant

against the MCF7 cell line after 24 hrs. exposure. The evaluation of the HCS


888

images acquired from figure (3-21) showed that the cytotoxic response to

biosurfactant was dose dependent.

Result illustrated a significant cytotoxic effect at 100 µg/ml of purified G.

thermoleovorans (Ir1) biosurfactant, so at this concentration, many changes were

observed. This result was used as a key parameter for the evaluation cytotoxic

effect of this biosurfactant.

Cytotoxicity is a complex process affecting multiple parameters and pathways.

After toxic insult, cells often undergo either apoptosis or necrosis accompanied by

changes in nuclear morphology, cell permeability, and mitochondrial function,

resulting in loss of mitochondrial membrane potential and release of cytochrome C

from mitochondria (Taylor, 2007).

Mingeot- Leclercq et al. (1995) reported that changes in cell membrane

permeability are often associated with a toxic or apoptotic response, and the loss of

cell membrane integrity is a common phenotypic feature of marked cytotoxicity.

While Wakamatsu et al. (2001) found that exposure of adrenal gland

phaeochromocytoma (PC12) cells to MEL (biosurfactant of Candida antartica)

enhanced the activity of acetylcholine esterase and interrupted the cell cycle at the

G1 phase, with a resulting outcome of neurites and partial cellular differentiation.

Kim et al. (2007) showed that surfactin blocks cell proliferation by inducing

proapoptotic activity and arresting the cell cycle. Furthermore, surfactin

strongly blocked the PI3K/Akt signaling pathway (PI3K phosphoinositide 3

kinase; Akt also known as protein kinase B (PKB) is a

serine/threoninespecific protein kinase); both proteins are involved in multiple

cellular processes such as cell proliferation and apoptosis. Furthermore, Du


888

Nucleus Permeability Dye MMP Cytochrome C Merge

Figure (3-21): The cytotoxic effect of different concentrations of purified biosurfactant on

MCF7 cell.

1:Untreated cell 2: Treated cell with (50µg/ml) 3: Treated cell with (100 µg/ml) 4: Treated cell with

Doxorubin (50 µg/ml).

1

2

3

4


888

et al. (2014) indicated that the disturbance of the cellular fatty acid composition of

breast cancer cell lines, by lipopeptide, was related to apoptosis.

STL and MEL glycolipids differentiation-inducing activity was attributed to a

specific interaction with the plasma membrane instead of a simple detergent-like

effect. Moreover, succinoyl trehalose lipids have been shown to inhibit growth and

induce differentiation of HL60 human promyelocytic leukemia cells (Sudo et al.,

2000) and human basophilic leukemia cell line KU812 (Isoda et al., 1995).

While Chiewpattanakul et al. (2010) showed the biosurfactant monoolein

produced by the dematiaceous fungus Exophiala dermatitidis SK80,

effectively inhibited the proliferation of cervical cancer (HeLa) and leukemia

(U937) cell lines in a dose dependent manner, interestingly, no cytotoxicity

was found with normal cells, even when high concentrations were used. Cell

and DNA morphological changes observed in both cancer cell lines include

cell shrinkage, membrane blebbing, and DNA fragmentation.

3.9 Antimicrobial effect of biosurfactant:

The antimicrobial activity of purified biosurfactant was examined against many

microorganisms such as gram positive (S. aureus, Streptococcus sp.), gram

negative bacteria (E. coli, P. aeruginosa, Proteus mirabilis) and fungi (A. niger,

Penicillium, C. albicans).

The results showed that the biosurfactant had different antibacterial effect on the

bacterial growth. As shown in figure (3-22) and when compared with

appendix(13), the biosurfactant with concentration 100 mg/ml had an effect on S.

aureus, Streptococcus sp. and P. aeruginosa with the inhibition zone 19 mm,

13mm and 10 mm respectively. While no effect of biosurfactant was observed

against other remaining bacterial strains.


888

Result illustrated in figure (3-23) show the antifungal effect of purified

biosurfactant against C. albicans growth with concentration 100 mg/ml and it

caused the inhibition zone (21mm). The concentration 75mg/ml had an effect with

inhibition zone 11mm. while there was no any effect of all concentrations of

biosurfactant against A. niger and Penicillium.

This effect may be attributed to the structure of biosurfactant, it is supposed to

exert its toxicity on the cell membrane permeability as detergent like effect that

emulsified lipid bacterial membranes and/or form a pore-bearing channel inside a

lipid membrane.

Deleu et al. (2008) found that the effect of lipopeptide biosurfactant of Bacillus

spp. was attributed to self-associate and form a pore-bearing channel was due to

the ability of micellular aggregate inside a lipid membrane.

Landman et al. (2008) mentioned that the lichenysin, pumilacidin and

polymyxin B are lipopeptides produced by B. licheniformis, B. pumilusand and B.

polymyxa, respectively, has shown antibacterial activities against a wide variety of

gram negative pathogens due to the high affinity for the lipid moieties of

lipopolysaccharide. Mannosylerythritolcations lipid (MEL), a glycolipid surfactant

of C. antartica, has shown an antimicrobial activity, particularly against gram-

positive bacteria (Kitamoto et al., 1993).

Zhao et al. (2010) pointed that the diverse structures of biosurfactant confer

them the ability to display versatile performance. While Fernandes et al. (2007)

who investigated the antimicrobial activity of biosurfactant (lipopeptides) of B.

subtilus demonstrated that this biosurfactant has a broad spectrum of antimicrobial

activity against microorganisms with multidrug-resistant profile.


887

Yalçin and Ergene (2009) found the antifungal activity of biosurfactant produced

by Pseudomonas sp. against yeasts (C. albicans FMC 17 and C. krusei ATCC

6258), with diameters of an inhibition zone ranging between 12 and 17 mm

respectively.

Rodrigues et al. (2006b) indicated that biosurfactant might also contain signaling

factors that interact with the host and/or bacterial cells, leading to the inhibition of

infections.

Moreover, they support the assertion of a possible role in preventing microbial

adhesion and their potential in developing anti-adhesion biological coatings for

implant materials.

Nitschke et al. (2010) reported that rhamnolipids produced by P. aeruginosa

LBI has an antimicrobial activity against several bacteria and fungi, including B.

cereus, S. aureus, M. luteus, M. miehei and N. crassa.

The characteristics of sophorolipid and rhamnolipid were evaluated as antifungal

agents against plant pathogenic fungi. Eight percent of mycelial growth of plant

pathogen (Phytophthora sp. and Pythium sp.) was inhibited by 200 mg/L of

rhamnolipid or 500 mg/L of sophorolipid, and zoospore motility of


887

Figure (3-22): Antibacterial activity of purified biosurfactant produced by

G. thermoleovorans(Ir1) against S. aureus grown on Muller Hinton agar incubated at 37 º C

for 24hrs.

Figure (3-23): Antifungal activity of purified biosurfactant produced by G. thermoleovorans

(Ir1) against C. albicans grown on Muller Hinton agar incubated at 28 º C for 5 day.

(100 mg/ml) biosurfactant

control

(100 mg/ml) biosurfactant

sample

control


885

Phytophthora sp. decreased by 90 % at 50 mg/L of rhamnolipid and 80% at 100

mg/L of sophorolipid.

The effective concentrations of zoospore lysis were two times higher than those

of zoospore motility inhibition. The highest zoospore lysis was observed with

Phytophthora capsici; 80 % lysis at 100 mg/L of di-rhamnolipid or lactonic

sophorolipid, showing the dependency of structure on the lysis. These results

showed the potential of microbial glycolipid biosurfactants as an effective

antifungal agent against damping-off plant pathogens (Dal-Soo et al., 2005).

Another lipopeptide with an antimicrobial activity and other interesting

biological properties is viscosin, a cyclic lipopeptide from Pseudomonas (Saini et

al., 2008).

3.10 Effect of some physical and chemical factors on partial purified

biosurfactant activity:

3.10.1 The physical properties of biosurfactant:

The physical properties of the partial purified biosurfactant produced by G.

thermoleovorans(Ir1) showed that the biosurfactant has a white to brown color, and

soluble in a slightly warm Tris solution, chloroform and water but partially

soluble in butanol and methanol. And the melting point was >250 ºC.

Singh et al. (2011) showed that the exopolysaccharide bioemulsifier produced

by B. licheniformis was dissolved in deionized water heating at 80 ºC.


887

3.10.2 Effect of different concentrations of biosurfactant on emulsification

activity:

Different concentrations of partial purified biosurfactant produced by G.

thermoleovorans (Ir1) were utilized for emulsification of sunflower oil. The result

showed that the optimum concentration of biosurfactant was 7 mg/ml and

E24%value 86%. The E24% was reduced at a concentration below this value,

with no detectable E24% at concentration 2 to 3 mg/ml (figure 3-24).

Liu et al. (2010) demonstrated that the biosurfactant synthesized by B.

subtilis CCTCC AB93108 one of the most powerful biosurfactant, has good

activity at concentration 2.96 g/L.

0

10

20

30

40

50

60

70

80

90

100

0 1 2 3 4 5 6 7 8 9 10

Emu

lsif

icat

ion

ind

ex

(E 2

4%

)

Concentration (mg/ml)

Figure (3-24): The effect of different concentrations of G. thermoleovorans (Ir1)

biosurfactant on emulsification index (E24%) of sunflower oil.


887

3.10.3 Effect of temperature on biosurfactant activity:

The results showed that the biosurfactant of G. thermoleovorans (Ir1) has good

stability with a wide range of temperatures (20-120 ºC), the maximum activity at

60 ºC was E24% = 87% (figure 3-25).

0

10

20

30

40

50

60

70

80

90

100

0 20 40 60 80 100 120 140

Emu

lsif

icat

ion

ind

ex (

E 2

4%

)

Temperture(ᵒC)

Figure (3-25): The effect of temperature on stability of biosurfactant produce by G.

thermoleovorans for 30 min.

Also the results showed that the biosurfactant has an activity at 100 ºC, and this

result revealed that this biosurfactant was heat stable, this stability may relate to its

structure (lipids, carbohydrates and protein).

The emulsification activity of extracellular bioemulsifier produced by B.

stearothermophilus VR-8 grown in a medium containing 4% crude oil was stable

over a broad range of temperatures (50–80 ºC), the emulsification activity was

100% at 80 ºC for 30 min, and 60% at 90 ºC and 100 ºC (Gurjar et al., 1995 ).

Result illustrated in figure (3-25) also indicate low activity of biosurfactant with

a high temperature above 100 ºC and this may be attributed to denature of its

structure (especially the protein part) at high temperature.


888

Sarubbo et al. (2006) mentioned that the loss of emulsifying activity during

heating at 100 ºC can be explained by the denaturation of the protein fraction of

bioemulsfier of Microbacterium sp. MC3B-10.

Several bioemulsifiers are effective at high temperatures, including the protein

complex from M. thermoautotrophium (De Acevedo and Mclnerney, 1996) and the

protein-polysaccharide-lipid complex of B. stearothermophilus ATCC 12980

(Gurjar et al., 1995). While Maneerat and Dikit (2007) observed that the cell-

associated bioemulsifier crude extract produced by Myroides sp. SM1 was stable in

a broad temperatures ranging from 30 to 121ºC and this range did not affect the

emulsification activity.

3.10.4 Effect of some salts on biosurfactant activity:

In order to determine the stability of biosurfactant with salts, three kinds of

mineral salts (NaCl, KCl and CaCl2) at different concentrations were mixed with

biosurfactant to detect their effect on the emulsification index.

Results presented in figure (3-26) show that the emulsification index was stable

at concentration 2%, 2% and 8% of NaCl, CaCl2 and KCl respectively.

Besides the results showed that the best salt, which maintain the E24% was

CaCL₂ then NaCl. It was also noticed that the low (2%) and high (20%)

concentration of KCl gave the lowest E24%.

From the above results, it is clear that the biosurfactant activity was stable over a

wide range of salt concentrations and the activity was stable even at a high

concentration of salt. This may be attributed to the salt, which plays a major role in

the physiological cellular activity and metabolism.


888

Abu-Rawaida et al. (1991) mentioned that the salt plays an important role in

biosurfactant production depending on its effect on cellular activity. Some

biosurfactant products, however, were not affected by salt concentrations up to 10

% (w/v), although little reduction in the critical micelle concentrations was

demonstrated.

40

50

60

70

80

90

100

0% 5% 10% 15% 20% 25%

Emu

lsif

icat

ion

ind

ex(E

24

%)

Salt concentration (%)

NaCl

KCl

CaCL₂

Figure (3-26): The effect of different salts (NaCl, CaCl2 and KCl)) concentrations on

stability of biosurfactant produced by G. thermoleovorans (Ir1).

Bioemulsifier extracted from Myroides sp. SM1was able to emulsify weathered

crude oil in the presence of NaCl from 0.51 M up to 1.54 M, but a loss in activity

was found when NaCl concentration was above 1.54M. The highest emulsification

activity was observed in the presence of 1.02 to 1.54 M of NaCl. However, the

activity was found in the absence of NaCl, while 3M CaCl2 inhibited the

emulsification of weathered crude oil by crude extract. The activity was not

inhibited in the presence of MgCl2 up to 0.1 M, but was enhanced at 0.02 M MgCl2

(Maneerat and Dikit, 2007).


888

Camacho-Chab et al. (2013) studied emulsifying activity and stability of a

bioemulsifier synthesized by Microbacterium sp. MC3B-10 and mentioned that the

highest levels of activity were observed at 3.5% NaCl. While the emulsification

activity of biosurfactant produced by Aeromonas spp., was maintained with

concentration of NaCl up to 5% (Ilori et al., 2005).

3.10.5 Effect of pH on biosurfactant activity:

The result declared in figure (3-27) indicate that biosurfactant of G.

thermoleovorans (Ir1) remain active over a wide range of pH (2-10). The highest

(E24%= 87%) was observed at pH 7, while the minimum E24%=58% was

recorded with pH 2.

This result was in agreement with Kokare et al. (2007) who mentioned that the

maximum activity of biosurfactant of Streptomyces sp. at pH value 7, and reduced

in acidic as well as in basic pH.

However, slightly higher levels of emulsifying activity that recorded at acid and

alkaline pH values, suggesting the ionization of functional groups that resulted in

the activation of less surface-active species within the bioemulsifier matrix

(Sarubbo et al., 2007).

In comparison, biodispersan of A. calcoaceticus A2 had an optimum functional

pH range of 9 to 12 for limestone-dispersing activity (Rosenberg et al., 1988).

While Adamu et al. (2015) found that the phospholipids produced by Bacillus

sphaericus EN3 and Bacillus azotoformans EN16 were more effective at pH of

8 to 10. While a precipitation was observed at pH below 6 in the crude extracted

bioemulsifier of Acinetobacter, but no changes in activity were observed in the pH

(6-12).


888

10

20

30

40

50

60

70

80

90

100

0 2 4 6 8 10 12

Emu

lsif

icat

ion

act

ivit

y(E%

)

PH value

Figure (3-27): The effect of different pH values on activity of biosurfactant produced by G.

thermoleovorans (Ir1).

The stability of crude extract bioemulsifier from A. calcoaceticus sub sp.

anitratus SM7 in alkaline pH indicated that ester linkages were not required for its

emulsifying activity, and at a pH close to isoelectric point, there was no

electrostatic repulsion between neighboring molecules, and the compounds tend to

coalesce and precipitate (Phetrong et al., 2008).

According to the above results, it can be concluded that the biosurfactant is

active with a wide range of temperature, different concentration of following salt

(NaCl, KCl and CaCl2) and at different pH values, so biosurfactant produced by G.

thermoleovorans (Ir1) can be used in many applications that require using extreme

conditions.


888

3.11 Detection of gene coded for biosurfactant production:

In an attempt to amplify and characterize the gene responsible for

biosurfactanteeeeee of G. thermoleovorans (Ir1), the primers for sfp gene coded for

biosurfactant produced by Bacillus sp. was used, because there was no data found

in NCBI about the gene(s) or DNA sequence coded for biosurfactant in

Geobacillus spp.

3.11.1 Isolation of genomic DNA:

Genomic DNA of G. thermoleovorans (Ir1) and B. subtilis (positive control) was

extracted using (2.1.6) kit, in order to amplify the gene coded for biosurfactant

using PCR. The results showed that the recorded range of DNA

concentration was 75-180 ng/μl and the DNA purity was 1.7-1.9, which

indicated a high purity. A pure DNA preparation expected A260/A280 ratio of 1.8

which was based on the extinction coefficients of nucleic acids at 260 nm and

280 nm (Green and Sambrook , 2012). Such results were also observed when the

DNA samples were analyzed by gel electrophoresis, in which sharp DNA

bands were detected, indicating purified DNA samples as shown in figure (3-28).


887

Figure (3-28): Gel electrophoresis for genomic DNA of G. thermoleovorans (Ir1), gel

electrophoresis was performed on 1% agarose gel and run with 5V/cm for 1.5 hrs. Lane (1)

is 10000 bp ladder, Lane: (2) genomic DNA of G. thermoleovorans, Lane: (3) genomic DNA

of B. subtilis. .

3.11.2 Amplification of gene coded for biosurfactant:

Genomic DNA was used to amplify the gene coded for the biosurfactant

production using a specific primer (table 2.1.4).

The results illustrated in figure (3-29) show that B. subtilis gave the positive

result, the amplified fragment was about 675 bp in size, which was the same size

for biosurfactant gene phosphopantetheinyl transferase (sfp). In comparison result

showed no amplification product was seen, when using the same primers and

Lane3

Lane2

Lane1


887

similar conditions, with G. thermoleovorans (Ir1). This means that the (sfp) gene

not found within genomic of this bacterium.

Amplification product

of sfp gene(675bp)

Figure (3-29): Gel electrophoresis for amplification of sfp gene using specific primers of sfp.

Electrophoresis was performed on 1.5% agarose gel and run with 5V/cm for 1hr. Lane (1)

DNA ladder (1kb), Lane (2): Amplification of G. thermoleovorans, Lane (3): Amplification

of Bacillus subtilis.

Roongsawang et al. (2002) mentioned that the sfp plays an important role in the

production of biosurfactant, and the species were identified as positive for the sfp

gene in the PCR experiment were close relatives to the species B. subtilis. While

Cosmina et al. (1993) showed that the sfp gene is an important member of the srfA

operon, which codes for a nonribosomal peptide synthetase complex also known as

surfactin synthetase. The sfp gene is an essential component of peptide synthesis

Lane 1 Lane 2 Lane 3

8888

7888

8888

8788

8788

8888

578

788

878


885

systems and it also plays a role in the regulation of surfactin biosynthesis gene

expression (CLSI, 2007).

Line 2

Line 1

Line M

Chapter FOUR

Conclusions

And Recommendations

Chapter four Conclusions and Recommendations

821

Conclusions and Recommendations

Conclusions:

- All thermophillic bacteria used in this study were able to produce

biosurfactant, and G. thermoleovorans Ir1 (JQ 912239) was the most efficient

one.

- The activity and productivity of biosurfactant was increased by optimized

cultural condition for G. thermoleovurance Ir1(JQ912239).

- The chemical composition of biosurfactant revealed that it consists of 37.7%

lipids, 26.2% carbohydrate and 10.7% protein. The chemical characterization

revealed that the lipid part consists of palmitic acid, stearic acid and oleic acid.

The carbohydrate consist of xylose, mannose and maltose. The protein part

consists of aspartic acid, glutamic acid and glutamine.

- Biosurfactant showed an inhibitory effect against three different tumor cell

lines (MCF7, Jurkate, and Hut78). The effect was dependent on the type of

tumor cell line, biosurfactant concentration, and exposure time, with no

cytotoxic effect on the normal kidney cell line.

-Biosurfactant had a cytotoxic effect against MCF7 cell line by decrease of cell

count, with increase in cell permeability, cytochrome C released from

mitochondria, and nucleus intensity and a significant reduction in the potential

of the mitochondrial membrane.

- The purified biosurfactant had different antibacterial effect against gram

negative and gram positive bacteria, it also had an antifungal activity.

- The biosurfactant is active with a wide range of temperature, different

concentration of salts and at different pH values, therefor, it can be used in

many applications required using extreme conditions.

Chapter four Conclusions and Recommendations

821

- The (sfp) gene is not found within genomic DNA of G. thermoleovorans

Ir1(JQ912239).

Recommendations:

1-More analytical techniques are required to clarify the chemical composition

of biosurfactant.

2- Studing the antiviral activity, antiadhesive and immunmodulatory effect of

this biosurfactant.

3- In vivo study of the antimicrobial and antitumor activity of biosurfactant.

4-Producting of biosurfactant and using it in different industrial applications

that require extreme conditions.

5- Genetic study of G. thermoleovorans Ir1 to detect the gene(s) responsible

for the biosurfactant production.

References

130

(A)

-Abbasnezhad, H. (2009). Role of microbial adhesion in phenanthrene

biodegradation by P. fluorescens LP6a. Ph.D Thesis, Chemical Engineering.

University of Alberta.

-Abdel-Mawgoud, A. M.; Lépine, F. and Déziel, E. (2010). Rhamnolipids:

diversity of structures, microbial origins and roles. Appl. Microbiol. Biotechnol.,

86(5):1323–1336.

-Abouseoud, M.; Yataghene, A.; Amrane, A. and Maachi, R. (2008).

Biosurfactant product ion by free and alginate entrapped cells of P. fluorescens. J.

Ind. Micr. Biotechnol., 35:1303 –1308.

-Abu-Ruwaida, A. S.; Banat, L. M.; Haditirto, S. and Khamis, A. (1991).

Nutritional requirements and growth characteristics of a biosurfactant producing

Rhodococcus bacterium. World. J. Microbiol., 7:53-61.

-Adamu, A.; Ijah, U. J. J.; Riskuwa, M. L.; Ismail, H. Y. and Ibrahim, U. B.

(2015). Study on biosurfactant production by two Bacillus Spp. International

Journal of Scientific Research in Knowledge. 3(1):013-020.

-Adav, S. S. and Lee, D. J. (2008). Extraction of extracellular polymeric

substances from aerobic granule with compact interior structure. J. Haz. Mat.,

154:1120–1126.

-Aizawa, T.; Neilan, B. A.; Couperwhite, I.; Urai, M.; Anzai, H.; Iwabuchi, N.;

Nakajima, M. and Sunairi, M. (2005). Relationship between extracellular

polysaccharide and benzene tolerance of Rhodococcus sp. Actinomyc., 19 :1-6.

-Al-Azawi, S. H. S. (1982). The effect of microorganism on asphaltic concrete.

MSc. Thesis. College of Science. University of Baghdad. (In Arabic).

http://www.ncbi.nlm.nih.gov/pubmed/?term=Abdel-Mawgoud%20AM%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=L%26%23x000e9%3Bpine%20F%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=D%26%23x000e9%3Bziel%20E%5Bauth%5D

131

-Al-Jailawi, M. H.; Mahdi, M. S. and Fadhil, A. (2013). Thermophilic bacteria

isolated from hydrocarbon contaminated soils in iraq, International Journal of

Biotechnology, Photon. 111: 275-283.

-Al-Saffar, A. Z. (2010). Antitumor, hepatotoxic and cytogenetic effect of the

partially purified endotoxin extracted from locally isolated S. typhimurium. Ph.D.

Thesis, Collage of Science, University of AL-Nahrain.

-Al -Tahhan, R. A.; Sandrin, T. R.; Bodour, A. A. and Maier, R. M. (2000).

Rhamnolipid-induced removal of lipopolysaccharide from P. aeruginosa: Effect

on cell surface properties and interaction with hydrophobic substrates. Appl.

Environ. Microbiol., 66(8):3262-3268.

-Amaral, P. F. F.; da Silva, J. M.; Lehocky, M.; Barros-Timmons, A. M. V.;

Coelho, M. A. Z.; Marrucho, I. M. and Coutinho, J. A. P. (2006): Production and

characterization of a bioemulsifier from Y. lipolytica: Process Biochemistry.

41:1894–1898.

-Amiriyan, A.; Assadi, M. M.; Saggadian, V. A. and Noohi, A. (2004).

Bioemulsan production by Iranian oil reservoirs microorganism. Iranian J. Env.

Health Sci. Eng., 1(2):28 – 35.

- Anandaraj, B. and Thivakaran, P. (2010). Isolation and production of

biosurfactant producing organism from oil spilled soil. J. Biosci. Tech., 1 (3):

120-126.

-Aparnaa, A.; Srinikethan, G. and Smitha, H. (2012). Production and

characterization of biosurfactant produced by a novel Pseudomonas sp. 2B.

Colloid Surface B., 95: 23-29.

-Arutchelvi, J.; Bahaduri, S.; Uppara, P. V. and Doble, M. (2009). Production

and characterization of biosurfactant from B. subtilis YB7. Journal of Applied

Sciences. 9: 3151 – 3155.

132

-Atlas, R. M. and Cerniglia, C. E. (1995). Bioremediation of petroleum

pollutans: Diversity and environmental aspects of hydrocarbon biodegradation.

Bio. Science. 45: 332-338.

-Atlas, R.; Brown, A. E. and Parks, L. C. (1995). Laboratory manual

experimental microbiology. Mosby –year Book, Inc., Wesline Industerial Drive,

St. Louis, Missouri.

(B)

-Bach, H.; Berdichevsky, Y. and Gutnick, D. (2003). An exocellular protein from

the oil –degrading microbe A. venetianus RAG-1 enhances the emulsifying

activity of polymeric bioemulsifier Emulsan. Applied and Environmental

Microbiology. 69 (5): 2608 – 2615.

- Banat, I. M. (1995a). Biosurfactants production and possible uses in microbial

enhanced oil recovery and oil pollution remediation: a review. Bioresource

Technol., 51:1–12.

-Banat, I. M. (1995b). Biosurfactant characterization and use in pollution

removal; state of the art (review). Acte. Biotechnol., 15(3):251-267.

- Banat, I. M.; Makkar, R. S. and Cameotra, S. S. (2000). Potential commercial

applications of microbial surfactants. Applied Microbiology and Biotechnology.

53: 495–508.

-Banat, I. M.; Marchant, R. and Rahman, T. J. (2004). G. debilis sp. a novel

obligatory thermophilic bacterium isolated from a cool soil environment and

reassignment of B. pallidus to G. pallidus comb. nov. Int. J. Syst. Evol.

Microbiol., 54:2197–2201.

133

-Banat, I. M.; Franzetti, A.; Gandolfi, I.; Bestetti, G.; Martinotti, M. G.;

Fracchia, L.; Smyth, T. J. and Marchant, R. (2010). Microbial biosurfactants

production, applications and future potential. Appl. Microbiol. Biotechnol.,

87:427–444.

-Batista, S. B.; Mounteer, A. H.; Amorim, F. R. and Totola, M. R. (2006).

Isolation and characterization of biosurfactant /bioemulsifier – producing bacteria

from petroleum contaminated sites. Bioresource Technology. 97(6): 868-875.

-Bednarski, W.; Adamczak, M. and Tomasik, J. (2004). Application of oil

refinery waste in the biosynthesis of glycolipids by yeast. Bioresource

Technology. 95: 15-18.

-Beech, I.; Hanjagsit, L.; Kalaji, M.; Neal, A. L. and Zinkevich, V. (1999).

Chemical and structural characterization of exopolymers produced by

Pseudomonas sp. NCIMB 2021 in continuous culture. Microbiology. 145: 1491–

1497.

-Benson, H. J. (2002). Microbiological Applications (8th) ed. McGraw Hill ,

Boston.

-Bertrand, J. C.; Bonin, P.; Goutx, M.; Gauthier, M. and Mille G. (1994). The

potential application of biosurfactants in combatting hydrocarbon pollution in

marine environments. Res. Microbiol., 145 (1):53–56.

-Bibel, D. J. and Aly, R. (1992). Inhibition of microbial adherence by

sphinganine. Can. J. Microbiol., 38: 983–985.

-Bidlan, R.; Deepthi, N. and Manonmani, H. (2007). Optimised production of

biosurfactant by S. marcescens DT-1P. Research Journal of Microbiology. 2(10):

705 – 716.

-Borzei x, C. and Frederique, K., (2003). Use of sophorolipids comprising

diacetyl lactones as agent for stimulating skin fibroblast metabolism. USpatent:,

6596265.

134

-Bonilla, M.; Olivaro, C.; Corona, M.; Vazquez, A. and Soubes, M. (2005).

Production and characterization of a new bioemulsifier from P. putida ML2, J.

Appl. Microbiol., 98: 456–463.

-Bonmatin, J. M.; Genest, M.; Labbe, H. and Ptak, M. (1994). Solution three

dimensional structure of surfactin: a cyclic lipopeptide studied by 1H-NMR,

distance geometry, and molecular dynamics. Biopolymers. 34:975-986.

-Bradford, M. M. (1976). Rapid and sensitive method for the quantitation of

microgram quantities of protein utilizing the principle of protein-dye binding.

Anal. Biochem., 72: 248–254.

-Brown, P.; DeAntonois, K. and Hall, P. (1997). High Performance Liquid

Chromatography. Handbook of Instrumental Techniques for Analytical

Chemistry, Frank Settle, Editor:147-164.

(C)

-Caccamo, D.; Gugliandolo, C.; Stackebrandt, E. and Maugeri, T. L. (2000). B.

vulcani sp. a novel thermophilic species isolated from a shallow marine

hydrothermal vent. Int. J. Syst. Evol. Microbiol., 50:2009–2012.

-Camacho-Chab, J. S.; Guézennec, J.; Chan-Bacab, M. J.; Ríos-Leal, E.;

Sinquin, C.; Muñiz-Salazar, R.; Rosa-García, S.; Reyes-Estebanez, M. and

Ortega-Morales, B. O. (2013). Emulsifying Activity and Stability of a non-toxic

bioemulsifier synthesized by Microbacterium sp. MC3B-10. Int. J. Mol. Sci.,

14:18959-18972.

-Camargo de Morais, M. M.; Ramos, S. A. F.; Pimentel, M. C. B.; Melo, E. H.

M., Morais, M. A.; Kennedy, J. F. and Lima Filho, J. L. (2006).

http://en.wikipedia.org/wiki/Marion_M._Bradford

135

Lipopolysacchride extracellular emulsifier produced by P. citrinum. Journal of

Biological Sciences. 6 (3): 511-515.

-Cameotra, S. S. and Makkar, R. S. (2004). Recent applications of biosurfactants

as biological and immunological molecules. Curr. Opin. Microbiol., 7(3):262-

266.

-Cameotra, S. S.; Makkar, R. S.; Kaur, J. and Mehta, S. K. (2010). Synthesis of

biosurfactants and their advantages to microorganisms and mankind. Adv. Exp.

Med. Biol., 672:261–280.

-Cao, X. H.; Wang, A. H.; Jiao, R. Z.; Wang, C. L.; Mao, D. Z.; Yan, L. and

Zeng, B. (2009). Surfactin induces apoptosis and G2/M arrest in human breast

cancer MCF-7 cells through cell cycle factor regulation. Cell Biochem.

Biophys., 4:163–171.

-Cao, X. H.; Zhao, S. S.; Liu, D. Y.; Wang, Z.; Niu, L. L.; Hou, L. H. and Wang,

C. L. (2011). ROS-Ca (2+) is associated with mitochondria permeability

transition pore involved in surfactin induced MCF-7 cells apoptosis. Chem. Biol.

Interact., 190(1):16-27.

-Cataldi, T. R. I.; Margiotta, G.; Lasi, L.; Chio, B. D.; Xiloyannis, C. and Bufo S.

A. (2000). Determination of sugar compounds in olive plant extracts by anion –

exchange chromatography with pulsed amperometric detection. Anal. Chem.,

72:3902-3907.

-Chakrabarti, S. (2012). Bacterial biosurfactant: characterization, antimicrobial

and metal remediation properties. MSc. Thesis. Department Of Life Science,

National Institute Of Technology, Rourkela, Odisha.

-Chen, C. Y.; Baker, S. C. and Darton, R. C. (2006). Continuous production of

biosurfactant with foam fractionation. Journal of Chemical Technology and

Biotechnology. (81): 1915–1922.

136

-Chen, S. Y.; Wei, Y. H. and Chang, J. S. (2007). Repeated Ph-stat fed- batch

fermention for rhamnolipid production with indigenous P. aeruginosa S2. Appl.

Microbiol. Biotechnol., 76(1):67-74.

-Chiewpattanakul, P. S.; Phonnok, A. D.; Emmanuelle, M., and Thanomsub,

B. W. (2010): Bioproduction and anticancer activity of biosurfactant produced by

the dematiaceous fungus E. dermatitidis SK80. J. Microbiol. Biotechnol.,

20(12):1664–1671.

-Christofi, N. and Ivshina I. B. (2002). Microbial surfactants and their use in

field studies of soil remediation. Journal of Applied Microbiology. 93(6) : 915–

929.

-Chtioui, O.; Dimitrov, k.; Gancel, F. and Nikov, I. (2005). Biosurfactnts

production by immobilized cells of B. subtilis ATCC21332 and their recover by

pertraction. Process. Biochem., 48(11):1795-1799.

-CLSI, (2007). Performance standards for antimicrobial susceptibility testing,

seventeenth informational supplement, Wayne, Pa, USA.

-Cooper, D. G. and Zajic, J. E. (1980). Surface active compounds from

microorganisms. Advances in Applied Microbiology. 26: 229-253.

-Cooper, D. G. and Paddock, D. A. (1984). Torulopsis petrophilum and surface

activity. Appl. Environ. Microbiol., 46: 1426-1492.

-Cosmina, P. I.; Rodriguez, F.; de Ferra, F.; Grandi, G.; Perego, M.; Venema, G.

and van Sinderen, D. (1993). Sequence and analysis of the genetic locus

responsible for surfactin synthesis in B. subtilis. Mol. Microbiol., 8(5):821-31.

http://onlinelibrary.wiley.com/doi/10.1111/jam.2002.93.issue-6/issuetoc

137

-Cunha, M. V.; Sousa, S. A.; Leitão, J. H.; Moreira, L. M.; Videira, P. A. and Sá-

Correia (2004). Studies on the involvement of the exopolysaccharide produced by

cystic fibrosis-associated isolates of the Burkholderia cepacia complex in biofilm

formation and in persistence of respiratory infections. J. Clin. Microbiol.,

42(7):3052-3058.

(D)

-Dal-Soo, Y.; Baek-Seok, L. and Eun-Ki, K. (2005). Characteristic of microbial

biosurfactant as an antifungal agent against plant pathogenic fungus. Journal of

Microbiology and Biotechnology. 15 (6): 1164-1169.

-Das, P.; Mukherjee, S. and Sen, R. (2008). Antimicrobial potential of a

lipopeptide biosurfactant derived from a marine B. circulans. J. Appl. Microbiol.,

104:1675-1684.

-Das, P.; Mukherjee, A. K. and Sen, R. (2009). Antiadhesive action of a marine

microbial surfactant. Colloids Surf. B: Biointerfaces.71: 183-186.

-Dastgheib, S. S. M.; Amoozegar, M. A.; Elahi, E.; Asad, S. and Banat, I. M.

(2008). Bioemulsifier production by a halothermophilic Bacillus strain with

potential applications in microbially enhanced oil recovery. Biotechnol. Lett.,

30:263–270.

-De Acevedo, G. T. and McInerney, M. J. (1996). Emulsifying activity in

thermophilic and extremely thermophilic microorganisms. J. Ind. Microbiol., 16:

17-22.

-Dean, A. P.; Sigee, D. C.; Estrada, B. and Pittman, J. k. (2010). Using FTIR

spectroscopy for rapid determination of lipid accumulation in response to

nitrogen limitation in freshwater microalgae. Bioresource Technology. (101):

4499–4507.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Cunha%20MV%5BAuthor%5D&cauthor=true&cauthor_uid=15243059

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sousa%20SA%5BAuthor%5D&cauthor=true&cauthor_uid=15243059

http://www.ncbi.nlm.nih.gov/pubmed/?term=Leit%C3%A3o%20JH%5BAuthor%5D&cauthor=true&cauthor_uid=15243059

http://www.ncbi.nlm.nih.gov/pubmed/?term=Moreira%20LM%5BAuthor%5D&cauthor=true&cauthor_uid=15243059

http://www.ncbi.nlm.nih.gov/pubmed/?term=Videira%20PA%5BAuthor%5D&cauthor=true&cauthor_uid=15243059

http://www.ncbi.nlm.nih.gov/pubmed/15243059

138

-Deleu, M.; Paquot, M. and Nylander, T. (2008). Effect of fengycin, a lipopeptide

produced by B. subtilis, on model biomembranes. Biophys. J., 94:2667–2679.

-Desai, J. D. and Banat, I. M. (1997). Microbial production of surfactants and

their commercial potential. Microbiology and Molecular Biology Reviews. 61

(1): 47-64.

-Dhasayan, A.; Selvin, J. and Kiran S. (2014). Biosurfactant production from

marine bacteria associated with sponge Callyspongia diffusa. Biotech., 3.

- Doolittle, W. F. (1999). Phylogenetic classification and universal tree. Science.

(284): 2124-2128.

-Dubois, M.; Gilles, K. A.; Hamilton, J. K.; Robers, P. A. and Smith, F.

(1956). Colorimetric method for determination of sugars and related substances.

Anal. Chem., 28 (3): 350 -356.

(F)

-Fathabad, E. G. (2011). Biosurfactants in pharmaceutical industry: Amini-

review. Am. J. Drug Discov. Dev., 1(1):58-69.

-Femi-Ola, T. O.; Oluwole, O. A.; Olowomofe, T. O. and Yakubu, H. (2015).

Isolation and screening of biosurfactant- producing bacteria from soil

contaminated with domestic waste water. British Journal of Environmental

Sciences. 3(1): 58-63.

-Feng, X. U. E. and Jin, L. (2009). Components and properties of bioemulsfier

from G. thermoleovorans. Journal of Microbiology. (1).

- Fernandes, P. A. V.; Arruda, I. R.; Santos, A. F. B.; Araujo, A. A.; Maior, A.

M. S. and Ximenes, E. A. (2007). Antimicrobial activity of surfactants produced

by B. subtilis R14 against multidrug-resistant bacteria. Braz. J. Microbiol., 38:

704-709.

139

-Fiechter, A. (1992). Biosurfactants: Moving towards industrial applications.

Trends in Biotechnology. 10: 208-217.

-Fracchia, L.; Cavallo, M.; Allegrone, G. and Martinotti, M. G. (2010). A

Lactobacillus-derived biosurfactant inhibits biofilm formation of human

pathogenic C. albicans biofilm producers. In: Current research. Technology and

Education Topics in Applied Microbiology and Microbial Biotechnology.

Méndez-Vilas A, editor. Formatex, Spain., 827–837.

-Fracchia, L.; Cavallo, M.; Martinotti, M. G. and Banat, I.M. (2012).

Biosurfactants and bioemulsifiers biomedical and related applications – present

status and future potentials. Biomedical science , Engineering and Technology.

In: Ghista DN (ed) InTech Open.325-370.

-Folkman, J. (2000). Tumor angiogenesis In: Bast, R. C., Kufe, D. W, Pollock,

R. F., Weichselbom, R. R., Holland, J. F., Ferri, E. and Ganster, T. E.(eds).

Cancer Medicine (5th

ed). B.C. Decher Inc. Canada.

-Fuma, S.; Fujshima, Y.; Corbell, N. D.; Souza, C.; Nakano, M. M.; Zuber, P.

and Yamane, K. (1993). Nucleotide sequence of 50 portion of srf A a that

contains the region required for competence establishment in B. subtilis. Nuccleic

acid Res., 21:93-97.

(G)

-Gautam, K. K. and Tyagi , V. K.(2005)., Microbial surfactants: A review.J.

Oleo. Sci..(55). 155–166.

-Gautam, K. K. and Tyagi, V. K. (2006). Microbial surfactants: A Review. J.

Oleo. Sci., 55(4): 155-166.

-Gerard, J.; Lloyd, R.; Barsby, T.; Massetolides, A. H. (1997).

Antimycobacterial cyclic depsipeptides produced by two Pseudomonads isolated

from marine habitats. J. Nat. Prod., 60: 223–9.

140

- Gervasio, P. D. S.; Matthias, M. and Jonas, C. (2009). Glycerol: A promising

and abundant carbon source for industrial microbiology. Biotech. Adv., 27:30-39.

-Ghayyomi, J. M.; Forghani, F. and Oh, D. (2012). Biosurfactan Production by

Bacillus sp. isolated from petroleum contaminated soils of sirri island. American

Journal of Applied Sciences. 9 (1): 1-6.

-Goesselsberger, C. G.; Hekele, O.; Brandstetter, M.; Aumayr, M.; Sommer, R.

and Gebeshuber, I. C. (2009). Topography and stiffness characteristics of B.

subtilis UV– resistant and UV- sensitive. International conference on

Bioengineering and Biomaterials: IC2B.

-Golubev, W. I.; Kulakovskaya, T. V. and Golubeva, W. (2001).The yeast P.

fusiformata VKM Y-2821 producing an antifungal glycolipid. Microbiol., 70:

553–6.

-Green, M. R. and Sambrook, J. (2012). Molecular cloning: A laboratory manual.

Cold Spriner Harbor Laboratory Press. Cold Spring Harbor. New York. USA.

-Gudinã, E. J.; Rangarajan, V.; Sen, R. and Rodrigue, L. R. (2013). Potential

therapeutic applications of biosurfactants. Trends in Pharmacological Sciences.

3(1):1–9.

-Guerra-Santos, L. H.; Käppeli, O. and Fiechter, A. (1986). Dependence of P.

aeruginosa continous culture biosurfactant production on nutritional and

environmental factors. Appl. Microbiol. Biot., 24(6): 443-448.

-Gurjar, M.; Khire, J. M. and Khan, M. I. (1995). Bioemulsifier production by B.

sterothermophilus VR-8 isolate. Letters in Applied Microbiology. 21: 83-86.

(H)

-Haba, E.; Pinazo, A.; Jauregui, O.; Espuny, M. J.; Infante, M. R. and Manresa,

A. (2003). Physicochemical characterization and antimicrobial properties of

141

rhamnolipids produced by P. aeruginosa 47T2 NCBIM 40044. Biotechnol

Bioeng., (81):316–322.

-Healy, M. G.; Devine, C. M. and Murphy, R. (1996). Microbial production of

biosurfactants. Resources, Conservation and Recycling. 18: 41–57.

-Heinemann, C. I.; van Hylckama Vlieg, J. E.; Janssen, D. B.; Busscher, H. J.;

van der Mei H. C. and Reid, G. (2000). Purification and characterization of a

surface-binding protein from L. fermentum RC-14 that inhibits adhesion of E.

faecalis 1131. FEMS Microbiol. Lett., 190(1):177-180.

- Heyd, M.; Kohnert, A.; Tan, T. H.; Nusser, M.; Kirschhöfer, F.; Brenner-

Weiss, G.; Franzreb, M. and Berensmeier, S. (2008). Development and

trends of biosurfactant analysis and purification using rhamnolipids as an

example, Anal. Bioanal. Chem., 391: 1579-1590.

- Holler, S. and Saunders, N. (1998). Principles of Instrumental Analysis College

Publishing, (5th

) ed: 673-697, 725-766.

-Hommel, R. K. and Ratledge, C. (1993). Biosynthetic mechanisms of low

molecular weight surfactants and their precursor molecules. Biosurfactants:

production, properties, applications. In Kosaric, N. (ed.). New York. 3-63.

-Horiike, T.; Miyata, D.; Hamada, K.; Saruhashi, S.; Shinozawa, T.; Kumar,

S.; Chakraborty, R.; Komiyama, T. and Tateno, Y. (2009). Phylogenetic

construction of 17 bacterial phyla by new method and carefully selected

orthologs. Gene. 429 (1–2): 59–64.

-Huang, Q.; Piao, X. S.; Ren, P. and Li, D. F. (2012). Prediction of digestible and

metabolizable energy content and standardized lleal amino acid digestibility in

wheat shorts and red dog for growing pigs. Asian. Australas. J. Anim. Sci.,

25(12):1748-1758.

(I)

http://www.ncbi.nlm.nih.gov/pubmed/?term=Saruhashi%20S%5BAuthor%5D&cauthor=true&cauthor_uid=19000750

http://www.ncbi.nlm.nih.gov/pubmed/?term=Shinozawa%20T%5BAuthor%5D&cauthor=true&cauthor_uid=19000750

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kumar%20S%5BAuthor%5D&cauthor=true&cauthor_uid=19000750

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kumar%20S%5BAuthor%5D&cauthor=true&cauthor_uid=19000750

http://www.ncbi.nlm.nih.gov/pubmed/?term=Chakraborty%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19000750

http://www.ncbi.nlm.nih.gov/pubmed/?term=Komiyama%20T%5BAuthor%5D&cauthor=true&cauthor_uid=19000750

http://www.ncbi.nlm.nih.gov/pubmed/?term=Tateno%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=19000750

http://linkinghub.elsevier.com/retrieve/pii/S0378-1119(08)00524-6



142

-Ilori, M. O.; Amobi, C. J. and Odocha, A. C. (2005). Factors affecting

biosurfactant production by oil degrading Aeromonas spp. isolated from a tropical

environment. Chemosphere. 61: 985-992.

-Irfan, M.; Shahi, S. K. and Sharma, P. K. (2015). In vitro synergistic effect of

biosurfactant produced by B. subtilis MTCC 441 against drug resistant S. aureus.

Journal of Applied Pharmaceutical Science. 5 (03):113-116.

-Isoda, H.; Shinmoto, H.; Matsumura, M. and Nakahara, T. (1995). Succinoyl

trehalose lipid induced differentiation of human monocytoid leukemic cell line

U937 into monocyte-macrophages. Cytotechnol., 19:79-88.

- ISO IDF 122: (2001). Milk and milk products -- General guidance for the

preparation of test samples, initial suspensions and decimal dilutions for

microbiological examination. 8261.

-Itoh, S.; Honda, H.; Tomita, F. and Suzuki, T. (1971). Rhamnolipids produced

by P. aeruginosa grown on n-paraffin. J. Antibiot., 24:855–859.

(J)

-Jagtap, S.; Yavankar, S.; Pardesi, K. and Chopade, B. (2010). Production of

bioemulsifier by Acinetobacter species isolated from healthy human skin. Indian

Journal of Experimental Biology. 48: 70-76.

-Jain, A.; Nishad, K. K. and Bhosle, N. B. (2007). Effects of DNP on cell

surface properties of marine bacteria and its implication for adhesion to surfaces.

Biofoul., 23(3-4):171-177.

-Janek, T.; Krasowska, A.; Radwańska, A. and Łukaszewicz, M. (2013).

Lipopeptide Biosurfactant Pseudofactin II Induced Apoptosis of Melanoma A

375 Cells by Specific Interaction with the Plasma Membrane.PLOs one 8.e57991.

-Jara, A. M. A. T.; Rosileide, A.F.S.; Galba, M. and Takaki, C. (2013).

Physicochemical characterization of tensio-active produced by G.

143

stearothermophilus isolated from petroleum-contaminated soil. Colloids and

Surfaces B, Biointerfaces.101, 315– 318.

-Jazeh, G. M.; Forghani, F. and Oh, D. (2012): Biosurfactan Production by

Bacillus sp. Isolated from petroleum contaminated soils of Sirri Island. American

Journal of Applied Sciences. 9 (1): 1-6.

-Johnson, V.; Singh, M. and Saini, V. S. (1992). Bioemulsifier production by an

oleaginous yeast Rhodotorulaglutinis IIP-30. Biotechnology Letters., 14: 487-

490.

- Joice, P. A. and Parthasarathi, R. (2014). Optimization of biosurfactant

production from P. aeruginosa PBSC1. Int. J. Curr. Microbiol. App. Sci.,

3(9):140-151.

-Joshi, S.; Bharucha, C. and Desia, A. J. (2008). Production of biosurfactant and

antifungal compound by fermented food isolate B. subtilis 20B. Bioresource

Technology. 99(11):4603-4608.

-Jung, M.; Lee, S. and Kim, H. (2000). Recent studies on natural products as

anti-HIV agents. Curr. Med. Chem., 7:649-661.

(K)

-Kadhim, H. M.; AL-Gelawi, M. H. and Majeed, H. (2008). Optimization of

biosurfactant production from locally isolated B. cereushi-2. Biologia Tunisie

Juillet. (5): 29 – 34.

- Kalyani, A. L. T.; Sireesha, S. G.; Aditya, A. K. G. and Sankar, G. G.(2014).

Isolation and antimicrobial activity of rhamnolipid biosurfactant from oil-

contaminated soil sample using humic-acid salts-vitamin agar. International

Journal of Research in Engineering and Technology. 3(5):357-365.

144

-Kato, T.; Haruki, M.; Imanaka, T.; Morikawa, M. and Kanaya, S. (2001).

Isolation and characterization of long-chain-alkane degrading B. thermoleovorans

from deep subterranean petroleum reservoirs. J. Biosci. Bioeng., 91:64-70.

-Kato, T.; Miyanaga, A.; Kanaya, S. and Morikawa, M. (2009). Alkane inducible

proteins in G. thermoleovorans B23. BMC Microbiology. 9:60.

-Kaufmann, C. and Brown, M. R. (2008):Regulation of carbohydrate

metabolism and flight Performance by a hypertrehalosaemic hormone in the

mosquito Anopheles gambiae . J. Insect Physiol., 54:367-377.

-Kearns, D. B. and Losick, R. (2003). Swarming motility in undomesticated B.

subtilis. Mol. Microbiol., 49(3):581-590.

-Kim, S. Y.; Kim, J. Y.; Kim, S. H.; Bae, H. J.; Yi, H.; Yoon, S. H.; Koo, B. S.;

Kwon, M.; Cho, J. Y.; Lee, C. E. and Hong, S. (2007). Surfactin from B. subtilis

displays anti-proliferative effect via apoptosis induction, cell cycle arrest and

survival signaling suppression. FEBS Lett., 4:865–871.

-Kim, S. J. and Yim, J. H. (2007). Cryoprotective properties of

exopolysaccharide (P-21653) produced by the Antarctic bacterium,

Pseudoalteromonas arctica KOPRI 21653. J. Microbiol., 45 (6):510-514.

-Kiran, G. S.; Hema, T. A.; Gandhimathi, R.; Selvin, J.; Thomas, T. A.; Ravji,

T. R. and Natarajaseenivasan, K. (2009). Optimazation and production of a

biosurfactant from the spong – associated marine fungus A. ustus MSF3. Colloids

and surfaces B: Biointerfaces. 73:250-256.

-Kitamoto, D.; Yanagishita, H.; Shinbo, T.; Nakane, T.; Kamisawa, C. and

Nakahara, T. (1993). Surface active properties and antimicrobial activities of

mannosylerythritol lipids as biosurfactants produced by C. antarctica. J.

Biotechnol., 29:91–96.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kearns%20DB%5BAuthor%5D&cauthor=true&cauthor_uid=12864845

http://www.ncbi.nlm.nih.gov/pubmed/?term=Losick%20R%5BAuthor%5D&cauthor=true&cauthor_uid=12864845


145

-Kitamoto, D.; Ikegami, T. and Suzuki, G. T. (2001). Microbial conversion of n‑

alkanes into glycolipid biosurfactants, mannosylerythritol lipids, by Pseudozyma

(C. antarctica). Biotechnol. Lett., 23:1709‑1714.

-Klekner, V. and Kosaric, N. (1993). Biosurfactants for cosmetics. Surfactant

Sci. Ser., 48:329–372.

-Kokare, C. R.; Kadam, S. S.; Mahadik, K. R. and Chopad, B. A. (2007). Studies

on bioemulsifier production from marine Streptomyces sp. S1. Indian Journal of

Biotechnology. 6: 78-84.

-Kosaric, N.; Choi, H. Y. and Bhaszczyk, R. (1990). Biosurfactant production

from Nocardia SFC-D. Tenside Surf. Det., 27: 294-297.

-Kosaric, N. (2001). Biosurfactants and their application for soil bioremediation.

Food Technology and Biotechnology. 39(4): 295-304.

-Kreft, J. U. and Wimpenny, J. W. (2001). Effect of EPS on biofilm structure

and function as revealed by an individual-based model of biofilm growth. Water

Sci. Technol., 43(6):135-41.

-Kretschner, A.; Block, H. and Wagner, F. (1982). Chemical and physical

characterization of interfacial- active lipids from R. erythropolis grown on n-

alkane. Appl. Environ. Microbiol., 44:864-870.

-Kulakovskaya, T.; Kulakovskaya, E. and Golubev, W. (2003). ATP leakage

from yeast cells treated by extracellular glycolipids of Pseudozymafusiformata.

FEMS Yeast Res., 3: 401–404.

-Kumar, C. G.; Joo, H. S.; Choi, J. W.; Koo, Y. M. and Changa, C. S. (2004).

Purification and characterization of an extracellular polysaccharide from

haloalkalophilic Bacillus sp. I-450.Enzyme and Microbial Technology. (34):

673–681.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kreft%20JU%5BAuthor%5D&cauthor=true&cauthor_uid=11381959

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wimpenny%20JW%5BAuthor%5D&cauthor=true&cauthor_uid=11381959

146

-Kumon, H.; Tomochika, K.; Matunaga, T.; Ogawa, M. and Ohmori, H. (1994).

A sandwich cup method for the penetration assay of antimicrobial agents

through Pseudomonas exopolysaccharides. Microbiol. Immunol., 38: 615–619.

-Kupiec, T. (2004). Quality-Control Analytical Methods:High-Performance

Liquid Chromatography, International Journal of Pharmaceutical Compounding.

8(3):22.

(L)

-Landman, D.; Georgescu, C.; Martin, D. A. and Quale, J. (2008). Polymyxins

revisited. Clin. Microbiol. Rev., 21:449–465. -Lang, S. (2002). Biological amphiphiles (microbial biosurfactants) .Curr. Opin.

Colloid. Interface Sci., 7:12-20.

J. J.; Theruvath, T. P.; Zhong, Z. and Nieminen, A. L. Lemasters,-

Mitochondrial calcium and the permeability transition in cell death. (2009).

.1401–(11): 1395 7871 Bioenergetics. –Biochimica et Biophysica Acta (BBA)

-Li, Z. Y.; Lang, S.; Wagner, F.; Witte, L. and Wray. V. (1984). Formation and

identification of interfacial-active glycolipids from resting microbial cells of

Arthrobacter sp. and potential use in tertiary oil recovery. Appl. Environ.

Microbiol., 48:610–617.

-Liang, T. W.; Wu, C. C.; Cheng, W. T.; Chen, Y. C.; Wang, C. L.; Wang, I. L.

and Wang S. L. (2014). Exopolysaccharides and antimicrobial biosurfactant

produced by P. macerans TKU029. Appl. Biochem.

Biotechnol., 172:933–950.

-Linhardt, R. J.; Bakhit, R. and Daniels, L. (1989). Microbially produced

rhamnolipid as a source of rhamnose. Biotechnology and Bioengineering. 33:

365-368.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2730424

147

-Liu, Z.; Zeng, G.; Zhong, H.; Fu, H.; Liu, X. (2010). Production and

characterization of biosurfactant from B. subtilis CCTCC AB93108. Journal

of Central South University of Technology. 17(3): 516-521.

-Luna-Velasco, M. A.; Esparza-Garc, F.; Can˜ı´zares- Villanueva, R. O. and

Rodrı´guez-Va´zquez, R. (2007). Production and properties of a bioemulsifier

synthesized by phenanthrene-degrading Penicillium sp. Process Biochemistry.

42:310–314.

(M)

-Madigan, M. T. and Martino, J. M. (2006). Brock Biology of

Microorganisms (11th) ed. Pearson. 136.

-Mahdi, M. S. (2013). Genetic study of thermotolerant bacteria in degradation of

nitro aromatic compounds. phD. Thesis. College of Science. AL-Nahrain

University.

-Makkar, R. S. and Rockne, K. J. (2003). Comparison of synthetic surfactants

and biosurfactants in enhancing biodegradation of polycyclic aromatic

hydrocarbons. Environ. Toxicol. Chem., 22(10):2280-2292.

-Maneerat, S. and Dikit, P. (2007). Characterization of cell- associated

bioemulsifier from Myroids sp. SM1, a marine bacterium . J. Sci. Technol., 29

(3): 769 – 779.

-Marchant, R.; Banat, I. M.; Rahman, T. J. and Berzano, M. (2002).The

frequency and characteristics of highly thermophilic bacteria in cool soil

environments. Environ. Microbiol., 4: 595–602.

http://link.springer.com/search?facet-creator=%22Zhi-feng+Liu+%E5%88%98%E6%99%BA%E5%B3%B0%22

http://link.springer.com/search?facet-creator=%22Guang-ming+Zeng+%E6%9B%BE%E5%85%89%E6%98%8E%22

http://link.springer.com/search?facet-creator=%22Hua+Zhong+%E9%92%9F%E5%8D%8E%22

http://link.springer.com/search?facet-creator=%22Xiao-lan+Liu+%E5%88%98%E5%B0%8F%E5%85%B0%22

http://link.springer.com/journal/11771


http://www.ncbi.nlm.nih.gov/pubmed/?term=Makkar%20RS%5BAuthor%5D&cauthor=true&cauthor_uid=14551990

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rockne%20KJ%5BAuthor%5D&cauthor=true&cauthor_uid=14551990


148

-Marchant, R. and Banat, I. M. (2010). The Genus Geobacillus and hydrocarbon

utilization. Handbook of Hydrocarbon and Lipid Microbiology, Timmis K. N.

(ed.). Springer-Verlag Berlin Heidelberg.

-Margesin, R. and Schinner, F. (2001). Potential of halotolerant and halophilic

microorganisms for biotechnology. Extremophiles. 5(2):73 83.

-Matsuyama, T.; Tanikawa, T. and Nakagawa, Y. (2010). Serrawettins and other

surfactants produced by Serratia. In: Biosurfactants: From Genes to Applications,

Soberón-Chávez G., Springer, Germany. 93-120.

-Michel, C.; Beny, C.; Delorme, F.; Poirier, L.; Spolaore, P.; Morin, D. and

d’Hugues, P. (2009). New protocol for the rapid quantification of

exopolysaccharides in continuous culture systems of acidophilic bioleaching

bacteria. Appl. Microbiol. Biotechnol., 82:371–378.

-Mimee, B.; Labbé, C., Pelletier, R. and Bélanger, R. R. (2005). Antifungal

activity of flocculosin, a novel glycolipid isolated from P. flocculosa. Antimicrob.

Agents Chemother., 49:1597–1599.

-Mingeot-Leclercq, M. P.; Brasseur, R. and Schanck, A. (1995). Molecular-

parameters involved in aminoglycoside nephrotoxicity. J. Toxicol. En. Viron.

Health., 44: 263–300.

- Mnif, I. and Ghribi, D. (2015). High molecular weight bioemulsifiers, main

properties and potential environmental and biomedical applications. World

Journal of Microbiology and Biotechnology. 31(5): 691-706.

-Mohanan, S.; Maruthamuthu, S.; Muthukumar, N.; Rajesekar, A. and

Palaniswamy, N. (2007). Biodegradation of palmarose oil (green oil) by S.

marcescens. International Journal of Environmental Science and Technology. 4

(2): 277-281.

http://link.springer.com/search?facet-creator=%22In%C3%A8s+Mnif%22

http://link.springer.com/search?facet-creator=%22Dhouha+Ghribi%22



149

-Monteiro, S. A.; Sassaki, G. L.; de Souza, L. M.; Meira, J. A.; de Araújo, J.

M.; Mitchell, D. A.; Ramos, L. P. and Krieger, N. (2007). Molecular and

structural characterization of the biosurfactant produced by P. aeruginosa

DAUPE 614. Chem. Phys. Lipids. 147: 1-13.

-Mukherjee, S.; Das, P. and Sen, R. (2006). Towards commercial production of

microbial surfactants. Trends in Biotechnology. 24(11): 509-515.

-Mulligan, C. N. (2005). Environmental application for biosurfactants. Environ.

Pollut., 133: 183-198.

-Muthusamy, K.; Gopalakrishnan, S.; Ravi, T. K. and Sivachidambaram, P.

(2008). Biosurfactants: properties, commercial production and application.

Current Science. 94 (6): 736-747.

(N)

-Nadaling, T. N.; Raymond, M.; Gilewiez, S. and Budzinisk, H. (2000).

Development of a protocol to study aerobic bacterial degradation of PAHs.

Polycyclic Aro. Comp., 18: 177-192.

-Nakano, M. M.; Corbell, N.; Besson, J. and Zuber, P. (1992). Isolation and

characterization of sfp: a gene that functions in the production of the lipopeptide

biosurfactant, surfactin, in B. subtilis. Mol. Genet., 232:313-321.

-Nakano, M. M. and Zuber, P. (1993). Mutational analysis of the regulatory

region of the srf A operon in B. subtilis. J. Bacteriol., 175:3188–3191.

-Nakata K and Kurane R. (1999). Production of an extracellular

polysaccharide bioflocculant by Klebsiella pneumonia. Biosci. Biotechnol.

Biochem. 63:2064–2068.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sassaki%20GL%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

http://www.ncbi.nlm.nih.gov/pubmed/?term=de%20Souza%20LM%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

http://www.ncbi.nlm.nih.gov/pubmed/?term=Meira%20JA%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

http://www.ncbi.nlm.nih.gov/pubmed/?term=de%20Ara%C3%BAjo%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

http://www.ncbi.nlm.nih.gov/pubmed/?term=de%20Ara%C3%BAjo%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mitchell%20DA%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ramos%20LP%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

http://www.ncbi.nlm.nih.gov/pubmed/?term=Krieger%20N%5BAuthor%5D&cauthor=true&cauthor_uid=17382918

150

-Naruse, N.; Tenmyo, O.; Kobaru, S.; Kamei, H.; Miyaki, T.; Konishi, M. and

Oki, T. (1990). Pumilacidin, a complex of new antiviral antibiotics: production,

isolation, chemical properties, structure and biological activity. J. Antibiot.,

43:267–280.

-Nazina, T. N.; Tourova, T. P.; Poltaraus, A. B.; Novikova, E. V.; Grigoryan, A.

A.; Ivanova, A. E.; Lysenko, A. M.; Petrunyaka, V. V.; Osipov, G. A.; Belyaev,

S. S. and Ivanov, M. V. (2001). Taxonomic study of aerobic thermophilic bacilli:

descriptions of G. subterraneus gen. nov., sp. nov. and G. uzenensis sp. nov. from

petroleum reservoirs and transfer of B. stearothermophilus, B.

thermocatenulatus, B. thermoleovorans, B. kaustophilus, B. thermodenitrificans

to Geobacillus as the new combinations G. stearothermophilus, G.

thermocatenulatus, G. thermoleovorans, G. kaustophilus, G. thermodenitrificans.

Int. J. Syst. Evol. Microbiol., 51:433-446.

-Nazina, T. N.; Lebedeva, E. V.; Poltaraus, A. B.; Tourova, T. P.; Grigoryan, A.

A.; Sokolova, D. S.; Lysenko, A. M. and Osipov, G. A. (2004). G. gargensis sp.

nov., a novel thermophile from a hot spring, and the reclassification of B. vulcani

as G. vulcani comb. nov. Int. J. Syst. Evol. Microbiol., 54:2019–2024.

-Nielsen, T.; Christophersen, C.; Anthoni, U. and Sørensen, J. (1999).

Viscosinamide, anewcyclic depsipeptide with surfactant and antifungal properties

produced by Pseudomonas fluorescens DR54. J. Appl. Microbiol., 86: 80–90.

-Nitschke, M.; Costa, S. G. and Contiero, J. (2010). Structure and

applications of a rhamnolipid surfactant produced in soybean oil waste. Appl.

Biochem. Biotechnol., 160: 2066–2074.

-Noah, K. S.; Fox S. L. and Bruhn, D. F. (2002). Development of continuous

surfactin production from potato process effluent by B. subtilis in an airlift

reactor. Applied Biochemistry Biotechnology. (100): 803–813.

http://www.ncbi.nlm.nih.gov/pubmed/?term=S%C3%B8rensen%20J%5BAuthor%5D&cauthor=true&cauthor_uid=10432590

151

-Noudeh, G. D.; Moshafi, M. H.; Khazaeli, P. and Akef, F. (2007). Studies on

bioemulsifier production by B. licheniformis PTCC 1595. American Journal of

Pharmacology and Toxicology. 2 (4): 164-169.

(O)

-Obayori, O. S.; Ilori, M. O.; Adebusoye, S. A.; Oyetibo, G. O.; Omotayo, A. E.

and Amund, O. O. (2009). Degradation of hydrocarbons and biosurfactant

production by Pseudomonas sp. strain LP1. World Journal of Microbiology and

Biotechnology. 25: 1615-1623.

-Ochsner, U. A.; Koch, A. K.; Fiechter, A. and Reiser, J. (1994). Isolation and

characterization of a regulatory gene affecting rhamnolipid biosurfactant

synthesis in P. aeruginosa. J. Bacteriol., 176:2044–2054.

-Ochsner, U. A.; Reiser, J.; Fiechter, A. and Witholt, B., (1995). Production of

P. aeruginosa rhamnolipid biosurfactants in heterogeneous host. Appl. Environ.

Microbiol., 61:3503–3506.

- Ohlendorf, B.; Lorenzen, W.; Kehraus, S.; Krick, A.; Bode, H. B. and König,

G. M. (2008). Myxotyrosides A and B, unusual rhamnosides

from Myxococcus sp. J. Nat. Products.72:82–86.

- Okoliegbe, I. N. and Agarry, O. O. (2012): Application of microbial surfactant

(areview). Scholarly Journals of Biotechnology. 1(1):15-23.

-Olivera, N. L.; Nievas, M. L.; Lozada, M.; Del prado, G. Dionisi, H. M and

Sineriz, F. (2009). Isolation and characterization of biosurfactant producing

Alcanivorax strain: hydrocarbon accession strategies and alkane hydroxylase gene

analysis . Res. Microbiol., 160:19-26.

- Oliveira, J. S.; Araújo, W.; Lopes Sales,

A. I.; Guerra, A. B.; Araújo, S. C.;

Vasconcelos, A. T. R.; Agnez-Lima, L. F. and Freitas, A. T. (2015). knowledge

http://www.ncbi.nlm.nih.gov/pubmed/?term=Oliveira%20JS%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ara%26%23x000fa%3Bjo%20W%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Lopes%20Sales%20AI%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=de%20Brito%20Guerra%20A%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=da%20Silva%20Ara%26%23x000fa%3Bjo%20SC%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=de%20Vasconcelos%20AT%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Agnez-Lima%20LF%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Freitas%20AT%5Bauth%5D

152

and algorithms to support biosurfactants and biodegradation studies. Database,

ID bav033

-Ongena, M. and Jacques, P. (2008). B. lipopeptides: versatile weapons for plant

disease biocontrol. Trends Micribiol., 16(3):115-125.

(P)

-Patel, R. N. and Desai, A. J. (1997). Surface active properties of raminolipids

from P. aeroginosa GS3. J. Basic Microbiol., 32 : 518 – 520 .

-Pavia, D. L.; Lampman, G. M.; Kritz, G. S. and Engel, R. G. (2006).

Introduction to organic laboratory techniques: A Microscale Approach., Cengage

Learning, (4th

)ed. Brooks/Cole Publishing Paul. 797–817.

-Persson, A.; Oesterberg, E. and Dostalek, M. (1988). Biosurfactant production

by Pseudomonas fluorescens378: Growth and product characteristics. Appl.

Microbiol. Biotechnol., 29(1):1–4.

-Phetrong, K.; Hkittikun, A. and Mannerat, S. (2008). Production and

characterization of bioemulsifier from a marine bacterium, A. calcoaceticus sub

sp. antitratus SM7. J. Sci. Technol., 30 (3): 297-305.

-Piggot, P. J. and Hilbert, D. W. (2004). Sporulation of B. subtilis. J. Cur. Opin.

In Microbiol., 7:579-586.

-Pines, O. and Gutnick, D. L. (1986). Role of emulsan in growth of A.

calcoaceticus RAG-1 on crude oil, Appl. Environ. Microbiol., 51: 661-663.

-Prescott, H. (2002). Laboratory exercises in Microbiology. (5 th

) ed.,170.

153

-Priya, T. and Usharani, G. (2009). Comparative Study for Biosurfactant

Production by Using B. subtilis and P. aeruginosa. Botany Research

International. 2 (4): 284-287.

(R)

-Rahman, K. S. M. and Gakpe, E. (2008). Production, characterization and

applications of biosurfactants- Review. Biotechnology. 7: 360-370.

-Rahman, M. S. and Ano, T. (2009). Production characteristics of lipopeptide

antibiotics in biofilm fermentation of B.subtilis. J. Environ. Sci., 21: 36-39.

-Rashid, N.; Morikawa, M. and Imanaka, T. (1995). An abnormally acidic

TATA-binding protein from a hyperthermophilic archaeon. Gene. 166:139-143.

-Robinson, K.; Gosh, M. and Shi, Z. (1996). Mineralization enhancement of

non-aqueous phase and soil-bound PCB using biosurfactant. Water Sci. Technol.,

34:303–309.

-Rodrigues, L.; Mei, H. C. V.; Teixeira, J. and Oliveira, R. (2004). Influence of

biosurfactants from probiotic bacteria on formation of biofilms on voice

prostheses. Applied Environ. Microbiol., 70: 4408-4410.

-Rodrigues, L.R.; Banat, I.M.; van der Mei, H.C.; Teixeira, J.A. and Oliveira, R.

(2006a). Interference in adhesion of bacteria and yeasts isolated from explanted

voice prostheses to silicone rubber by rhamnolipid biosurfactants. Journal of

Applied Microbiology.100:470–480.

-Rodrigues, L.; Banat, M.; Jose´ Teixeira and Oliveira R. (2006b).

Biosurfactants: potential applications in medicine. Journal of Antimicrobial

Chemotherapy. 57:609–618.

154

-Rodrigues, L. R. (2011). Inhibition of bacterial adhesion on medical devices. In:

Linke D, Goldman A (eds) Bacterial adhesion: biology, chemistry, and physics,

series: Adv. Exp. Med. Biol. Springer, Germany: 351–367.

-Ron, E. and Rosenberg, E. (2001). Natural roles of biosurfactant. Environ.

Microbiol., 3(4): 229- 236.

- Roongsawang, N.; Thaniyavarn, J.; Thaniyavarn, S.; Kameyama, T.; Haruki,

M.; Imanaka, T.; Morikawa, M. and Kanaya, S. (2002). Isolation and

characterization of a halotolerant B. subtilis BBK-1 which produces three kinds of

lipopeptides: bacillomycin L plipastin and surfactin. Extremophiles. 6(6): 499–

504.

-Rosenberg, E.; Zuckerberg, A.; Rubinovitz, C. and Gutnick, D. L. (1979).

Emulsifier Arthrobacter RAG-1: isolation and emulsifying properties. Appl.

Environ. Microbiol., 37:402–408.

-Rosenberg, E.; Rubinovitz, C.; Gottlieb, A.; Rosenhak, S. and Ron, E. Z.

(1988). Production of Biodispersan by A. calcoaceticus A2. Applied and

Environmental Microbiology. 54(2):317-322.

-Rosenberg, E. I. and Ron, E. Z. (1999). High- and low-molecular-mass

microbial surfactants. Appl. Microbiol. Biotechnol., 52(2):154-62.

-Rusansky, S.; Avigad, R.; Michaeli, S. and Gutnick, D. L. (1987). Involvement

of a plasmid in growth on and dispersion of crude oil by A. calcoaceticus

RA57. Appl. Environ. Microbiol., 53: 1918-1923.

(S)

155

-Saharan, B. S.; Sahu, R. K. and Sharma, D. (2011). A Review on biosurfactants:

fermentation, Current Developments and Perspectives. J. of Genetic Engineering

and Biotechnol., 29.

-Saini, H. S.; Barragán-Huerta, B. E.; Lebrón-Paler, A.; Pemberton, J. E.;

Vázquez, R. R.; Burns, A. M.; Marron, M. T.; Seliga, C. J.; Gunatilaka, A. A.

and Maier, R. M. (2008). Efficient purification of the biosurfactant viscosin from

P. libanensis strain M9-3 and its physicochemical and biological properties. J.

Nat. Prod., 71:1011–1015.

-Salihu, A.; Abdulkadir, I. and Almustapha, M. N. (2009). An investigation for

potential development on biosurfactants. Biotechnol. Mol. Biol. Rev., 4: 111-117.

-Salager, J.L. (2002). Surfactants- types and uses. FRIP booklet E# 300A,

Mérida-Venezuela.

-Sarachat, T.; Pornsunthorntawee, O.; Chadavej, S. and Rujiravanit, R. (2010).

Purification and concentration of rhamnolipid biosurfactant produced by p.

aeruginosa SP4 using foam fractionation. Bioresource Technology. (101): 324-

330.

-Sarubbo, L. A.; Marçal, M. C.; Neves, M. L. C.; Silva, M. P. C.; Porto, A. L.

F. and Campos- Takaki, G. M. (2001). Bioemulsifier production in batch culture

using glucose as carbon source by C. lipolytica. Appl. Biochem. Biotechnol.,

95:59–67.

-Sarubbo, L. A.; Moura de Luna, J. and Takaki, G. M. (2006). Production and

stability studies of the bioemulsifier obtained from strain of C. galbrata

UCP1002. Electronic Journal of Biotechnology. 9 (4): 400-406.

-Sarubbo, L.; Farias, C. and Campos-Takaki, G. (2007). Co-utilization of canola

oil and glucose on the production of a surfactant by C. lipolytica. Curr.

Microbiol., 54: 68–73.

156

-Satpute, S. K.; Banpurkar, A. G.; Dhakephalkar, P. K.; Banat, I. M. and

Chopade, B. A. (2010). Methods for investigating biosurfactants and

bioemulsifiers: a review. Critical Reviews in Biotechnology. Informa

healthcare. (32):1-18.

- Schramm, L. L.; Stasiuk, E.N. and Marangoni, D. G.(2003). Surfactants and

their applications. Annu. Rep. Prog. Chem., Sect.( 99): 3–48

-Schaffer, C.; Franck, W. L.; Scheberl, A.; Kosma, P.; Mc Dermott, T. R. and

Messner, P. (2004). Classification of isolates from locations in Austria and

Yellowstone National Park as G. tepidamans sp. nov. Int. J. Syst. Evol.

Microbiol., 54:2361–2368.

-Scholz, T.; Demharter, W.; Hensel, R. and Kandler, O. (1987). B. pallidus sp.

nov., a new thermophilic species from sewage. Syst. Appl. Microbiol., 9:91–96.

-Sekhon, R. S.; Lin, H.; Childs, K. L.; Hansey, C. N.; Buell, C. R.; de Leon, N.

and Kaeppler, S. M. (2011). Genome-wide atlas of transcription during maize

development. Plant J., 66(4):553-63.

-Sen, R. and Swaminathan, T. (2005). Characterization of concentration and

purification parameters and operating conditions for the small scale recovery of

surfactin. Process Biochem., 40:2953-2958.

-Seydlová, G. and Svobodová, J. (2008). Review of surfactin chemical properties

and the potential biomedical applications. Cent. Eur. J. Med., 3:123–133.

-Shabtai, Y. and Gutnick, D. L. (1985). Tolerance of A.calcoaceticus RAG-1 to

the cationic surfactant cetyltrimethylammonium bromide: role of the

bioemulsifier emulsan. Appl. Environ. Microbiol., 49:192–197.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sekhon%20RS%5BAuthor%5D&cauthor=true&cauthor_uid=21299659

http://www.ncbi.nlm.nih.gov/pubmed/?term=Lin%20H%5BAuthor%5D&cauthor=true&cauthor_uid=21299659

http://www.ncbi.nlm.nih.gov/pubmed/?term=Childs%20KL%5BAuthor%5D&cauthor=true&cauthor_uid=21299659

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hansey%20CN%5BAuthor%5D&cauthor=true&cauthor_uid=21299659

http://www.ncbi.nlm.nih.gov/pubmed/?term=Buell%20CR%5BAuthor%5D&cauthor=true&cauthor_uid=21299659

http://www.ncbi.nlm.nih.gov/pubmed/?term=de%20Leon%20N%5BAuthor%5D&cauthor=true&cauthor_uid=21299659

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kaeppler%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=21299659


157

-Shafiei, Z.; Abdul Hamid, A.; Fooladi, T. and Yusoff, M. W. M. (2014).

Surface Active Components: Review. Current Research Journal of Biological

Sciences. 6(2): 89-95.

-Shaligram, N. S. and Singhal R. S. (2010). Surfactin – A Review, Food

Technol. Biotechnol., 48 (2): 119–134.

- Sheppard, J. D. & Cooper, D. G. (1990). The effect of a biosurfactant on

oxygen transfer in a cyclone column reactor. Journal of Chemical Technology

and Biotechnology.48: 325-336.

-Shimakata, T. and Minatogawa, Y. (2000). Essential role of Trehalose in the

synthesis and subsequent metabolism of Corynomycolic acid in C. matruchotii

.Archives of Biochemist. Biophysics. 7036-7043.

-Shoeb, E.; Akhlaq, F.; Badar, U.; Akhter, J. and Imtiaz, S. (2013). Classification

and industrial applications of biosurfactants. natural and applied sciences. 4(3).

243-252.

-Sifour, M.; Al-Jilawi, M. H. and Aziz, G. M. (2007). Emulsification properties

of biosurfactant produced from P. aeruginosa RB 28. Pakistan Journal of

Biological Sciences. 10 (8): 1331 – 1335.

-Silva, R. F. S.; Almeida, D. G; Rufino, R. D.; Luna, J. M.; Santos, V. A. and

Sarubbo, L. A. (2014). Applications of biosurfactants in the petroleum industry

and the remediation of oil spills. Int. J. Mol. Sci., 15(7): 12523–12542.

-Singh, M.; Saini, V. S.; Adhikari, D. K.; Desai, J. D. and Sista, V. R. (1990).

Production of bioemulsifier by producing strain of C. tropicalis during

hydrocarbon fermentation. Biotechnol. Lett., 12: 743-746.

158

-Singh, R. P.; Shukla, M. K.; Mishra, A.; Kumari, P.; Reddy, C. R. K. and Jha,

B. (2011). Isolation and characterization of exopolysaccharides from seaweed

associated bacteria B. licheniformis. Carbohydrate Polymers. 84(3):1019–1026.

-Smyth, T. J. P.; Perfumo, A.; Marchant. R. and Banat, I. M. (2010). Isolation

and analysis of low molecular weight microbia glycolipids, Handbook of

Hydrocarbon and Lipid Microbiology, Timmis K. N. (ed.), Springer-Verlag

Berlin Heidelberg. (28):3706-3721.

-Solaiman, D. K. Y.; Ashby, R. D.; Nuñez, A. and Foglia, T. A. (2004).

Production of sophorolipids by C. bombicola grown on soy molasses as substrate.

Biotechnol. Lett., 26:1241-1245.

-Sudo, T.; Zhao, X.; Wakamatsu, Y.; Shibahara, M.; Nomura, N.; Nakahara, T.;

Suzuki, A.; Kobayashi, Y.; Jin, C.; Murata, T. and Yokoyama, K. K.(2000).

Induction of the differentiation of human HL-60 promyelocytic leukemia cell line

by succinoyl trehalose lipids. Cytotechnology. 33: 259–264.

-Sung, M. H.; Kim, H.; Bae, J. W.; Rhee, S. K.; Jeon, C. O.; Kim, K.; Kim, J. J.;

Hong, S. P.; Lee, S. G.; Yoon, J. H.; Park, Y. H. and Baek, D. H. (2002). G.

toebii sp. a novel thermophilic bacterium isolated from hay compost. Int. J. Syst.

Evol. Microbiol., 52:2251–2255.

T))

-Tabatabaee, A.; Assadi, M. M.; Noohi, A. A. and Sajadian, V. A. (2005).

Isolation of biosurfactant producing bacteria from oil reservoirs. Iranian J. Env.

Health Sci. Eng., 2 (1): 6-12.

159

-Tahzibi, A.; Kamal, F. and Assadi, M. M. (2004). Improved production of

Rhamnolipids by a P. aeruginosa mutant. Iranian Biomedical Journal. 8 (1): 25 –

31.

-Takai, T.; Nakamura, T.; Toki, T.; Tsunogai, U.; Miyazaki, M.; Miyazaki, J.;

Hirayama, H.; Nakagawa, S.; Nunoura, T. and Horikoshi, K. (2008). Cell

proliferation at 122°C and isotopically heavy CH4 production by a

hyperthermophilic methanogen under high-pressure cultivation. PNAS., 105 (31):

10949 –10954.

- Taylor, D. L. (2007). High Contant Screening. A powerful approach to systems

cell biology and drug discovery. Method Mol. Biol., 356- 360.

- Thanomsub, B.; Watcharachaipong, T.; Chotelersak, K.; Arunrattiyakorn, P.;

Nitoda, T. and Kanzaki, H. (2004). Monoacylglycerols: glycolipid

biosurfactants produced by a thermotolerant yeast, C. ishiwadae. J. Appl.

Microbiol., 96: 588-592.

-Thanomsub, B.; Pumeechockchai, W.; Limtrakul, A.; Arunrattiyakorn, P.;

Petchleelaha, W.; Nitoda, T. and Kanzaki, H. (2006).Chemical structures and

biological activities of rhamnolipids produced by P. aeruginosa B189 isolated

from milk factory wast: Bioresource Technology. 97: 2457–2461.

-Tuleva, B. K.; Ivanov, G. R. and Christova, N. E. (2002). Biosurfactant

production by a new P. putida strain. Naturforsch. J. Biosci., 57: 356–360.

(V)

-Van Haesendonck, I. P. H. and Vanzeveren, E. C. A. (2004). Rhamnolipids in

bakery products. International application patent (PCT). W. O. 2004/040984.

-Van Hamme, J. D.; Singh, A. and Ward, O. P. (2003). Recent Advances in

Petroleum Microbiology. Microbiol. Mol. Biol. Rev., 67(4):503 549.

160

-Van-Hamme, J. D.; Singh, A. and Ward, O. P. (2006). Surfactants in

microbiology and biotechnology. Biotech. Advances. 24: 604-620.

-Veenanadig, N. K.; Gowthaman, M. K. and Karanth, N. G. K. (2000). Scale up

studies for the production of biosurfactants in packed column bioreactor.

Bioproc. Biosyst. Eng., 22(2):95-99.

- Vivek, C.; Abrenam, D. L.; Towne, J. F.; waring, U. W. and David, J. B.

(2008). Application of High- Content Multi parameter Cytotoxicity Assay to

prioritize Compounds based on toxicity potential in humans. Journal of

Biomoleculer screening. 13: 527- 537.

(W)

- Wakamatsu, Y.; Zhao, X.; Jin, C.; Day, N.; Sjibahara, M.; Nomura, N.;

Nakahara, T.; Murata, T. and Yokohama, K. K. (2001). Mannosylerythritol lipid

induces characteristics of neuronal differentiation in PC12 cells through an ERK-

related signal cascade. Eur. J. Biochem., 268: 374–83.

-Wang, C. L.; Ng, T. B.; Yuan, F.; Liu, Z. K. and Liu, F. (2007). Induction of

apoptosis in human leukemia K562 cells by cyclic lipopeptide from B. subtilis

natto T-2. Peptides. 28(7):1344-1350.

-Wright, J. R. (2003). Pulmonary surfactant: a front line of lung host defense. J.

Clin. Invest., 111: 1453–55.

(Y)

- Yalçın, E. and Çavuşoğlu, K. (2010). Structural analysis and antioxidant

activity of a biosurfactant obtained from B.subtilis RW-I. Turkish Journal of

Biochemistry. 35(3): 243–247.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wang%20CL%5BAuthor%5D&cauthor=true&cauthor_uid=17643554

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ng%20TB%5BAuthor%5D&cauthor=true&cauthor_uid=17643554

http://www.ncbi.nlm.nih.gov/pubmed/?term=Yuan%20F%5BAuthor%5D&cauthor=true&cauthor_uid=17643554

http://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20ZK%5BAuthor%5D&cauthor=true&cauthor_uid=17643554

http://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20F%5BAuthor%5D&cauthor=true&cauthor_uid=17643554


161

-Yalçin, E. and Ergene, A. (2009). Screening the antimicrobial activity of

biosurfactants produced by microorganisms isolated from refinery waste waters.

Journal of Applied Biological Sciences. 3 (2): 148 – 153.

-Yakimov, M. M.; Timmis, K. N.; Wray, V. and Fredrickson, H. L. (1995).

Characterization of a new lipopeptide surfactant produced by thermotolerant and

halotolerant subsurface B. licheniformis BAS 50. Appl. Environ. Microbiol.,

61:1706–1713.

-Yakimov, M. M.; Amro, M. M.; Bock K. Boseker, H. L.; Kessel, D. G. and

Timmis, K. N. (1997). The potential of B. licheniformis strains for in situ

enhanced oil recovery. Journal of Petroleum Science and Engineering. 18(12):147

160.

-Yin, H.; Qiang, J.; Jia, Y.; Ye, J.; Peng, H.; Qin, H.; Zhang, N. and He, B.

(2009). Characteristics of biosurfactant produced by P. aeruginosa S6 isolated

from oil- containing wastewater. Process Biochem., 44:302-308.

-Youssef, N. H.; Dunacn, K. E.; Nagle, D. P.; Savage, K. N.; Knapp, R. M. and

McInerney, M. J. (2004). Comparison of methods to detect biosurfactant

production by diverse microorganism. J. Microbiol. Meth., 56: 339-347.

(Z)

-Zinjarde, S. S. and Pant, A. (2002). Emulsifier from tropical marine yeast, Y.

lipolytica NCIM 3589. J. Basic Microb., 42: 67-73.

-Zhao, X.; Wakamatsu, Y.; Shibahara, M.; Nomura, N.; Geltinger, C.; Nakahara,

T.; Murata, T. and Yokoyama, K. K. (1999). Mannosylerythritol lipid is a potent

inducer of apoptosis and differentiation of mouse melanoma cells in culture.

Cancer Res., 59(2):482-6.

162

-Zhao, Z.; Wang, Q.; Wang, K.; Brain, K.; Liu, C. and Cou, Y. (2010). Study of

the antifungal activity of B. vallismortis in vitro and identification of its

antifungal component. Biores. Technol., 101:292-297.

-Zhao, J.; Wu, Y.; Alfred, A. T.; Xin, X. and Yang, S. (2013). Chemical

structures and biological activities of rhamnolipid biosurfactants produced by P.

aeruginosa M14808. Journal of Chemical and Pharmaceutical Research.

5(12):177-182.

-Zheng, C.; He, J.; Wang, Y.; Wang, M. and Huang, Z. (2011). Hydrocarbon

degradation and bioemulsifier production by thermophilic G. pallidus strains.

Bioresource technology. 102:9155- 9161.

Reference from Internet:

-Duarte, C.; Gudiña, E. J.; Lima, C. F. and Rodrigues, L. R. (2014). Effects of

biosurfactant on the viability and proliferation of human breast cancer cells.

AMB. Express. http://www.amb-express.com/content.

-Gudiña, E. J.; Fernandes, E. C.; Rodrigues, A. I.; Teixeira, J. A.

and Rodrigues, L. R. (2015a).Biosurfactant production by Bacillus subtilis using

corn steep liquor as culture medium. Front Microbiol.,

http://dx.doi.org/10.3389/fmicb .

- Gudiña, E.J.; Pereira, J. F.; Costa, R.; Evtuguin, D. V.; Coutinho, J. A.;

Teixeira, J. A. and Rodrigues, L. R. (2015b). Novel bioemulsifier produced by

a Paenibacillus strain isolated from crude oil. Microb. Cell Fact.

http://www.microbialcellfactories.com/content.

-Sharma, D.; Saharan, B.S.; Chauhan, N.; Procha, S. and Lal, S.(2015). Isolation

and functional characterization of novel biosurfactant produced by Enterococcus

faecium. Springr plus.http://www. Springerplus.com/content.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Duarte%20C%5Bauth%5D


http://www.ncbi.nlm.nih.gov/pubmed/?term=Lima%20CF%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rodrigues%20LR%5Bauth%5D

http://www.amb-express.com/content.


http://www.ncbi.nlm.nih.gov/pubmed/?term=Fernandes%20EC%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rodrigues%20AI%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Teixeira%20JA%5Bauth%5D


http://dx.doi.org/10.3389/fmicb


http://www.ncbi.nlm.nih.gov/pubmed/?term=Pereira%20JF%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Costa%20R%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Evtuguin%20DV%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Coutinho%20JA%5Bauth%5D




http://www.microbialcellfactories.com/content.4

APPENDICES

Appendix (1) HPLC analysis of the standard amino acid components, with flow

rate 1 ml/min.

Appendix (2) HPLC analysis of the standard carbohydrate components, equipped

with binary delivery pump model LC -10A.

Intensity

Retention time

Intensity

Retention time

Appendix (3) HPLC analysis of standard fatty acid components, equipped with

binary delivery pump model LC -10A shimadzu, the eluted peak was monitored by

SPD 10A VP detector.

Retention time

Appendix (4) Gas chromatography analysis of standard fatty acid methyl ester.

Intensity

Appendix (5):Inhibition percent associated with MCF7 cells line in different

concentrations and time periods.

Appendix (6): Inhibition percent associated with Jurkat cells line in different


3333333N =

MCF7

Concentrations (mg/ml)

102030405060100

Inh

iibtio

n p

erc

en

t %

80

70

60

50

40

30

20

10

0

-10

777N =

MCF7

Periods

72 h.48 h.24 h.

Inh

iibtio

n p

erc

en

t %

80

70

60

50

40

30

20

10

0

-10

3333333N =

Jurkat 2

Concentrations Concentrations (mg/ml)

102030405060100

Inh

iibtio

n p

erc

en

t %

70

60

50

40

30

20

10

0

-10

777N =

Jurkat 2

Periods

72 h.48 h.24 h.

Inh

iibtio

n p

erc

en

t %

70

60

50

40

30

20

10

0

-10

22

Appendix (7): Inhibition percent associated with Hut78 cells line in different


Appendix(8): Effect of different concentrations of purified biosurfactant on cell

count of MCF7 cell line.

Dox:positive control.

3333333N =

Hut3

Concentrations Concentrations (mg/ml)

102030405060100

Inh

iibtio

n p

erc

en

t %

40

30

20

10

0

-10

777N =

Hut3

Periods

72 h.48 h.24 h.

Inh

iibtio

n p

erc

en

t %

40

30

20

10

0

-10

Appendix(9): Effect of different concentrations of purified biosurfactant on cell

permeability of MCF7 cell line.


Appendix(10): Effect of different concentrations of purified biosurfactant on

cytochrome c of MCF7 cell line.


0

20

40

60

80

100

120

140

control 100 50 50:Dox

Cyt

och

rom

e c

Treatment (µg/ml)

Appendix(11):Effect of different concentrations of purified biosurfactant

on mitochondrial membrane potential change of MCF7 cell line.


Appedix(21): Effect of different concentrations of purified biosurfactant

on nucleus intensity of MCF7 cell

line.


0

10

20

30

40

control 100 50 50:Dox

Mit

och

on

dri

a m

em

bra

nce

po

ten

tial

ch

ange

Treatment (µg/ml)

0

100

200

300

400

500

600

control 100 50 Dox 50

Nu

cle

us

Treatment (µg/ml)

Appendix(13):Antibiotic sensitivity of the test bacterial isolates:

Zone of inhibition Antibiotic Bacteria

11

12

12

12

Oxacillin-

Cefoxitin(30µg)

Ciprofloxacin (5µg)

Clindamycin(2µg)

Staphylococcus aureus

12

11

Tetracycline(30µg)

Erythromycin(15mg)

Streptococcus SPP.

12

12

Ceftazidime(30mg)

Aztreonam(15µg)

Enterobactericeae

12

12

Meropenem(10µg)

Ceftazidime (30µg)

Pseudomonas

aeruginosa

الخلاصه

الاسزفبدح ػه انقذسح نذب انذساسخ ز ف اسزخذيذ انز انؼششح انجكزشخ انؼضلاد

دػخ ك شداػزج انشكجبد الاسيبر رى ػضنب ف دساس سبثق انخبو انفػ ي

.سيبرانحهه نهذسكشثبد الا انزطشف خذذح ي انجكزشب انحج نهحشاسح

سزحلاةلاا يؤشش ػه ااػزبد بدانسزحهج زبج قبثهزب لاػنهكشف ز انؼضلاد غشثهذ

(E24)٪, اسزحلاةفؼبن و( / ر يه) شذ انسطحان قبط (EA ثبسزخذاو )انخبو انفػ

انسزحهت قبدسح ػه ازبج كبذ انؼضلاد أ خغ أظشد انزبئح .انطبق انكشث كصذس

.الأكثش كفبءح Ir1 thermoleovorans Geobacillus (JQ912239)كب انح

فؼم انسلانث انسزحهت انحزبج لإ انظشف انثه رى رحذذ

G.thermoleovorans Ir1 ف ز انجكزشب : ثزخ أ ز انظشف انزبئح ظحذا قذ

كهسذ حذ نهكشث كصذس (٪1) وانخب انفػػه انحب( pH7) الأيلاذ انؼذخ سػ

200 انزحشك ) يغ، يئخ 00 انحع ثذسخخ حشاسح،زشخنه كصذس (٪0.3) الأيو

.أبو10نذح (دسح ف انذققخ

الاسزخلاص انزبئح أ أظشد. غشق خثلاث ثبسزخذاو انسزحهت انح أسزخهض

ػد ثبسزخذاو انسزحهت انح رى رقخ . فؼبن نهسزحهت انح أفعم أػط بلأسزث

.اسزحلاث شبغأػطذ قى خثلاث، رى انحصل ػه انسهكب لاو

ي ٪ 20,2 ,د٪ 33,3 ي أ زك سزحهت انحانزشكت انكبئ نه كشف

.ي انجشربد ٪10,3 انكشثذساد

FTIR ،HPLC ،GC NMRل خضئب انق أانسزحهت انح انق / أخعغ

.انخاص انكبئخ لاسزكبل

انكشثذساد ,انذ حز ػه انسزحهت انح أ FTIR زدخ كشفذ

نهسزحهت انح الأحبض انذخ أ يكبد HPLCال أشبسد زبئح . ف حبدانجشر

هصاضان فكبذ انكشثذساد أيب ،الانك طح سزشكا حط جبنزكان حط كبذ

اندهربيك حط, الأسجبسرك حط الأيخ الأحبض ، ف ح أانبنزص انبص

.انكهربي

سجخ ػبنخ ي زك انسزحهت انح ي( انذ) اندضء انشئسا GC أظش رحهم

الأنك حط( C18:0) اسزشك حط (،C16:0) اسزش يثم انجبنزك حبيط ي

(C18:1n9C ،)انذخ الاخش الأحبض ي أقم سجخ.

انشكت: يشكج زك ي خضئب انق أ انسزحهت انح HNMR غف أظش

انسزحهت انح زبئح أيب . د طحسثب ؼض ن انثب انذ انثلاثخ انشئس

رحز خؼب فقذ رج ا ،انسهكب لاود رى انحصل ػهب ي ػ انزانثلاس انقى ،انق

انؼشاق ف انز زى رفزب رؼذ الأن ي ػب ز انذساسخ قذ رك فقػ. ػه انذ انثلاثخ

انز رهق انعء ػه قذسح انجكزشب الانف نهحشاسح لازبج انسزحهت انح.

خطغ خلاب ثلاثخ يؼبيهخى ر ،انق سزحهت انحنه انفؼبنخ انعبدح نلأساو رحذذ خملأ

انزبئح أظشد .انسزحهت انح يخزهفخ ي زشاكضث( MCF7, Hut78 Jurkat) سشغبخ

يذح انسزحهت انحرشكض ،انخلاب انسشغبخ خػ ؼزذ ػه ع كب انزأثش أ

اد ار الأكثش حسبسخ() MCF7 انخلاب انسشغبخ خػ ػه اػه رأثش كب انزؼشض.

فزشح انحعبخ(.) سبػ32 خلال٪ 00.66 رثجػان يم / يكشغشاو 100 انزشكض

60أ بئحانز أظشد. انسخ انخهخ ذساسخن MCF7 انخلاب انسشغبخ خػ أخعغ

يغ، خلابانػذد اخفبض كجش ف ذسجج انق انسزحهت انح يم ي / يبكشكشاو100

خزضالا اناحكثبفخ ، انزكذسب ي C انسزكشوخشج ، فبرخ انخهخ ف صبدح كجشح

. انزكذسب غشبء كفبءحكجش ف

، الأحبء اندشخ ثؼط ردب انق نهسزحهت انح أخزجشد انفؼبنخ انعذ يكشثخ

انجكزشب قذ ثجػ انسزحهت انح رج أ

(Staphylococcus aureus, Streptococcus sp., Pseudomonas aeruginosa)

(.Candida albicans)انفطشبد

انسزحهت أ خذ. هسزحهت انحانكبئخ ن انخصبئض انفضبئخ ثؼط ذدسس

فثبثذ ؼبنخان حشاسحان بدذسخن يزحم انحظخ، قى ي فؼبلا ف يذ اسغ كب انح

.NaCl, CaCl2 KCL الأيلاذ كضارش ي يذ اسغ

ف ثكزشبانسزحهت انح ازبج سؤنخ ػ( ان)اندبد اند زحذذن ف يحبنخ

thermoleovorans Ir1 G., ي ثكزشب ز انجكزشب ي دانذب اناسزخهض

subtilis . B ند انخبص انجبدئ ثبسزخذاو رعخرىsfp (نسزحهت انح ا لأزبجشفشان

يغ (صج قبػذ 036) رعخى ػه برحانحصل انزبئح أظشد (..Bacillus spp ف

G. thermoleovorans Ir1 ثكزشب يغ ثب نى زى انحصل ػه B.subtilis ثكزشب

فيالمستحلب الحيوي عن إنتاج مسؤول هذا الجين ليسان يعني وهذا

thermoleovorans. G.

.

جيرت انعراق

زارة انتعهى انعان انبحث انعه

نجايعو اننير

كهت انعهو

قطى انتقانو الاحائو

نتاج، تنقو تصف انطتحهب انحي ين بكتراا

Geobacillus thermoleovorans

دراضو فعانتو انضادة نلاحاء انجيرو الاراو

تأطرح

كهو انعهو/ جايعت اننيرن كجسء ين ين يتطهباث نم درجت اندكتراه يجهص انى يقديت

فهطفو ف عهو انتقانت الأحائت

ين قبم

ىبو ينصر ناصر

2002تقانو أحائو, جايعو اننيرن بكانرش عهو,

2005قانو أحائو, جايعو اننيرن , ت ياجطتر عهو

شرافٳب

الاضتاذ اندكتر

انجلايياجد حطن

2015تز 1436شال

Documents

Production, purification and characterization of