Production of pectolyase from Rhizomucor pusillus by solid

Production of pectolyase from Rhizomucor pusillus by solid-state

fermentation

by

Amira Mohamed Abd Elaal Rizk

A Thesis submitted in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

in Biochemical Engineering

Approved Dissertation Committee

Prof. Dr. Marcelo Fernández-Lahore Jacobs University Bremen

Prof. Dr. Arnulf Materny Jacobs University Bremen

Prof. Dr. Matthias Ullrich Jacobs University Bremen

Prof. Dr. Kamel Kamal Ali Sabet Cairo University

Date of Defense: 2nd June 2017

Life Science & Chemistry

Statutory Declaration

Family Name, Given/First Name Rizk, Amira Mohamed Abd Elaal

Matriculation number 20328918

What kind of thesis are you submitting: Bachelor-, Master- or PhD-Thesis PhD-Thesis

English: Declaration of Authorship I hereby declare that the thesis submitted was created and written solely by myself without any external support. Any sources, direct or indirect, are marked as such. I am aware of the fact that the contents of the thesis in digital form may be revised with regard to usage of unauthorized aid as well as whether the whole or parts of it may be identified as plagiarism. I do agree my work to be entered into a database for it to be compared with existing sources, where it will remain in order to enable further comparisons with future theses. This does not grant any rights of reproduction and usage, however. This document was neither presented to any other examination board nor has it been published. German: Erklärung der Autorenschaft (Urheberschaft) Ich erkläre hiermit, dass die vorliegende Arbeit ohne fremde Hilfe ausschließlich von mir erstellt und geschrieben worden ist. Jedwede verwendeten Quellen, direkter oder indirekter Art, sind als solche kenntlich gemacht worden. Mir ist die Tatsache bewusst, dass der Inhalt der Thesis in digitaler Form geprüft werden kann im Hinblick darauf, ob es sich ganz oder in Teilen um ein Plagiat handelt. Ich bin damit einverstanden, dass meine Arbeit in einer Datenbank eingegeben werden kann, um mit bereits bestehenden Quellen verglichen zu werden und dort auch verbleibt, um mit zukünftigen Arbeiten verglichen werden zu können. Dies berechtigt jedoch nicht zur Verwendung oder Vervielfältigung. Diese Arbeit wurde noch keiner anderen Prüfungsbehörde vorgelegt noch wurde sie bisher veröffentlicht. ………………………………………………………………………………………………………. Date, Signature

Content

i

Contents Page

List of Contents i

List of Tables v

List of Figures vii

List of abbreviations xii

Acknowledgments xiv

Abstract ix

Chapter 1 Pectinases in zygomycete fungi: Structure, Applications, Production and Strain

development

1

Abstract 2

1. Literature review 4

1.1. Pectinases 4

1.2. Pectinase production 13

1.2.1 Fermentation modes 13

1.2.2. Pilot approaches 17

1.3. Microbial screening and development strategies 18

1.2.1. Pectin lyase coding gene 22

1.5. Potential of Rhizomucor pusillus for pectinases production 23

1.6. Project objectives, working hypothesis and thesis outline 25

1.7. References 34

Chapter 2: Materials and Methods 42

Abstract 43

2.1. Materials 44

2.1.1. Chemicals 44

2.1.2. Agro-industrial residues 44

2.1.3. Fungal strains propagation 44 2.2.1. Preparation of agro-industrial residues 45

2.2.2. Fungal strains propagation and spore suspension preparation 46

2.2.3. Screening for hydrolytic activity using Plate assay 46

2.2.4. Submerged fermentation (SmF) 47

2.2.5. Solid state fermentation (SSF) 48

2.2.6. Experimental design 48

Content

ii

2.2.7. Bioreactor study 54

2.2.8. Enzyme leaching 54

2.2.9. Analytical determinations 55

2.2.9.1. Pectin lyase estimation 55

2.2.9.2. Polygalacturonase enzyme assay 55

2.2.9.3. Protein determination 56

2.2.9.4. Optimum temperature and pH 56

2.2.10. Strain development for pectinase production 57

2.2.10.1 Fungal mycelia preparation 57

2.2.10.2. Establishment of protoplasting system 57

2.2.10.3. Protoplast regeneration 60

2.2.10.4. Protoplast fusion 61

2.2.10.5. Fusant identification 63

2.2.11. Biochemical characterizations 66

2.2.12. SDS-PAGE analysis (one dimension) 67

2.2.13. Zymogram (native polyacrylamide gel electrophoresis) 67

2.2.13. 2D gel electrophoresis 68

2.2.14. Protein identification using MALDI-TOF 68

2.2.15. Application of the enzyme complex in juices clarification 69

2.2.16. Identification of Rppnl coding gene 69

2.2.16.1. Genomic DNA preparation 69

2.2.16.2. RNA preparation 70

2.2.16.3. cDNA synthesis 70

2.2.16.4. Amplification of Rppnl coding gene 71

2.2.16.5. DNA gel-electrophoresis 72

2.2.16.6. DNA sequencing 72

2.7. References 73

Chapter 3: Screening and Production of pectin depolymerizing enzymes using a new

zygomycetes strain using submerged fermentation mode

75

Abstract 76

3.1 Screening of pectinase enzymes using agar plate cultivation 77

3.2. Degradation of different pectin substances by as a sole carbon source 78

3.3. Pectinase production using orange peel (OP) and orange peel extract (OPE) by SmF 80

3.4. Effect of lemon peel on pectin depolymerizing enzymes production 85

Content

iii

3.5. Conclusion 87

3.6. References 88

Chapter 4: Pectin lyase production using a new strain Rhizomucor pusillus DSM 1331: solid

state fermentation optimization, partial characterization and bioreactor scaling up

process

91

Abstract 92

4.3. Solid state fermentation for pectin lyase production 93

4. 3.1. PNL production at a flask scale 94

4.3.1.1. Screening 94

4.3.1.2. Optimization 98

4.3.1.3. Modeling 102

4. 3.2. Culture profile of PNL production in SSF at Flask scale 103

4. 3.3. PNL enzyme production in SSF bioreactor scale 104

4. 3.4. Culture profile of PNL production in SSF bioreactor scale 106

4.4. Conclusion 110

4.5. References 111

Chapter 5: Genome shuffling: an innovative for enhancing multi-pectin depolymerizing

enzymes production by R. pusillus DSM 1331

114

Abstract 115

5. Strain development 116

5.1. Establishment of protoplast isolation, purification, regeneration system 116

5.1.1. Protoplast isolation, purification 116

5.1.2. Protoplast regeneration 125

5.2. Application of genome shuffling using protoplast fusion 127

5.2.1. Isolation of haploid segregatns 128

5.2.2. Fusant identification and characterization 131

5.2.2.1. Morphology and sporulation 131

5.2.2.2. ITS amplification and sequencing 132

5.2.2.3. Intracellular protein electrophoresis profile 133

5.2.2.4. Screening for some specific enzymes 135

5.3. Pectinase production profile of AR9-fusant 137

5.3.1. Polygalacturonase 137

5.4. Secretion of pectin depolymerizing enzymes (PDEs) using lemon peel as inducer 138

Content

iv

5.5. Conclusion 140

5.6. References 141

Chapter 6: Biochemical characterization and proteomic analysis of a novel extracellular

pectin depolymerizing proteins secreted by Rhizomucor pusillus DSM 1331

144

Abstract 145

6.1 Characterization of crude extract 146

6.1. Pectin degrading complex from R. pusillus 146

6.2. Pectin lyase optimum temperature and pH 149

6.3. Pectin degrading complex by AR9- fusant 151

6.4. Pectin lyase optimum temperature and pH 156

6.5. Pectin degrading complex vs. commercial pectinase preparations 158

6.6. Proteomic characterization 160

6.6.1. 2D-gel electrophoresis 160

6.6.2. Protein Identification by MALDI-TOF 163

6.7. Application 168

6.4. Conclusion 170

6.5. References 172

Chapter 7: Novel pectolyase coding gene from Rhizomucor pusillus DSM 133:

identification and comparative analyses with genes from various microorganisms

176

Abstract 177

7. Identification of the pectin lyase coding gene 178

7.1. Isolation of Rppnl gene using genomic DNA 178

7.2. Multiple alignments of different PNL gene sequences 180

7.3. Isolation of the Rppnl using cDNA 183

7.4. Protein homology 187

7.5. Conclusion 189

7.8. References 190

Chapter 8: General Discussion 191

8.1. Discussion and bottlenecks 192 8.2. Future outlook 196 8.3. References 198

List of Publications 202

Content

v

List of Tables

1.1. Industrial applications of pectin degrading enzymes, which play a vital role in various

biotechnological processes

9

1.2. Commercial pectin degrading enzymes. Note: This data is obtained from PECTINASES

database 2011

11

1.3. Applications of genome shuffling approach for phenotype engineering 21

2.1. Experimental ranges of variables of different levels for screening experiments 50

2.2. Experimental variables ranges and results for screening experiments 51

2.3. Experimental ranges of variables of different levels for 1st optimization experiments 52

2.4. D-Optimal RSM design for understanding the effect of interaction experimental

parameters on PL activity

53

2.5 Primer sequence of ascomycete-specific primer pair ITS4 and ITS5 64

4.1. Experimental variables ranges and results of 1st screening experiments 95

4.2. Experimental conditions used for pectin lyase production according to experimental design.

Coded ranges of variables and results values obtained for 2nd screening experiments the stage

97

4.3. A comparison study of solid-state fermentation is scaling up the process for PNL production

by R. pusillus at flask and bioreactor level.

105

5.1. Optimization of protoplast formation process a) Different enzyme mixtures effect on Yield

protoplast ×105 cell/mL b)Lytic enzyme concentration influence on protoplast formation

from fungal mycelia incubated at 30 °C and pH 5.5 for 6 h in presence of KCl (0.6 M) as

osmotic stabilizer (results shown represent the mean of three replicate ± standard divisions)

118

5.2. Results represent the effect digestion medium with different pH values (4.5, 5.5, 6.5 and 7.5)

on protoplast formation from fungal mycelia. Results shown represent the mean of three

replicate ± standard divisions)

122

5.3. Factors affecting protoplast, a) type of regeneration medium (PDA: Potato Dextrose Agar

medium, YME: Yeast Malt Extract, GYE: Glucose Yeast Extract medium and BMP:

Breeding minimal peptone medium) b) type osmotic stabilizer. Values are mean of triplicate

± standard division

123

5.4. Intracellular protein pattern for parental strains and fusant 134

5.5. Enzymatic activity of Mutant R. pusillus , 5-6 and fusant 136

Content

vi

6.1. Comparison between PNL produced by R. pusillus and PNL enzymes reported by other

investigations, which represents the influence of inducer type on PNL activities. Different

inducers are used for PNL production [wheat bran: WB, lemon peel: LP, sugarcane bagasse:

SC, and apple peel: AP]

148

6.2. Comparison between PDEs enzymatic activities in the crude extract using both of SmF

and SSF produced by parental strains and fusant. The enzyme complex was produced

by SmF1 or SSF2

155

6.3. Comparison between PDEs enzymatic activities in some commercial preparations. The

enzyme complex was produced by SmF1 or SSF2 or a mixture of enzymes produced by SmF

and SSF3

159

6.4. Summary of the common proteins identified by MS analysis for Fructozyme P

(as commercial preparation)

164

6.5. Summary of the common proteins identified by MS analysis for R. pusillus and AR9-fusant 166

7.1. The highest significant homology of sequences with Rppnl gene of Rhizomucor pusillus by alignments

on sequences on DNA level and deduced amino acid on protein level

188

7.2. Homology analysis of the deduced amino acid obtained from the amplified Rppnl fragment

obtained by R. pusillus DSM1331with conserved amino acid sequences of one motif

commonly observed in PNL sequences

189

Content

vii

List of Figures

1.1. Schematic structure illustrating the chemical structure of pectic substances present

in the plant tissue 5

1.2. The illustrative drawing shows the chemical classification of pectin degrading

enzymes 6

1.3. Schematic illustration of the biochemical mechanism involved in the enzymatic

pectin degradation process using pectinase 7

1.4. Description of the forms of the vegetative mycelial produced by fungal strain 14 1.5. Overview of the solid state fermentation system is the presence of filamentous fungi

hyphae 16

1.6. Schematic overview is illustrating the fungal strain development strategy using

genome shuffling approach 20

1.7. Development of zygomycetes fungi: (a) fungal mycelium (b) early stage of spore

formation (c) sporangium (d) released spores (e) zygosporangia 23

1.8. Schematic diagram of project outline 33 2.1. Flow chart showing isolation and purification of protoplast 59 2.2. Schematic representation of protoplast fusion and regeneration 62 3.1. Screening for pectinolytic activity of five zygomycete strains (Mucor circinelloides,

M. mucedo, Mucor spp., Rhizomucor pusillus and R. miehei) growing on pectin as

a sole source of carbonPectinolytic activity was determined by the clearing zone

around colonies

77

3.2. Coloration between growth pattern and degradation of various carbon source

substrates as relation to pectinase production by R. pusillus. High growth pattern;

3) wheat bran, 4) sugarcane bagasse, 6) lemon peel, 7) orange peel, and 11) sugar

beet 12) Arabinose. Moderate growth pattern; 1) glucose, 2) galactose, 5)

rhamnose), 8) polygaracturonic acid and 9) polygalacturonic acid sodium salt) and

14) commercial citrus pectin. Catabolic repression pattern; 8) xylose and 13)

sucrose

79

3.3. Polygacturonase activity of Rhizmucor pusillus DSM1331 and using either orange

peel powder (OPP) or orange peel extract (OPE) on SmF. 82

3.4. Production of PG by Rhizmucor pusillus DSM1331 using orange peel extract (OPE)

on SmF. 83

Content

viii

3.5. Stimulation of different from morphology Rhizmucor pusillus DSM1331 using

either orange peel powder (OPP) or orange peel extract (OPE) on SmF 85

3.6. Effect of lemon peel as inducer on the secreted PDEs complex in submerged

fermentation (SmF) by Rhizmucor pusillus DSM1331

86

4.1. Interaction among different substrate combinations (lemon peel powder, sugar beet

powder and sugarcane bagasse and wheat bran with constant amount) with three

moisture content (80,100, and 120%) and three fermentation times (4, 6, and 8

days) on pectin lyase production by Rhizomucor pusillus in SSF

99

4.2. Response surface plot illustrates the effect of moisture level (80-120%) and

fermentation time (4-8 days) on PNL production (U/g) by R. pusillus in SSF. The

fermentation mixture is fixed as wheat bran (0.65 = 3.25g), lemon peel powder

(0.25 = 1.25g) and sugarcane bagasse (0.1= 0.50g). The enzyme activity was at the

lowest value at the blue color, and it increases significantly in the direction of the

red color

101

4.3. Cultivation profile shows the dramatic change in the soluble protein

concentration(mg/g), total carbohydrate concentration (mg/g), pH in the crude

extract (-) and PNL activity (U/g) during the solid state fermentation process by R.

pusillus at the bioreactor level using the optimized condition for PNL production

103

4.4. Cultivation profile shows the dramatic change in the soluble protein

concentration(mg/g), total carbohydrate concentration (mg/g), pH in the crude

extract (-) and PNL activity (U/g) during the solid state fermentation process by R.

pusillus at the bioreactor level using the optimizedcondition for PNL production

107

5.1. I) Isolation of protoplasts from fungal mycelia in the presence of lytic enzyme from

Trichoderma harzianum + chitanase+ β-glucuronidase + hemicellulase and osmotic

stabilizer KCl (0.5 M) incubated at 30 °C and pH 5.5 (a) partial lysis of mycelia (b)

crude protoplast after 6 h incubation (c) purified protoplast (arrow indicates

protoplasts). II) Protoplast formation process from fungal mycelia incubated at 30

°C and pH 5.5 for 6 h, a) effect of osmotic stabilizer type (0.6 M) on (b) effect of

lytic enzyme concentration (c) incubation temperature. Values are mean of

triplicate ± standard division

120

Content

ix

5.2. I) Effect of different osmotic stabilizer (0.6M) supplementedto PDA medium on

protoplast regeneration. II) Factors affect protoplast regeneration from fungal

mycelia (a) duration of mycelium incubation with lytic enzyme (b) regeneration

temperature. Results shown represent the mean of three replicate ± standard

divisions

124

5.3. Regeneration of selected fusants on PDA medium supplemented with KCl 0.6 M. 127

5.4. Segregation of fusant obtained from R. pusillus DSM1331 and A. sojae ATCC20235

Mutant 5-6 (on minimal medium containing fluorophenylalanine as haplodizing

agent: a) Fused without haploidization 13 U/mL PG activity, b) 1sthaploidization,

c) 2ndhaploidization 23 U/mL PG activity, d) 3rdhaploidization 50 U/mL PG activity

and e) 4thhaplodization 60 U/mL PGase activity

129

5.5. Fermentation behavior of Mutant 5-6, R. pusillus and fusant 131

5.6. Morphology difference between R. pusillus, Mutant 5-6 as parental strain and

fusant:a) R. pusillus, b) Fusant and c) Mutant 5-6

132

5.7. ITS1–5.8S–ITS2 ribosomal DNA PCR amplicons of Mutant 5-6, R. pusillus and

fusant: P1- Mutant 5-6, P2- R. pusillus, F- fusant, M- DNA marker

133

5.8. Mycelial protein profile of P1- Mutant 5-6, P2- R. pusillus F- fusant and M- Protein

marker

135

5.9. Time course for PGase production of the shuffled strains AR. The data were from a

minimum of three replicates. Error bars SD for each data point

137

5.10. Effect of fermentation model on PDEs complex produced by AR9 fusant by (a)

Smf (b) SSF with the influence of lemon peel as inducer. PMG, and PG (U/g)

secretion in the crude enzyme extract obtained by R. pusillus via solid-state

fermentation under optimized conditions for 6 days cultivation

139

6.1. Evaluation of various pectin depolymerizing activities: PNL PMG, and PG (U/g)

secretion in the crude enzyme extract obtained by R. pusillus via solid-state

fermentation under optimized conditions for 6 days cultivation

146

6.2. The effect of different temperature degrees (30, 40, 50, 60 and 65 °C) on the PNL

enzyme activity (U/g) produced by R. pusillus using SSF cultivation

150

6.3. The effect of different pH levels (4.5-9) on PNL activity (U/g) produced by R.

pusillus using SSF cultivation

150

6.4. PDEs complex vs fermentation mode by AR9-fusant 152

Content

x

6.5. The effect of different temperature degrees (30, 40, 50, 60 and 65 °C) on PNL

activity (U/g) produced AR fusant using SSF cultivation

156

6.6. The effect of different pH levels (4.5-9) on PNL activity (U/g) produced AR9- fusant

using SSF cultivation

157

6.7. 2D–PAGE presenting separation of proteins derived from R. pusillus, Fusant AR9

cultured via solid-state conditions and Fructozyme P (as commercial perpetration

and a positive control for pectin lyase enzyme). Protein samples were

electrophoresed in an IPG of pH 3 to 10 (7 cm) in the first dimension and a 12.5 %

SDS-polyacrylamide gel in the second dimension

162

6.8. MALDI-TOF mass spectra of 2D–PAGE gel of pectin lyase present in commercial

perpetration (Fructozyme)

167

6.9. MALDI-TOF mass spectra of 2D–PAGE gel of predicted pectin lyase from R.

pusillus

167

6.10. Clarification effect of enzyme preparations (Rp: crude extract from R. pusillus, +veC: Fructozym P as a positive control, -veC Blank and AR9: crude extract from

AR9- fusant). The process was carried at 45 °C for 120 min of incubation

169

7.1. Amplification of pectin lyase coding gene (Rppnl) using genomic DNA of

Rhizomucor pusillus by gradient PCR using different annealing temperatures: a)

50, b) 56, c) 60, d) 65, e) 70 oC and f) 2- log DNA ladder (0.1-10kb)

179

7.2. Amplification of Rppnl gene using genomic DNA of Rhizomucor pusillus at the

optimal annealing temperature of 56 oC: a) and b) 2- log DNA ladder (0.1-10kb)

179

7.3. Pectin lyase coding gene (Rppnl) nucleotide sequence for amplified PCR

product produced from genomic DNA of pRhizomucor pusillus

180

7.4. Multiple nucleotide sequences alignment of the amplified Rppnl fragment

obtained by R. pusillus DSM1331 and various PNL genes in NCBI database

181

7.5. Phylogentic tree of Rppnl from R. pusillus and PNL enzymes, with hightest

sequence smilarity, from other organisms maily fungal strains. The tree was

performed using NCBI Blast tree viewer

182

7.6. Amplification of Rppnl gene using cDNA of Rhizomucor pusillus: a)

Gradient PCR using different annealing temperatures 58.5 and 60.8oC, b)

the optimal annealing temperature of 59oC

184

Content

xi

7.7. Amplification of Rppnl gene using cDNA of Rhizomucor pusillus at optimal

annealing temperature: a) 59 oC and b) 2- log DNA ladder (0.1-10kb)

184

7.8. The nucleotide sequence of Rppnl gene amplified from cDNA of

Rhizomucor pusillus

185

7.9. Phylogentic tree of the cDNA sequences obtained from the amplified Rppnl

fragment obtained by R. pusillus DSM1331. The sequence was compared

with PNLs enzymes, with hightest smilarity, from other organisms maily

fungal strains.different in PNL proteins in NCBI database

186

7.10. Deduced amino acid sequence of Rppnl gene amplified of Rhizomucor

pusillus

187

Content

xii

List of Abbreviations

ANOVA analysis of variance A.niger Aspergillus niger Arg arginine A. sojae Aspergillus sojae IMI 191303 A. sojae uvm Aspergillus sojae ATCC 20235 (UV mutant) ATP adenosine-5-triphosphate BME betamercaptoethanol BMP breeding minimal peptone BSA bovine serum albumin CHAPS 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate CMCase carboxymethylcellulase CHA Cycloheximide 2DG 2-deoxyglucose 2DG 2 dimension gel DOE design of experiment DTT dithiothretiol EC enzyme commission EDTA ethylenediamineteteraacetic acid FPA fluorophenylalanine FU 5-Fluorouracil GA galacturonic acid gDNA genomic DNA GS genome shuffling GRAS generally recognized as safe GYE glucose yeast extract HCCA α-Cyano-4-hydroxycinnamic acid His Histidine IEF isoelectric focusing ITS internal transcribed spacer kb kilobase pair LE lytic enzyme LBP lemon peel ME metabolic engeenierring Met methionine M. circinelloides Mucor circinelloides MLR multiple lineare regression M. mucedo Mucor mucedo NADP Nicotinamidadenindinukleotidphosphat OPE orange peel extract OPP orange peel powder PAGE polyacrylimed gel electrophoresis

Content

xiii

PB phosphate buffer PCR polymerase chain reaction PDA potato dextrose agar PDEs Pectin depolymerizing enzymes PEG polyethelyen glycol PE pectin esterase PG polygalacturonase PL pectin lyase PMG polymethygalacturnase PMSF Phenylmethylsulfonylfluorid RDB rotating drum bioreactor R. miehei Rhizomucor miehei R. pusillus Rhizomucor pusillus rRNA ribosomal ribonucleic acid RT room temperature SD standard division SDS-PAGE sodiun dodecyl sulfate- polyacrylimed gel electrophoresis SSF solid state fremention SmF submerged fermentation SCP sugar beet powder SCB sugarcane bagasse 2-TBA thiobarbituric acid T. harzianum Trichoderma harzianum UV ultraviolet V volt WB wheat bran Wt wild type YME yeast malt extract

Content

xiv

Units

d day

Da dalton

g gram

h hour

kDa kilodalton

l liter

M molar

mA milliamber

min minute

mg milligram

µg microgram

°C Degree Celsius

ml milliliter

mm millimeter

mM millimolar

nm nanometer

rpm Revolutions per minute

sec second

v/v volume/volume

U/kg/d unit/ kilogram/ day

U/mg unit/ milligram

U/mL Unit of enzyme activity per milliliter

To

My mother, the soul of my father, sisters, and brothers.

And

My family, friends and everyone who has helped, encouraged and

supported me throughout my studies and research journey.…

Acknowledgment

xvi

Acknowledgment First of all, I would like to thank ALLAH AL-mighty, the most merciful and compassionate, for support, help, and generosity. With Allah´s care and mercy, I completed the PhD journey. “All praise is to Allah, Lord of the worlds.” (Quran: 1:2) I would like to thank my advisor Prof. Dr. Marcelo Fernández-Lahore for your advices and supervision. Thanks for what you taught me in my career and life. I am grateful for giving me the opportunity to work structured and independently on this topic and for your tremendous support. Prof. Dr. Arnulf Materny, Prof. Dr. Matthias Ullrich and Prof. Dr. Kamel Kamal Ali Sabet, thanks for accepting to evaluate and to review my thesis. I am indebted for your interesting discussions and fruitful hints. My deep thanks to Dr. Sonja Diercks-Horn for her scientific support and discussions as well as her friendly accompany during this period. I am indebted to Dr. Marten Kangwa, thank you for all your given support, scientific help, friendly encouragement, and cooperation during my PhD time. I would like to give a big “Thank you” to all DSP group members and guests both previous and current ones. Thank you all for providing pleasant atmosphere not only to work but also to have special moments, experience new things together and to be my family in Bremen. Many thanks to Nina Nentwig for the friendly support in the lab, for sharing your experience, being a friend and sharing a good time in my personal life. Thanks for Nina Böttcher for your help and Lab assistance. I am very grateful for my friends here in Bremen who stayed beside me in hard moments and happy ones too. Thank you all: Dr. Sirma, Dr. Noor, Dr. Aasim, Dr. Silvia, for all other things I learned from you and for your trust in me. For being so delightful friends and all discussions but above all, the great working environment, all the moments that we had. I am especially thankful to Dorga, Prasad, Naveen, Rodrigo, Antonio and Dr. Rajash for their remarkable moments that we shared together at work and also as friends. I would like to especially thank all members of Food Science and Technology Department, Faculty of Agriculture at Tanta University for supporting me. Also, my profound thanks for Dr. Adel Abo Zaid, Dean of Faculty of Agriculture at Tanta University for his endless help and encouragement. I am grateful to the members of AG Kohnert, AG Springer, AG Brix, AG Ullrich and everyone who gave me a hand during my time at Jacobs University Bremen, especially to Dr. Khalil Assaf, Dr. Ahmed Rezk, Dr. Khaled Abdullah, Dr. Rohan Shah, Veronika Will and Alexendera Lazar for scientific suggestions and Ushi for her help.

Thanks a lot for JMSA community and all my friends inside Jacobs University for sharing moments, events and fun together.

Acknowledgment

xvi

I am thankful for the Egyptian Government for financial support to my scholarship. Also, the support provided by Jacobs University Bremen via the project PGSYS / ETB-2008-44 and PGSYS EXCHANGE.

Dr. Rasha, thank you for giving me so much care, assistance and excellent time we shared together and with your family. Dr. Abla, Dr. Alzahraa and Dr. Rasha, thanks for all advices you gave to me and for helping me not only you but also your family. Thanks for being a sister before being a real friend. Dr. Zainab, I would like to give warm and big thanks for you. For all things, we did together especially the crazy ones, for years of friendship in “Ph.D. universe and personal life moments.” You tought me what real friend means. Maren, thanks a lot for being my host family and for all amazing moments we share together “Ich und dir immer mit sehr viel Freude an unseren Zeit.” Frau Molter and Herr Molter, my endless thanks for both of you. I am glad to have you as my parent here in Bremen. Every moment is printed in my heart. Thanks a lot for the advice, encouragement and genuine care, “Ich bete, dass du immer in meinem Herzen bleibst und ich auch in deinem Herzen.”

Alaa, Soha, Yasmine, and Nagham , thanks for years of friendship and all moments we shared during this time. Thank you for being here beside me and giving a helping hand to me always. My friends home back: Dr. Asmaa, Shimaa, Moshera, Heba, and Noha. You made my way fruitful by your support and by holding my hands. I knew you were always beside me. Thank you so much for your unseen prayers.

Last but definitely not least, my sincere gratitude to my Mother and the soul of my Father, my sisters, brothers and everyone in my family and their Kids, my beloved Uncle Eng. Sayed Nada for their proper care, patience, being always beside me and endless encouragement. My feelings are behind the words and only by your prayers and effort I purse to have my PhD. My profound thanks and grateful for unseen prayers from everyone. Your prayers are the secret of my success.

Finally, I am grateful to all who made this work possible. Firstly and lastly, I thank ALLAH (SWT) for the endless blessings and grants.

“My Lord, increase me in Knowledge”

xv

Abstract

The filamentous fungus Rhizomucor pusillus DSM 1331 is recognized to produce several

industrial enzymes by solid-state fermentation (SSF). However, until now, information on

the production of pectolyase enzyme has been very limited. This project deals with the

exploration of R. pusillus DSM 1331 as a potential pectolyase producer, with the main

emphasis on pectin lyase (PNL) production under solid-state conditions. Pectin lyase (PNL)

catalyzes the degradation of highly esterified pectin via a β-elimination mechanism. PNLs

are grouped with pectate lyases (PL), in Family 1 of the polysaccharide lyases.

Pectinases have been exploited in various industrial applications. In the industrial market,

juice clarification and wine production are the main applications of these enzymes. The

present study developed a rational bioprocess for pectolyase production using different

strategies. Herein, a microbial screening for different zygomycete strains was applied to

define the parental strain for pectolyase production. As Rhizomucor pusillus showed the

highest pectinase activity, this strain was selected for process development. A second

screening step was conducted to select significant inducers for the fermentation media

design. R. pusillus exhibited the ability to produce pectin degrading enzymes using both

submerged fermentation (SmF), in the presence of lemon peel as an inducer, as well as on

solid state fermentation (SSF) systems.

Since SSF is reported as an efficient fermentation mode via utilization of inexpensive

agroindustrial material, this fermentation mode was selected. The process was optimized

at the laboratory scale and scaled-up utilizing a rotating drum bioreactor. The maximum

PNL activity reached 100 U/g (specific activity 45.2 U/mg protein), this was achieved with

a solid media containing 67% wheat bran, 19% lemon peel powder and 14% sugarcane

bagasse. The optimized process was scaled up 200X resulting in maximum productivity of

20,000 U/kg/d.

xvi

The Strain development strategy using the genome shuffling (GS) approach was selected

to enhance enzyme production. The GS system was successfully developed for different

filamentous fungal strains (R. pusillus and A. sojae). AR9-fusant was obtained from GS

with significant enhancement in pectolyase production. The fusant had a significant PNL

and PMG activities in comparison with parental strains, showing a maximum PNL activity

of 580 U/g, five times higher than the parental strain.

Pectolyase activity including pectin lyase (PNL) and polymethylgalacturonase (PMG).

PNL enzyme activity was optimal at 40 °C and under acidic conditions (pH = 5.5) for R.

pusillus. AR9-fusant revealed cultures with different patterns in the pectinolytic activities

and the biochemical properties. A preliminary attempt for protein identification was

performed using MALDI-TOF.

In pectinases research at the molecular level, little work was performed on the production

of PNL enzyme or PNL gene isolation using R. pusillus. This study reports, for the first

time, the isolation of the Rppnl gene, which encodes the pectin lyase of R. pusillus. The

nucleotide and the deduced amino acid sequence of Rppnl gene were compared with the

reported sequences of PNLs from other sources in the NCBI database. Both analyses

revealed significant homology with pectin lyases found in other fungi.

In conclusion, the results of this work display the potential of R. pusillus as a promising

pectolyase producer, utilizing an improved strain and solid-state production. The proposed

process corroborates the effectiveness of a Generally Regarded as Safe (GRAS) microbial

strain to produce PNL on inexpensive fermentation substrates, opening the way for several

industrial applications.

Chapter 1

Literature review

Pectinases in zygomycete fungi: Structure,

Applications, Production and Strain

development

Literature review Chapter 1

2

Abstract

The current review introducing the importance of pectinases production by

zygomycete fungi with emphasis on fermentation manipulation and strain

development approaches. Herein, the attention lies mainly in enzyme mode of actions,

substrate structure, industrial applications, processes production, biochemical

characterizations, enzyme-coding gene and strain development are introduced in

details. Pectinases or pectinolytic enzymes have an extensive usage in the food

industry and several biotechnological applications. The protein secretion, production

quantity, biochemical characteristic and technological properties are influenced by the

secreting strain and the fermentation mode. Here, the chemical structures, function

properties, applications of pectinases enzymes were reviewed. Several filamentous

fungi and different microbial sources such as Aspergillus ssp., Mucor spp., yeast, and

bacteria have been extensively deliberated before, much less are documented on the

pectinolytic enzymes secretion by the genus Rhizomucor. The production of the pectin

degrading enzymes is well-identified through both submerged fermentation (SmF)

and solid state fermentation (SSF). The development of economically production

processes is a significant hurdle in the commercialization of biomolecules which

requires a constant demand for providing strain development approaches, to gain

overproducing strains. Production of industrial enzymes requires the development of

low-cost and higher-yield processes. Towards this goal, microbial strains with higher

levels of production should be considered. Genome shuffling (GS) has been used

extensively over the past two decades to increase biomolecules production. Indeed,

few fungal strains belonged to this genus have been reported as pectinase producers

using solid-state fermentation (SSF) with distinctive biotechnological properties.

Since fermentation manipulation is a coordinator factor to improve the production of

interested bio-substances, both fermentation systems had significant influences on

enzyme production that had to be deeply investigated.


3

Various strain development approaches are described for achieving this goal through

strain engineering. The GS technology has been presented as a novel whole genome

engineering tactic for the rapid improvement of cellular phenotypes by using recursive

protoplast fusion with multi-parental strains. This offers the advantage of

recombination throughout the entire genome.

Moreover, commercial preparation drawbacks and the industrial applications with

concentrating on juice industry were described. Advances in omics technology and

computational simulation are allowing us to develop low-cost and higher-yield

processes and make it possible to understand cellular physiology and characteristics,

which can be used subsequently for designing strategies.


4

1. Literature review

1.1. Pectinases

Pectinases are enzymes commonly referred to as pectic enzymes, pectinolytic

enzymes, and pectin degrading enzymes that represent one-quarter of food production

enzymes. They are heterogeneous proteins that cleave pectin by attacking the

galacturonan backbone at different positions [1-4]. Pectic compounds are very

complex colloidal acid polysaccharides. They were ordered by the American

Chemical Society [5, 6] as protopectin, pectic acid, pectinic acids and pectins based

on the type of attached groups in the main chain. Protopectin is a parent pectic

molecule. Pectic acids are pectic compounds composed of polygalacturonic acid and

are mostly free of methyl ester groups, while pectates are the acid salts of pectic acid.

Pectinic acids are those polygalacturonic acids containing numerous amounts of

methyl ester. Galacturonic acid residues linked by α (1-4) linkage represent a

backbone of pectin substances with side chains consisting of L-rhamnose, arabinose,

galactose and xylose as shown in (Figure 1.1).

Pectin is a generic name for a mixture containing pectinic acid as the major

component. Pectin in the native form presented in plant tissues represents major

components of the middle lamellae [7] , approximately 0.5 to 1%, based on a fresh

weight basis in most plant materials, as reported in [8].

.


5

Figure 1.1: Schematic structure illustrating the chemical structure of pectic substances present in the plant tissue.

The pectin backbone and the side chains consist of different sugar moieties. Galacturonic acid units form the main backbone.The building block molecule (Galacturonic acid) is presented in various types; galacturonic acid, methylated galacturonic acid, and amidated galacturonic acid also the main chain, several sugar molecules are contributing in the side chain structure, e.g., L-rhamnose, arabinose, galactose, and xylose.

Since pectic materials are a complex bio-substance, several pectin degrading enzymes

are required to degrade it completely into simpler molecules like galacturonic

acids.The difference between these enzymes is present in their cleavage mode, a

cleavage site and substrate specificity (Figure.1.2). The enzymes are also categorized

into two main clusters that act on smooth regions or hairy regions in pectin substances.


6

Figure1.2: The illustrative drawing shows the chemical classification of pectin degrading enzymes. Pectinases are grouped based on three main criteria. The first principle is depended on the cleavage mode on the glycosidic bond (hydrolase or lyase). The second one relies on the site of cleavage on the pectic materials which includes either endo or exo. The enzyme that acts within the substrate molecule called endo while the one's breaks at the end of the substrate chain termed exo. The third principle is based on the substrate preference of either pectin or pectate usage. Pectin depolymerase enzymes (PDEs) cleave the bonds between galacturonate units

by two mechanisms: hydrolases and lyases. Hydrolyases degrade, while lyases cleave

glycosidic bonds by elimination, giving rise to unsaturated products (Figure1.3).

Among these enzymes, pectin lyases show specific activity for methyl esterified

pectin, whereas pectate lyases are distinct for un-esterified polygalacturonate

(pectate).


7

Figure1.3: Schematic illustration of the biochemical mechanism involved in the enzymatic pectin degradation process using pectinase.The degradation of pectin molecules requires different enzymes; PMG, polymethylgalacturonases; PG, polygalacturonases; PE, pectinesterase; PNL, pectin lyase. In addition to the main enzymes, arabinogalactanase, rhammogalaturonase, exo-arabanase, endo-arabansase are involved in this enzymatic process for the cleavage of the side chain. In this scheme, the arrow shows the place where the pectinase reacts within the pectic substances. (a) R = H for PG and CH3 for PMG; (b) PE; and (c) R = H for PGL and CH3 for PNL. The presented mechanism modified from [9].

Polygalacturonase (PG), polymethylgalacturonase (PMG) and pectin lyase (PNL) are

considered the most studied in commercial pectinase preparations. These proteins

have been classified into a larger family of carbohydrate-degrading enzymes and can

get into at the CAZY [10].


8

PLs have an eliminative cleavage mechanism on pectin (methoxylated

polygalacturonic acid) that produces unsaturated oligogalacturonides [11, 12]. PNL

(EC 4.2.2.10) classifies under the lyases, or pectic transeliminases group, that break

down pectin directly by depolymerization. In several microbial groups, the PNL

synthesizes have been studied, but it was rarely reported on the plant.

The commercial preparations are mainly produced using fungal genera with the

specific role of PNL producers such as Aspergillus, Penicillium, and Fusarium [13,

14]. However, there are few reports of bacterial and yeast pectin lyase [15, 16].

There is a group of pectinolytic enzymes broadly recognized as pectinases. These

enzymes are involved in pectin degradation and have been reviewed for different

applications. As a result of the great variety in the structure of pectins, they are

categorized into enzymes acting on the “smooth regions” composed of

homogalacturonan, and enzymes acting on the “hairy region,” which

rhamnogalacturonan is the main unit. The groups of enzymes which are involved in

the degradation of the hairy region of pectins are rhamnogalacturonan lyase,

rhamnogalacturonan hydrolase, and rhamnogalacturonan galactohydrolase. These

enzymes have seldom been studied and need a wide study on their structures and

functions. However, there are other additional enzymes involved in degradation of

side chains of pectins, which contain α-arabinofuranosidase (E.C. 3.2.1.55),

endoarabinase (E.C. 3.2.1.99), β-galactosidase (E.C. 3.2.1.23), endogalactanase (E.C.

3.2.1.89) and feruloyl and p-coumaroyl esterases. The importance of a certain enzyme

complex is a function of a specific application (Table 1.1).


9

Table 1.1

Industrial applications of pectin degrading enzymes, which play a vital role in various

biotechnological processes

Application

Required enzyme

Importance

Process condition

Apple juice extraction Pectin lyase +++ Fruit pressing

exo endo B Arabinases +

Rhamnogalacturonase +

Pectinacetylesterase +

Apple and Pear

Endoglucanases ++

Cell wall destruction

Fruit liquefaction

Exoglucanases +

Cellobiohydrolyase +

ᵦ-Glucosidase Xaylanse +

Grape must clarification

Polygalacturonase +++

Must depectinisation

Pectinmethylesterase +

Pectin lyase +

Arabinogalactanses +

Wine quality

Exo-β Arabinosidase +++

Aroma release Apiosidase +++

Glucosidase +++

Rhamnosidase +++

Clear Pineapple juice

Galacotmannanase +++

Gum hydrolysis Arabinogalactanses ++

Polygalacturonase +

French Cider

Pectinmethylesterase

+++

Ca+2 pectate

formation


10

Table1.1: (Continued)

Application

Required enzyme

Importance

Process condition

Concentrated juices

clarification

(Apple, Pears, and Grape)

Pectinmethylesterase +++

Juice depectinisation Polygalacturonase +++

Pectin lyase ++

Arabinogalactanses +

Rhamnogalacturonase +

Pectinacetylesterase +

In the market, several commercial preparations of pectin degrading cocktails are

produced as presented in (Table 1.2). These commercial preparations usually are a

mixture of pectinase with another carbohydrate degrading enzyme like cellulases and

amylases to prompt particular application. For instance, in juice and wine production,

these proteins have been utilized to improve the yield, viscosity reduction, to remove

off the peels, juice clarification, and stability enhancement. Moreover, the enzyme is

used in extract vegetal oils, tea-leaf fermenting, and textile application ]17[ .

In spite of the wide range of commercial pectinase applications in the market that

occupies about 25% of the overall manufacturing of enzyme preparations, pectinase

production is one of the most prospective bioprocesses which need to be developed.


11

The global market for industrial enzymes is projected to exceed the US $ 7.6 billion

by 2022. Although commercial pectinase applications in the market occupy about

40% of the overall manufacturing of enzyme preparations, pectinase production is one

of the most prospective bioprocesses which needs to be developed.

Table1.2

Commercial pectin degrading enzymes. Note: This data is obtained from

PECTINASES database 2011

Trade name

Company

Location

Pectinol, Rohament Rohm, GmbH Darmstadt, West Germany

Panzym C.H. Boehringer Sohn Ingelheim, West Germany

Klerzyme Clarizyme Wallerstein Co. Des Plaines, USA

Pectinase Biocon Pvt Ltd Bangalore, India

Pectinex Schweizerische Ferment A.G. Basel, Switzerland

Rapidase Societe Rapidase S.A. Seclin, France

Sclase Kikkoman Shoyu Co. Tokyo, Japan

Pectolase Grinsteelvaeket Aarthus, Denmark

Ultrazyme Ciba-Geigy, A.G. Basel, Switzerland

Solpect L60 Varuna Biocell Pvt. Ltd. India

Food Grade Pectinase Unikbio Biotech Ltd. China

Rohapect MA Plus AB Enzymes Finland

Ly Peclyve PR Lyven France

MaxLiq Danisco Denmark

Pectinase Mash Novozyme Denmark


12

In this potential, improvement of production technology mainly on biochemical

aspects, detailed understanding of the fermentation methods, and several recovery

approaches prepare for the microbial production of enzymes. A multi-step process,

including low-cost agricultural waste as raw materials, not only decreases the capital

investment and booms up the product commercialization but also aids in remediation.

There is a developing need for the industrial processes to have economic and

environmentally responsible approaches to improve pectinase production processes.

Pectin-degrading enzymes (PDEs) are potentially valuable candidates in this effort

because they could reduce process time and efficiency. In several studies, PDEs

reported that possessed pH optima and specific activities on the degradation of pectic

material for each application. For instance, indeed pectin lyase enzymes are required

for novel display applications; they rely on pectin degradation through one-step to

obtain desirable food products. Thermal stability is considered one of the major

constraints in the rapid development of biotechnological process such as candy and

juice which required thermo-stable PDEs. The interaction between thermal stability

and pH is another important aspect affecting pectinase activity and their applications.

All of those influences need more efforts for better understanding, and this can be

achieved using biochemical techniques and innovative experiments in cellular and

molecular biology. These efforts could offer a real breakthrough in pectinase research

[17].


13

1.2. Pectinase production

1.2.1. Fermentation modes

Focusing on fermentation process [submerged fermentation (SmF) or solid state

fermentation (SSF), have been successfully used in pectinase production by fungi [18-

22] and by bacteria [23, 24].

SmF is a well-developed model applied on an industrial scale for producing a vast

diversity of microbial substances. SmF is technically easier in comparison to SSF. It

has been intensely developed from the 1940s onwards as a response to the necessity

of producing antibiotics on a large-scale [25]. It is important to explain that, the

enzyme synthesis is correlated with carbon and nitrogen sources quality and

concentration. In the case of SmF, three extreme types of morphology, pellets, clumps

and free filaments, are known.

Both pellets and free filaments are used in industrial fungal fermentations [26].

Filamentous mycelia culture can be completely free of pellets whereas a culture

containing pellets always contains some filamentous mycelia [27, 28]. A schematic

drawing the differences of pellets, clump and hyphae morphology are given in (Figure

1.4).


14

Figure 1.4: Description of the forms of the vegetative mycelial produced by fungal strain. The present graph is representing the morphological development of the vegetative mycelia of filamentous fungi. The fungal cell is growing in three types; pelleted morphology and dispersed morphology which includes freely dispersed and clump.

Research in this area is more advanced with bacteria than with fungi, which need more

detailed research for fungal strains. Fermentation research is required for a rare

overproducing strain in nature, and microorganism deregulation that leads to

overproduction of a desired commercial product with vast quantities such as pectinase

enzyme, protease, and many industrial enzymes [29]. Deregulation comes about by

nutritional as well as classical and molecular genetics manipulations to remove

negative regulatory mechanisms, as well as to enhance active regulatory mechanisms.


15

These mechanisms include induction, nutrient regulation by sources of carbon,

nitrogen, and phosphorus as well as cultivation conditions (temperature and pH).

Modification of such pathways for a definite wild-type isolated from nature, in the

laboratory yields overproduction of certain metabolites; this is the essence of

fermentation. The production development of metabolites can be achieved by the use

of metabolic engineering approaches involving the combination of classical microbial

genetics, selection with cell biology, genetic engineering, and fermentation process

manipulation.

A primary specific trait is an engineering approach to the research, reconstruction, and

design of metabolic cell networks, to control and govern metabolic fluxes [30, 31].

Several microbes are capable of using agricultural residues (cellulose, starch, lignin,

xylan, and pectin) as carbon sources by producing a massive array of enzymes in

different environmental niches [32]. In industry, PNL is produced either by solid state

fermentation (SSF) or submerged fermentation (SmF). However, SSF approach is

commonly more susceptible to high enzyme yield [33, 34].

SSF is a cultivation process where microorganisms grow on a solid matrix. The

microbial growth occurs in the nonappearance, or near absence, of free water.

Although, the substrate must have sufficient moisture to support microbial growth and

metabolism. The water is absorbed within the moist solid medium. However, few

drops of water may be present between the solid particles [35]. This system is

displayed in (Figure 1.5).


16

Figure 1.5: Overview of the solid state fermentation system is the presence of filamentous fungi hyphae. The graph illustrates the arrangement of moist solid particles and continuous gas phase during the cultivation of a filamentous fungi hyphae.

For the biotechnological process, one of the key challenges in SSF is the selection of

both useful substrate (organic and/or inorganic raw materials) and operation

conditions (temperature, pH, mass transfer, mixing, aeration rate, and heat transfer)

[36]. Considerable interest is in the efficient utilization of various agricultural residues

under investigation. For instance, sugarcane bagasse, wheat bran, lemon peel, rice

straw, sugar beet pulp, apple pomace, and orange peel are used as substrates in SSF

[37, 38]. These materials provide an environment closer to the natural one for the

cultivated strains.


17

An important factor for enzyme secretion here is medium composition, hence the

appropriate balance between nutrient amount, elements availability, induction

strength and supportive effect as inert carriers to provide an efficient environment for

maximum enzyme production.

1.2.2. Pilot approaches

In bioreactor aspects, several bioreactor types (tray, column, and rotating drum) are

used for pectinase production in the SSF process [39]. Till now, only a few studies

were reported in a bioreactor level for PNL production in details. Debaryomyces

nepalensis as PL producer was evaluated using batch and fed-batch bioreactor [40].

Keeping in view the possibility of some bottlenecks in the scaling up process, which

limits the cell growth and enzyme production, as well as the increase in the industrial

applications of PNL enzymes, raises the attention to the expansion in process

development [41].

Despite the increasing number of publications dealing with SSF, it is very hard to

draw a general conclusion from the data presented. On a gram bench-scale, SSF

seems to be superior to SmF in several aspects. Though, SSF up-scaling, required

for the industrial scale utilization, is hard to control at a large level. At pilot scale,

several bioreactors were used in the production of pectinase [42, 43]. For example,

pilot- scale packed-bed bioreactor was tested for pectinase production [44].


18

1.3. Microbial screening and development strategies

Filamentous fungi have an economic and significant contribution to the industrial

biotechnology. They can be isolated from the diverse natural environment (e.g., soil

and organic waste) and can use an extensive range of carbon and nitrogen sources for

growth. This ability gives an extraordinary metabolic diversity of several filamentous

fungi for further exploitation as producers of new antibiotics and promising enzymes.

The industrial potential of filamentous fungi has encouraged research in the large-

scale fermentation processes development, downstream processing, and methods for

strain improvement.

The classic strain improvement focuses on random mutagenesis and screening that

remains the industry standard for commercial organism development. On the other

hand, molecular genetics systems for fungi became a substitute approach to strain

development. This strategy requires information about the desired gene sequence and

the expression host, as well as having costly chemicals and apparatuses. Also, the

transformation system for filamentous fungi is still not well established and have

many difficulties because of complicated structure for fungal cell wall.

Metabolic engineering (ME) is targeting microbial genetic manipulation based on

molecular biology techniques, analytical methods, and mathematics tools. ME is now

moving towards a global-scale strategy called systems metabolic engineering to

improve the bioprocess performance [45, 46]. This approach relies on the integration

of upstream and downstream bioprocess optimization at early stages, focusing on

reconstructing phenotypes by whole genome engineering methods [47]. The

evolutionary design follows nature's ‘engineering’ principle. One of the regular

contributions to the tools of combinatorial engineering is genome shuffling (GS).


19

GS technology is a similar strategy for DNA shuffling which is defined as a procedure

that combines the benefit of multi-parental crossing allowed by DNA shuffling with

the recombination using entire genomes. The previous approach is associated with

conventional breeding, while in vitro recombination of genes (<10 kb) is routine, it is

not for whole genomes more than 1 Mb [48]. This approach, based on protoplast

fusion, has been used to modify the phenotypic traits since the late 1970s. Though

GS originated from protoplast fusion, it is a different method compared to the last one.

The straight protoplast fusion refers to the fusion between two cells (only two parents),

with various genetic characters, and obtaining a stable recombinant with the

combination of the genetic characteristics of both parents. In contrast, GS permits for

several recursive genome fusion rounds resulting in the final improved strain

involving the genetic trait of various initial organisms. The concept of GS can be

explained in (Figure 1.6).

The main advantage is an increase in genetic variety which immensely enhances the

opportunity to obtain high performance. It is a novel technology which differs from

protoplast fusion. It has been applied as an effective whole-cell engineering tactic for

the rapid improvement of industrially important microbial phenotypes.

The application of GS for phenotype construction can be represented in (Table 1.3).

For instance, an intergeneric hybrid was obtained from Aspergillus niger and

Penicillium digitatum for enhancing the production of verbenol, a highly-valued food

flavoring agent [49].


20

Figure 1.6: Schematic overview is illustrating the fungal strain development strategy using genome shuffling approach. The current method is based on four main steps to obtain the improved hybrid. (1) Selection of parental strains to construct the genetic library. (2) Cell wall digestion to release the protoplast which contains the entire genome of each strain. This process is called protoplasting. (3) Protoplast fusion, where the protoplasts from different parental strain are mixed to obtain new recombinations. (4) Recursive protoplast fusion, this step means repeating the fusion step between the new hybrids with the target parental strain in several rounds until the improved strain is selected.


21

It is a promising approach, which is not only useful for producing enhanced strains

but also as a source of information and data on complex metabolic and regulatory

networks for a vast variety of microorganisms. This tool has been applied to increase

the products yield, strain tolerance, and substrate uptake. In conclusion, strain

improvement is a critical part of establishing a production process.

Table 1.3

Applications of genome shuffling approach for phenotype engineering

Categories

Microorganisms

Product

Improvement amount

References

Increase in

product yield

Streptomyces fradiae Tylosin

6 times [50]

Sorangium cellulosum Epothilone

130 times [51]

Bacillus subtilis Fibrinolytic enzyme

4–5 times [52]

Streptomyces gilvosporeus Natamycin 1.17 times [53]

Phaffia rhodozyma Astaxanthin 1.43 times [54]

Strain

tolerance

enhancement

Streptomyces pristinaespiralis

100-μg/ml pristinamycin resistant recombinant

[55]

Candida krusei 0.85% acetic acid [56]

Saccharomyces cerevisiae High cell viability up to 55 °C

and tolerate 25% ethanol stress [57]

Substrate

uptake

improvement

Pseudomonas sp. Dibenzothiophene degradation

[58]

Sphingobium chlorophenolicum

Tolerate higher levels and degrade PCP

[59]

Lactobacillus delbrueckii Direct conversion of starch to lactic acid

[60]


22

1.4. Pectin lyase coding gene

Lyases have been defined as a class of enzymes that cleave the glycosidic bond of the

pectin substances by β-elimination. PNLs are classified under Family 1 of the

polysaccharide lyases [61] and in the superfamily pectate lyase.

The 3D structures of two PNL have been determined, including Aspergillus niger

pectin lyase A (PNLA) [62] and pectin lyase B (PLB) [63]. Although PLs and PNLs

exhibit a similar structural architecture and related catalysis mechanisms, they

nonetheless diverge significantly in their carbohydrate binding strategy [62, 64].

The growing number of databases on the structure of pectinolytic enzymes has

assisted in the analysis of minor structural variances that are responsible for the

specific recognition of a unique oligosaccharide sequence in a heterogeneous mixture

[64].

The gene corresponding to PNL enzymes was studied in several organisms. Most of

the available information about fungal PNLs and their corresponding encoding genes

have been obtained from saprophytic/opportunistic fungi. Several strains were

reported for the PNL gene isolation such as Aspergillus niger [65, 66], A. oryzae [67,

68], A. fumigatus [69] and Penicillium griseoroseum [70].

The zygomycete Rhiomucor pusillus is economically important; it provides a

convenient model to study the extracellular proteins coding genes. Up to now, no

genetic study is provided by a strain of R. pusillus on pectin degrading proteins, which

contrasts with other fungal and bacterial strains. It is important to perform a

phylogenetic analysis using protein sequences and deduced amino acid sequences

reported for PNLs to define the relationship between the three-dimensional structures

of different PNL producing microorganisms,


23

1.5. Potential of Rhizomucor pusillus for pectinases production

Zygomycetes receive enlarged attention in the biotechnology industries. They are

well known due to their extended use in China and Southeast Asia, for the production

of fermented foods such as tempeh and tofu. Several fungi in this group have in current

times been explored and used for the manufacture of a broad range of metabolic

products, such as organic acids, enzymes, and biofuels, e.g., bioethanol and

biodiesel[71]. Moreover, the zygomycetes biomass contains beneficial quantities of

proteins, lipids, amino acids and chitosan [72]. As filamentous fungi, they have

several reproduction methods by the formation of zygosporangia as is shown in

(Figure 1.7).

Figure 1.7: Development of zygomycetes fungi: (a) fungal mycelium (b) early stage of spore formation (c) sporangium (d) released spores (e) zygosporangia.


24

The genus Rhizomucor includes three species: R. pusillus, R. miehei, and R. tauricus;

these are clearly distinct from Mucor by the quality of their thermophilic nature and

some morphological features. The R. pusillus has a central role in producing a large

variety of extracellular enzymes such as amylase, phytase, lipase and milk-clotting

rennin. Moreover, it is recognized as a GRAS (generally regarded as safe) status

microorganism, which allows its products to be used in food-related applications [73-

75].

However, to our knowledge, there has little research been done on Rhizomucor as a

pectinase producer, only a few investigations for polygalacturonase production have

been studied using R. pusillus by solid state fermentation [76, 77]. From another

perspective, R. pusillus and Rhizopus rhizopodiformis are used by solid state

fermentation for lipase production using olive cake and sugarcane bagasse.

Several zygomycetes isolated represent a remarkable role in pectinase production that

leads them to be considered as promising pectinases producers[78]. For instance,

Rhizopus oryzae is capable of producing polygalacturonase that plays an essential role

in mulberry root maceration process [79]. Mucor rouxii NRRL 1894 was reported as

producer of extracellular endopolygalacturonase (PGase) [80] and Mucor

circinelloides ITCC 6025 for exopolygalacturonase production [81]

Another genus is closer to Rhizomucor that is reported as a pectinase producer is

Rhizopus. For instance, R. microsporus var. rhizopodiformis was reported as a

polygalacturonase and pectin lyase producer using lemon peels [82].

Endopolygalacturonase secreted by R. oryzae was comparable to that of the

commercial Flaxzyme utilized in the textile process as reported by [83].


25

1.6. Project objectives, working hypothesis, and thesis outline

In industrial biotechnology, most efforts are directed towards the introduction of new

systematic strain improvement tactics. This approach is well known for its central role

in the development of bioproducts process to recover the expansion of market demand,

as well as solving the drawbacks of the current products in the industrial process. The

present work in this thesis deals with two main focuses – Rhizomucor and pectin-

degrading enzymes (PDEs). The broad spectrum of pectinase most probably reflects

the complexity of the substrate requires a synergetic mode of action between different

pectinolytic enzyme members.

It is, therefore, likely that the polygalacturonase (PG) and pectin lyase (PNL) enzymes

with different biochemical properties have diverse physiological functions in

industrial applications. It is essential to point out though, PDEs such as PG have been

the focus of significant research while PNL is less well studied. The PDEs are

important in many biotechnological processes; however, they are usually applied as

an enzyme complex (enzyme crude extract). There are a lot of industrial processes in

which pectinase can be used to improve the quality and the yield of final products.

Further investigation of fermentation conditions and physicochemical characteristics

of new enzymes mixtures are required. Also, screening a large number of

microorganisms, having high active enzyme production, can lead to more efficient

and stable proteins for the particular industrial process.

Another remarkable element is enzyme stability during the technological process.

Thermal stability is considered one of the major constraints in the rapid development

of biotechnological process such as (candy and juice) that required thermostable

pectinase. Furthermore, the interaction between thermal stability and pH is another

important aspect affecting pectinase activity and their applications.


26

All those influences need more effort for thorough understanding using biochemical

techniques and innovative experiments in cellular and molecular biology, and it can

offer a real breakthrough in pectinase research.

The current work represents a part of the larger project European project “Bioprocess

Platform for the PGzyme system” that targets the production of new PDE cocktails

with a sufficient potential for different industrial applications. Moreover, it aims a

comprehensive understanding of the fundamental keys to the secretion, regulation,

production, fermentation, and characterization of the produced mixture to solve the

main bottlenecks through bioprocess strategy (http://www.pgzyme.org).

In broad focusing, the foremost goal of the present thesis is to investigate and develop

zygomycete fungi for PDEs production and bioprocess development, starting from

agro-industrial materials. Herein, the thesis is divided into five studies, in which each

investigation was addressed through several questions to achieve the core objectives

as follow:

1. Screening and production of pectin depolymerizing enzymes using a new

zygomycetes strain(s) mainly R. pusillus by different fermentation modes.

a. Which strain can be used as an efficient pectinase producer?

b. Does R. pusillus act as an efficient pectinase producer?

c. Which inducer will be significant for PDEs production?

d. Does carbon sources type influence the secreted proteins?

e. What is the better cultivation system SmF or SSF?

2. Solid state fermentation (SSF) for a novel PDE complex production by R. pusillus

using agro-industrial waste mixtures.

a. Is RSM methodology an efficient approach for increasing enzyme production?

b. Do medium composition and fermentation parameters affect the PDEs

complex?

c. What are the types of PDEs secreted by SSF fermentation?


27

d. How is the produced PDEs cocktail differed using SSF model vs. SmF?

e. How is protein production influenced by 200X Scaling up in bioreactor?

3. Genome shuffling in R. pusillus for enhancing multi-pectinase production was evaluated.

a. Does Genome Shuffling (GS) present a challenging technology? b. Is genome shuffling a recommended approach for pectinase

production? c. What are the bottlenecks that are better for GS utilization?

d. Are modern fungal development strategies more gainful for genotype improvement than classic ones?

4. Biochemical characterization and proteomic analysis of extracellular PDEs complex secreted by investigated strains

a. What are the main biochemical characteristics of the obtained enzyme complex?

b. How the secreted PDE proteins are varied based on the fermentation model?

c. What are the unique features of the gained extract vs. commercial perpetrations?

d. Which the suggested application for the PDEs crude extract?

5. Genetic investigation and protein modeling analysis for PNLs encoding gene and the deduced amino acid by the studied strain.

a. Is the encoding gene constitutive or inducible? b. How is the isolated gene similar to published PNLs genes? c. What are the mutual features of the deduced amino acid that correspond to

the putative RNA gene sequence?


28

Thesis outline

The present project is intended to develop a new PDEs complex produced by

filamentous fungi strain to utilize the metabolic engineering approach via

fermentation manipulation and genome shuffling (GS) strategies. The thesis

encompassed seven main chapters which are briefly represented in (Figure 1.8) and

described as follows:

Chapter 1 presents the thesis, and the project is introduced.

Herein, an active background about both pectinase enzymes and zygomycetes fungi

have been extensively collected to build our hypothesis. Moreover, the

biotechnological applications usage of the target proteins and the industrial

consumption in the food industry were mentioned. The influence of both secreting

strain and the fermentation mode on enzyme secretion, biosynthesis level, production

quantity, biochemical characteristic and technological properties were screened in the

previous period. Pectin degrading enzymes produced by different microbial sources

have been deliberated to understand the mechanism of protein secretion. Furthermore,

SSF and SmF were taken into account to understand the effect of fermentation mode

on enzyme production. This part also emphasizes the pectinase structure, their

bioprocess production, biochemical characterization, strain development, commercial

preparation drawbacks, on their tenders with directed on juice industry. Based on the

previous background, thesis goals, hypothesis, and outline were planned.


29

Chapter (2) describes in detail all materials and method developments for the setting

up of several approaches that represent project core.

In this part, all the experimental materials used during this research were mentioned

in details. The cultivation conditions of the investigated microbial strains were applied

according to the culture collections endorsement. The influence of fermentation mode

using both submerged fermentation (SmF) and solid state fermentation (SSF) on the

secreted enzyme complex was examined at flask level using different cultivation and

nutritional parameters to assess the process of the target for the enzyme production.

SSF optimization was directed using the design of experiment in multiple steps and

followed by statistical analysis of the gained data. The process was scaled up 200X

using 15-L rotating drum type solid-state bioreactor (RDB) to evaluate the

effectiveness of the technological process in comparison with flask scale. Genome

shuffling was applied as strain development strategy using multi-step procedures.

The secreted extracts were characterized using the determination of altered PDEs

activities, protein estimation, pH, and different physicochemical properties estimation.

Protein analysis of the crude extract was performed using SDS-PAGE (one dimension

and 2D). Protein (s) Identification was studied using MALDI-TOF analysis. Isolation

and identification of pectin lyase coding gene were conducted, and in-silico DNA and

protein analysis were performed.

Chapter (3) screens different zygomycetes strains, e.g., Mucor and Rhizomucor

strains as pectinase producers, presents the raw materials for enzyme

induction


30

In this chapter, strain screening for various wild-type strains as PDEs producers were

conducted. After that studying the influence of different carbon sources on the

selected strain mainly Rhizomucor pusillus DSM 1331 on the enzyme secretion. After

selection of both strain and carbon source, an investigation of the carbon source form

(peel or extract) had a better influence in SmF process. Moreover, the comparison

between both of SmF and SSF was performed to select the appropriate fermentation

mode based on enzyme activities and process technology. Finally, protein analysis for

the secreted mixture was analyzed.

Chapter (4) evaluates and optimizes solid state fermentation processes influencing

PDEs production and scales up at the laboratory bioreactor level.

In the current section, SSF was selected as fermentation mode for PDEs production

with the interest of pectin lyase (PNL). For this purpose, the biological and

technological processes were explored in detail. All process parameters, e.g., various

substrates, pH, and cultivation parameters that influence enzyme production were

selected for investigation.

Optimization of fermentation process was carried out using the design of experiment

in multiple steps of screening and optimization. After that, the technological process

was evaluated by scaling up to 200X fold using the optimized medium. Finally, the

biochemical characteristics of enzyme complex were investigated as well as the

secreted protein being analyzed.


31

Chapter (5) establishes the genome shuffling (GS) system for strain development,

presents fusant strain to enhance the PDEs production.

Here, GS approach was carried out as microorganism development method via several

steps. Establishment of screening and selection tool, e.g., autotrophic marker,

antibiotic, molecular identification and antifungal resistant to the hybrid were

performed. Recursive genome shuffling rounds were applied for simultaneously

amplifying the desired fusant to induce enzyme secretion process. The gained hybrid

was tested for PDE activities using different fermentation mode. The obtained

complex was cauterized using protein analysis and biochemical characterization.

Chapter (6) characterizes the selected enzyme complex using biochemical

characterization and Proteomic analysis.

The protein complex was investigated in deep by several biochemical characteristics

(e.g., types of PDs, optimal pH, optimal temperature, extract pH, stability).

Furthermore, the secreted protein was analyzed using different electrophoresis

approaches. Protein identification using MALDI-TOF analysis was conducted.

Comparative analysis of the obtained complex and some commercial preparations

were performed. The crude enzyme was applied for juice clarification.

Chapter (7) identifies pectin lyase coding gene cDNA and protein modeling to

explore the protein homology.

The pectin lyase-coding gene was isolated and identified using both genomic DNA

and RNA. The obtained fragment was sequenced and translated to get the deduced

amino acid sequence.


32

Database alignment was conducted to compare the amino acid sequence of pectin

lyase identified by the investigated strain and the other PNL from different organisms.

Chapter (8) analyzes all the experimental data and concludes the first potential for

the produced cocktails.

Industrial application in comparison with information in the literature was described.

Here, critical discussion of the obtained results with the information available in

literature was described to find the unique value for the current project. A concluded

future outlook was remarked for the proposed extension of the current research.


33

Figure 1.8: Schematic diagram of Project outline

Scaling up

Literature review

Screening

Parental strain Strain development Molecular identification

Optimization

Characterization

Genome shuffling

Rppnl gene isolation

Comparative analysis

Fusant Selection

Application

Fermentation

Recommendation

Future outlook


34

1.7. References

1. Jacob, N., et al., Hydrolysis of pectin: An enzymatic approach and its

application in banana fiber processing. Microbiological Research, 2008.

163(5): p. 538-544.

2. Sakai, T., et al., Pectin, Pectinase, and Protopectinase: Production,

Properties, and Applications, in Advances in Applied Microbiology, N. Saul

and I.L. Allen, Editors. 1993, Academic Press. p. 213-294.

3. Khan, M., E. Nakkeeran, and S. Umesh-Kumar, Potential application of

pectinase in developing functional foods. Annual review of food science and

technology, 2013. 4: p. 21-34.

4. Garg, G., et al., Microbial pectinases: an ecofriendly tool of nature for

industries. 3 Biotech, 2016. 6(1): p. 47.

5. Kertesz, Z.I., Pectic substances. 1951: Interscience Publishers, Inc.; New

York.

6. Cameron, R.G., et al., Pectin homogalacturonans: Nanostructural

characterization of methylesterified domains. Food Hydrocolloids, 2015. 47:

p. 184-190.

7. Alkorta, I., et al., Industrial applications of pectic enzymes: a review. Process

Biochemistry, 1998. 33(1): p. 21-28.

8. Tapre, A. and R. Jain, Pectinases: Enzymes for fruit processing industry.

International Food Research Journal, 2014. 21(2): p. 447-453.

9. Jayani, R.S., S. Saxena, and R. Gupta, Microbial pectinolytic enzymes: a

review. Process Biochemistry, 2005. 40(9): p. 2931-2944.

10. Database, C.A.E., 2017.

11. Brühlmann, F., et al., Pectinolytic enzymes from actinomycetes for the

degumming of ramie bast fibers. Applied and environmental microbiology,

1994. 60(6): p. 2107-2112.

12. Irshad, M., et al., Biotechnological valorization of pectinolytics and their

industrial applications: a review. Natural product communications, 2014.

9(11): p. 1649-1654.


35

13. Dênis, S., et al., Pectinase production by Penicillum viridicatum RFC3 by

solid state fermentation using agricultural wastes and agro-industerial by-

products. . Braz. J. Microbiol., 2002. 33: p. 318-324.

14. Ramanujam, K.P., N. Saritha, and S. Palani, Production of pectin lyase by

solid state fermentation of sugarcane bagasse using Aspergillus niger. Adv.

Biotechnol. J., 2008. 30(30-33).

15. Lara-Marquez, A., et al., Cloning and characterization of a pectin lyase gene

from Colletotrichum lindemuthianum and comparative

phylogenetic/structural analyses with genes from phytopathogenic and

saprophytic/opportunistic microorganisms. BMC Microbiol., 2011. 11: p. 260.

16. Nadaroglu, H., et al., Production of a Novel Pectin Lyase From Bacillus

pumilus (P9), Purification and Characterisation and Fruit Juice

Application,.pdf. Rom. Biotechnol. Lett., 2010. 15(2): p. 5167-5176.

17. Wu, M.-C., et al., Separation and utilization of pectin lyase from commercial

pectic enzyme via highly methoxylated cross-linked alcohol-insoluble solid

chromatography for wine methanol reduction. Journal of agricultural and food

chemistry, 2007. 55(4): p. 1557-1562.

18. Buyukkileci, A.O., C. Tari, and M. Fernandez-Lahore, Enhanced production

of exo-polygalacturonase from agro-based products by Aspergillus sojae.

BioResources, 2011. 6(3): p. 3452-3468.

19. Martin, N., et al., Pectinase production by fungal strains in solid-state

fermentation using agro-industrial bioproduct. Brazilian Archives of Biology

and Technology, 2004. 47: p. 813-819.

20. Castilho, L.R., R.A. Medronho, and T.L.M. Alves, Production and extraction

of pectinases obtained by solid state fermentation of agroindustrial residues

with Aspergillus niger. Bioresource Technology, 2000. 71(1): p. 45-50.

21. Trentini, M.M.S., et al., Purification of pectinases from Aspergillus niger

ATCC 9642 by ethanol precipitation. Biocatalysis and Agricultural

Biotechnology, 2015. 4(3): p. 315-320.

22. Pili, J., et al., Utilization of Orange Peel, Corn Steep Liquor, and Parboiled

Rice Water in the Production of Polygalacturonase from Aspergillus niger.

Industrial Biotechnology, 2015. 11(5): p. 284-291.


36

23. Soares, M.M.C.N., et al., Pectinolytic enzyme production by Bacillus species

and their potential application on juice extraction. World Journal of

Microbiology and Biotechnology, 2001. 17(1): p. 79-82.

24. Pasha, K.M., Molecular and biochemical characterization of pectinolytic

potential of microbes isolated from industrial fruit waste. 2015.

25. Sunnotel, O. and P. Nigam, Pectinolytic activity of bacteria isolated from soil

and two fungal strains during submerged fermentation. World Journal of

Microbiology and Biotechnology, 2002. 18(9): p. 835-839.

26. Metz, B. and N.W.F. Kossen, The growth of molds in the form of pellets–a

literature review. Biotechnology and Bioengineering, 1977. 19(6): p. 781-799.

27. Tari, C., N. Gögus, and F. Tokatli, Optimization of biomass, pellet size and

polygalacturonase production by Aspergillus sojae ATCC 20235 using

response surface methodology. Enzyme and Microbial Technology, 2007.

40(5): p. 1108-1116.

28. Nyman, J., et al., Pellet formation of zygomycetes and immobilization of yeast.

New Biotechnology, 2013. 30(5): p. 516-522.

29. Wang, L., et al., Bioprocessing strategies to improve heterologous protein

production in filamentous fungal fermentations. Biotechnology Advances,

2005. 23(2): p. 115-129.

30. Nielsen, J., Metabolic engineering. Applied Microbiology and Biotechnology,

2001. 55(3): p. 263-283.

31.Sanchez, S. and A.L. Demain, Metabolic regulation of fermentation processes.

Enzyme and Microbial Technology, 2002. 31(7): p. 895-906.

32. Semenova, M.V., et al., Use of a preparation from fungal pectin lyase in the

food industry. Applied Biochemistry and Microbiology, 2006. 42(6): p. 598-

602.

33. Thomas, L., C. Larroche, and A. Pandey, Current developments in solid-state

fermentation. Biochem. Eng. J., 2013. 81(0): p. 146-161.

34. Viniegra-González, G., et al., Advantages of fungal enzyme production in solid

state over liquid fermentation systems. Biochemical Engineering Journal,

2003. 13(2): p. 157-167.


37

35. Mitchell, D.A., et al., New developments in solid-state fermentation: II.

Rational approaches to the design, operation and scale-up of bioreactors.

Process Biochemistry, 2000. 35(10): p. 1211-1225.

36. Castilho, L.R., R.A. Medronho, and T.L.M. Alves, Production and extraction

of pectinases obtained bu solid state fermentation of agroindustrial residues

with Aspergillus niger. Bioresour Technol. , 2000. 71: p. 45- 50

37. Pandey, A., C.R. Soccol, and D. Mitchell, New developments in solid state

fermentation: I-bioprocesses and products. Process Biochem., 2000. 35(10):

p. 1153-1169.

38. De Gregorio, A., et al., SCP and crude pectinase production by slurry-state

fermentation of lemon pulps. Bioresour Technol, 2002. 83(2): p. 89-94.

39. Liao, C. and Y. Zheng, Solid state fermentation bioreactor. Wei sheng wu xue

tong bao., 2005. 32(1): p. 99-103.

40. Gummadi, S.N. and D.S. Kumar, Batch and fed batch production of pectin

lyase and pectate lyase by novel strain Debaryomyces nepalensis in bioreactor.

Bioresour Technol, 2008. 99(4): p. 874-881.

41. Hölker, U., M. Höfer, and J. Lenz, Biotechnological advantages of laboratory-

scale solid-state fermentation with fungi. Applied Microbiology and

Biotechnology, 2004. 64(2): p. 175-186.

42. Yu-Guo, L.C.-Y.Z., Solid State Fermentation Bioreactor [J]. Microbiology,

2005. 1: p. 020.

43. Liao, C. and Y. Zheng, Solid state fermentation bioreactor. Wei sheng wu xue

tong bao, 2004. 32(1): p. 99-103.

44. Pitol, L.O., et al., Production of pectinases by solid-state fermentation in a

pilot-scale packed-bed bioreactor. Chemical Engineering Journal, 2016. 283:

p. 1009-1018.

45. Durot, M., P.-Y. Bourguignon, and V. Schachter, Genome-scale models of

bacterial metabolism: reconstruction and applications. Fems Microbiology

Reviews, 2009. 33(1): p. 164-190.

46. Mora-Lugo, R., Engineering filamentous fungi to improve bio-reaction

performance in fermentation systems: application to the production of

food/technical enzymes. PhD dissertation, Jacobs University Bremen, 2015.


38

47. Sauer, U., Evolutionary Engineering of Industrially Important Microbial

Phenotypes, in Metabolic Engineering, J. Nielsen, et al., Editors. 2001,

Springer Berlin Heidelberg. p. 129-169.

48. Stephanopoulos, G., Metabolic engineering by genome shuffling. Nat Biotech,

2002. 20(7): p. 666-668.

49. Rao, S.C.V., R. Rao, and R. Agrawal, Enhanced production of verbenol, a

highly valued food flavourant, by an intergeneric fusant strain of Aspergillus

niger and Penicillium digitatum. Biotechnology and Applied Biochemistry,

2003. 37(2): p. 145-147.

50. Zhang, Y.-X., et al., Genome shuffling leads to rapid phenotypic improvement

in bacteria. Nature, 2002. 415(6872): p. 644-646.

51. Gong, G.-l., et al., Mutation and a high-throughput screening method for

improving the production of Epothilones of Sorangium. Journal of Industrial

Microbiology & Biotechnology, 2007. 34(9): p. 615-623.

52. Yong, L.H.-y.G., Whole genome shuffling to enhance activity of fibrinolytic

enzyme-producing strains. China Biotechnology, 2007. 10: p. 009.

53. Hui, Z., J. Zhi-hua, and C. Pei-lin, Natamycin-producing strain breeding by

genome shuffling. Chinese Journal of Antibiotics, 2006. 31(12): p. 739.

54. Zheng, Z. and X. Zhao, Astaxanthin-producing strain breeding by genome

shuffling. Journal of Biotechnology, 2008. 136(Supplement): p. S310-S311.

55. Xu, B., et al., Evolution of Streptomyces pristinaespiralis for resistance and

production of pristinamycin by genome shuffling. Applied Microbiology and

Biotechnology, 2008. 80(2): p. 261-267.

56. Wei, Y., et al., Two pectin lyase genes, pnl-1 and pnl-2, from Colletotrichum

gloeosporioides f. sp. malvae differ in a cellulose-binding domain and in their

expression during infection of Malva pusilla. Microbiology, 2002. 148.

57. Shi, D.-j., C.-l. Wang, and K.-m. Wang, Genome shuffling to improve

thermotolerance, ethanol tolerance and ethanol productivity of

Saccharomyces cerevisiae. Journal of Industrial Microbiology &

Biotechnology, 2009. 36(1): p. 139-147.

58. Kumar, M., Improving polycyclic aromatic hydrocarbons degradation by

genome shuffling. Asian Journal Microbiology Biotechnology Environmental

Science, 2007. 9: p. 145-149.


39

59. Dai, M. and S.D. Copley, Genome shuffling improves degradation of the

anthropogenic pesticide pentachlorophenol by Sphingobium

chlorophenolicum ATCC 39723. Applied and environmental microbiology,

2004. 70(4): p. 2391-2397.

60. John, R.P., D. Gangadharan, and K.M. Nampoothiri, Genome shuffling of

Lactobacillus delbrueckii mutant and Bacillus amyloliquefaciens through

protoplasmic fusion for L-lactic acid production from starchy wastes.

Bioresource Technology, 2008. 99(17): p. 8008-8015.

61. Lombard, V., et al., A hierarchical classification of polysaccharide lyases for

glycogenomics. Biochemical Journal, 2010. 432(3): p. 437-444.

62. Mayans, O., et al., Two crystal structures of pectin lyase a from Aspergillus

reveal a ph driven conformational change and striking divergence in the

substrate-binding clefts of pectin and pectate lyases. Structure, 1997. 5.

63. Vitali, J., et al., The three-dimensional structure of Aspergillus niger pectin

lyase B at 1.7-Å resolution. Plant Physiology, 1998. 116(1): p. 69-80.

64. Herron, S.R., et al., Structure and function of pectic enzymes: virulence factors

of plant pathogens. Proceedings of the National Academy of Sciences, 2000.

97(16): p. 8762-8769.

65. Kusters-van Someren, M.A., et al., Structure of the Aspergillus niger pelA

gene and its expression in Aspergillus niger and Aspergillus nidulans. Current

genetics, 1991. 20(4): p. 293-299.

66. Gysler, C., et al., Isolation and structure of the pectin lyase D-encoding gene

from Aspergillus niger. Gene, 1990. 89(1): p. 101-108.

67. Kitamoto, N., et al., Sequence analysis and overexpression of a pectin lyase

gene (pel1) from Aspergillus oryzae KBN616. Biosci Biotechnol Biochem,

2001. 65.

68. Kitamoto, N., et al., A second pectin lyase gene (pel2) from Aspergillus oryzae

KBN616: its sequence analysis and overexpression, and characterization of

the gene products. Journal of bioscience and bioengineering, 2001. 91(4): p.

378-381.

69. Nierman, W.C., et al., Genomic sequence of the pathogenic and allergenic

filamentous fungus Aspergillus fumigatus. Nature, 2005. 438.


40

70. Bazzolli, D.S., et al., Molecular characterization and expression profile of

pectin-lyase-encoding genes from Penicillium griseoroseum. Canadian

journal of microbiology, 2006. 52(11): p. 1070-1077.

71. Ferreira, J.A., et al., Zygomycetes-based biorefinery: Present status and future

prospects. Bioresource Technology, 2013. 135: p. 523-532.

72. Alves, M.H., et al., Screening of Mucor spp. for the production of amylase,

lipase, polygalacturonase and protease. Brazilian Journal of Microbiology,

2002. 33: p. 325-330.

73. Millati, R., L. Edebo, and M.J. Taherzadeh, Performance of Rhizopus,

Rhizomucor, and Mucor in ethanol production from glucose, xylose, and wood

hydrolyzates. Enz. Microbial. Technol., 2005. 36: p. 294-300.

74. Yegin, S., et al., Aspartic proteinases from Mucor spp. in cheese

manufacturing. Appl. Microbiol. Biotechnol., 2011. 89 p. 949-960.

75. Somkuti, G.A., F.J. Babbel, and A.C. Somkut, Lipase of Mucor pusillus. Appl.

microbiol. and biotechnol., 1969: p. 606-610.

76. Asif Siddiqui, M., Veena Pande, and M. Arif, Production, Purification, and

Characterization of Polygalacturonase fromRhizomucor pusillus Isolated

from Decomposting Orange Peels. Hindawi Publishing Cor. Enz.Res., 2012:

p. 1-8.

77. Maleki, M.H., et al., Screening of some Zygomycetes strains for pectinase

activity. J. Microbiol. Biotechnol. Res., 2011. 1: p. 1-7.

78. Maleki, M.H., et al., Screening of some Zygomycetes strains for pectinase

activity. Journal of Microbiology and Biotechnology Research, 2017. 1(2): p.

1-7.

79. Ghosh, B. and R.R. Ray, Current commercial perspective of Rhizopus oryzae:

A review. J. Appl. Sci., 2011. 11: p. 2470-2486.

80. Saad, N., et al., Production, purification and characterization of an

endopolygalacturonase from Mucor rouxii NRRL 1894. Enzyme and

Microbial Technology, 2007. 41(6): p. 800-805.

81. Thakur, A., et al., Production, Purification, and Characterization of

Polygalacturonase from Mucor circinelloides ITCC 6025. Enzyme Research,

2010. 2010: p. 7.


41

82. Damásio, A.R.d.L., et al., Biotechnological potential of alternative carbon

sources for production of pectinases by Rhizopus microsporus var.

rhizopodiformis. . Brazilian Archives Biology Technology, 2011. 54: p. 141-

148.

83. Akin, D.E., et al., Retting flax with endopolygalacturonase from Rhizopus

oryzae. Textile Res. J., 2002. 72: p. 27-34.

Chapter 2

Material and Methods

Materials and Methods Chapter 2

43

Abstract

The current part includes all the experimental materials, e.g., microbial strains, agro-industrial, and

chemical that have been used during this research. The sources of all the microbial strains, as well

as cultivation conditions, were described in details according to the culture collections

recommendation. In the first part of the current research, the effect of on fermentation mode on

the secreted enzyme type was investigated. Screening of different fungal strains was carried out

to select the desired strain for enzyme production. Moreover, the fermentation process in two

modes both submerged fermentation (SmF) and solid state fermentation (SSF) was tested to study

the influence on enzyme production at flask level. The second part was based on studying the

impact of several cultivations, and nutritional parameters were studied to evaluate the ideal process

condition for yield enzyme. After the section of the best fermentation mode, an SSF optimization

was conducted using the design of experiment in multiple steps and followed by statistical analysis

of the obtained results. The fermentation process was scaled up 100X using 15-L rotating drum

type solid-state bioreactor (RDB) to evaluate the effectiveness of the technological process in

comparison with small lab scale in the flask. In the third part, strain development strategy was

applied using genome shuffling approach through several methods. The fourth part was focused

on characterization of the secreted enzyme extract (s) by the determination of different PDEs

activities, protein estimation, pH, and different physicochemical properties estimation. Proteomic

analysis of the crude extract (s) was performed using SDS-PAGE (one dimension and 2D).

Identification of the target protein (s) was studied using MALDI-TOF analysis. The last part was

carried out to identify pectin lyase coding gene using molecular approaches. After that, database

alignment for the nucleotides sequence and the deduced amino acid sequence was performed. A

full description of all the used equipment, instruments and tools mentioned in the supportive

material attached to this chapter.


44

2.Materials and Methods

2.1. Materials

2.1.1. Chemicals

All chemicals were analytical grade. Pectin, polygalacturonic acid, polygalacturonic acid sodium

salt, dithiothreitol (DTT), and β-mercaptoethanol (BME), lytic enzyme (Trichoderma harzianum),

chitinase, β-glucuronidase, and hemicellulase were purchased from Sigma- Aldrich. Commercial

pectinases such as Fructozym P was obtained from ERBSLÖH Geisheim AG (Geisheim,

Germany). Pectinase from A. niger was obtained from Sigma-Aldrich Chemie GmbH (Steinheim,

Germany). Molasses were acquired from local suppliers (Golden Sweet, Meckenheim, Germany).

2.1.2. Agro-industrial residues

In the current study, several carbon sources were tested for the enhancement of PDEs process.

Sugar beet pulp pellets with > dry matter of 89% were purchased from Nordzuker AG (Uelzen,

Germany). The pellets were ground to a fine powder to be used in laboratory scale SSF. Lemon

peel and orange peel were purchased from Heinrich Klenk (Schwebheim, Germany). Sugarcane

bagasse was obtained from a sugar production factory (Egypt). Wheat bran, as a main component

in all SSF mixtures, was ordered from Bremer Rolandmühle-Erling (Bremen, Germany).

2.1.3. Fungal strains propagation

The strains used in this study were purchased from different culture collections and propagated on

agar plates according to the specifications given by the culture collections.


45

R. pusillus DSM 1331, Mucor circinelloides DSMI 1175, Mucor mucedo, Mucor sp. and

Rhizomucore mehie strains were from the German Collection Microorganisms and Cell Culture-

DSMZ (Deutsch Sammlung von Microorganisms and Zelllkuturen GmbH).

For strain development approach, four Aspergillus strains (wild type) were obtained from different

culture collection in the lyophilized form and propagated according to the recommended method

specified by the culture collections. A mutant A. sojae ATCC 20235 UV 5/6 was generated in Prof.

Lahore’s Laboratory in Jacobs University Bremen and used in strain development approach.

2.2. Methods

2.2.1. Preparation of agro-industrial residues

Raw materials were dried at 50 °C, ground to a fine powder with a coffee grinder and stored in

plastic bags before use. SSF medium composed of 5 g solid mixture was wet with a hydrated

solution in the respective percentages according to the experimental design given in this section.

The described moisture levels in all experiments set-ups were calculated as dry basis moisture

content according to this equation:

% =

∗ 100.

Where fresh weight is the weight of solid mixture plus hydrated solution and dry weight means

weight of the dry solid mixture.


46

2.2.2. Fungal strains propagation and spore suspension preparation

The strains used during this study were propagated on agar plates according to the specifications

given by the culture collections. R. pusillus DSM 1331, Mucor circinelloides DSMI 1175, Mucor

mucedo, Mucor sp. and Rhizomucore mehie strains were maintained on potato dextrose agar (PDA)

plates at 4°C and subcultured on the same medium at 30 °C for spore formation. Spores were

harvested after 3 days of cultivation by suspending them in sterile 0.1% Tween 80. A. sojae ATCC

20235 UV mutant 5/6 was generated in Prof. Lahore’s Laboratory in Jacobs University Bremen

was used in strain development approach.

Yeast Malt Extract (YME) agar medium composition was as follows in (g/L); malt extract (10),

yeast extract (4), glucose (4) and agar (20), this medium was used for the propagation of A. sojae

mutant. For sporulation molasses agar (MA) medium containing: glycerol (45 g/L), molasses (45

g/L), peptone (18 g/L), NaCl (5 g/L), KCl (0.5 g/L), FeSO4.7H2O (15 mg/L), KH2PO4 (60 mg/L),

MgSO4 (50 mg/L), CuSO4.5H2O (12 mg/L), MnSO4.H2O (15 mg/L) and agar (20 g/L) was used.

Plates were incubated at 30 °C for 5 days. Stock cultures from spores of all mentioned strains were

preserved in 20% glycerol and stored at -80 °C. Spores were harvested after 5 days of cultivation

by suspending spores in sterile distilled water. Inoculum size adjusted by manual spore counting

in a Thoma hemocytometer chamber.

2.2.3. Screening for hydrolytic activity using plate assay

For detection of enzymes activities, the methodology was the one proposed [1], with certain

modification. Strains were screened for proteins relevant to the processing of potential industrial

technologies.


47

The screened enzymes were polygalacturonases (PG), pectin lyase (PNL), proteases, lipase,

amylase and carboxymethycellulase (CMCase), and the respective substrates used were: citric

pectin, gelatin, CaCl2/tween 80, starch and carboxymethycellulose (Difco).

In a Petri dish containing 15 mL of the suitable substratum, a disk of 5mm in diameter was removed

from the central part of the medium, and the hole filled in with 50 μL of 106 spores/mL suspension

and incubated at 30ºC. All the tests were performed in triplicate. The level of enzyme production

was evaluated by the halo diameter, measured in centimeters, in the reverse of the Petri dish. The

enzyme activity was measured within 2 and 7 days depend on the tested enzyme. The positive

activity was determined by halo formation, except for lipase which was determined by the

development of white precipitation area and proper growth development for

carboxymethycellulase activities.

2.2.4. Submerged fermentation (SmF)

Fermentation was carried out using 30 mL medium which contains 10 g/L orange peel, 61.9 g/L

sugar beet syrup and 8.4 g/L (NH4)2SO4 in 300 mL Erlenmeyer flask (sterilized at 121°C for 20

min). Each flask was inoculated by 1 mL fungal spore suspension (105 spores /mL) and incubated

for 5 days on a rotary shaker (New Brunswick Scientific, NU, USA) at 30 °C and 250 rpm [2].

After the incubation period, the culture broth was centrifuged at 10,000 rpm for 10 min at 4 °C

and used as the crude enzyme. Supernatants were kept at 4 °C until activity was assayed. Most of

the works on pectinase production have been focused on either submerged fermentation where the

pectin is used as the inducer to a pre-formulated synthetic medium or through solid state

fermentation using pectin rich substrates like citrus peel, fruit wastes, etc. [3].


48

To our best knowledge, little work has been reported on pectinase enzyme production from the

Orange peel extract (OPE). The current study was focused on optimizing pectinase production

using the fungus M. circinelloides DSMI 1175 (as control) and R. pusillus DSM 1331 as new

pectinase producers from the aqueous extract obtained from orange peel, and comparing the same

from standard SmF medium containing orange peel powder (OPP). The production medium was

formulated using the raw extract as the base material for submerged fermentation.

2.2.5. Solid state fermentation (SSF)

Fermentation experiments were performed using 5 g of the experimental mixture in 300 mL flask

and the media were moisturized at the particular level according to the design of the experiment

in section 2.2.6. The moisture content for all the experimental media was calculated according to

the equation in section 2.2.1. The flasks containing wetted mixture was sterilized at 121 oC for

30min and were left to cool down at room temperature (R.T) before inoculation.

One mL of spore suspension was used for inoculation with the concentration calculated according

to the desired spore concentration as section 2.2.6.

2.2.6. Experimental design

Fermentation experiments were performed to study the influence of numerous SSF operational

conditions and agroindustrial substrates (independent variables) on PNL activity (dependent

variables). The tests were planned according to DOE at multiple steps of screening (two steps)

followed by two optimization stages. Substrate concentrations and fermentation conditions had

been based in the studies reported by [4].


49

2.2.6.1. Screening steps

The current stage was conducted to explore different SSF operational parameters in order to

classify the significant experimental conditions in PNL production.

In the first screening step, five factors were evaluated with 3 experimental levels. Therefore, the

independent variables studied were: temperature (X1, ᵒC), pH (X2), inoculum size (X3, spore/mL),

time (X4) moisture content (X5, %water/100% substrate), and the response variable was PL

production (Y1, U/mL & U/g substrate). The studied ranges for the selected parameters are given

in (Table 2.1), using lemon peel and orange peel as primary inducers, 19 experimental runs were

required in the analysis for each medium. SSF medium was composed of 5 g substrate mixture in

300 mL Erlenmeyer flasks containing the following agro-industrial materials: orange peel or

lemon peel (1.25 g), wheat bran (2.5 g) and sugarcane bagasse (1.25 g). Herein, the Moisture

content was adjusted to 60, 100 and 160% of water added to the 100% of the solid substrate, and

then the medium was sterilized at 120 °C for 20 min.

Flasks were inoculated with 1 ml of spore suspension with a final concentration of 1 x 107

spores/mL. The inoculated flasks were incubated at 30 °C and samples were collected at 3, 6 and

9 days for each trial and subsequently subjected to further analysis steps.


50

Table 2.1

Experimental ranges of variables of different levels for screening experiments

In the second screening step, the variables with no enhancement influence have been observed on

the enzyme production. In the first screening step, the level of temperature, pH, and inoculum size

were fixed and ranges of both time and moisture content were varied.

The experimental evaluation was based on the following parameters mixture of the substrate

(medium composition), time and moisture content (%water/100% substrate) and the SSF

performed according to the experimental design showed in (Table 2.2).

Factors

Symbol

Low

Center

High

Temperature X1 30 40 50 pH X2 3 5 8 Inoculum size X3 104 105 107 Time X4 3 6 9 Moisture X5 60 100 160


51

Table 2.2

Experimental variables range and results for screening experiments

Trial No.

Experimental factors

X1 X2 X3 X4 X5

1 30 3 104 3 60 2 50 3 104 9 160 3 30 8 104 9 160 4 50 8 104 3 60 5 30 3 107 3 160 6 50 3 107 9 60 7 30 8 107 9 60 8 50 8 107 3 160 9 40 5 105 6 110

10 40 5 105 6 110 11 40 5 105 6 110 12 30 3 104 9 60 13 50 3 104 3 160 14 30 8 104 3 160 15 50 8 104 9 60 16 30 3 107 9 160 17 50 3 107 3 60 18 30 8 107 3 60 19 50 8 107 9 160

X1: temperature, X3: inoculum size, X4: time, X5Moisture content

2.2.6.1. Optimization steps

A two-step optimization strategy was carried out after the screening part, using RSM modeling to

optimize PNL production.

In the first optimization stage, time and moisture content from the physical parameters were

optimized using optimized inoculum size; pH and temperature from the previous screening steps.

Regard inducers, orange peels, was excluded, and the further optimization was based on mixtures

of wheat bran, sugarcane bagasse, sugar beet and lemon peel.


52

Three levels of time (4, 6 and 8 days) and moisture content (80, 100 and 120 %) were selected.

For the substrate mixture, wheat bran was fixed at coded value 0.65, and the rest substrates were

lemon powder (0.015 to 0.145), sugar beet pulp powder (0.015 to 0.145), and sugarcane bagasse

(0.15 to 0.15) as presented in (Table 2.3). The coded value was multiplied by 5 (which represent

5 g medium) to calculate the experimental values in all experiments.

Table 2.3

Experimental ranges of variables of different levels for first optimization experiments

Trial No.


X4 X5 WB SC SB LP

1 4 60 1 0 0 0 2 4 60 0 1 0 0 3 4 60 0 0 1 0 4 12 60 1 0 0 0 5 12 60 0 1 0 0 6 12 60 0 0 1 0 7 4 120 1 0 0 0 8 4 120 0 1 0 0 9 4 120 0 0 1 0

10 12 120 1 0 0 0 11 12 120 0 1 0 0 12 12 120 0 0 1 0 13 8 90 0.5 0.5 0 0 14 8 90 0.5 0 0.5 0 15 8 90 0.5 0 0 0.5 16 8 90 0 0.5 0 0.5 17 8 90 0.5 0.25 0.25 0 18 8 90 0.5 0.25 0 0.25 19 8 90 0.5 0 0.25 0.25 20 8 90 0 0.5 0.25 0.25 21 8 90 0.5 0.5 0 0 21 8 90 0.5 0 0.5 0 22 8 90 0.5 0 0 0.5 23 8 90 0 0.5 0 0.5


53

In the second optimization stage, the final medium composition was established, the initial central

structure face-centered design was evaluated with two parameter times (4-8 days) and moisture

content (80-120%) with 3 center points (replicates). D-Optimal RSM model was performed to for

understanding the effect of experimental interaction parameters on PNL activity as it shown in

(Table 2.4).

Table 2.4

D-Optimal RSM model for understanding the effect of experimental interaction parameters on PNL activity

Trial No.


X4 X5 SC SB LP WB

1 4 80 0.1 0.1 0.1 0.7 2 4 80 0.3 0.1 0.1 0.5 3 4 80 0.2 0.1 0.1 0.6 4 4 80 0.1 0.15 0.15 0.6 5 8 80 0.1 0.1 0.1 0.7 6 8 80 0.1 0.25 0.1 0.55 7 8 80 0.15 0.1 0.25 0.5 8 8 80 0.25 0.15 0.1 0.5 9 4 120 0.1 0.1 0.1 0.7

10 4 120 0.3 0.1 0.1 0.5 11 4 120 0.1 0.3 0.1 0.5 12 4 120 0.1 0.1 0.3 0.5 13 8 120 0.1 0.1 0.1 0.7 14 8 120 0.3 0.1 0.1 0.5 15 8 120 0.1 0.3 0.1 0.5 16 8 120 0.1 0.1 0.3 0.5 21 4 95 0.15 0.25 0.1 0.5 22 4 105 0.15 0.1 0.25 0.5 23 8 95 0.3 0.1 0.1 0.5 24 8 95 0.1 0.15 0.25 0.5 25 8 105 0.1 0.1 0.15 0.65 26 8 105 0.25 0.1 0.1 0.55 27 5 80 0.1 0.3 0.1 0.5 28 5 80 0.1 0.1 0.3 0.5 29 7 80 0.1 0.25 0.15 0.5 30 5 120 0.1 0.25 0.15 0.5 31 5 120 0.25 0.1 0.15 0.5 32 7 120 0.1 0.1 0.25 0.55


54

2.2.7. Bioreactor study

For scaling up the process, the optimized conditions established at flask level by screening and

optimization studies (temperature, moisture content and substrate mixture) were used in the 15-L

rotating drum type solid-state bioreactor (RDB), Terrafors- IS -Infors HT, Switzerland, with 1 kg

dry substrate mixture.

Before sterilization, moisture content was adjusted to the optimal conditions, and R. pusillus spores

with final concentration 1 x 107 spores/mL were inoculated directly in the bioreactor.

RDB rotation was carried out during the first day of cultivation 1 rpm for 10 min clockwise

followed by 10 min anticlockwise. The effect of aeration rate on three different flow rates from 2

L/min to 5 L/min to 2 L/min at the first day of SSF then shifted from 2 L/min to 5 L/min and kept

constant over the fermentation process was studied. Samples were taken from different sides of

the bioreactor with the amount of 20 g, mixed well, and divided into 4 portions (5 g for each

portion) for enzyme extraction. Bioreactor runs were carried out in duplicates. Productivity was

defined as the number of units of enzyme activity per liter of enzyme solution per hour.

2.2.8. Enzyme leaching

For enzyme extraction in all SSF experiments (flasks and bioreactor), the fermented material was

mixed with 50 mL of different solvents (distilled water and 0.1M acetate buffer pH 4.8) and

agitated for an hour at 24 °C at 200 rpm. The extract was separated by centrifugation at 10,000 g

for 15 min at 4 °C, followed by filtration for efficient removal of mycelia and the solid residues.

The leached supernatant was used as the source of crude extracellular enzyme for subsequent

analysis.


55

2.2.9. Analytical determinations

2.2.9.1. Pectin lyase estimation

Pectin lyase (PNL) activity was assayed according to the procedure provided by [5] with slight

modifications. The reaction mechanism based on measuring the formation of unsaturated

galacturonides as a product of pectin degradation after incubation with the PNL enzyme. This

compound reacts with 2-thiobarbituric (2-TBA) acid forming a chromophore that can be detected

colorimetrical at 550 nm [6-8]. Culture filtrate in the amount of 250 μL was mixed with 250 μL of

1 % solution of citrus pectin (classic CF201, 71% degree of esterification) in 100 mM acetate

buffer pH 4.8.

The reaction mixture was incubated for 30 min at 30 °C, followed by adding 50 μL of 1 N NaOH

solution; the mixture was heated at 80 °C for 5 min and cooled down in an ice-water bath. Then,

600 μL of 1N HCl and 500 μL of 0.04 M 2-TBA were added to the mixture and incubated for a

second time at 80°C for 5min, then cooled down in an ice-water bath. Finally, the PNL activity of

the crude extract was measured at 550 nm. Blanks were prepared by the addition of acetate buffer

instead of the enzyme. One unit of PNL activity was defined as the amount of enzyme that changes

0.01 absorbance unit at 550 nm under standard assay conditions. Specific activity is the number of

enzyme activity units per mg protein.

2.2.9.2. Polygalacturonase enzyme assay

Exo-polygalacturonase (exo-PG) activity was assayed according to the procedure provided by

[9]with slight modifications, which is based on measuring the reducing sugar concentration after

incubation of enzyme with the substrate.


56

Culture filtrate (containing exo-PG enzyme) in the amount of 86 μL was mixed with 400 μL of

2.4 g /L polygalacturonic acid solution in 100 mM acetate buffer at a pH of 4.8. This mixture was

incubated at 40 °C for 20 minutes. The reducing sugar released was measured using the Nelson-

Somogyi method calibrated with galacturonic acid [10]. One unit of exo-PG activity was defined

as the enzyme that catalyzes the release of 1 μmol of product per unit volume of culture filtrate per

unit time under standard assay conditions (at 40 °C and pH of 4.8).

PG activity was calculated according to the following equation:

Exo-PG activity (U/mL) = (μg of galacturonic acid/212.12) * (1/20) * (1/0.086) * (DF)

2.2.9.3. Protein determination

Total soluble protein in the culture filtrate was estimated according to modified Bradford method

with BSA as standard. The assay was performed in a microplate by triplicate [11].

2.2.9.4. Optimum temperature and pH

The effect of temperature and pH on PNL activity was evaluated respectively. The effect of

different temperatures on enzyme activity was determined using 30 to 60 °C at 4.8 pH for 30 min

under standard conditions. Additionally, the influence of pH was studied for values from 4 to 8;

hence, the enzyme solution was mixed with various buffer solutions with appropriate pH value.

The reaction was carried out under standard assay conditions, and the aliquots of the mixtures were

taken at intervals ranging from 0 to 60 min for PNL activity measurement.


57

2.2.10. Strain Development for Pectinase Production

2.2.10.1 Fungal mycelia preparation

Spores were collected from 5 days old culture and suspended in 5 mL distilled sterile water under

aseptic conditions. The spore suspension with a concentration of 105 spores /mL was transferred

aseptically into 30 ml potato dextrose broth in 300 ml Erlenmeyer flasks.

The flasks were cultivated at 30 °C for 18-24 h on a rotary shaker (100 rpm). The young fungal

mycelia were harvested by filtration using sterilized cheesecloth and washed with sterilized

distilled water, followed by washing twice with phosphate buffer containing KCl as an osmotic

stabilizer. Mycelia pretreatment with some thiol-compounds is an efficient stage which affects

protoplast release. Two thiol–compounds (50 mM DTT and 0.2% BME) were tested for their effect

on protoplast formation from mycelia.

For pretreatment conditions, fungal mycelia were incubated for 60 min at 30 °C with 0.1 M

phosphate buffer (PB) pH 5.5 either with or without thiol-compounds. Mycelia were then washed

twice with sterilized distilled water. Theses mycelia were incubated with a lytic enzyme produced

by Trichoderma harzianum and chitinase and once pretreatment conditions were optimized,

further steps were applied to study additional factors affecting in protoplast isolation.

2.2.10.2. Establishment of protoplasting system

Based on the published literature, several lytic enzymes singly and in combination were tested in

the presence of KCl (0.6 M), digestion buffer with pH 5.5 and mycelia concentration 100mg as

fresh weight at 30 °C using gentle shaking at 75 rpm to release viable protoplast.


58

These enzymes are lytic enzyme from Trichoderma harzianum (5 mg/mL), chitinase (20 µg/mL),

β-glucuronidase (0.46 mg/mL) and hemicellulase (40 µg/mL). After selection of a lytic enzyme

cocktail, various osmotic stabilizer types were tested for their effect on protoplast release. The

selected osmotic stabilizers, MgSO4, potassium chloride, sorbitol, and sucrose, which were all

tested at concentrations of 0.6 M to determine the most suitable osmotic one. The whole protoplast

isolation and purification process is summarized in (Figure2.1).

According to the tested results of the previous factors, the effect of some important factors in

protoplast isolation from pectinase producing fungal strains were investigated including digestion

buffer pH (4.5, 5.5, 6.5, 7.5), Lytic enzyme concentration (2.5, 5, 10 mg \ mL), enzymatic digested

time (2, 3, 4, 5, 6 h), digestion temperature (25, 30, 35 °C) and mycelia age (1, 2, 3, 4, 5 d). These

experiments were established under the following conditions, optimal osmotic pressure stabilizers

(0.6 M potassium chloride), and potent enzyme cocktail at gently shaking 75 rpm.

The basic procedure of protoplast liberation was conducted as follows: mycelia collection

(filtration) then rinsed twice by osmotic stabilizer then pretreatment with thiol compounds.

Enzyme digestion of mycelia. 0.1 g mycelia were suspended in the 10ml enzymatic mixture for

digestion.

The mixture containing lytic enzyme cocktail and osmotic stabilizer was prepared first in PB

buffer, and then sterilized by 0.22 µm of pore membrane and incubated with lytic mixture p at

30°C with gentle shaking till the protoplast started to release. The number of protoplasts liberated

were counted every 30 min.


59

Under a phase contrast light microscope for the liberation of protoplast with a hemocytometer

(when the highest concentration took place, the reaction was stopped). Removal of the undigested

mycelial fragment; residual mycelia fragments in digesting solution were done by different

methods which had to be tested and optimized (filtration/centrifugation).

Figure 2.1: Flow chart representing isolation and purification of protoplast

Cultivation

Mycelia collection

Pretreatment with thiol reagent (DTT and BME)

Digestion (release of protoplast)

Protoplast purification(filttration / centrfugation)

Viability assessment of protoplasts


60

Protoplast purification, protoplasts were purified by washing twice in the osmotic stabilizer the

same with that used in enzymatic digestion, and then the pellets were collected via centrifugation.

It is observed that centrifugation step was considered a very critical step and centrifugation speed

should be optimized. Assessment of protoplasts viability was tested with methylene blue and

observed by phase contrast light microscope. Stain solution was added to protoplast suspension

for 5 min at room temperature Then protoplasts were examined.

2.2.10.3. Protoplast regeneration

Protoplast regeneration procedure is described as follows: the obtained protoplasts were first

centrifuged to remove the osmotic stabilizer, then, the pellet was diluted with 0.6 M sorbitol or

sterile water to about 103, 104 and 105 cells/ml. Plating protoplasts was performed by the addition

of 0.1ml diluted protoplasts into petri dishes (9 cm in diameter) containing 25 ml regeneration

medium and incubated at 30°C for 4 - 10 days.

The regeneration rate was calculated according to the following formula:

Regeneration rate (%) = (A-B) / plated protoplast number × 100%

A: colony number regenerated from protoplasts diluted with 0.6 M mannitol.

B: colony number regenerated from protoplasts diluted with sterile water.

Regeneration of protoplast was studied using different media namely potato dextrose agar (PDA),

yeast malt extract (YME), glucose yeast extract medium (GYE) and breeding minimal peptone

medium (BMP). These media tested either with or without osmotic stabilizer (0.6 M).

Furthermore, different types of osmotic stabilizer (MgSO4, KCl, and sorbitol) are tested as a

supporting agent in regeneration medium.


61

Moreover, the effect of protoplasts obtained from different incubation time (2, 4, 6, 8 h) and

regeneration temperature (25, 30, 35 °C) on recovery rate were evaluated. The culture methods of

protoplasts regeneration were used both in the single layer and double layers culture. In single

layer culture, 50µl of protoplasts suspension was diluted and plated onto the regeneration medium

in petri dishes and incubated.

In double layers culture, the same protoplasts amount was platted on regeneration medium and

covered with 5 ml of the regeneration medium containing 0.7% agar and incubated. The cultures

were incubated until colonies became visible.

The protoplasts regeneration process to visible colonies was observed by microscope or the naked

eye, and photographs were taken.

2.2.10.4. Protoplast fusion

Fusion of protoplasts was induced as described in a previous publication [12] using polyethylene

glycol (PEG). Treatment of protoplast- protoplast mixtures with PEG is the approach typically

exploited to induce protoplasts fusion. Protoplast fusion was performed according to the method

[13] with certain modifications. Schematic diagram represents protoplast fusion and regeneration

step are shown in (Figure 2.2).

The efficacy of different PEG molecular weight (4000–6000) and concentration (30, 40 and 50%

v/v), as well as fusion time (10, 20, 30, 40, 50 and 60 min), were optimized. Fusion procedure can

be summarized as follow: One mL of the protoplast suspension containing 106 protoplasts was

prepared, and an equal number of protoplasts from both parental strains was mixed.


62

Two hundred ml of PEG (PEG with 10 mM CaCl2 and 50 mM glycine buffer pH 5.0) was added

and gently mixed by rolling the tube. Aliquot of 500 ml PEG solution was added and mixed gently

to the fusion mixture again. This step was repeated twice, and the mixture was incubated at 30 °C

for different incubation time (10, 20, 30, 40, 50, 60 min), Osmotic stabilizer (sorbitol 0.6 M) with

volume 1.1 mL of was added and mixed gently. These dilution steps were repeated two times by

adding 2.2 mL of sorbitol (0.6 M).

Figure 2.2: Schematic representation of protoplast fusion and regeneration

Protoplast strain Protoplast strain

Mix equal number of Protoplasts

Centrifugation

PEG treatment

Washing /resuspend in osmotic stabilizer

Plating in osmotic stabilizer regeneration medium

Incubation at 30 ᵒC for 4 – 10 days

Hybrid selection


63

After the fusion and dilution, protoplasts were recovered by centrifugation at 100 g for 1 min and

suspended in 5 ml sorbitol / KCl (0.6 M). A small volume of diluted protoplasts sample was

observed under a compound microscope for fusion. An aliquot (0.1ml) of fused protoplasts was

plated on non-selective medium, complete medium, and minimal medium. After that, plats were

checked for regeneration. For regeneration, complete medium was supplemented with KCl (0.6

M). Fusion frequency was determined by the following equation:

Fusion frequency = No. of regenerated colonies in *RMM

No. of regenerated colonies in **RCM

*RMM: minimal regeneration medium

**RCM: regeneration complete medium

Similar to interspecific (two different species) fusion methods, intergeneric (two different genes)

and intraspecific (within the species) protoplast fusion was also carried out using PEG solution.

Intraspecific fusants served as a control for interspecific protoplast fusion.

2.2.10.5. Fusant identification

Morphological examination (colony morphology and spore color), sporulation time, molecular

methods (intracellular protein pattern and ITS sequence of the nuclear rRNA), antifungal

substances, metal ions resistance, antibiotics resistance, and nutrient requirement (certain amino

acids and purine) were used to identify both parental strains and fusant(s). The isolates grown in

PDA and molasses agar (MA) media to verify the morphology differences, spore color and

following up the sporulation period.


64

Identification was subsequently confirmed by sequencing the Internal Transcribed Spacers 1 and

2 (ITS1-ITS2) of the nuclear rRNA by using the ascomycete-specific primer pair ITS4 and ITS5

(Table2.3). DNA was extracted as previously described by [14].

PCR amplification was performed as described by [15] with minor differences in the thermal

cycling conditions employed. All PCR products were purified using PCR purification kit (Qiagen,

Hilden, Germany) and sequenced on both strands using the primers described above.

After sequencing, the identity of parent and fusant was confirmed. The primer synthesis and PCR

product sequencing were performed by MWG Operon (Eurofins MWG Operon, Ebersberg,

Germany).

Table 2.5

Primer sequence of ascomycete-specific primer pair ITS4 and ITS5

Intracellular protein pattern as another identification marker was also performed. Total intracellular

was extracted from parental, and hybrid strains are growing in PDA medium as a complete

medium. Cells were collected by filtration, washed twice with distilled water and resuspended in

5 mL buffer (0.1 M Tris-base, 33 mg NADP and 1.2 mM EDTA). After that, cells were frozen

using liquid nitrogen and grounded in a mortar.

Internal

Transcribed Spacers

Primer Sequence

ITS4 5′ TCCTCCGCTTATTGATAT GC 3′ ITS5 5′GGAAGTAAAAGTCGTAACAAGG3′


65

Cell debris was removed by centrifugation at 10,000 rpm for 20 min. Protein extract was lyophilized

and stored at -20 °C until used. Total protein content of the lysate was determined by Nanodrop at

260 nm. Vertical SDS-PAGE (7.5 and 12 %) of 20 µg protein was performed for 4h at 100 V [16].

Cells were statically cultured at 30 °C for 4 days. Samples were prepared for 2D gel electrophorisis.

After harvesting by centrifugation at 6000 rpm and 4 °C for 10 min, pelleted cells were washed

with water then resuspended in lysis solution (0.54 gml−1 urea, 0.08 gml−1 CHAPS,2% (w/v)

DTT, 1.4% (w/v) PMSF and 2% pH 3–10 ampholytes). Samples were disrupted by grinding in

liquid nitrogen and then being centrifuged for 30 min at 15,000rpm and 4 °C. Protein

concentrations of the supernatants were determined by Nanodrop. The proteins were stored at −70

°C. The 2-DE gels method was carried out according to Bio-Rad protocol. For examination of

antifungal resistance either in parental strains or the obtained fusant, hypertonic medium and two

antifungal agents were used.

Hypertonic medium was made up of (g/L in distilled water): glucose, 80.0; NH4NO3, 2.0; KH2PO4,

10.0; MgSO4.7H2O, 0.25; FeCl2.6 H2O, 0.02; MnSO4, 0.14 and the initial pH was adjusted to 4.25.

The 5-fluorouracial (FU) and cyclohexamide (CHA) as antifungal substances were used with a

concentration of 10 and 20 µg/mL and 100 and 250 µg/mL respectively.

Metal ions resistance for parental and fused strains was carried out using hypertonic medium

mentioned in the antifungal screening section. Several metal ions (Co++, Cu++, Fe+++, Hg++ and

Zn++) were tested with different concentrations. All metal ions examined with 500and 1000 ppm

except mercury was used at 200 and 300 ppm.


66

The Antibiotics resistance was studied by growing either the parental strain or the fusant on media

containing various types of antibiotic ampicillin, kanamycin, and tetracycline. Serial

concentrations of each antibiotic were tested starting from 150 mg/mL to 300 mg/mL.

Resistance or sensitivity for antifungal, metal ions and antibiotics was used as a selectable marker

to differentiate between the parental strain and the obtained hybrid. Nutrient requirement for

particular amino acids and purine selected as an alternative selectable marker.

Four amino acids (arginine, histidine, cysteine & isoleucine) and adenine with concentration 20

µg/ mL were added to the hypertonic medium. The ability of parental strain and fusant to grow in

the absence of the nutrients were examined.

2.2.11. Biochemical characterizations

To understand the influence of the fermentation process, as well as media composition on the

secreted PDEs, a comparative investigation on enzymes produced by R. pusillus was

accomplished. The obtained data were compared to commercially available pectinase preparations

for the identification of specific pectinolytic enzyme profiles with regard to their applications.

Therefore, a crude extract derived from R. pusillus (Chapter 4 and 5), as well as crude extract

produced by hybrid AR9 (Chapter 6) was analyzed for pectinase activities (PNL, PG, and PMG).

The crude extract produced by both SmF and SSF were dialyzed overnight at 4 °C, using

SnakeSkin® pleated dialysis tubing, 10,000 MWCO (Thermo Scientific, Rockford, USA).

Samples were concentrated to 1.5 mg/mL total protein concentration, using a freeze-dryer and

subjected to further investigations.


67

2.2.12. SDS-PAGE analysis (one dimension)

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was conducted

according to [17] as described in the technical manual for protein electrophoresis [18]. Briefly,

12.5% SDS-PAGE gels with approximately 2 cm stacking buffer zone were cast, and samples run

in constant current mode at 15 mA/gel, and R.T using Mini Protein® 2 C system (BioRad).

Samples were mixed with 2x treatment buffer 2:1v/v and load add up with 10 μL per lane. Protein

bands were visualized, using colloidal Coomassie G-250 staining. Pre-stained molecular weight

marker (Bio labs-P7709V) used for molecular mass determination.

2.2.13. Zymogram (native polyacrylamide gel electrophoresis)

Native PAGE was performed as mentioned in the previous part without adding SDS and DDT into

the gel mixture as in the electrophoresis protocol. The detection of pectinases activity occurs by

acting on polygalacturonic acid or sodium salt or pectin as substrate. Samples were separated on a

native PAGE, and subsequently, the gel was first incubated for 20 min in 0.1 M citrate phosphate

buffer (pH 5.0). Afterward, gels were contacted with a (solid) agar substrate containing 0.25%

(w/v) of each for 50 min or 90 min at 30°C. The agar plate was then treated with 1% (w/v)

ruthenium red which precipitated the substrate and revealed pectinases activity as translucent

bands on a dense background [19].


68

2.2.14. 2D gel electrophoresis

Isoelectric focusing (IEF) first dimension was performed using Dry Strip gels (IPG strips) pH 3-

10 or pH 4-7 strips (GE Healthcare) and 2D-PAGE was done according to the methods settled by

[20]. Each Strip was rehydrated overnight at room temperature in a rehydration buffer containing

8 M urea, 1 % CHAPS, 0.4 % DTT and 0.5 % pharmalyte pH 3-10. Aliquots of 100 μL sample,

containing concentrated protein solution and rehydration buffer in the ratio 1:3, was loaded per

strip, and IEF was performed using a Multiphor II system (GE Lifesciences) and running

conditions were followed as recommended by [21]. This was followed by performing the second

dimension, SDS-PAGE and separation were carried out in the Mini-PROTEAN Tetra cell

electrophoresis system (Bio-Rad Laboratories, Inc.) at constant current (20 mA/gel). The gels were

fixed and stained following the colloidal Coomassie (G-250) as normal staining procedure

(Neuhoff et.al., 1988).

2.2.15. Protein identification using MALDI-TOF

The target spots and bands were manually excised from stained SDS-polyacrylamide gels either

one dimension or 2D and subjected to enzymatical trypsin according to the gel digestion protocol

described by [22]. A 2-μL drop of sample was spotted onto ground steel target (Bruker Daltonics)

and kept for drying down at room temperature. Amount of 1.2 μL of matrix solution (0.7 mg/mL

α-cyano-4- hydroxy cinnamic acid (HCCA) in TA85 solvent (85:15 (v/v) acetonitrile: 0.1 %

trifluoroacetic acid in water)) was added on top of the dried spot and it is left to dry again. MALDI-

TOF MS and tandem MS (MS/MS) sequencing analyses were conducted on an Autoflex II

TOF/TOF mass spectrometer (Bruker Daltonics).


69

The instrument Calibration was performed using an HCCA peptide calibration standard (Bruker,

Daltonics). Bruker Daltonics Flex Analysis and BioTools software were used for Spectra analysis.

Data obtained from MALDITOF and MS/MS analyses (peptide mass fingerprinting and peptide

fragment ion) were used to search for protein candidates in the NCBI database. The correlation of

mass spectrometric data with the sequence database was accomplished by using Mascot (v. 2.0

Matrix Sciences, UK) database searching software.

2.2.16. Application of the enzyme complex in juices clarification

Cloudy pure apple juice was purchased from the local market (beckers bester GmbH, Lütgenrode,

Germany). Enzymatic treatment was performed in a water bath at 50 °C applying one mL of crude

extract per mL of cloudy juice [23].

2.2.17. Identification of Rppnl coding gene

2.2.17.1. Genomic DNA preparation

R. pusillus was grown on PDB for 2 days. Genomic DNA isolation from these mycelia was carried

out according to [24]. The vegetative mycelia (100 mg) were frozen under liquid-N2 and

completely ground with a pre-cooled homogenizer. DNA extraction was carried out as described

before by [25] with some modifications. The ground materials were mixed with 400 μl lysis buffer

before they were incubated at 50°C for 15 min. Subsequently, 0.5 volumes phenol / chloroform /

isoamyl alcohol were mixed with the extract.


70

The nucleic acids were collected in the aqueous phase before being precipitated with an equal

volume of isopropanol. The DNA was centrifuged for 20 min at 12,000 xg. The DNA pellet was

washed twice with 70 % EtOH before it was finally dissolved in 50-100 μl TE buffer.

2.2. 17.2. RNA preparation

For the isolation of total RNA, R. pusillus cultures were grown at 30 ºC for 2 days in PDB medium

on a rotary shaker at 150 rpm. The fungal cells were separated from the medium and immediately

used for total RNA isolation. The sample was homogenized in 1 ml of Trizol and incubated for 5

minutes at room temperature. Two-hundred μl chloroform were added to the samples and

incubated for 3 minutes at room temperature. The samples were centrifuged at 12,000 xg for 15

min at 4°C. The aqueous phase was transferred to a new tube. The aqueous phase was incubated

with 500 μl isopropyl alcohol for 10 minutes at room temperature and then centrifuged at 12,000

xg for 10 minutes at 4°C. The RNA pellet was washed with 1 ml 75% ethanol and dried in air. The

RNA was dissolved in RNase-free water by passing the solution a few times through a pipette tip

and incubating for 10 minutes at 55°C. The concentration of RNA was determined by measuring

the absorbance at 260 nm (A260) in Nanodrop.

2.2.17.3. cDNA synthesis

Reverse transcription was synthesised as described according to the manufacturer specifications

(Fermentas). To remove contaminating DNA which would negatively interfere in quantitative

PCR analysis, a DNase digestion was carried out. Equal amounts of RNA (1 μg) were mixed with

20U Ribonuclease inhibitor, 1U DNase (Fermentas) and 1 μl 10X reaction buffer with MgCl2.

DEPC-treated water was added to the mixture to the final volume of 10 μl.


71

The mixure was incubated for 30 minutes at 37°C. DNase was inactivated by adding 1μl 25 mM

EDTA and incubated at 65°C for 10 minutes. The prepared RNA was used as a template for reverse

transcriptase. Reverse transcription reactions were performed using the RevertAid™ M-MuLV

Reverse Transcriptase with the oligo (dT) 18 (Fermentas) according to the instructions of the

supplier. 1μl of a five-fold dilution of the cDNA was used as template in PCR amplification

systems.

2.2. 17.4. Amplification of Rppnl coding gene

The specific primers for pectolyase coding gene were used for gene amplification. Primer

sequences were:

1- PNL_Fw-NcoI: TTT GTC CAT GGC AGT CGG CGT GTC CGG CTC T (31 (the

forward primer).

2- PNL_Rv-XbaI: TTT GTT CTA GAC ACA GGT TGC CCT GAC CGG C (31 bp) (the

reverse primer).

The PCR reaction was carried out in a total volume of 50 μl containing 1 μl of deoxynucleotides

(dNTP: 10 mM of each) mix, 4 μl of DNA template (70 ng/μl), 2 μl of 100 μM forward primer and

2 μl of 100 μM reverse primer, 5 μl of 10 × PCR buffer, 1.5 μl of Taq DNA Polymerase (New

England Biolabs, Frankfurt Germany), and 34.5 μl of distilled water. The PCR program employed

was as follows: 94 °C for 5 min followed by 40 cycles; 94°C for 30 sec, 55 °C for 30 sec, 72 °C

for 2.5 min and followed by final extension at 72 °C for 2.5 min. The procedure was applied with

certain modification to get the full length of pectolyase encoding gene, using both of genomic

DNA and cDNA from R. pusillus.


72

2.2. 17.5. DNA gel-electrophoresis

Agarose gel (1-2%) was used to electrophoretically separate DNA fragments. Agarose was mixed

with electrophoresis buffer to the desired concentration and then heated in a microwave until

complete melting. Ethidium bromide was added to the gel (final concentration 0.5 μg/ml) to

facilitate visualization of DNA after electrophoresis.

2.2. 17.6. DNA sequencing

The dideoxyribonucleoside chain termination procedure originally developed by [26] was

employed for sequencing the double-stranded purified PCR product. The DNA sequence was

determined by automated DNA sequencing method. The automated DNA sequencing reactions

were performed using ABI PRISM Big Dye terminator cycle sequencing ready reaction kit (PE

applied Biosystems, USA), in conjunction with ABI PRISM (3100 Genetic Analyzer). Cycle

sequencing was performed using Thermal Cycler, and the reaction was conducted in a total volume

of 20 μl containing 8 μl of terminator ready reaction mix, 150ng of PCR product, and 3.2 pmol of

specific Rppnl forward and reverse primers. Alignment of DNA sequences was performed using

the BLASTX comparison with GenBank database.


73

2.3. References

1. Alvarez, E., et al., Spectrum of zygomycete species identified in clinically significant

specimens in the United States. Journal of Clinical Microbiology, 2009. 47(6): p. 1650-

1656.

2. Buyukkileci, O.A., C. Tari, and F.-L. Marcello, Enhanched production of

exopolygalactuonase from agro-based prosucts by Aspergillus sojae. BioResources, 2011.

6(3): p. 3452-3468.

3. Buyukkileci, A.O., C. Tari, and M. Fernandez-Lahore, Enhanced production of exo-

polygalacuronase from agro-based products by Aspergillus sojae 2011. Vol. 6. 2011.

4. Praveen Kumar Ramanujam , S.N., Palani Subramanian, Production of pectin lyase by

solid state fermentation of sugarcane bagasse using Aspergillus niger.pdf. Advanced

Biotech 2008. 30.

5. Nedjma, M., N. Hoffmann, and A. Belarbi, Selective and Sensitive Detection of Pectin

Lyase Activity Using a Colorimetric Test: Application to the Screening of Microorganisms

Possessing Pectin Lyase Activity. Analytical Biochemistry, 2001. 291(2): p. 290-296.

6. Mitchell, D.A., et al., New developments in solid-state fermentation: II. Rational

approaches to the design, operation and scale-up of bioreactors. Process Biochem., 2000.

35(10): p. 1211-1225.

7. Yadav, S., et al., Pectin lyase: A review. Pro.cess Biochem., 2009. 44(1): p. 1-10.

8. Hölker, U. and J. Lenz, Solid-state fermentation — are there any biotechnological

advantages? Curr. Opin. Microbiol,, 2005. 8(3): p. 301-306.

9. Panda, T., G.S.N. Naidu, and J. Sinha, Multipleresponse analysis of pectinolytic enzymes

by Aspergillus niger: a statistical view. Process Biochemsitry, 1999. 35.

10. Nelson, N., Nelson-Somogyi modification colorimetric method for determination reducing

sugar. Journal of Biological Chemistry, 1944. 153: p. 375-380.

11. Bradford, M., A rapid and sensitive method for the quantitation of microgram quantities

of protein utilizing the principle of protein-dye binding. Analytical Biochemistry . 1976.

72: p. 248-254.

12. Davey, M.R., et al., Plant protoplasts: status and biotechnological perspectives.

Biotechnology advances, 2005. 23(2): p. 131-171.


74

13. Anné, J. and J.F. Peberdy, Conditions for induced fusion of fungal protoplasts in

polyethylene glycol solutions. Archives of Microbiology, 1975. 105(1): p. 201-205.

14. Aamir, S., et al., A rapid and efficient method of fungal genomic DNA extraction, suitable

for PCR based molecular methods. 2015.

15. Solís, S., et al., Hydrolysis of orange peel by a pectin lyase-overproducing hybrid obtained

by protoplast fusion between mutant pectinolytic Aspergillus flavipes and Aspergillus

niveus CH-Y-1043. Enzyme and Microbial Technology, 2009. 44(3): p. 123-128.

16. Laemmli, U.K., Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature, 1970. 227.

17. Laemmli, U., Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature . 1970. 227: p. 680-685.

18. AmershamBiosciencesAB., Protein electrophoresis. . Technical manual, 1999.

19. Manchenko, G.P., Handbook of Detection of Enzymes on Electrophoresis Gels. 1994, Boca

Raton: CRC Press.

20. Görg, A., et al., Two-dimensional electrophoresis with immobilized pH gradients for

proteome analysis. Technical University of Munich, 2003. 53.

21. BA, G.H., Instructions 28-9537-55 AA: Immobiline DryStrip. 2009.

22. Shevchenko, A., et al., In-gel digestion for mass spectrometric characterization of proteins

and proteomes. Nat. Protocols, 2007. 1(6): p. 2856-2860.

23. Nakkeeran, E., S. Umesh-Kumar, and R. Subramanian, Aspergillus carbonarius

polygalacturonases purified by integrated membrane process and affinity precipitation for

apple juice production. Bioresource Technology, 2011. 102(3): p. 3293-3297.

24. Al‐Samarrai, T. and J. Schmid, A simple method for extraction of fungal genomic DNA.

Letters in applied microbiology, 2000. 30(1): p. 53-56.

25. Aamir, S., et al., A rapid and efficient method of fungal genomic DNA extraction, suitable

for PCR based molecular methods. Plant Pathology & Quarantine, 2015. 5(2): p. 74-81.

26. Sanger, F., S. Nicklen, and A.R. Coulson, DNA sequencing with chain-terminating

inhibitors. Proceedings of the national academy of sciences, 1977. 74(12): p. 5463-5467.

Chapter 3

Screening and Production of pectin

depolymerizing enzymes using submerged

fermentation mode

Screening and production of PDEs using SmF Chapter 3

76

Abstract

Several zygomycete fungi are industrial producers of enzymes. Pectin degrading enzymes (PDEs)

are one of the potential bioproducts that required production developments. Utilization of

agroindustrial wastes that compose of polysaccharides might serve as a nutrient for protein

synthesis. This work aims to study pectin depolymerizing enzyme secretion by culturing some

zygomycete strains in a medium supplemented with various agroindustrial wastes. Five

zygomycete fungal strains (Mucor circinelloides, M. mucedo, Mucor spp., Rhizomucor pusillus

and R. miehei) were screened for citrus pectin utilization as the sole carbon source. The pectinase

depolymerization activity was confirmed by the ability to precisely form hydrolyzation halos in

assay plates. R. pusillus showed the largest size of the bright halo and the highest pectinase activity.

Polygalacturonase production by submerged fermentation indicated a significant secretion using

different forms and types of inducers (orange peel powder and orange peel extract, and lemon

peel). The cultivation conditions and the influence of the various substrates have been evaluated

on the enzyme secretion. R. pusillus was able to produce polygalacturonase activity DSM1331 and

M. circinelloides DSMI 1175 (as control) using both orange peel powder and orange peel extract

for submerged fermentation (SmF). Utilization of orange peel extract attained a maximum activity

of 28 U/ mL and 30 U/ mL for R. pusillus and M. circinelloides, respectively. R. pusillus display

a compact mycelium morphology during fermentation by orange peel extract as a pellet, which

helps in viscosity reduction and enzyme production enhancement. The crude extract showed a

synergetic secretion effect of different pectin depolymerizing enzymes (PDEs) such as pectin lyase

(PNL) and polymethygalacturnase (PMG). The presences of both PNL and PMG occurred when

orange peel replaced with lemon peel as inducer with values of 80 and 20 U/ mL, respectively and

45 U/ mL of PG. It observed that R. pusillus is better than the other strains and represented a

significant potential for PDEs. The results of the present investigation prove that exo-acting

glycoside hydrolases show a prominent role in pectin degradation. Exploiting this strain for PDEs

secretion would be valuable.


77

3.1. Screening of pectinase enzymes using agar plate cultivation

Five filamentous fungal strains belonging to zygomycete (Mucor circinelloides, M. mucedo,

Mucor spp., Rhizomucor pusillus and R. miehei) were examined for their ability to grow in pectin

as the only carbon source. These strains were screened for pectin hydrolysis by plate assay and

classified as good producers of pectin depolymerizing enzymes when a larger bright halo is

presented. The absence of pectinolytic activity is confirmed when no clear lysis zones were

observed (Figure 3.1).

In the current study, the highest amounts of PG were found to be secreted by R. pusillus that shows

the larger size of the bright halo and significant pectinolytic activity. For this purpose, R. pusillus

has been chosen for further investigations and M. circinelloides DSMI 1175 used as a control for

PG production by submerged fermentation (SmF).

Figure 3.1: Screening for pectinolytic activity of five zygomycete strains (Mucor circinelloides,

M. mucedo, Mucor spp., Rhizomucor pusillus and R. miehei) growing on pectin as a sole source of

carbonPectinolytic activity was determined by the clearing zone around colonies.

M. circinelloides R. pusillus R. miehei M. mucedo Mucor spp.


78

3.2. Degradation of different pectin substances by as a sole carbon source

For clear understanding, the pectinolytic activity of R. pusillus strain was tested for the utilization

of 14 carbon sources that can induce or repress the enzyme secretion. Only in the presence of six

substances (five as agro-wastes materials and one as monosaccharides; wheat bran, sugarcane

bagasse, lemon peel, orange peel, sugar beet and Arabinose), did the strain show an extremely

significant growth (Figure 3.23,4,6,7,11,12). These results reveal the metabolic potential for utilization

as sole carbon sources, as well as induction for PDEs.

On the other hand, some of the monosaccharides and disaccharides showed a catabolic repression

for pectinase secretion, e.g., xylose and sucrose (Figure3.28,13). The moderate growth pattern was

observed for the reaming carbon source as monosaccharides (glucose, galactose, and rhamnose),

polysaccharides (poly galacturonic acid and polygalacturonic acid sodium salt) and commercial

citrus pectin (Figure 3.21,2,5,8,9,14).

Screening of various carbon source substrates gave a better understanding of the fungal cell

metabolic machinery. That helps in the selection of media components and enzyme inducers, as

well as avoiding the catabolic repression effect. It is clear that each fungal strain had an explicit

preference for an individual substrate that correlates pectin degradation mechanism and PDEs that

will be used in the catabolic process [1].


79

Figure 3.2: Coloration between growth pattern and degradation of various carbon source

substrates as relation to pectinase production by R. pusillus. High growth pattern; 3) wheat bran,

4) sugarcane bagasse, 6) lemon peel, 7) orange peel, and 11) sugar beet 12) Arabinose. Moderate

growth pattern; 1) glucose, 2) galactose, 5) rhamnose), 8) poly galacturonic acid and 9)

polygalacturonic acid sodium salt) and 14) commercial citrus pectin. Catabolic repression

pattern; 8) xylose and 13) sucrose.

3 4

7 6

11

12

13

8

2 1

5

14

10 9


80

Based on this information, it is clear that R. pusillus had a significant potential to degrade

several types of pectic substances. As results of the obtained information, different carbon

saucers with high growth potential were selected to be used in the current study under

different fermentation model SmF and SSF (Chapter 4).

3.3. Pectinase production by submerged fermentation

Among fungal enzymes, pectinase enzymes are associated with the development, fruit ripening

and degradation of the pectic substances in the vegetal cell wall. The degradation process plays a

significant role in food technology. This is due to a reduction in filtration time, increasing of

volume and clarification of juice, providing a more stable and concentrated product [2].

For the high demand of pectinase, new producers need to be continuously discovered. The primary

sources of the pectinolytic enzymes are yeast, bacteria and an enormous variety of filamentous

fungi, Aspergillus [3-8]. Over studies with microorganisms, experimental assays proved that the

enzyme synthesis is associated with the quality and concentration of the carbon sources. In this

expanse, research is more progressive with bacteria than with fungi[9].

The investigations of pectinases synthesis from Aspergillus, Fusarium, and Verticillium, among

others, display that it is induced mainly by pectin or pectin associated with other substances. Also,

few Mucor strain were described as pectinase producer [5, 10, 11].

However, Rhizomucor investigations regarding pectinase production are not well known. These

make the current work vital at looking deep to evaluate pectinase production of R. pusillus

DSM1331 as a new pectinase producer.


81

Screening for the optimal fermentation medium (using agricultural by-products as inducers of

pectinase) and cultivation condition, which will affect the morphology in submerged fermentation

(submerged fermentation), should be investigated. First, R. pusillus DSM1331 and M.

circinelloides DSMI 1175 as a wild-type were tested for polygalacturonase activity. For this

reason, several parameters have been optimized such as fermentation temperature, shaking speed

and spore concentration. Furthermore, the effect of pectin inducer substrate such as orange peel

(OP) in the fermentation medium, either as orange peel powder (OPP) or orange peel extract,

(OPE) has been studied. The goal from the last parameter mainly is monitoring the morphology

characteristics for the tested fungi during fermentation that have an indirect effect on enzyme

production and reduction of viscosity in a bioreactor level.

Polygalacturonase activity has been produced by either R. pusillus DSM1331 or M. circinelloides

DSMI 1175 using both OPP and OPE in SmF. The activity was high when orange peel extract was

used to record 30 U/ mL and 23 U/ mL, for M. circinelloides DSMI 1175 and R. pusillus DSM1331

respectively. These represent almost double of the activity when orange peel powder used (Figure

3.3).


82

Figure 3.3: Polygalacturonase activity of Rhizmucor pusillus DSM1331 and using either orange

peel powder (OPP) or orange peel extract (OPE) on submerged fermentation.

Moreover, the fermentation temperature played a real role that affects the enzyme production. The

optimal temperature varied between M. circinelloides DSMI 1175 and R. pusillus DSM1331.

Focusing on R. pusillus, the maximum activity obtained at 30 °C after 4 days of fermentation

(Figure 3.4).

0

5

10

15

20

25

30

35

R.pusilus M.Circinelloides

PGas

act

ivity

U/m

L

Fungal strains

OPP OPE


83

Figure 3.4: Production of PGase by Rhizmucor pusillus DSM1331 using orange peel

extract (OPE) on SmF.

Comparing with literature, the pectinase activity that was obtained by two Mucor strains is a

reasonable start, to be considered as a polygalacturonase producers. Nevertheless, more factors

should be investigated in the fermentation process for the improvement of enzyme production. It

was reported that Thermomucor indicae-seudaticae produced 13.6 U mL-1 of exo-PG in a

submerged culture containing orange bagasse and wheat bran with amount of 10 g L-1 for each

substrate [12].

0

5

10

15

20

25

30

35

0 24 48 72 96 120 144

PGas

e ac

tivity

(U/m

L)

Fermentation time (h)


84

Moreover, M. circinelloides ITCC 6025 produced an extracellular PG enzyme using citrus pectin

as an inducer [13] and under the same optimum culturing temperature [11]. It is important to

conclude that the effect of pectin containing material on the induction of PDEs secretion has been

evaluated by several researcher [4, 14-17] which needs always for further optimization for a

selective inducer.

Considering the morphology, altered growth morphologies varying from compact pelleted to

filamentous forms can be obtained under submerged culture conditions. It was observed that

Mucor grew in mycelial clumps in all current flasks when orange peel power is present. In

contrast, the clump form did not appear when orange peel extract has been used as a base

fermentation medium. Here, mycelial clumps are referred to as a network of entangled mycelia

(Figure 3.5), forming small groups [18]. Pelleted morphology has an advantage of decreasing the

viscosity of the broth, which results in the improving of mixing, aeration of the culture as well as

broth mass transfer properties. [19, 20]. Therefore, the current study demonstrated that some more

extensive work on the factors promoting pellet growth and exo-PG yields needs to be carried out

in future research [9, 21].

It is also recognized that pelleted growth facilitates downstream processing by simplifying solid–

liquid separation. On the other hand, dispersed filamentous morphology is developed when fungus

grows on rapidly metabolized substrates, which may reduce product formation yield and impede

oxygen transfer by increasing the viscosity of the culture fluid. So, broths produced by pelleted

growth are more easily mixed and aerated as compared to filamentous growth [22].


85

Figure 3.5: Stimulation of different morphology forms of Rhizmucor pusillus DSM1331 using

either orange peel powder (OPP) or orange peel extract (OPE) on SmF.

3.4. Effect of lemon peel on pectin depolymerizing enzymes production

Lemon peel powder was used instead of orange peel powder to evaluate the induction effect of

PDEs production in SmF by R. pusillus. As it is presented in (Figure 3.6), the crude extract was

examined for different pectin depolymerizing enzymes, e.g., PNL, PG, and PMG. The highest

activity was obtained at the 4 d of SmF with values of 80, 45 U/ mL and 20 U/ mL PNL, PG and

PMG respectively. The previous study has demonstrated the capacity of R. pusillus to produce

only PG, with value 38 U/mL, by using orange peel as an inducer [5] .

The high level of hydrolytic activity may suggest that the strain has a preference to highly esterified

carbon sources like lemon peel that induce both PNL and PMG. This suggestion is in agreement

with some reports that reveal the importance of high methylated pectin sources for both enzyme

productions [5, 23, 24].

Clump Pellet


86

Pectinase production from orange peel extract and the orange peel powder was compared. The

new procedure using orange peel extract adopted in the current investigation had high

exopolygalacturonase activities proving its commercial production feasibility. The lemon peel is

the by product from the fruit processing industry act as a important source for the pectinase enzyme

production. The current research point will work as first line information to the researchers who

are exploring the possibilities of converting waste to wealth, the concept which is currently

evolving rapidly in the applied science branches from all possible dimensions.

Figure 3.6: Effect of lemon peel as inducer on the secreted PDEs complex in submerged

fermentation (SmF) by Rhizmucor pusillus DSM1331.

0

20

40

60

80

100

PL PG PMG

Act

ivity

(U/m

L)

Pectin degrading enzymes (PDEs)PNL


87

3.5. Conclusion

Several filamentous fungi produce numerous pectinase activities, and such enzymes are used

currently in several biotechnological industries as crude, and usually a well-characterized, mixture.

Rhizomucor pusillus turned out to be a promising pectinase producer when it grows in a medium

containing agroindustrial wastes. R. pusillus was able to unitize different pectin substances than

various Mucor and Rhizomucor strains. It is very useful to utilize such residues for enzymes

production in industrial scale. Citrus peel utilization as a byproduct played an important role for

an essential protein in food industries. In the present study, orange peel extract has high

polygalacturonase activity production compared to orange peel powder. R. pusillus is a source of

numerous enzymatic activities, including PNL, PG, and PMG for depolymerizing pectin

substances. Herein, results show that the established SmF conditions enable the induction of

different pectin depolymerizing enzymes (PDEs) formation. In the presence of lemon peel, a

selection of the various PDEs was stimulated; 80, 20 and 45 U/ mL PNL, PMG, PG respectively.

In conclusion, agroindustrial residues, such as lemon peel and orange peel, induce a significant

level of PDEs by R. pusillus.

These findings can be used to various potential in the food industry which decreases several

process bottlenecks. For example, viscosity reduction which is considered as a dependent element

of the mycelium morphology. Moreover, the utilization of these materials for industrially

enzymatic production would reduce environmental pollution and cost.


88

3.7. References

1. Benoit, I., et al., Degradation of different pectins by fungi: correlations and contrasts

between the pectinolytic enzyme sets identified in genomes and the growth on pectins of

different origin. BMC Genomics, 2012. 13(1): p. 321.

2. Masoud, W. and L. Jespersen, Pectin degrading enzymes in yeasts involved in fermentation

of Coffea arabica in East Africa. International Journal of Food Microbiology, 2006. 110(3):

p. 291-296.

3. Solís, S. and M.E. Flores, Improvement of pectinase production by interspecific hybrids of

Aspergillus strains. Letters in Applied Microbiology, 1997. 24(2): p. 77-81.

4. Sethi, B.K., P.K. Nanda, and S. Sahoo, Enhanced production of pectinase by

Aspergillusterreus NCFT 4269.10 using banana peels as substrate. 3 Biotech, 2016. 6(1):

p. 36.

5. Siddiqui, M.A., V. Pande, and M. Arif, Polygalacturonase production from Rhizomucor

pusillus isolated from fruit markets of Uttar Pradesh. African Journal of Microbiology

Research, 2013. 7(3): p. 252-259.

6. Batool, S., et al., Production and partial purification of pectin lyase by Aspergillus niger

grown on orange peels. African Journal of Microbiology Research, 2013. 7(13): p. 1144-

1149.

7. Uzuner, S. and D. Cekmecelioglu, Enhanced pectinase production by optimizing

fermentation conditions of Bacillus subtilis growing on hazelnut shell hydrolyzate. Journal

of Molecular Catalysis B: Enzymatic, 2015. 113: p. 62-67.

8. Rahmani, N., A. Andriani, and Y.S. Anggraini, Pectinase production by Aspegillus ustus

BL5 at soild state fermentation medium using agricultural biomass Jurnal Teknologi

Indonesia (JTI), 2015. 36(3).

9. Sunnotel, O. and P. Nigam, Pectinolytic activity of bacteria isolated from soil and two

fungal strains during submerged fermentation. World Journal of Microbiology and

Biotechnology, 2002. 18(9): p. 835-839.

10. Alves, M.H., et al., Screening of Mucor spp. for the production of amylase, lipase,

polygalacturonase and protease. Brazilian Journal of Microbiology, 2002. 33: p. 325-330.


89

11. Thakur, A., et al., Production, Purification, and Characterization of Polygalacturonase

from Mucor circinelloides ITCC 6025. Enzyme Research, 2010. 2010: p. 7.

12. Martin, N., et al., Pectinase production by a Brazilian thermophilic fungus Thermomucor

indicae-seudaticae N31 in solid-state and submerged fermentation. Microbiology, 2010.

79(3): p. 306-313.

13. Ahmed, I., et al., Bioprocessing of citrus waste peel for induced pectinase production by

Aspergillus niger; its purification and characterization. Journal of Radiation Research and

Applied Sciences, 2016. 9(2): p. 148-154.

14. GÖĞÜŞ, N., et al., Evaluation of orange peel, an industrial waste, for the production of

Aspergillus sojae polygalacturonase considering both morphology and rheology effects.

Turkish Journal of Biology, 2014. 38(4): p. 537-548.

15. Martin, N., et al., Pectinase production by fungal strains in solid-state fermentation using

agro-industrial bioproduct. Brazilian Archives of Biology and Technology, 2004. 47: p.

813-819.

16. Heerd, D., et al., Pectinase enzyme-complex production by Aspergillus spp. in solid-state

fermentation: A comparative study. Food and Bioproducts Processing, 2012. 90(2): p. 102-

110.

17. Heerd, D., S. Diercks-Horn, and M. Fernández-Lahore, Efficient polygalacturonase

production from agricultural and agro-industrial residues by solid-state culture of

Aspergillus sojae under optimized conditions. SpringerPlus, 2014. 3(1): p. 742.

18. Reichl, U., R. King, and E.D. Gilles, Characterization of pellet morphology during

submerged growth of Streptomyces tendae by image analysis. Biotechnology and

Bioengineering, 1992. 39(2): p. 164-170.


polygalacturonase from agro-based products by Aspergillus sojae. BioResources, 2011.

6(3): p. 3452-3468.

20. Jayani, R.S., S. Saxena, and R. Gupta, Microbial pectinolytic enzymes: a review. Process

Biochemistry, 2005. 40(9): p. 2931-2944.

21. Nyman, J., et al., Pellet formation of zygomycetes and immobilization of yeast. New

Biotechnology, 2013. 30(5): p. 516-522.


90

22. Tari, C., N. Dogan, and N. Gogus, Biochemical and thermal characterization of crude exo-

polygalacturonase produced by Aspergillus sojae. Food Chemistry, 2008. 111(4): p. 824-

829.

23. Damásio, A.R.d.L., et al., Biotechnological potential of alternative carbon sources for

production of pectinases by Rhizopus microsporus var. rhizopodiformis. Brazilian

Archives of Biology and Technology, 2011. 54(1): p. 141-148.

24. Nadaroglu, H., et al., Production of a novel pectin lyase from Bacillus pumilus (P9),

purification and characterisation and fruit juice application. Romanian Biotechnological

Letters, 2010. 15(2): p. 5167-5176.

Chapter 4

Pectolyase production using by Rhizomucor

pusillus DSM 1331: Solid-state fermentation

optimization and pilot studies

Pectolyase production using R. pusillus: SSF Chapter 4

92

Abstract

Several pectin degrading enzymes are produced by microorganisms and have tremendous

potential in the numerous industries. Amongst these, pectin lyase (PNL) catalyze the

depolymerization of esterified pectin by a β-elimination mechanism. PNL have extensive

applications, mainly in the extraction and clarification of juices and wines. They are the only

recognized pectinases which are capable of cleaving high esterified pectins (present in fruits)

into small molecules without formation of methanol. In the present study, the extracellular PNL

secretion by Rhizomucor pusillus DSM 1331 in solid state fermentation (SSF) were conducted

in a flask and rotating drum bioreactor. Different raw materials (lemon peel, wheat bran,

sugarcane bagasse, orange peel and sugar beet powder) were used in various combinations to

optimize the fermentation medium and enhance process efficiency. Moreover, the influence of

enzyme production process parameters; temperature, pH, inoculum size, time, and moisture

content was evaluated. The optimized results showed that pectin lyase reached a maximal

activity of 100 U/g and a specific activity of 45.24 U/mg. The highest value obtained when the

medium contains 3.25 g wheat bran, 1 g lemon peel powder, and 0.75 g sugarcane bagasse were

used. The highest activity was obtained at 120% moisture level, 30°C and 5 days of SSF. The

optimized mixture used for scaling up study in a laboratory rotating drum type solid-state

bioreactor (RDB). The process promotes PNL production with a maximum productivity of

20,000 at intermitted rotating conditions. The production process corroborates the effectiveness

of the investigated strain to produce PNL on inexpensive fermentation substrates mixture

contains lemon peel and sugarcane bagasse that induces enzyme secretion as well as improves

process operation. The biochemical characteristics of the attained enzymatic extract can be

useful for altered industrial applications.


93

4. 3. Solid-state fermentation for pectolyase production

Microbial enzymes receive industrial demand, and they are continuously exploited in the

market. Rhizomucor pusillus being an industrially necessary organism, produces an extensive

variety of extracellular enzymes including carbohydrate degrading enzymes viz.cellulases,

amylase and pectinases. Only four reporters were published for polygalacturonase

productionas a member of pectinases [1-3] while no data is available for the PNL production

by R. pusillus.

Pectin lyase (PNL) has biotechnological potential mainly in fruit industries. This is due to the

fact that it degrades the pectin without disturbing the ester bond which responsible for the aroma

of juice. Also, it does not cause to methanol formation which is toxic [4-6]. R. pusillus was

previously screened selected as pectinase producer (Chapter 3).

The influence of the type of carbon sources as an inducer for PNL secretion was evaluated and

the selection of the test materials based on the screening that was conducted in Chapter 3

(section 3.2). In the previous section, wheat bran, sugarcane bagasse, lemon peel, orange peel,

and sugar beet had a potential effect on R. pusillus growth. These agro-waste materials were

selected to design the fermentation mixture for optimal PNL production.

In light of these points, this study investigated the effect of different pectin coontaing waste as

a substrate to induce PNL production by R. pusillus growth. The interaction between a good

mixture of the tessed substrate is expected to enhance both fungal growth, protien synthesis and

enzyme secretion. Furthermore, experimental design and statistical tools were employed to

investigate the effects of these parameters and their interactions with each other.


94

The current study not only serves as a basis for the combination of all the aforementioned

parameters, but also introduces a new strain. To the best of our knowledge, this strain has not

been previously considered for this purpose in biotechnology.

4. 3.1. PNL production at flask scale

In the current study, the effect of process parameters and medium composition was investigated

to increase PNL secretion in solid-state fermentation by R. pusillus as a new PNL producer. The

enzyme production was evaluated based on the use of a different mixture of agricultural wastes

in order to valorize the biotechnological potential of low-cost substrates. Wheat bran, sugar

beet powder, lemon peel powder, orange peel powder and sugarcane bagasse were used by

varying amount of each substrate. This is offering the optimal cultivation conditions under SSF.

In addition to medium composition, relevant SSF parameters such as temperature, pH, inoculum

size, moisture content (at dry basis moisture level) and incubation time, were tested. Initially,

PNL activity in the presences of orange peel as inducer showed lower values in comparison

with lemon peel (data not shown). For that reason, the study was completed with lemon peel

only.

4.3.1.1. Screening

In the first stage, temperature, pH, inoculum size, time, and moisture content were evaluated

for finding the optimal PNL production level (Table 4.1). The results showed that both of pH

and temperature have no influence on increasing the PL production. Indeed, at high values of

pH or temperature, the enzyme activity decreases with increasing the fermentation time (3 and

4 U/mL, respectively).


95

At day 3 of cultivation, the activity at pH 3 was 22.07 U/mL. In contrast, an increase of pH to

8 at the same time period; the pectolyase activity value was decreased to 16.78 U/mL and

reached. The positive effect of low pH value reveals less contamination environment.

Table 4.1

Experimental variables ranges [temperature (ᵒC), pH (-), inoculum size (spore/mL), time (day)

and moisture content (% water/100 g substrate)] for the first screening step and the experimental

results of PNL production (U/g) by R. pusillus using solid-state fermentation.

Assay

Coded variables

Responses

Temperature (ᵒC)

pH (-)

Inoculum size

(spore/mL)

Time (day)

Moisture content

(%water/100 g substrate)

Pectin lyase

production (U/mL)

Pectin lyase

production (U/g)

X1 X2 X3 X4 X5 *Y1 *Y2 1 30 3 104 3 60 22.07 44.14 2 50 3 104 9 160 3.34 6.68 3 30 8 104 9 160 3.34 6.68 4 50 8 104 3 60 4.90 9.80 5 30 3 107 3 160 8.69 16.78 6 50 3 107 9 60 6.16 12.32 7 30 8 107 9 60 5.46 10.92 8 50 8 107 3 160 16.24 32.48 9 40 5 105 6 110 9.75 19.50 10 40 5 105 6 110 12.28 24.56 11 40 5 105 6 110 10.16 20.32 12 30 3 104 9 60 4.73 9.56 13 50 3 104 3 160 4.36 8.72 14 30 8 104 3 160 13.82 27.64 15 50 8 104 9 60 12.43 24.86 16 30 3 107 9 160 3.81 7.62 17 50 3 107 3 60 25.08 50.16 18 30 8 107 3 60 13.64 27.28 19 50 8 107 9 160 4.51 9.02

*Y= experimental value for pectin lyase production


96

For inoculum size parameter, there was no significant influence of (p<0.05), with a value of

0.433 on the enzyme production. Thus, the condition for the second screening stage, inoculum

size, pH, and temperature were fixed to as followed 105 spores/mL, 3 and 30 °C, respectively.

The obtained conditions were relatively similar to PNL derived from A. niger in SSF except the

pH value was 6, that can be correlated to strain nature as well as medium composition [7]. The

interaction between both time and moisture on PNL activity was significant at (p<0.05), with

values of 0.048 and 0.049 respectively. For that reason, the range of these two factors was

modified in the next step to evaluate the effect using a wider level.

The second part of the screening, after SSF parameters selection, was to assess the impact of

different kinds of substrates and concentration (Table 4.2). The results showed that the use of

wheat bran as a sole substrate source was directly influenced by the increase in moisture level.

A highest significant stimulation of PNL production was 38 U/mL with 120% (water/100g

substrate); in contrast the value of 17 U/mL with 60% (water/100g substrate).

Moreover, it was observed that the PNL activity decreased more than 50% by increasing the

fermentation time to 12 days from the maximum value of 22 U/mL after the day 4 of SSF. Since

the moisture content is a vital parameter in SSF system [8], it was proven that high moisture

levels decrease the substrate porosity as well as reduce oxygen transfer. However, the low level

may lead to a limitation on nutrient availability and increase the metabolic heat accumulation

[9]. These facts were in line with the obtained results which revealed the significant influence

of moisture level on PNL production.


97

Table 4.2

Experimental conditions used for PNL production (U/mL and U/g) by R. pusillus via solid-state

fermentation according to experimental design. Coded ranges of variables [percentage of

medium substrates (wheat bran, sugarcane bagasse, sugar beet powder and lemon peel) time

(day) and moisture content (%water/100 g substrate)] and results in values obtained from the

second screening experiments stage.

Assay

Coded variables

Responses

Wheat bran

(%)

Sugarcane bagasse

(%)

Sugar beet

powder (%)

Lemon peel (%)

Time (day)

Moisture content

(%)

Pectin lyase

production (U/mL)

Pectin lyase

production (U/g)

X1 X2 X3 X4 X5 X6 Y1* *Y2 1 1 0 0 0 4 60 22.32 44.64 2 0 1 0 0 4 60 9.11 18.22 3 0 0 1 0 4 60 16.01 32.02 4 1 0 0 0 12 60 17.47 34.94 5 0 1 0 0 12 60 5.09 10.18 6 0 0 1 0 12 60 9.29 18.58 7 1 0 0 0 4 120 38.14 76.28 8 0 1 0 0 4 120 12.98 25.96 9 0 0 1 0 4 120 18.34 36.68

10 1 0 0 0 12 120 28.05 56.10 11 0 1 0 0 12 120 12.61 25.22 12 0 0 1 0 12 120 20,69 41.38 13 0.5 0.5 0 0 8 90 43.71 87.42 14 0.5 0 0.5 0 8 90 32.33 64.66 15 0.5 0 0 0.5 8 90 29.01 58.02 16 0 0.5 0 0.5 8 90 26.68 53.36 17 0.5 0.25 0.25 0 8 90 60.21 120.42 18 0.5 0.25 0 0.25 8 90 52.30 104.60 19 0.5 0 0.25 0.25 8 90 39.14 68.27 20 0 0.5 0.25 0.25 8 90 28.08 56.16 21 0.5 0.5 0 0 8 90 43.37 86.74 22 0.5 0 0.5 0 8 90 32.22 46.44 23 0.5 0 0 0.5 8 90 29.63 59.26 24 0 0.5 0 0.5 8 90 26.08 52.16

*Y= experimental value for pectin lyase production


98

The effect of a combination of wheat bran and three more inducers with different percentage,

denoted a diametric influence in the improvement of enzyme secretion. The highest activity was

60 U/mL when wheat bran, sugarcane bagasse, and sugar beet powder were used. While the

combination of wheat bran, sugarcane bagasse, and lemon peel showed 52 U/mL a moisture of

90%water/100g after day 8.

Furthermore, the treatments with sugarcane bagasse and lemon peel without wheat bran at the

same moisture level and incubation time showed a PNL activity decreases by more than half

(26.60 U/mL). These results demonstrate the importance of the wheat bran addition in the

optimized mixture. The dominant presence of wheat bran in this mixture was already described

for enhancing microbial growth and enzyme production in filamentous fungi by SSF system

[10].

4.3.1.2. Optimization

In the first optimization step, the interactions effect among the narrowed ranges of time (4, 6

and 8 days) and moisture content (80, 100, and 120 % water/100% substrate) on PNL activity

were evaluated. The interaction also included the influence of different inducer mixtures with a

constant amount of wheat bran as represented in (Figure 4.1). The results obtained with the

lowest moisture level (80% water/100% substrate) showed the highest activity (70 U/mL at six

days) in the presence of the maximum amount of lemon peel. The values followed by the

addition of sugar beet powder and sugarcane bagasse (Figure 4.1a2). As the increase of

sugarcane bagasse, sugar beet decreases, a remarkable increase in PNL activity to 80 U/mL was

obtained at a moisture content of 100% water/100% substrate, demonstrated after 8 days

(Figure 4.1 b2).


99

Figure 4.1: Interaction among different substrate combinations (lemon peel powder, sugar beet

powder and sugarcane bagasse and wheat bran with constant amount) with three moisture

content (80,100, and 120%) and three fermentation times (4, 6, and 8 days) on pectin lyase

production by Rhizomucor pusillus in SSF.

a1 a2 a3

c1

b3

c3

b2 b1

c2

PNL

U/g


100

The sugarcane bagasse had a supportive influence and inner carrier role that was similar to the

results mentioned by [11]. These impacts give a proficient environment for oxygen and nutrient

distribution as well as decrease in accumulation of metabolic energy.At moisture level (120 %

water/100% substrate), maximum PNL activity was 90 U/mL after 6 days of fermentation.

Under these conditions, the lemon peel was the best inducer with the mixture containing the

highest amount of sugarcane bagasse and the lowest amount of sugar beet powder (Figure

4.1.c2,).

The other residues tested showed about half of the activity of the carbon sources previously

mentioned. It clearly observed that utilization of agricultural pectin-containing wastes is well

known for the industrial pectinase production. However, the synergetic role of this mixture

(wheat bran, lemon peel, and sugarcane bagasse) has a potential effect of stimulating PNL

secretion. The current outcome occurred by providing several advantages for the fermentation

process e.g. the induction effect, a nutrient source, and effective porosity. All of these values

that enhance fungal growth, as well as enzyme production with less oxygen uptake, mass

transfer, and heat transfer drawbacks.

In the second stage, lemon peel plus sugarcane bagasse mixture demonstrated that the maximum

activity obtained without the addition of sugar beet. The response surface graph (Figure 4.2)

showed a rise on PNL production to100U/mL (200U/g) at 120 % moisture content at 5 days of

SSF. The enhancement happened when the fermentation medium contains the previous

inducers plus wheat bran. These results of high enzymatic production are due to a close contact

of the fungal mycelia with the carbon source. It has also been proved that most researchers

utilized wheat bran for carbohydrate degrading enzymes production because it contains

sufficient nutrients [12].


101

Previous studied revealed that the presence of inducer substrates like orange peel, lemon peel

and apple pomace is important for pectin degrading enzymes (PDEs) production by SSF.

Both lemon peel and orange peel record an essential role in PNL production [13]. The

maximum activity (100 U/g) attained by R. pusillus using lemon peel as an inducer is higher

than the produced value by R. oryzae 17.17 U/g when orange peel was used [14]. Furthermore,

the obtained activity was closer to PNL produced by A. niger (229 U/mL) utilizing sugarcane

bagasse and nutrient solution after 7 days of SSF [7].

Figure 4.2. Response surface plot illustrates the effect of moisture level (80-120%) and

fermentation time (4-8 days) on PNL production (U/g) by R. pusillus in SSF. The fermentation

mixture is fixed as wheat bran (0.65 = 3.25g), lemon peel powder (0.25 = 1.25g) and sugarcane

bagasse (0.1= 0.50g). The enzyme activity was at the lowest value at the blue color, and it

increases significantly in the direction of the red color.


102

It is importantly observed that lemon peel worked as the best inducer for PNL stimulation in

comparison with other pectin sources (e.g. orange peel, sugar beet and sugarcane bagasse). This

conclusion is in agreement with results described by [15] that reported the highest activity was

attained when lemon peel alone was used as an inducer in SmF with a value of 88.57 U/mg in

comparison with several organic and synesthetic pectin sources. However, the enzyme activity

was 35.08 U/mg with sugarcane bagasse, 12.18 U/mg with wheat bran and 0.001 U/mg orange

peel powder. These data support the importance of the optimized mixture in the study of high

enzyme induction and secretion.

4.3.1.3. Modeling

The model showed a data adjustment with R2 of 0.89 and a lack of fit of 0.063 indicating that

the model was significant with the obtained experimental data. The experimental values had

resulted in enzyme production of 100 U/mL PNL whereas the model predicted a production of

107 U/g that indicates the data obtained by performing validation experiments were in good

agreement with the predicted responses under optimized media and fermentation conditions.

A multiple linear regression analysis (MLR) was done to fit the polynomial equation to the

experimental data points. The pectin lyase production (Y) was correlated with the independent

variables; time (Xt), moisture (Xm), wheat bran (Xwb), lemon peel (Xlp), sugarcane bagasse (Xsc),

sugar beet (Xsb) as well as their interactions. According to the ANOVA results, variables were

identified as significant factors, leading to the following equation:


103

= 77.81 + 1.28 + 2.82 − 3.66 − 6.08 − 0.033 + 0.71 − 10.16 − 1.81

− 0.82 − 2.83 − 5,21 + 2.78 − 0.84 − 2.39

− 1.16 + 1.23 + 2.47

Evaluation of the screening and optimization results showed that induced substrates, moisture

content, and time, as well as their combinations, significantly affected PNL secretion in the

crude extract. Also, the interactions between all above-mentioned parameters had significant

influences on enzyme production. In conclusion, the optimal conditions established after the

sequential screening and optimization study were 30 °C temperature, 105 spores/mL inoculum

size, moisture level 120 %, 5 days, pH 3 and a medium mixture containing wheat bran, lemon

peel, and sugarcane bagasse. These conditions were tested at the scale of study.

4. 3.2. Culture profile of PNL production in SSF at Flask scale

The cultivation profile of R. pusillus at the flask scale is presented in (Figure 4.3). PNL

secretion started slowly in the first two days of fermentation reaching 18.23 U/g. At the same

period, a significant decrease was seen in the carbohydrate and protein concentration, while the

medium pH is slightly increased. The diametric decrease of both carbohydrate and protein can

be related to fungal growth and mycelium formation. At the third day of cultivation, the activity

had increased more than 50% in comparison with the second day.

The maximum peak of enzyme production was observed at the 5th day with a value of 100 U/g.

This coincided with an increase in total protein concentration which was noticed at the same

time. The enzyme productivity was calculated as 20 U/g/d.


104

Figure 4.3. Cultivation profile shows the dramatic change in the soluble protein concentration

(mg/g), total carbohydrate concentration (mg/g), pH in the crude extract (-) and PNL activity

(U/g) during the solid state fermentation process by R. pusillus at the flask level using the

optimized condition for PNL production.

The total carbohydrate consumption was observed to be significantly decreased from the 1st day

and reached to 8.01 mg/g at the end of the fermentation period. The uptake of carbohydrate can

be correlated to the fungal growth as well as the synthesis of metabolic products. The pH values

measured in the extracts were increased by the extension of fermentation period to reach (6.86)

on the 5th day and slightly decreased at the last day of cultivation to (6.41).

Carbohydrate concentration


105

4. 3.3. PNL enzyme production in SSF bioreactor scale

The fermentation process was scaled up by increasing the fermentation biomass 200 times more

of the dry substrate containing wheat bran, lemon peel powder, and sugarcane bagasse powder

in amounts of 675, 250, and 75g respectively. The fermentation conditions in a rotating drum

type solid-state bioreactor (RDB)-Terrafors-IS, Infors HT, were based on the optimal valued

obtained in shaking flask experiments. The data in (Table 4.3) shows a comparison chart with

the operational SSF conditions and enzyme productivity values achieved by R. pusillus at both

culture flask and bioreactor level. The obtained PNL productivity at the bioreactor level was

0.92 fold compared to the flask level (33.33 and 30.83 U/g/d, respectively).

Table 4.3

A comparison study of solid-state fermentation is scaling up the process for PNL production by

R. pusillus at flask and bioreactor level.

Parameters

Flask

Bioreactor

Substrate (g) 5 1000

Scale up ratio 1 200

Agitation Manual shaking* Intermittent mixing **

Aeration (L/min) --- 2

PNL activity (U/g) 100 95.63

Productivity(U/g/d) 20 19.13 *Agitation twice for 5 min manually **Agitation twice at the day of inoculation and every day during fermentation period (1rpm/10min)


106

Herein, the enzyme production was increased for several reasons; firstly the of effect substrate

mixture that induces both fungal growth and protein section. Secondly, the moderate amount of

moisture content which revealed the availability of nutrients, protein diffusion, sufficient

oxygen uptake and less metabolic energy accumulation.

Finally, the physical properties of the RDB have relatively easy operating advantages in order

to control individual parameters mainly temperature, mixing rate and aeration. These

parameters are significantly critical in increasing pectin lyase production and give more

advantage to RDB over other bioreactors like tray bioreactor [16, 17]. Extracellular PNL was

produced by A. niger NCIM 548 using batch bioreactor, and the maximum activity was 0.0091

U under optimized conditions[18]. It is important to mention that in literature, studies on PNL

production at bioreactor scale is not well investigated which gives this work a remarkable

addition to the scaling up processes.

In conclusion, the obtained results revealed that R. pusillus seems to be a microorganism able

to produce PNL in both systems (flask and bioreactor). The utilization of optimized medium

based on agricultural residues for PNL production was successfully proved at the bioreactor

level. The combination of cost reduction, efficient process operation, and high productivity by

the investigated strain are promising for large-scale production.

4. 3.4. Culture profile of PNL production in SSF bioreactor scale

As it is shown in (Figure 4.4), through the course of SSF, soluble carbohydrate was degraded

from 25.06 mg/g to 8.01 mg/g showing extensive use of the existing carbon and energy (C/E)

source for both biomass and product synthesis.


107

The total protein content decreased at the beginning of the fermentation from 6.75 mg/g at the

1st to 3.98 mg/g until the 3rd day of cultivation. But from the 4th day of cultivation, the protein

secretion was higher than the degradation of soluble proteins (4.72 mg/g), and it reached to 5.78

mg/g at the last day of fermentation process. The increasing protein concentration could show

the production of extracellular enzymes. The pH of the crude extract was increased during the

time development of the fermentation process from 4.87 at the 1st day to 6.41 at the last day of

cultivation.

Figure 4.4. Cultivation profile shows the dramatic change in the soluble protein concentration

(mg/g), total carbohydrate concentration (mg/g), pH in the crude extract (-) and PNL activity

Carbohydrate concentration


108

(U/g) during the solid state fermentation process by R. pusillus at the bioreactor level using the

optimized condition for PNL production.

Regarding the pH of the crude extract, in bioreactor study, it is observed that pH values starting

from the 3rd day of fermentation are a bit higher and reached to 6.86 in the peak of PNL

production. At the same point in flask experiment, the pH recorded a value of 5.6. The increase

in the pH value at bioreactor may be due to the accumulation of the metabolic products with the

decrease of the moisture content by the end of the fermentation process.

In comparison between the cultivation profile of flask scale and bioreactor scale, it is observed

a slight difference in higher values of PNL activity, protein concentration, and the pH of the

crude extract until the 5th day of cultivation. The increase of PNL activity in the bioreactor

during the first 5 days can be correlated to the rise of the aeration inside the bioreactor while

the oxygen amount inside the flask was limited during the fermentation process.

As the oxygen rate is improved, the growth of fungal mycelia increased which affects the protein

secretion. The previous point can experimentally prove by the increase of the soluble protein

concentration. From the obtained results, it is revealed that protein concentration in the

bioreactor process was enhanced in compersion with the protein concentration at flask

experiments.

A comparative evaluation of the operational parameters at laboratory vs. pilot scale processing

is presented in Table 3. R. pusillus, when cultivated in a solid-state bioreactor, was able to

produce 95.65% of the enzyme produced at laboratory scale (e.g. 20 U/g/d vs. 19.13 U/g/d).

Therefore, the production was maintained upon scale-up.

Several reasons could explain this behavior. Firstly, the effect substrate mixture has that induces

both fungal growth and protein synthesis; secondly, the adequate amount of moisture content


109

which facilitated the availability of nutrients and oxygen uptake; thirdly, the technological

environment provided by the bioreactor with strict control over process parameters

(temperature, mixing rate and aeration).

Since process parameters are critical to enzyme production, the implementation of a fully

controlled drum bioreactor can outperform other common cultivation strategies [19]. Several

bioreactors have been used for pectinases production. For instance, fixed bed column bioreactor

was used for PG and PMG using solid substrate cultivation [20], column-try bioreactor [21] and

rotating drum bioreactor [22]. However, the pilot scale process in pectinases production is still

challenging due to the operational difficulties and process complication.

In rotating drum bioreactor (RDB), the airflow rate shows a significant effect on enzyme

activity, which increases when aeration is used rather than a static environment. At low

agitation, the best results of exo-PG were observed, while more frequent agitation could destruct

the fungal cultures as a consequence of the forces during mixing [22]. The same observation

was obtained in the current result when an intermediate agitation was used as described by [23].

The effect of the air flow in a rotating drum bioreactor to enhance the production of cellulases

and hemicellulases [23, 24]. The results revealed that high aeration is preferred for both biomass

and enzyme production.

For PNL production at bioreactor scale, lemon peel has been used as an inducer in Batch and

fed-batch bioreactor by Debaryomyces nepalensis [25, 26]. Also, extracellular PNL was

produced by A. niger NCIM 548 using batch bioreactor, and the maximum activity was 0.0091

U under optimized conditions [27].


110

It is important to mention that in the open literature, studies on bioreactor scale-up for PNL

production are not well investigated. The gained results make the current study and edition in

the up-scaling production for PNL fermentation.

In comparison with a typically defined medium designated in the literature for PNL production,

the highest PNL production was observed when the medium was composed of a mixture of

WB, SC, and LP. The maximum production of PNL was reached after 5 days of cultivation. In

conclusion, the results obtained in this work revealed that R. pusillus reveals to be a

microorganism able to produce PNL in SSF. The utilization of an optimized medium based on

agricultural residues for PNL production was successfully proved at bioreactor level.

The system can be easily scaled-up. The combination of cost reduction, efficient process

operation, and high productivity by the investigated strain are promising for large-scale

production. Moreover, it is important to reference that no other publications are published about

PNL and PMG production by R. pusillus or other research groups.

4.4. Conclusion

Rhizomucor pusillus had a new potential for extracellular PNL secretion in solid-state

fermentation (SSF). It is important to mention that no literature had been reported on the PNL

production and optimization by R. pusillus. Maximum activity was achieved of 100 U/mL with

45.24 U/mg specific. The optimized mixture that was used contains wheat bran, lemon peel

powder, and sugarcane bagasse. The highest PNL activity was obtained at 30 °C, 120%

moisture level and 5 days of SSF.


111

In a laboratory rotating drum type solid-state bioreactor (RDB), the maximum productivity was

obtained using the optimized mixture with a value of 1800 U/Kg/d, taking into account the

synergetic effect of this combination in process operation. The achieved results also claim novel

information on the PNL production as well as adding a significant investigation in scale up

studies using RDB. The obtained enzyme complex proposes a new enzyme mixture which can

be applied in juice and wines applications or other industrial processes like pectin extraction,

coffee fermentation, and oil extraction. It was also shown that total liberation of pectin sugars,

without any decomposition can be achieved by combination of a multi-enzymatic system. This

gives a significant potential of the secreted protein by the current strain. The organism used in

the present study will be further considered for protein characterization, protein identification

and strain development, and is currently in research.

4.5. References



Research, 2013. 7(3): p. 252-259.

2. Siddiqui, M., V. Pande, and M. Arif, Production, purification, and characterization of

polygalacturonase from Rhizomucor pusillus isolated from decomposting orange peels.

Enzyme research, 2012. 2012.

3. Maleki, M.H., et al., Screening of some Zygomycetes strains for pectinase activity.

Journal of Microbiology and Biotechnology Research, 2017. 1(2): p. 1-7.

4. Khan, M., E. Nakkeeran, and S. Umesh-Kumar, Potential application of pectinase in

developing functional foods. Annual review of food science and technology, 2013. 4: p.

21-34.


112

5. Sharma, N., M. Rathore, and M. Sharma, Microbial pectinase: sources, characterization

and applications. Reviews in Environmental Science and Bio/Technology, 2013. 12(1):

p. 45-60.

6. Semenova, M.V., et al., Use of a preparation from fungal pectin lyase in the food

industry. Applied Biochemistry and Microbiology, 2006. 42(6): p. 598-602.

7. Ramanujam, K.P., N. Saritha, and S. Palani, Production of pectin lyase by solid state

fermentation of sugarcane bagasse using Aspergillus niger. Adv. Biotechnol. J., 2008.

30(30-33).

8. Gervais, P., Water Relations in Solid-state Fermentation, in Current Developments in

Solid-state Fermentation, A. Pandey, C. Soccol, and C. Larroche, Editors. 2008,

Springer New York. p. 74-116.

9. Pandey, A., Solid-state fermentation. Biochem. Eng. J., 2003. 13(2–3): p. 81-84.

10. Thomas, L., C. Larroche, and A. Pandey, Current developments in solid-state

fermentation. Biochem. Eng. J., 2013. 81(0): p. 146-161.

11. Pandey, A., et al., Biotechnological potential of agro-industrial residues. I: sugarcane

bagasse. Bioresource Technology, 2000. 74(1): p. 69-80.

12. Bhargav, S., et al., Solid-state Fermentation: An Overview. Chem. Biochem. Eng. Q.,

2008. 22(1): p. 49-70

13. Yadav, S., et al., Pectin lyase: A review. Pro.cess Biochem., 2009. 44(1): p. 1-10.

14. Hamdy, S.H., Purification and characterization oof Pectin Lyase Rhiops oryzae. Ann.

Microbil., 2005. 55(3): p. 205-211.

15. Damásio, A.R.D.L., et al., Biotechnological potential of alternative carbon sources for

production of pectinases by Rhizopus microsporus var. rhizopodiformis. Braz. Arch. of

Biol. and Technol., 2011. 54: p. 141-148.

16. Durand, A., Bioreactor designs for solid state fermentation. Biochem. Eng. J., 2003.

13(2–3): p. 113-125.

17. Lonsane, B.K., et al., Engineering aspects of solid state fermentation. Enz. Microbial

Technol., 1985. 7(6): p. 258-265.

18. Panda, T. and G.S.N. Naidu, Rotating simplex method of optimization of physical

parameters for higher production of extracellular pectinases in bioreactor. Bioprocess

Engineering, 2000. 23(1): p. 47-49.


113

19. Durand, A., Bioreactor designs for solid state fermentation. Biochemical Engineering

Journal, 2003. 13(2): p. 113-125.

20. Linde, G.A., et al., Column bioreactor use for optimization of pectinase production in

solid substrate cultivation. Brazilian Journal of Microbiology, 2007. 38: p. 557-562.

21. Héctor A. Ruiz , et al., Pectinase production from lemon peel pomace as support and

carbon source in solid-state fermentation column-tray bioreactor. Biochemical

Engineering Journal 2012. 65: p. 90-95.

22. Diaz, A., et al. Solid state fermentation in a rotating drum bioreactor for the production

of hydrolytic enzymes. in Icheap-9: 9th international conference on chemical and

process engineering, Pts. 2009.

23. Kalogeris, E., et al., Performance of an intermittent agitation rotating drum type

bioreactor for solid-state fermentation of wheat straw. Bioresource Technology, 2003.

86(3): p. 207-213.

24. Kalogeris, E., et al., Design of a solid-state bioreactor for thermophilic microorganisms.


25. Gummadi, S.N. and D.S. Kumar, Optimization of chemical and physical parameters

affecting the activity of pectin lyase and pectate lyase from Debaryomyces nepalensis:

a statistical approach. Biochemical Engineering Journal, 2006. 30(2): p. 130-137.

26. Gummadi, S.N. and D.S. Kumar, Batch and fed batch production of pectin lyase and

pectate lyase by novel strain Debaryomyces nepalensis in bioreactor. Bioresource

Technology, 2008. 99(4): p. 874-881.

27. Panda, T. and G. Naidu, Rotating simplex method of optimization of physical parameters

for higher production of extracellular pectinases in bioreactor. Bioprocess and

Biosystems Engineering, 2000. 23(1): p. 47-49.

Chapter 5

Genome shuffling: a new strategy for enhancing

pectin depolymerizing enzyme production by

Rhizomucor pusillus DSM 1331

Genome shuffling: a new strategy for enhancing PDEs by R. pusillus Chapter 5

115

Abstract

The goal of this study is to develop a firsthand Rhizomucor pusillus strain as a filamentous

fungal strain for enhancing pectinase productivity. Genome shuffling (GS) have been applied

by protoplast fusion between Rhizomucor pusillus DSM 1331 and Aspergillus sojae ATCC

20235 (UV mutant). The optimum conditions viz. lytic enzymes, mycelium age, osmotic

stabilizers, and regeneration medium were determined for protoplasts formation. Fusion factors

viz. fusogen, osmotic stabilizer, pH, the incubation period and regeneration medium, the fusion

frequency were optimized. A promising intergeneric hybrid AR9 was obtained using

polyethylene glycol as fusogen agent through three rounds of genome shuffling. Morphological

and genetic markers were used for the confirmed fusant formation. AR9-fusant acquired the

ability to produce polygalacturonase (PG) and utilize various carbon sources in comparison

with the wild-type R. pusillus by submerged fermentation (SmF) with orange peel. AR9-fusant

was able to obtain 45 U/mL of PG. The PG activity of AR9-fusant was similar in the presence

of 2-deoxyglucose (2DG), which means that the fusant has acatabolic repression resistant

against 2DG. The Hybrid was able to secret different pectinases, e.g., PNL, PG, and PMG when

lemon peel used as an inducer by both SmF and solid state fermentation (SSF). The maximum

activities were 149.3, 37.7 and 51 U/mL, PNL, PG, and PMG, respectively using SmF. SSF,

the highest values were 579.7, 32 and 141 U/g, PNL, PG, and PMG, respectively. The AR9-

fusant presented PDEs cocktails that can exploit in different food industries. Since there are no

such studies reported to date, this study considered as a powerful tool for extending the

application of genome shuffling in inter-kingdom genome shuffling for filamentous fungi

breeding. Also, it opens a new area in pectinase research in developing stable hybrids with

desirable features to meet the current market demand for the enzyme. Increasing industrial

applications underline the importance of developing genetically improved strains, such as the

AR9-fusant, with the potential to be exploitable for large scale production of these enzymes.

Genome shuffling: a new strategy for enhancing PDEs by R. pusillus Chapter5

116

5. Strain development

Improvement of filamentous fungi strains depends on a more proficient production process and

superior final product quality. Nevertheless, fungi genetic improvement is very challenging and

needs more effort in reaching a significant improvement. In early studies applying traditional

genetic approaches encountered many problems. Therefore, development of metabolic

engineering strategies successfully introduced several preferred properties into different

industrial strains especial when the genome sequences in not existing. Genome shuffling is one

of the metabolic engineering approaches which aims to improve a filamentous fungi phenotype.

Based on this strategy, it is necessary to optimize protoplast liberation systems, with high

regeneration rate, and high fusion frequency, since all these will affect the genetic and viability

characteristics for the target phenotype as well as the strategy efficiency.

5.1 Establishment of protoplast isolation, purification, regeneration system

5.1.1 Protoplast isolation, purification

The isolation of protoplast from microbial cells involves the complete digestion of the cell wall

by enzymes. The digestion step allows the cell contents to be enclosed by plasma membrane

without any damage or bursting. Also for survival as intact structures, the protoplast must be

released into a hypertonic medium. Different cell wall lytic enzymes are commercially used for

protoplast isolation from filamentous fungi. Focusing on fungal mycelia, the used lytic enzymes

still are ineffective because of the complex cell wall structure of filamentous fungi and the

physiological status of the organism at the time of protoplasting. The protoplasting time is a

major factor in determining protoplast yield and quality.


117

This part aims to establish a protocol for optimizing a maximum number of isolated protoplast

that has high regeneration capability. For that, several factors have been optimized. Concerning

the cell wall lytic enzyme from Trichoderma harzianum (Sigma-Aldrich), utilization of each

enzyme separately did not affect protoplast releasing; this results similar to [1]. The addition of

chitanase has significantly affected the liberation process of protoplast by increasing the yield

to 1.2 Protoplast ×105 cell/mL. The positive influence of chitanase could be a reason because

of the cell wall structure, which consists of a glucan/chitin complex [2].

Another possibility to increase the protoplast yield is by the addition of β-glucuronidase and

hemicellulase for 2.5 mg/mL lytic enzyme and chitinase; this will increase the protoplast yield

to 2.1 protoplasts ×106 (Table 5.1a). The results presented in (Table 5.1b) showed that the

maximum release of protoplast accrued by using 5 mg/mL of the lytic enzyme.

It has noted that the released protoplasts increased with raising lytic enzyme concentrations.

Although the utilization of very high level (more than 10 mg/ mL) was damaging that results in

protoplast lysis soon after and significantly toxic levels [3]. It is an important observation that

pretreatment of mycelia by some sulfur compounds influences the structure of cell wall, which

would become flexible or more sensitive to the enzyme. In the present experiment, mycelium

was treated with 2-mercaptoethanol, and its preparation frequency of protoplasts was enhanced.

It was stated that when the mycelium treated with 2-mercaptoethanol, cells could easily break

which is propitious to preparation protoplast [4]. The data confirmed in the current study. All

the considered factors influence protoplast release. Among of them, lytic enzyme concentration,

mycelia age, digestion buffer pH and osmotic stabilizer seemed to have a more significant effect

and play a critical role in protoplast release.


118

Table 5.1

Optimization of protoplast formation process a) Different enzyme mixtures effect on Yield

protoplast ×105 cell/mL b)Lytic enzyme concentration (mg/mL) influence on protoplast

formation from fungal mycelia incubated at 30 °C and pH 5.5 for 6 h in the presence of KCl

(0.6 M) as osmotic stabilizer (results shown represent the mean of three replicates ± standard

divisions).

a) Lytic enzyme cocktail

*ND: not detected

b) Lytic enzyme (Trichoderma harzianum) concentration (mg/mL)

Alternative enzyme cocktail

Protoplast Yield (×105protoplasts/ml)

Lytic enzyme (Trichoderma harzianum) ND *

Chitinase ND *

L.E + Chitinase 1.2

Hemicellulase ND *

β-glucuronidase ND *

Lytic enzyme + Chitinase + β-glucuronidase 1.8

Lytic enzyme + Chitinase + β-glucuronidase + Hemicellulase 21

Enzyme

concentration

Yield protoplast (×105protoplasts/ml)

4.5 5.7±0.5

5.5 8.8±0.4

6.5 7.1±0.4

7.5 6.1±0.3


119

The optimal duration of lytic enzyme treatment differs among fungal species and also within

the strain. Since the age of the mycelium plays a major role in the release of protoplast, an

experiment was carried out to determine the optimum age of the mycelium for the liberation of

protoplast. Maximum release of protoplast occurred from 18- 24 h old mycelium at 6 h of

incubation (Figure 5.1.I). With further increase in age (e.g., 2 or 3 days), the mycelia released

less number of protoplasts. Old mycelia are not ideal for efficient, and easy protoplast release

and the obtained protoplasts are hardly regenerated into mycelia due to bad quality

(Balasubramanian et al. 2003). Moreover, mycelia concentration influences the protoplasting

process. The protoplast release was much less when the mycelia amount above 100 mg as fresh

weight, while either 50 mg or 100 mg was suitable for high protoplast yield when it controlled

with digestion time.

However, the increase in mycelia concentrations also makes protoplast recovery more difficult.

The reason could be that the presence of undigested mycelia is high [5]. The osmotic pressure

stabilizers are another important component to consider in the choice of lytic enzymes. The

osmotic pressure stabilizers can keep the balance of interior and exterior osmotic pressure of

the protoplasts, which have lost the protection of cell wall, and can prevent the protoplasts

bursting. So, the selection of the optimal osmotic pressure stabilizer is a very important

parameter.

Up to now, for a particular fungus, there is no reasonable explanation about a kind of chemical

reagent that is more suitable as an osmotic pressure stabilizer than another. However, there is a

general assumption that inorganic salts are more effective with filamentous fungi, and sugar

and sugar alcohols with yeasts and higher plants.


120

Figure 5.1: I) Isolation of protoplasts from fungal mycelia in the presence of lytic enzyme from

Trichoderma harzianum + chitanase+ β-glucuronidase + hemicellulase and osmotic stabilizer KCl (0.5

M) incubated at 30 °C and pH 5.5 (a) partial lysis of mycelia (b) crude protoplast after 6 h incubation (c)

purified protoplast (arrow indicates protoplasts). II) Protoplast formation process from fungal mycelia

incubated at 30 °C and pH 5.5 for 6 h, a) effect of osmotic stabilizer type (0.6 M) (b) effect of lytic

enzyme concentration (c) incubation temperature. Values are mean of the triplicate ± standard division.

0

2

4

6

8

10

MgSO4 KCl Sorbitol Sucrose KCl +Sorbitol

Prot

opla

st y

ield

per

×(1

06)

Osmotic stablizer

0

2

4

6

8

10

2.5 5 10

Prot

opla

st n

umbe

r×(1

06 )

Lytic enzyme concentration(mg/mL)

02468

10

25 30 35Prot

opla

st n

umbe

r×(1

06 )

Temperature (°C)

a

b

a

c

b

(I) (II)


121

In this study, four osmotic stabilizers were tested for their efficacy in releasing protoplast from

A. sojae mycelia. A maximum number of protoplasts was obtained when recombination

between KCl and sorbitol was used 8.8 × 106 (Figure 5.1.IIa).

The optimal duration of lytic enzyme treatment may differ among fungal species and also within

the strain. For that, this experiment finds out the optimum digestion time required for maximum

protoplast release. The highest release occurred after 6 h incubation under the experimental

conditions (Figure 5. 1. IIb).

As the incubation time rose up, the protoplast number decreased, this may be because of

protoplasts bursting immediately after release due to the toxic contaminates presence. The

temperatures examined for the optimal number of released protoplast were 25, 30, and 35 °C.

A high frequency of protoplast release was noted at 30 °C with 0.6 M KCl as an osmotic

stabilizer (Figure. 5.2c).

The effect of digestion medium pH has a significant impact on protoplast formation. Protoplast

yields measured at pH 4.5, 5.5, 6.5, and 7.5, the maximum yield of protoplast was observed at

pH 5.5 (Table 5.2) which was suitable than the other tested pH values. This means acidic pH

produced a good amount of protoplast than neutral and alkaline once.

The optimal condition for protoplast liberating was to incubate 24 h old mycelia and amount 50

mg fresh weight at 30 °C for 6 h in the mixture of pH 5.5 containing lytic enzyme cocktail and

KCl plus sorbitol as an osmotic stabilizer. The protoplast concentration gained by different

factors was different, with a range of 2.9 × 106 - 8.8 × 106 protoplasts/ml. This system was

successfully applied in several filamentous fungi strains belonging to Aspergillus sp. and Mucor

sp. genera with certain modifications.


122

Table 5.2

Results represent the effect digestion medium with different pH values (4.5, 5.5, 6.5 and 7.5)

on protoplast formation from fungal mycelia. Results shown represent the mean of three

replicate ± standard divisions).

5.1.2 Protoplast regeneration

Protoplast regeneration offers a relative property in enzyme treatment and cell viability. The

lack of recovery is presumably either because of the lack of or damage of nuclei at some point

during the digestion treatment. In some cases, protoplast release and regeneration improved

with increasing age of the cultures. The effect of unclear or the old cells would probably be the

less plasticity and therefore less capable of responding to the stresses induced during protoplast

formation. The protoplasts assessed for their ability to regenerate into actively growing fungal

colonies on agar medium. For optimizing regeneration conditions, four factors osmotic

stabilizers, regeneration medium, regeneration temperature and protoplast type obtained from

different digestion periods were examined.

pH

Yield protoplast

(×105protoplasts/ml)

4.5 5.7±0.5

5.5 8.8±0.4

6.5 7.1±0.4

7.5 6.1±0.3


123

The culture medium is responsible for adequate protoplast regeneration, for that several

regeneration media (PDA, BMP, GYE, and YME) were tested. Data in Table 5.3a and Figure

(5.3) revealed that PDA medium showed the highest regeneration rate 2.5 %, followed by BMP

with regeneration rate 1.8 %. The results revealed that the two media PDA and BMP were

preferable in regenerating protoplasts. Three osmotic stabilizers were used in medium to

regenerate protoplasts. Both of 0.6 M KCl and sorbitol (0.6M) presented the highest

regeneration rate (2.3 and 1.9%) while, 0.6 M MgSO4.7H2O provided zero of regeneration rate,

which suggested that MgSO4.7H2O were not adapt to act as an osmotic stabilizer in regenerating

protoplasts (Table 5.3b). When fused protoplasts were inoculated in osmotically stabilized

media, a part of the population underwent cell wall regeneration, reverting to normal mycelium.

Table 5.3

Factors affecting protoplast, a) type of regeneration medium (PDA: Potato Dextrose Agar

medium, YME: Yeast Malt Extract, GYE: Glucose Yeast Extract medium and BMP:

Breeding minimal peptone medium) b) type osmotic stabilizer. Values are mean of triplicate

± standard division

a) Type of regeneration medium b) Type osmotic stabilizer.

Osmotic stabilizer

Regeneration rate

(%)

MgSO4.7H2O 0±0:0

Sorbitol 1.9±0.3

KCL 2.3±0.6

Medium

Regeneration rate

YME 1.5±0.2

PDA 2.5±0.1

GYE 1.2±0.1

BMP 1.8±0.3


124

The duration of mycelium incubation with lytic enzyme for protoplast release has a significant

effect on protoplast regeneration as well as the incubation temperature for protoplast after

spreading on the regeneration medium. For this reason, the previous parameters had been

investigated. Protoplasts regeneration rate obtained both from different digestion time, and

regenerated at various temperatures, seemed to have significant differences (Figure 5.2a and

b).

Figure 5.2: I) Effect of different osmotic stabilizer (0.6M) supplemented to PDA medium

on protoplast regeneration. II) Factors affect protoplast regeneration from fungal mycelia (a)

duration of mycelium incubation with lytic enzyme (b) regeneration temperature. Results

shown represent the mean of three replicate ± standard divisions.

a

b

0

1

2

3

25 30 35

Reg

enra

tion

rate

(%)

Temperature (°C)

0

1

2

3

2 6 6 8

Reg

enra

tion

rate

(%)

Digestion time (h)

PDA+ KCl PDA+ sorbitol

PDA+ MgSO4 PDA

(I) (II)

a

b


125

In conclusion, the optimum regeneration conditions were to regenerate protoplasts isolated from

6 h of incubation in PDA medium supplemented with either KCl or sorbitol with the same

morality 0.6 M as an osmotic stabilizer at 30 °C.

5.2 Application of genome shuffling using a protoplast fusion

The proficiency of genome shuffling is associated with the efficiencies of formation, fusion

and protoplasts regeneration of recombination between heterogeneous chromosomes in the

diploid or multiploid cells obtained after fusion, and of the eventual segregation of right

prototrophs containing only one genome [6].

This explains why the previous part is considered as so critical and essential for the successful

of genome shuffling approach. Protoplast fusions were performed between A. sojae Mutant 5-

6 (UV mutation) and Mucor sp. or R. pusillus DSM1331 or A. sojae IMI 191303 (wild-type).

The parental strains were protoplasted, the same amount of each protoplast was mixed,

suspended in PEG solution for different incubation time and plated on PDA medium

supplemented with KCl (0.6 M). Fusants were isolated and recultured on PDA and BMP

minimal agar medium supplemented with 0.6 M KCl as shown in (Figure 5.3). The latest

medium worked as a selective medium for pectinase fusant, since the sole carbon source is

pectin [5]. Fusion frequency was expressed as the ratio of the number of fusant cells to the

number of initial cells. Different PEG concentrations tested for protoplast fusion. Low

concentrations of PEG (< 30%) did not steady the protoplasts, and the protoplasts got burst

whereas 40% PEG was observed to be an optimal level. Further increase of PEG concentration

resulted in shrinkage of the protoplasts.


126

The optimum fusion frequency was about 1.5-1.7 x 10 3 per initial cell. Effect of exposure time

with PEG on interspecific fusion also examined. PEG treatment for 20 min recorded supreme

fusion frequency. Increasing exposure time of PEG caused loss of viability of protoplasts due

to dehydration associated with protoplast rupture According to all protoplast fusion types

results (interspecific, intraspecific and intergeneric) was carried out by 40% PEG with pH 7.5,

at 30 °C, and 20 min incubation.

In the present work, intraspecific fusion was used to relate and characterize the interfusant and

parental strains. Once the regeneration started, the growth of mycelium was observed after 4

days on fungicides adjusted medium.

The non-fusant colonies did not regenerate with a long cultivation period of more than 4 days.

They slowly started reviving after 5 days, and their growth was very slow. In contrast,

Intraspecific fused protoplasts began to regenerate after only 2 days of incubation at 30 °C on

selective medium. Fusant colonies chosen based on the fast growth, sporulation and transferred

to PDA medium with fungicides, antibiotics and heavy metal which used as selectable markers.

The resistance fusant colonies were sub-cultured and examined for pectinase activity. Also,

some amino acids and purine deficiency as a growth requirement for parental and fusant have

been developed. Referring to pectinase activity three of the obtained fusants could be detected

as pectinase producers that can consume pectin as a sole carbon source in a pectin-containing

medium. These three fusant named as AM fusant, AR9-fusant and 3A fusant (Figure 5.3).


127

Figure 5.3: Regeneration of selected fusants on PDA medium supplemented with 0.6 M

KCl.

5.2.1 Isolation of haploid segregations

Diploids were induced to haploid by treatment with fluorophenylalanine (FPA). Spores of the

diploid strain were inoculated on complete medium containing fluorophenylalanine (100

mg/mL) as a haploidizing agent [7] and incubated for 7-21 days at 30 °C. Isolates from haploid

sectors grown on complete medium containing fluorophenylalanine for another 7-10 days. This

treatment repeated for four cycles. Haploid sergeants were sub-cultured on complete minimal

medium supplemented after successive strain purification.

The nutritional requirements of the obtained segregants (Arg, His, and Met), antifungal

resistance, heavy metals resistance and antibiotic-resistant were determined for phenotypic

characterization. Also, ribosomal RNA sequences to amplify the ITS1 region, as a genetic

marker have been done to compare between fusant and parental strains.

R. pusillus A. sojae Mutant 5-6

Mucor sp. A. sojae Mutant 5-6

A. sojae IMI 191303 A. sojae Mutant 5-6

3A Fusant AR9 Fusant AM Fusant


128

In an attempt to investigate haploidization of the heterozygous diploid, and if it is possible to

improve their enzymes productivities, as mentioned above FPA was used as the haploidizing

agent. The three obtained fusants were treated with FPA. Spontaneous segregation of the

heterozygous diploid has been done. In several trails, some of the haploidized strains were

randomly isolated, and pectionase activity (polygalacuronae) was examined. Regarding

productivity, one segergant comes from AR9-fusant, represent an improvement in enzyme

productivity with the effect of haploidization process.

It recorded that after the third cycle of haploidization PG activity increase about three times

more than the original fusant (starting from 13 U/mL reaching to 50 U/mL), while the effect of

fourth haploidization trials was not that high since the activity only increase to represent 60

U/mL.

The result means through several haploidization trials using FPA, some improved strains

presenting high productivity were obtained (Figure 5.6). These results were in similarity with

[8]. The results demonstrated the objective and significance of the protoplast fusion system,

which could successfully be used to develop a hybrid strain in filamentous fungi that lack sexual

reproduction.


129

Figure 5.4: Segregation of fusant obtained from R. pusillus DSM1331 and A. sojae

ATCC20235 Mutant 5-6 (on minimal medium containing fluorophenylalanine as haplodizing

agent: a) Fused without haploidization 13 U/mL PG activity, b) 1st haploidization, c) 2nd

haploidization 23 U/mL PG activity, d) 3rd haploidization 50 U/mL PG activity and e) 4th

haplodization 60 U/mL PGase activity.

This conclusion supported by results of [8] which represent a pectin lyase overproducing hybrid

was obtained by protoplast fusion between Aspergillus flavipes and Aspergillus giveus for

hydrolysis of orange peel. Also, recombinant strains to cellulases production were generated by

protoplast fusion between Penicillium echinulatum and T. harzianum [9].

The resulting fusants showed faster and higher secretion of cellulases in solid-state cultures in

comparison to the parental strains. The current data is more evidence that the application of

genome shuffling for strain improvement and generating better industrial strain is confirmed.

a b c

d e


130

It is also an important explanation in the differences between PG activity of parental strain

fusant that R. pusillus DSM1331 have less activity than as a natural wild-type and the

fermentation medium also not a much suitable environment for high production. For that, the

coming goal is to establish an optimal fermentation condition for R. pusillus DSM1331 and

compare with the obtained fusant. The creation of some mutant from R. pusillus wild type is a

significant element which can affect a powerful point in the breeding system.

Another important illustration of these differences is the growth behavior of filamentous fungi

during the submerged fermentations. It is well known that the fungal culture exhibits two major

morphologies, as pellet or mycelia, which are much determined by several environmental and

genetic factors (strain type, pH and composition of the media, inoculation ratio, inoculum type,

agitation speed, aeration rate and genetic factors of the culture).

Pellet morphology is desired usually in fermentations and downstream processing due to the

non-viscous rheology of the broth [10]. Out of this present work results, R. pusillus as a wild-

type forming a clump that is unfavorable morphology that can decrease the strain productivity.

On the other hand, fusant was closer to mutant 5-6 as both are forming pellets (Figure 5.5). It

is reported that four strains enhanced acid tolerance and l-lactic acid volumetric productivity of

Lactobacillus rhamnose was after three rounds of genome shuffling based on the recursive

protoplast fusion [11].


131

Figure 5.5: Fermentation behavior of Mutant 5-6, R. pusillus, and fusant

5.2.2. Fusant identification and characterization

5.2.2.1. Morphology and sporulation

Colony morphology has been used to classify interspecific and intergeneric fusion products

especially if the species differ considerably in colony morphology (Mrinalini, 1997). The

parental colonies of Mutant 5-6 were cotton, and dark-white color completely cover the surface

of the culture plate, with greenish spore color and grew as a small pellet in the liquid medium.

R. pusillus parental colonies were very tiny; thin white mycelia and spread in the whole plate

with black spore color and forming a clump in the liquid medium. The fusant culture also

showed faster growth compared to the parents (Figure 5.6). These observations coincide with

the results observed on fused protoplasts of Pichia stipitis interspecific crosses. A possible

reason for such a variable and slightly regeneration frequency is the absence of the nucleus in

the released protoplasts.

Mutant 5-6 R. pusillus Fusant


132

It has been reported that Potato Dextrose Yeast Extract Agar (PDYEA) medium with 0.6 M

KCl served as a good regeneration medium for T. harzianum protoplasts in which the fusant

showed a faster growth rate when compared to parents [12].

A high percentage of protoplast regeneration in PDYEA medium amended with 0.6 M KCl, as

opposite to PDYEA without osmotic stabilizers was found by [13]. The previous result also

supports the important role of osmotic stabilizers as a critical parameter. The fusant colonies

were dark greenish-white color and produced small discrete mycelia in the liquid medium. The

differences are represented in (Figure 5.6). It is an important observation to regard the

differences in sporulation period that record 5-7 days for the parental strains and 3-4 days for

fusant.

Figure 5.6: Morphology difference between R. pusillus, Mutant 5-6 as parental strain and

fusant:a) R. pusillus, b) Fusant and c) Mutant 5-6

5.2.2.2. ITS amplification and sequencing

Identification included comparison of fungal strains (parental and fusant) polymerase chain

reaction (PCR) amplicons of the ITS1–5.8S–ITS2 ribosomal DNA region. Amplification of the

complete ITS1, 5.8S, and ITS2 regions of the ribosomal DNA gene was achieved using primers

ITS1 and ITS4 (Figure 5.7).

b a c


133

Forward and reverse ITS sequences were used to construct a single sequence of each isolate

examined. Alignments of the obtained sequences showed that AR9-fusant returned scores with

high similarity Aspergillus oryzae with 95% and 82% to the genus Mucor. The obtained fusant

is more close to Mutant 5-6 than to R. pusillus, and this gives more evidence that the protoplast

fusion may have resulted in the genetic interaction that gives rise to the inherited genetic

material in hybrid colonies. Several researchers used the molecular identification to compare

between the parental strained and the generated fusants [14-17].

Figure 5.7: ITS1–5.8S–ITS2 ribosomal DNA PCR amplicons of Mutant 5-6, R. pusillus and

fusant: P1- Mutant 5-6, P2- R. pusillus, F- fusant, M- DNA marker.

5.2.2.3. Intracellular protein electrophoresis profile

Mycelial protein pattern analysis by electrophoresis is used as one of the markers for the

identification of fusant. Polymorphisms found in proteins, as one of the molecular markers,

have significantly facilitated the analysis of relatedness between parents and fusants and are

also extremely informative.

M P1 F P2 P1 F P2


134

The presence or absence of protein bands between the parents and the hybrids (fusants) confirm

the hybrid formation. Protein pattern variation was much used for detecting the genetic variation

through evolution and denoted the genetical relationship of parents with their progeny. The

current technique is known in the comparison between several fungal strains [18, 19].

In the present study, the protein polymorphism of fusant was identified using electrophoresis

technique based on separation of proteins. For instance, the 43 and 28 kDa proteins expressed

in R. pusillus were also expressed in the protoplasmically fused hybrid; similarly, the 58 and 25

kDa proteins present in Mutant 5-6 were strongly expressed in the fusant (Figure 5.8. and Table

5.4).

Table 5.4

Intracellular protein pattern for parental strains and fusant

Band

number

P1

R. pusillus

F

AR9 fusant

P2

Mutant 5-6

1 - + +

2 - + +

3 + + +

4 - + +

5 + + -

6 + + -

7 + + +

8 + + +

9 + + +

10 - + +

11 + + -

12 - + +

13 - + +


135

The results showed the relatedness of protein polymorphism between parents and the fusant. In

the similarity with morphological and molecular methods, this analysis is helpful for confirming

the formation of new hybrid and was considered more close to Mutant 5-6 than R. pusillus.

Figure 5.8: Mycelial protein profile of fungal strains: P1- Mutant 5-6, P2- R. pusillus, F- fusant

and M- Protein marker.

5.2.2.3. Screening for some specific enzymes

Specific enzyme screening was assayed on agar plates, using pectin, carboxymethylcellulose

(CMC), starch, gelatin and CaCl2/Tween 80 as substrates for polygalacturonase, pectin lyase,

carboxymethylcellulase (CMCase), and lipase, respectively. For instance, fusant exhibited

carboxymethylcellulase activity with the production of polygalacturonase enzymes (Table 5.5).

kDa P1 F P2 M P1 F P2

175

80

58

46


136

These enzymes influence olive oil quality, and their use is permitted in some countries because

they increase the antioxidant activity of phenol compounds, conferring protective properties.

The presence of phenolic compounds influences the prolongation of oil shelf life. They are also

important from a technological standpoint because they increase yield by hydrolyzing olive

cell-wall polysaccharides. The obtained hybrid and their enzymes could be used in different

industries that could employ biotechnological processes for bioconversion, and the use of

agricultural by-products. Also, it could provide benefit for protein production in the various

sectors. For that purpose, quantification of the enzymatic activities with a chief industrial

application, pectin lyase, carboxymethylcellulase and lipases needed for further investigations.

Table 5.5

Enzymatic activity of Mutant R. pusillus, 5-6 and fusant

Enzyme

Fungal strain

Parent 1

R. pusillus

Parent 2

Mutant 5-6

Fusant

(AR9)

PGase + ++++ +++

PNLase + + +++

Amylase ++ + ++

CMCase ++ ++ ++++

Lipase + ++ ++++

Protease +++ ++++ ++ (+) weak activty - (++) moderate - (+++) high - (++++) strong


137

5.3. Pectinase production profile of AR9-fusant

5.3.1 Polygalacturonase

The time course of polygalacturonase production of the shuffled strains was analyzed using

Rhizomucor pusillus DSM 1331 as a control. The results showed that the wild-type strain and

the shuffled strains showed a close trend in the 5-day submerged fermentation period, except

for the level of cellulose production at the 5th day of fermentation (Figure 5.9). Enzyme activity

in both strains increased continuously during fermentation, reaching a maximum at 4 days and

then decreasing with increasing fermentation time only in case of the wild-type strain.

Moreover, genome shuffling proved to be a successful technique in eukaryotic microorganisms,

efficiently improving the production activities of PGase within a short period.

Figure 5.9: Time course for PGase production of AR9-fusant. The data were

from three replicates ± SD for each data point.

0

15

30

45

60

75

0 24 48 72 96 120 144

PG a

ctiv

ity (U

/mL

)

Fermentation time (h)


138

6.4. Secretion of pectin depolymerizing enzymes using lemon peel as an inducer

The pectin depolymerizing (PDEs) mixture produced by AR9-fusant was investigated. The

obtained strain showed a significant behavior in the production of different types of pectinase

under different fermentation models. The Hybrid was able to secret varied pectin

depolymerizing enzymes involved; pectin lyase (PNL), polygalacturonase (PG), and

polymethylgalacturonase (PMG), when lemon peel was used as an inducer by both submerged

(SmF) and solid state fermentation (SSF). Both fermentation models showed an efficient system

for enhancing enzyme production. It is observed that the ratio between PNL, PG, and PMG

relatively fluctuated.

In SmF, the maximum activities were 149.33, 37.67 and 51.00 U/mL, PNL, PG, and PMG

respectively (Figure.5.10a). On the other hand, the highest values were 579.67, 32.00 and

141.00 U/g, PNL, PG, and PMG respectively by SSF (Figure 5.10b). The fusant can produce

PDEs by utilization of lemon peel as a key inducer in SmF and mixture with wheat bran and

sugarcane bagasse in SSF. This explains the importance of lemon peel in a medium composition

that plays a primary role in PNL production.

In comparison with results in chapter 3 and 4, it has to be noted that the hybrid showed a greater

potential than R. pusillus (wild type) for the production of PDEs in both fermentation models.

It is also important to indicate that this is the first report for strain development by genome

shuffling for R. pusillus in pectinase production. Also, it is a new study of PNL and PMG

secretion under different fermentation models using R. pusillus. In comparison to other PDEs

producers, the present cocktail activities suggested that the hybrid offered an attractive

alternative to PDEs preparations that can be exploited in different food industries.


139

Figure 5.10: Effect of fermentation model on PDEs complex (PNL, PG, and PMG)

produced by AR9-fusant by (a) Smf (b) SSF with the influence of lemon peel as an

inducer.

0

20

40

60

80

100

120

140

160

Act

ivity

(U/m

L)

Pectin depolymerizing enzymes (PDEs)

PL

PG

PMG

a. SmF

0

100

200

300

400

500

600

700

Avtiv

ity (U

/g)

Pectin depolymerizing enzymes (PDEs)

PL

PG

PMG

b.SSF

PNL

PNL


140

5.4. Conclusion

Currently, protoplasts are an important biological tool in both classical and molecular genetics.

For this reason, it is crucial that an efficient and reproducible protoplast protocol be developed

for the fungi under study. Herein, a novel high-throughput protocol for isolation of protoplast

from Rhizomucor pusillus DSM 1331 mycelium, a potential industrial strain, was optimized.

The present findings with fine-tuned and precise information of protoplasts release, inter,

intrafusion and regeneration would immensely be useful in the strain improvement. The mycelia

were digested by enzyme mixture using lytic enzyme from Trichoderma harzianum 5mg as the

main digestion enzyme with a decrease in concentration of more than half compared with other

literature.

The protoplasts were purified and then regenerated by different culture media. The results

showed that regeneration frequency was better on PDA medium supplemented with 0.6 M KCL.

By integrating all of those improved conditions, this process was screened for more than 10

fungal strains either wild types or mutants and belongs to altered generic, as well as diverse,

species. Application of genome shuffling strategy in this work provided a new fusant, which

produces three times as much pectin depolymerizing enzyme as the wild type does under both

SmF and SSF. The maximum activity was obtained when lemon peel was used in the

fermentation medium as an inducer. In SSF, the fermentation mixture containing lemon peel,

sugarcane bagasse, and wheat bran has a supportive effect on enzyme secretion with the highest

yield of ca. 580U/g at 5day of fermentation.


141

The AR9-fusant obtained in this study from an intergeneric cross could be tested for the various

biotechnological application. The current research provides the foundation to develop an

engineered strain of pectinase producing fungus by protoplast fusion.

It is also essential to remark that this is the first report for strain development by genome

shuffling for R. pusillus in pectinase production. The AR9-fusant presented PDEs cocktails that

can be applied in a wide range of industrial applications. Application of genome shuffling in

filamentous fungi breeding is an efficient approach for strain development.

6.5. References

1. de Bekker, C., et al., An enzyme cocktail for efficient protoplast formation in Aspergillus

niger. Journal of microbiological methods, 2009. 76(3): p. 305-306.

2. Hearn, V. and J. Sietsma, Chemical and immunological analysis of the Aspergillus

fumigatus cell wall. Microbiology (Reading, England), 1994. 140: p. 789.

3. Rui, C. and J. Morrell, Production of Fungal Protoplasts from Selected Wood-

Degrading Fungi. Wood and Fiber Science, 1993. 25(1): p. 61-65.

4. Peberdy, J.F., Fungal protoplasts: isolation reversion and fusion. Annual Review of

Microbiology, 1979. 33: p. 21-39.

5. Peraza, L., et al., Growth and pectinase production by Aspergillus mexican strain

protoplast regenerated under acidic stress. Applied Biochemistry and Biotechnology,

2003. 111(1): p. 15-27.

6. John, R.P., D. Gangadharan, and K.M. Nampoothiri, Genome shuffling of Lactobacillus

delbrueckii mutant and Bacillus amyloliquefaciens through protoplasmic fusion for L-

lactic acid production from starchy wastes. Bioresource Technology, 2008. 99(17): p.

8008-8015.

7. Hastie, A.C., Benlate-induced Instability of Aspergillus Diploids. Nature, 1970.

226(5247): p. 771-771.


142

8. Solís, S., et al., Hydrolysis of orange peel by a pectin lyase-overproducing hybrid

obtained by protoplast fusion between mutant pectinolytic Aspergillus flavipes and

Aspergillus niveus CH-Y-1043. Enzyme and Microbial Technology, 2009. 44(3): p. 123-

128.

9. Cheng, Y., et al., Genome shuffling improves production of cellulase by Penicillium

decumbens JU‐A10. Journal of applied microbiology, 2009. 107(6): p. 1837-1846.




11. Wang, Y., et al., Genome-shuffling improved acid tolerance and L-lactic acid

volumetric productivity in Lactobacillus rhamnosus. Journal of Biotechnology, 2007.

129(3): p. 510-515.

12. Mrinalini, C. and D. Lalithakumari, Integration of enhanced biocontrol efficacy and

fungicide tolerance in Trichoderma spp. by electrofusion/Integration einer verbesserten

Wirksamkeit der biologischen Bekämpfung und der Flungizidtoleranz in Trichoderma

spp. durch Elektrofusion. Zeitschrift für Pflanzenkrankheiten und

Pflanzenschutz/Journal of Plant Diseases and Protection, 1998: p. 34-40.

13. Balasubramanian, N., et al., Release and regeneration of protoplasts from the fungus

Canadian Journal of Microbiology, 2003. 49(4): p. 263-268.

14. Patil, N., et al., Molecular characterization of intergeneric hybrid between Aspergillus

oryzae and Trichoderma harzianum by protoplast fusion. Journal of applied

microbiology, 2015. 118(2): p. 390-398.

15. Ouattara, H.G., et al., Molecular identification and pectate lyase production by Bacillus

strains involved in cocoa fermentation. Food microbiology, 2011. 28(1): p. 1-8.

16. Schwarz, P., et al., Molecular identification of zygomycetes from culture and

experimentally infected tissues. Journal of Clinical Microbiology, 2006. 44(2): p. 340-

349.

17. Rehman, H.U., et al., Morphological and molecular based identification of pectinase

producing Bacillus licheniformis from rotten vegetable. Journal of Genetic Engineering

and Biotechnology, 2015. 13(2): p. 139-144.


143

18. Suárez, M.B., et al., Proteomic analysis of secreted proteins from Trichoderma

harzianum: identification of a fungal cell wall-induced aspartic protease. Fungal

Genetics and Biology, 2005. 42(11): p. 924-934.

19. Wang, X., et al., Comparative proteomic analysis of differentially expressed proteins in

shoots of Salicornia europaea under different salinity. Journal of Proteome Research,

2009. 8(7): p. 3331-3345.

Chapter 6

Characterization and proteomic analysis of

extracellular pectin depolymerizing complex

secreted by Rhizomucor pusillus

Characterization and proteomic analysis of PDEs complex Chapter 6

145

Abstract

The effect of fermentation mode on secreted pectinase complexes was investigated. The

extracellular extracts obtained from Rhizomucor pusillus and AR9 fusant using both SmF and SSF

were produced. Herein, three pectin depolymerizing activities (PDEs) were measured in all

extracts [pectin lyase (PNL), polygalacturonase (PG) and polymethylgalacturonase (PMG)]. These

enzymes represent the chief pectinolytic activities in most of the commercial preparation.

Moreover, the degradation of pectin substances depends on the presence of these three enzymes.

In SSF, the extract produced by Rhizomucor pusillus, no PG activity was detected while SmF

obtained a remarkable activity for PG. The three depolymerizing activities were obtained by SmF

while only PNL and PMG were detected by SSF for R. pusillus as a wild type. The AR9 hybrid

produced maximum activities of 579, 23,141 U/g PNL, PG, PMG (SSF) and 149, 37, 51 U/mL

PNL, PG, PMG (SmF) respectively, using lemon peel as an inducer. The hybrid had a significant

PNL and PMG activities. Furthermore, the physicochemical properties and proteomic profiles of

the crude extracts were studied. The PNL obtained from R. pusillus has an optimum pH of 5.5 and

optimum temperature 40ºC for the crude extract. On the other hand, the enzyme produced by

Fusant, the optimal pH was 7.0, optimal temperatures at 45ºC. Enzyme stability at temperatures

above 40ºC and in neutral and acidic pH gives the crude extracts the validity to be used in Juice

clarification, functional food preparation, and maceration, etc., Electrophoresis, using SDS-PAGE

for enzymatic extracts obtained from showed a different number of bands with different masses

were determined. A preliminary step for protein identification was performed using MALDI-TOF.

The novel complex proposes a useful mixture of food industries without methanol liberation as a

byproduct of pectin degradation. The results achieved from this work suggested that the both

fermentation methods (SmF or SSF) are responsible for including changes in the PDEs complexes

secreted by R. pusillus and its fusant.


146

6.1 Characterization of crude extract

6.1. Pectin degrading complex from R. pusillus

Several studies were performed on the crude leachate to characterize the R. pusillus secretome

under solid culture conditions. PMG and PG as PDEs activities were measured, as well as PNL

activity -the chief target. Experimental results indicated that no PG activity was detected in the

crude enzyme preparation. On the other hand, the PMG assay revealed a significant production

level (52 U/g). The obtained data reveals that R. pusillus has a potential for the utilization of a wide

range of pectic substances which, in turn, influence the quality of the PDEs complex that is

produced (Figure 6.1).

Figure 6.1. Evaluation of various pectin depolymerizing activities: PNL, PMG, and PG (U/g)

secretion in the crude enzyme extract obtained by R. pusillus via solid-state fermentation under

optimized conditions for 6 days cultivation.

0

15

30

45

60

75

90

105

PL PG PMG

Act

ivity

(U/g

)

Pectin depolymerizing enzymes (PDEs)PNL


147

The absences of PG activity in the R. pusillus crude leachate can be explained based on the

genotype of this particular strain, because of technological criteria or combination of both factors.

However, the presence of high PNL and PMG activities propose a different mechanism for pectin

degradation by R. pusillus. The previous enzymes work specifically on pectin which is highly

esterified [1].

It is observed also that as the production of extracellular PNL increased, the production of PG

decreased. This phenomenon correlated well with the esterification degree of the substrates that

were present in the fermentation medium. The secretion of PNL by Rhizopus sp was enhanced by

the utilization of LP a sole carbon source (88 U/mg) while only 58 U/mg was obtained as PG [2].

As it is reported in (Table 6.1), the inducer type influenced the PNL production. The highest PNL

activity was obtained when the fermentation media contained LP. The utilization of apple peel

(AP) also affects the PNL activity significantly, on the other hand, citrus pectin takes the last rank

for enzyme production. The results of the current study supported LP role and claimed the presence

of WB and SC could improve the enhancement of LP role. The fermentation mode (SSF vs. SmF),

media composition, process conditions and producer strain are key elements in the type of PDEs

activities for crude leachate in the extracts [3-5].

In comparison with literature, the production of PNL was higher using SSF for PNL. In agreement

with Aspergillus niger was able to produce 288.9 U/g of PNL via SSF [6]. In comparison with

SmF by Rhizopus microspores var. rhizopodiformis, PNL activity reached 57.7 U/ml [2]. The

result proves the influence of fermentation mode on enzyme production.


148

Table 6.1

Comparison between PNL produced by R. pusillus and PNL enzymes reported

by other investigations, which represents the influence of inducer type on PNL

activities. Different inducers are used for PNL production [wheat bran: WB,

lemon peel: LP, sugarcane bagasse: SC, and apple peel: AP].

The levels of PNL observed in the R. pusillus crude extract was compared to some of the

commercial preparations (Clear Rapide; FinoG) which were characterized by [3]. The percentage

of PNL in R. pusillus crude extract was higher than the percentage of PNL in Clear Rapide and

FinoG, respectively. Furthermore, PMG activities were higher than the levels found in the

commercial preparations.

Strain

Activity

(U/g)

Inducer

type

Reference

Rhizomucor pusillus 100 WB, LP, SC Current study

Fusarium. oxysporium 35 AP [7]

Erwinia aroidase 12 Citrus pectin [8]

Debaryomyces nepalensis 4 LP [9]

Chenopodium. capitatum 13 Citrus pectin [10]

Rhizoups. microsporus 88 LP [2]


149

The specific presence of PNL and PMG in the crude leachate makes the crude extract for diverse

biotechnological processes where PNL is needed to attack low-esterified pectin substrates, such as

winemaking industry or the productions based on highly esterified pectin fruits [5, 11].

6.2. Pectin lyase optimum temperature and pH

The effect of temperature on PNL activity was evaluated within the range 20 °C to 70 °C by

performing the standard enzyme assay (pH 8, 30 min). R. pusillus secreted PNL, which exhibited

an optimal temperature at 40 °C (Figure 6.2). The PNL enzyme has activity between 25 and 65

°C while no activity was detected under 30 °C, and above 60 °C. The optimum temperature of

PNL was similar to the same enzyme produced from Erwinia aroidase [8], A. oryzae [12] and

Crystofilobasidium capitatum [10].

The optimum pH of PNL activity was studied at fixed assay conditions at 40 °C with various pH

values ranged from 4 to 11 (100 mM acetate buffer for pH 4.5-5; 100 mM sodium phosphate for

pH 6-8; 100 mM sodium carbonate for pH 9). The optimum pH found for the enzyme from R.

pusillus was 5.5 (Figure 6.3), which is identical to the value found by the PNL from E. aroidase

[8] and A. niger [6]. On the contrary, alkaline optimum pH values were observed in the case of

Fusarium oxysporium [7] and Pythium splendens [13].

In open literature, most PNL enzymes depict an alkaline range of optimum pH values. This

indicates that the enzyme produced by R. pusillus could be better suited for example, in the

clarification of fruit juices.


150

Figure 6.2. The effect of different temperature degrees (30, 40, 50, 60 and 65 °C) on the PNL

enzyme activity (U/g) produced by R. pusillus using SSF cultivation.

Figure 6.3. The effect of different pH levels (4.5-9) on PNL activity (U/g) produced by R.

pusillus using SSF cultivation.

30 35 40 45 50 55 60 650

20

40

60

80

100

120

Temperarure (ᴼC)

PNL

activ

ity (U

/g)

4.5 5 5.5 6 6.5 7 7.5 8 8.50

153045607590

105

pH (-)

PNL

activ

ity (

U/g

)


151

6.3. Pectin degrading complex by AR9-fusant

PDEs mixture produced by AR9 hybrid was investigated using altered fermentation mode (SmF

and SSF). The shuffled strain showed a significant behavior in the productivity of various PDEs

enzymes under SmF and SSF. The Hybrid was able to secret different PDEs; PNL, PG, and PMG,

when lemon peel was used as an inducer in both fermentation systems.

These enzymes are the main protein complex with potential to degrade pectin by breaking down

the pectin molecule using different mechanisms (hydrolytic or trans-eliminative). It is observed

that the ratio between PNL, PG, and PMG fluctuated relatively between the two fermentation

methods.

The enzyme activities in (Figure 6.4) showed that were 149.3, 37.7 and 51.0 U/mL, PNL, PG, and

PMG respectively by SmF. On the other hand, the highest values were 579.7, 32.0 and 141.0 U/g,

PL, PG, and PMG respectively using SSF. The PNL and PMG activities were 3.9 and 2.8 times

increased when SSF was used respectively, in comparison with SmF. PG activity; it is observed

that a slight decrease occurred in the enzyme productivity by SSF than SmF with a value of 5.7

U/mL. Thus, lemon peels were used as a primary inducer of SmF for enzyme production, while a

mixture of wheat bran and sugarcane bagasse was added in SSF for enhancing the enzyme

secretion by the fusant.


152

Figure 6.4. PDEs complex vs fermentation mode by AR9 -fusant

0

100

200

300

400

500

600

700

Avtiv

ity (U

/g)

Pectin degrading enzymes (PDEs)

PNLPGPMG

SSF

0

20

40

60

80

100

120

140

160

180

Act

ivity

(U/m

L)

Pectin degrading enzymes (PDEs)

PNLPGPMGSmF


153

In conclusion, the enzyme activity profiles obtained from the crude extract of the hybrid was

significantly different in both fermentation modes when compared with other extracts.

Nevertheless, the cocktail obtained by SSF was superior in PNL activity than the one obtained

from SmF by fusant. This explains the importance of lemon peel in a medium composition as it

plays a critical role in PNL secretion. The current results come in agreement with [14] who

reported that SSF yields better enzyme activities when compared with SmF.

Moreover, the effect of growth conditions, substrate diffusion, and operating parameters can also

play a vital role in the type and the amount of the secreted PDEs enzyme. In a comparative view

between the parental strains and hybrid for PDEs activities, results in (Table 6.2) revealed that the

hybrid showed greater potential for the PDEs secretion in both fermentation model than R. pusillus.

In SSF cultivation. PNL, PG, and PMG activities by AR9 fusant were higher than R. pusillus. It is

important to note that no PG activities with R. pusillus were not observed, while the shuffled strain

produced 32 U/mL under SSF. This claims the superior effect of GS in changing the genetic

combination, and a great potential for the fusant to yield a unique PDEs complex in comparison

with the parent strains.

In the case of SmF, it has been observed that the shuffled strain was superior to the wild type in

both of PNL and PMG activities while the PG activity decreased from 48 U/mL for the wild-type

to 37.67 U/mL for the fusant. The decline in PG productivity can be explained by referring to the

lemon peels chemical structure which contains highly methylated pectin molecules that encourage

PNL and PMG secretion [15].


154

A. sojae strains as a second parent has been investigated for its ability to produce PDEs using SmF

and SSF [16, 17]). The M5/6 mutant was created from A. sojae for enhancing the pectinolytic

productivity, and it has a different profile than A. sojae. Therefore, for their enzyme productivity

plus the morphological benefits that affect the production process, they had been used as a parent

strains to improve R. pusillus by GS.

The PNL and PMG activities of the shuffled strain were higher than A. sojae with values 12.4 and

8.5 times by SSF respectively. PG and PMG activities were greater in the case of SmF, and it

reached up to 18.4 and 7.2 times more than A. sojae (Table 6.2).

The PDEs complex for M5/6 was significantly different than the AR9-fusant. The shuffled strain

showed a potential improvement specialty in PNL and PMG by SmF and SSF. In SmF, the PNL

production was 18.4 times higher than that produced by M5/6. Moreover, PMG productivity was

45.5 times increased in comparison to M5/6 using SSF.

Several studies investigated the essential aspects of pectinase production by submerged

fermentation and reviewed the literature on enzyme production by SSF [18-23]. However, no

reports are published comparing the enzyme profiles of the different type of pectinase activities

when produced by the two different fermentation methods mentioned above.


155

Table 6.2

Comparison between PDEs enzymatic activities in the crude extract using both of

SmF and SSF produced by parental strains and fusant. The enzyme complexes were

produced by SmF1 or SSF2.

Enzyme complex

PDEs activity

(U/mL)1 or (U/g) 2 .

References

PG

PNL

PMG

R. pusillus1

48.0± 1.9

60.0 ± 1.2

18.2 ± 1.8

This study

R. pusillus2

*ND

102.1 ± 3.2

52.3 ±1.9

This study

AR9-fusant 1

37.7 ± 3.2

149.3 ± 7.1

51.0 ± 4.6

This study

AR9-fusant 2

32.0 ± 4.7

579.7 ± 15.4

141.0± 3.6

This study

A. sojae wt

1

40.4± 3.8

**NM

7.1 ± 0.4

[3, 24]

A. sojae wt

2

97.8 ± 0.1

14.7 ± 0.4

12.0 ± 0.2

[3]

Mutant 5-61

105.2 ± 3.4

17.4 ± 1.5

8.1 ± 0.09

[3]

Mutant 5-62

16.1 ± 1.5

**NM

3.1± 0.8

[17]

*ND: not detected **NM: not measured


156

6.4. Pectin lyase optimum temperature and pH

The effect of temperature on PNL activity was evaluated within the range 20 °C to 70 °C by

performing the standard enzyme assay (pH 8, 30 min). Fusant AR9 secreted PNL, which exhibited

an optimal temperature at 45 °C (Figure 6.5). The enzyme has activity at temperature between

30 and 60 °C, while no activityw under 30 °C, and above 60 °C. The optimum temperature of

PNL was closer to PNLs from Erwinia aroidase [8], A. oryzae [12] and Crystofilobasidium

capitatum [10].

Figure 6.5. The effect of different temperature degrees (30, 40, 50, 60 and 65 °C) on

PNL activity (U/g) produced AR-fusant using SSF cultivation.

30 35 40 45 50 55 60 650

100

200

300

400

500

600

Temperarure (ᴼC)

PNL

activ

ity (U

/g)


157

The optimum pH found for the enzyme from R. pusillus was 7 (Figure 6.6), which is identical to

the value found by the PNL from E. aroidase [8] and A. niger [6]. On the contrary, alkaline

optimum pH values were observed in the case of Fusarium oxysporium [7] and Pythium splendens.

In the open literature, most PNL enzymes depict an alkaline range of optimum pH values. It

indicates that the enzyme produced by R. pusillus could be better suited for processes such as the

clarification of fruit juices.

Figure 6.6. The effect of different pH levels (4.5-9) on PNL activity (U/g) produced AR fusant

using SSF cultivation

4.5 5 5.5 6 6.5 7 7.5 8 8.50

100

200

300

400

500

600

pH (-)

PNL

activ

ity (

U/g

)


158

6.5. Pectin degrading complex vs. commercial pectinase preparations

In the industrial market, the commercial pectinase preparations are mainly cocktails contained PG,

PMG, PNL, and PE, as it is recommended for the industrial market having a high percentage of

PG, PNL, and PMG (Lara-Marque et al., 2011). PNL activity was detected in significant quantity

in most of the commercial preparation particularly in those utilized in fruit mashing (Yield mash)

and juice clarification (Fructozyme P).

As shown in (Table 6.3), the pectinolytic activities of AR9-fusant have a particular print in its

cocktail compares to the listed commercial preparations. The crude extract of AR9-fusant strain

was higher in PNL as a central activity with similar behavior with the Fructozyme P, as commercial

preparation [3].

The percentage of PNL and PMG activities were higher than FinoG, Clear RapidG, and Yield

mash. As indicated above in (Table 6.3), it is also observed that PMG productivity was greater

than all the commercial preparations. In comparison to other PDEs producers, the available

cocktail activities suggested that the hybrid offered an attractive substitution to PDEs preparations

that can be proposed in different industries.

It should be noted that there has been little research done on Rhizomucor as PDE's producer. Only

a few investigations for PG production have been studied using SSF [25-28]. It is also important

to mention that this is the first report for strain development by GS for R. pusillus in PDE's

production. Furthermore, this study is a novel investigation of PNL and PMG secretion under

different fermentation models using R. pusillus and the shuffled strain.


159

The current research has been done to add a remarkable effort in the pectinase production and

strain development. Moreover; genome shuffling proved to be a successful technique in eukaryotic

microorganisms, efficiently improving the PDEs productivity within a short period.

Table 6.3

Comparison between PDEs enzymatic activities in some commercial

preparations. The enzyme complex was produced by SmF1 or SSF2 or a mixture

of enzymes produced by SmF and SSF3.

Commercial

enzyme preparations

PDEs activity

(U/mL)

References

PG

PNL

PMG

Fructozyme P1

91.90

595.9

15.30

[3]

Fino G1

99.30

14.50

21.3

Clear Rapide G1

107.0

25.8

37.7

First Yield1

97.20

491.00

35.90

Pro Clear3

94.90

333.50

13.1

Yield Mash1

108.80

107.7

8.90

*ND: not detected **NM: not measured


160

6.6. Proteomic characterization

Fungi secrete\ plenty of proteins under solid-state culture conditions. Proteins secreted by R.

pusillus under solid-state conditions were characterized using isoelectric focusing (IEF), gel

electrophoresis and mass spectrometry (MS) analysis. PDEs enzymes secreted by fungi are used

extensively for the extraction and clarification of fruit juices and several other application. In the

current study, extracts produced by R. pusillus and AR9-fusant were characterized for the PDEs

profiling.

6.6.1. 2D-gel electrophoresis

The SSF enzyme extract of R. pusillus was subjected to dialyzes and concentration by

lyophilization to reach the recommended protein concentration. The concentrated sample was used

for 2D-PAGE separation. This technique constitutes a combination of isoelectric focusing and

SDS-polyacrylamide gel electrophoresis in which the separation of proteins is dependant on the

isoelectric point (pI) in the first dimension and the size in the second dimension.

The enzyme complex of R. pusillus was extracted by different leaching buffers (water, acetate

buffer, NaCl, and phosphate buffer) was separated via a 2D gel. As it is shown in (Figure, 6.7),

the leaching buffer influenced the extracted proteins in the crude extract to understand the

influence of the extraction buffer on the leached proteins, each extraction was separated using the

2D gel. Several proteins with different molecular weight and IP were detected. It is observed that

using water, NaCl and acetate buffer exhibited the extraction of acidic proteins with PI ranged

from 3 to 5.5.


161

On the other hand, using phosphate buffer encourage the extraction of neutral and alkaline proteins

with PI ranged from 6 to 10. The investigated protein profiles on the 2D gel were used for protein

Identification using MALDI-TOF. The information obtained from the 2D gel (PI and molecular

weight) with MALDI-TOF identification is used to identify the obtained spots

Moreover, a commercial pectinolytic enzyme preparation, which was earlier tested for the

presence of PNL activity, were analyzed by 2D gel to identify PNL enzyme and use it as a positive

control. For the previous reason, spots on the gel corresponding to Fructozyme P (as commercial

perpetration and positive control for pectin lyase enzyme) was subjected to the mass spectrometric

characterization of proteins (Figure 6.7).


162

Figure 6.7. 2D–PAGE presenting separation of proteins derived from R. pusillus, Fusant AR9

cultured via solid-state conditions and Fructozyme P (as commercial perpetration and a positive

control for pectin lyase enzyme). Protein samples were electrophoresed in an IPG of pH 3 to 10 (7

cm) in the first dimension and a 12.5 % SDS-polyacrylamide gel in the second dimension.

PNL

AR9-fusant Fructozyme P

Water Acetate buffer

Phosphate buffer NaCL


163

6.6.2. Protein identification by MALDI-TOF

The crude extract obtained via solid-state culture was used to separate protein band or spot using

the 2D gels. Mass spectrometry (MS) analysis was performed on the peptides obtained after

enzymatic degradation of the gel-separated proteins. The combination of separation of proteins by

2D-PAGE or SDS-PAGE and quantification of individual proteins with mass spectrometry and

database searching was performed for the identification of the separated proteins present in the

extract.

All the spots on the 2D gels presented in (Figure 6.7) for the crude extract of R. pusillus, AR)

fusant and Fructozyme P were subjected to protein Identification. MALDI-TOF MS/MS analysis

yielded in the fruitful identification of PNL enzyme in commercial pectinase preparations. The

protein pattern of the commercial preparations presented the presence of protein bands in the acidic

range which is similar to the crude extract of R. pusillus when the fermented cultures were leached

with water, acetate buffer and NaCl. The identified pectin lyase enzyme (PNL) from the

commercial Fructozyme P pectinolytic enzyme preparation was previously tested for the presence

of PNL activity as a positive control. In addition to PNL in the commercial preparation, several

other proteins have been identified (Table 6.5).

The identified proteins play a significant role in the degradation of pectic substances. One of the

identified proteins is arabinofuranosidase which degrades the side chain in the hairy region of

pectin. These enzymes work with a synergistic effect with another pectinase to degrade pectin in

fruit and vegetables. However, there was still a multiplicity of bands which could not be identified.


164

Table 6.4

Summary of the common proteins identified by MS analysis for Fructozyme P

(as commercial preparation).

Identified Protein

Organism

PPM

score

Accession

number

Glucoamylase I precursor (Glucan 1,4-alpha-glucosidase) (1,4-alpha-D-glucan glucohydrolase)

Aspergillus kawachii

200 79 gi|113790

Glucoamylase precursor Aspargillus awamori 200 79 gi|1389841

Gucoamyase I Aspargillus awamori 200 79 gi|226358

Hypothetical protein AN0952.2 [Aspergillus nidulans FGSC A4]

Aspergillus nidalans 150 74 gi|67517411

Chain A, Crystal Structure Of Arabinofuranosidase Complexed With Arabinose

Aspergillus kawachii 50 85 gi|55670668

Pectin Lyase A Aspergillus niger

50 66 gi|2624697

Hypothetical protein [Yarrowia lipolytica]

Yarrowia lipolytica 150 68 gi|50543708


165

Proteins present in R. pusillus extract were separated by their pI in the first dimension and

according to their molecular weights in the second dimension by subjecting to 2D gel (Figure 6.7).

All the protein spots were excised and used for mass spectrometric characterization.

Some of the protein spots separated by 2D resulted in the appearance of similar molecular weights

but differing pIs. However, only some protein spots were identified by mass spectrometric

characterization. Some identified protein spots were enzymes which have a role in pectin

degradation. These enzymes are summarized in (Table 6.5). An important observation is a

similarity between the identified spots in the crude extract produced by the experimental strains

and the enzymes in the commercial preparation Fructozyme P.

Results showed reproducible MS spectra corrispoending to pectin lyase was identified from

Fructozyme P (Figure 6.8a), The gained spectra was used as postive control to identify the selected

spot from R. pusillus extract.

It is observesd that peak (1707.755) was similar in both MS spectra. The MS spectra was identified

from 28 kDa spot (4.5 PI) of the expected PNL obtained from the crud extract of R. pusillus

(Figure 6.8b). It may be considered as the corresponding band of PNL. However, it needs further

confirmation using different strategies.

The bottlenecks of peptides identification might be due to the insufficient concentration of proteins

in the sample. Also, the lack of the genome sequenced of the investigated strains makes the

alignment of the obtained good spectra difficult. It is important to report that we had a lot of

significant spectra, but either no matches with the available proteins in a database or matching

with hypothical proteins.


166

Table 6.5

Summary of the common proteins identified by MS analysis for R. pusillus and AR9-fusant.

Identified Protein

Organism

PPM

Score

Accession

number

beta-glucosidase Mucor ambiguus 100 64 gi|2494338

Pectinesterase Aspergillus niger 130 71 gi|2369

Chain A, Crystal Structure

of Arabinofuranosidase

Complexed With Arabinose

Aspergillus kawachii 50 70 gi|55670668

Glucoamylase I Aspargillus awamori 120 79 gi|113790

Endoglucanase A precursor (Endo

-1,4-beta-glucanase A)

(CellulaseA) (Carboxymethylcellulase) (CMCase-I)

Aspergillus kawachii

56 66 gi|2494338


167

Figure 6.8. MALDI-TOF mass spectra of 2D–PAGE gel of pectin lyase present in commercial

perpetration (Fructozyme).

Figure 6.9. MALDI-TOF mass spectra of 2D–PAGE gel of predicted pectin lyase from

R. pusillus.

2954.299

832.260

661.984

1167.597 1707.755

1993.903

0.0

0.5

1.0

1.5

4x10

Inte

ns. [

a.u.

]

500 1000 1500 2000 2500 3000m/z

1867.704

1475.7351161.642

2091.8101707.705

2383.747

0

1000

2000

3000

4000

5000

Inte

ns. [

a.u.

]

1000 1500 2000 2500 3000 3500 4000 4500m/z


168

Proteins secreted from filamentous fungi are usually highly glycosylated. The glycosylation

supports the resistance to proteolysis and makes extracellular proteins stable and soluble in the

culture medium. The resistance to proteolysis obstructs the identification by peptide mass

fingerprinting. In-gel deglycosylation was suggested for the elimination of sugar chains of fungal

proteins as well as to decrease their protease resistance, which facilitates identifying the

extracellular proteins of fungi [29-31].

Moreover, they claim to overcome problems resulted from the presence of O-linked

oligosaccharides, which results in a diversity of peptide masses, by obtaining peptide amino acid

sequences utilizing tandem mass spectrometry (e.g., MALDI-TOF MS/MS). However, the lake of

information on the PNL enzyme proteins identification as well as genome sequence of R. pusillus

among the published date makes a bottleneck in protein identification [32].

6.7. Application

Juice production is one of the most important applications for pectinases. In the industrial market,

some fruit juices and vegetable are indeed cloudy. The cloudiness is present because of the

suspended solids which are present normally in juices. Another reason for this turbidity is the high

pectin concentration that leads to the colloid formation [5, 33].

In the clear juice production, the suspended particles can be removed by precipitation earlier than

filtration. This step called clarification, and the enzymatic depectinization of juices leads to a

proficient decrease of cloudiness. In apple juice processing, pectinases are the major types of

enzymes used in juice clarification of apple juice mainly PNL, PG, and PMG [33-35].


169

Enzyme extracts produced by R. pusillus and AR9-fusant were tested for apple juice clarification.

A positive control containing “Fructozym P” as a commercial preparation was used to compare

the obtained extracts with different available pectinolytic activities. The protein concentration was

constant in all the experimental trials. Samples were incubated 120 min at 45 °C until a visual

clarifying influence was detected. As it is shown in (Figure 6.10), for the positive control

“Fructozym P” the juice was completely clarified after 50 min of incubation. The crude extract

produced by AR9 fusant was only partially clarified while the extract R. pusillus from the

clarification effect can be observed, but it also remains turbid and unclear.

Figure 6.10. Clarification effect of enzyme preparations (Rp: crude extract from R. pusillus, +veC: Fructozym P as a positive control, -veC Blank and AR9: crude extract from AR9-

fusant). The process was carried at 45 °C for 120 min of incubation.

AR9 -ve C

+ve C

R. p


170

The process of clarification is influenced by different factors (enzyme complex type, juice

composition, pH, temperature, and contact time and enzyme concentration). The temperature was

selected as moderate temperature obtained from different conditions applied during the process in

industrial apple juice production [33, 36].

Usually, the clarification increases with increasing temperature as long as the temperature is under

denaturation temperature for the enzyme. According to the result in this chapter, the PNL activity

was optimal at 40 and 45 °C for R. pusillus and AR9-fusant respectively. Nevertheless, both

extracts have significant activity till 45 and 50 °C. Herein, a significant potential for the application

in fruit juice industry was observed. According to the findings of Tari et al. (2008), it is possible

to assume the applied temperature of 50 °C should be below the denaturation temperature, which

would eliminate the speculation of low activity due to enzyme inactivation.

6.8. Conclusion

R. pusillus has a significant potential for PNL production under optimized SSF process conditions.

Maximum activity was obtained using a cost-effective agro-industrial biomass mixture (LP, WB,

and SC) with yields of 100 U/g and 52 U/g for PNL and PMG respectively. According to our

knowledge, this is the first report on the generation of PNL and PMG enzymes by R. pusillus The

PDEs complex produced by R. pusillus has a unique depolymerizing activity with a core role of

PNL. The synergetic influence of PMG plus PNL leads to pectin degradation without methanol

formation in the end product. This particular mode of action, as well as the optimal conditions for

enzyme activity (pH 5.5; 40 °C), suggest potential applications in the food industry e.g. juice

manufacture and functional food preparation.


171

GS method was proved for PDEs production enhancement in which an efficient and reproducible

protoplasmic shuffling system was developed. The AR9 Fusant produces novel pectinase

complexes containing PNL, PMG, and PG with superior activities to the parent strains.

The secreted proteins were significantly high under SmF and SSF. Enzyme secretion reached to

the highest yield ca. 580U/g after 5 days of SSF using lemon peels. The gained cocktail owns

unique PDEs with the foremost action of PNL. The obtained enzyme complex by the intergeneric

hybrid could be investigated as a substitute for production and biotechnological applications of

PDEs. Since there are no such studies stated, the study can be considered as a powerful tool for

exploiting GS in filamentous fungi breeding, where it opens a new area in developing desirable

pectinase stable hybrids to encounter current market demands.

The pectinolytic activity of the crude solution has specific properties which can offer advantages

over currently available pectinase preparations. The enzyme complex can be applied directly to

vegetables without the need for pH modification. Furthermore, because of the temperature stability

of the enzyme, it can be used at a processing temperature of 50 ºC, which is sufficient to limit the

growth of mesophilic contaminants in the process.


172

6.9. References

1. Arunachalam, C. and S. Asha, Pectinolytic Enzyme - A Review of New Studies. Advanced

Biotechnology Journal, 2010. 1.

2. Damásio, A.R.d.L., et al., Biotechnological potential of alternative carbon sources for

production of pectinases by Rhizopus microsporus var. rhizopodiformis. Brazilian

Archives of Biology and Technology, 2011. 54(1): p. 141-148.

3. Mata-Gómez, M.A., et al., A novel pectin-degrading enzyme complex from Aspergillus

sojaeATCC 20235 mutants. Journal of the Science of Food and Agriculture, 2015. 95(7):

p. 1554-1561.

4. Panda, T. and G. Naidu, Rotating simplex method of optimization of physical parameters

for higher production of extracellular pectinases in bioreactor. Bioprocess and Biosystems

Engineering, 2000. 23(1): p. 47-49.

5. Garg, G., et al., Microbial pectinases: an ecofriendly tool of nature for industries. 3 Biotech,

2016. 6(1): p. 47.

6. Yadav, S. and N. Shastri, Partial purification of an extracellular pectin lyase from a strain

of Aspergillus niger. Indian J Microbiol, 2004. 44: p. 201-4.

7. Guevara, M., M. Gonzalez-Jaen, and P. Estevez, Pectin lyase from Fusarium oxysporum f.

sp. radicis lycopersici: purification and characterization. Progress in Biotechnology, 1996.

14: p. 747-760.

8. Kamimiya, S., et al., Purification and Properties of a Pectin trans-Eliminase in Erwin

aroideae Formed in the Presence of Nalidixic Acid. Agricultural and Biological Chemistry,

1974. 38(5): p. 1071-1078.

9. Gummadi, S.N. and D.S. Kumar, Batch and fed batch production of pectin lyase and

pectate lyase by novel strain Debaryomyces nepalensis in bioreactor. Bioresource

Technology, 2008. 99(4): p. 874-881.

10. Nakagawa, T., et al., A cold‐active pectin lyase from the psychrophilic and

basidiomycetous yeast Cystofilobasidium capitatum strain PPY‐1. Biotechnology and

Applied Biochemistry, 2005. 42(3): p. 193-196.

11. Lara-Márquez, A., et al., Biotechnological potential of pectinolytic complexes of fungi.

Biotechnology letters, 2011. 33(5): p. 859-868.


173

12. Lim, J.Y., Y. Fujio, and S. Ueda, Purification and characterization of pectinesterase and

pectin lyase from Aspergillus oryzae A-3. Journal of Applied Biochemistry, 1983.

13. Chen, W.-C., H.-J. Hsieh, and T.-C. Tseng, Purification and characterization of a pectin

lyase from Pythium splendens infected cucumber fruits. Botanical Bulletin of Academia

Sinica, 1998. 39.

14. John, R.P., D. Gangadharan, and K. Madhavan Nampoothiri, Genome shuffling of

Lactobacillus delbrueckii mutant and Bacillus amyloliquefaciens through protoplasmic

fusion for l-lactic acid production from starchy wastes. Bioresource Technology, 2008.

99(17): p. 8008-8015.

15. Benoit, I., et al., Degradation of different pectins by fungi: correlations and contrasts

between the pectinolytic enzyme sets identified in genomes and the growth on pectins of

different origin. BMC Genomics, 2012. 13.

16. Tari, C., N. Dogan, and N. Gogus, Biochemical and thermal characterization of crude exo-

polygalacturonase produced by Aspergillus sojae. Food Chemistry, 2008. 111(4): p. 824-

829.

17. Heerd, D., S. Diercks-Horn, and M. Fernández-Lahore, Efficient polygalacturonase

production from agricultural and agro-industrial residues by solid-state culture of

Aspergillus sojae under optimized conditions. SpringerPlus, 2014. 3(1): p. 742.

18. Fernandes, P., Enzymes in Food Processing: A Condensed Overview on Strategies for

Better Biocatalysts. Enzyme Research, 2010. 2010: p. 19.

19. Suresh, B. and T. Viruthagiri, Optimization and Kinectics of Pectinase Enzyme Using

Aspergillus niger by Solid-state Fermentation. 2010. 2010.

20. Viniegra-González, G., et al., Advantages of fungal enzyme production in solid state over

liquid fermentation systems. Biochemical Engineering Journal, 2003. 13(2): p. 157-167.


and applications. Reviews in Environmental Science and Bio/Technology, 2013. 12(1): p.

45-60.

22. Rahmani, N., A. Andriani, and Y.S. Anggraini, Pectinase production by Aspegillus ustus

BL5 at soild state fermentation medium using agricultural biomass Jurnal Teknologi

Indonesia (JTI), 2015. 36(3).


174

23. Hadj Sassi, A., et al., Enhancement of solubility, purification and inclusion-bodies-

refolding of an active pectin lyase from Penicillium occitanis expressed in Escherichia coli.

International Journal of Biological Macromolecules, 2017. 95: p. 256-262.


polygalacturonase from agro-based products by Aspergillus sojae. BioResources, 2011.

6(3): p. 3452-3468.

25. Maleki, M.H., et al., Screening of some Zygomycetes strains for pectinase activity. J.

Microbiol. Biotechnol. Res., 2011. 1: p. 1-7.

26. Siddiqui, M.A., V. Pande, and M. Arif, Production, Purification, and Characterization of

Polygalacturonase from Rhizomucor pusillus Isolated from Decomposting Orange Peels.

Enzyme Research, 2012. 2012: p. 8.



Research, 2013. 7(3): p. 252-259.

28. Rizk, A., et al., Optimization of medium composition for the novel pectin lyase producer

Rhizomucor pusillus DSM 1331 through response surface methodology. New

Biotechnology, 2014. 31, Supplement: p. S117.

29. Suárez, M.B., et al., Proteomic analysis of secreted proteins from Trichoderma harzianum:

identification of a fungal cell wall-induced aspartic protease. Fungal Genetics and Biology,

2005. 42(11): p. 924-934.

30. Nunez, A., et al., Identification of extensin protein associated with sugar beet pectin. J

Agric Food Chem, 2009. 57.

31. Zhou, P., et al., Genome sequence and transcriptome analyses of the thermophilic

zygomycete fungus Rhizomucor miehei. BMC genomics, 2014. 15(1): p. 294.

32. Heerd, D., Pectinolytic enzymes of A. sojae ATCC 20235: The impact of bioprocessing

strategy on solid-state production and downstream processing of polygalacturonase. PhD

dissertation, Jacobs University Bremen, 2013.

33. Tapre, A. and R. Jain, Pectinases: Enzymes for fruit processing industry. International

Food Research Journal, 2014. 21(2): p. 447-453.

34. Kashyap, D.R., et al., Applications of pectinases in the commercial sector: a review.

Bioresource Technol, 2001. 77.


175

35. Soares, M.M.C.N., et al., Pectinolytic enzyme production by Bacillus species and their

potential application on juice extraction. World Journal of Microbiology and

Biotechnology, 2001. 17(1): p. 79-82.

36. Díaz, A.B., et al., Applicability of enzymatic extracts obtained by solid state fermentation

on grape pomace and orange peels mixtures in must clarification. LWT - Food Science

and Technology, 2011. 44(4): p. 840-846.

Chapter 7

Molecular Identification of Novel pectin lyase

encoding gene from Rhizomucor pusillus

Molecular identification of novel pectin lyase gene Chapter 7

Abstract

Microbes produce cell wall degrading enzymes as part of their approaches for plant

invasion/nutrition. Amongst these, pectin lyases (PNLs) catalyze the depolymerization of

esterified pectin by a β-elimination mechanism. PNLs are grouped together with pectate lyases

(PL) in Family 1 of the polysaccharide lyases. The best characterized fungal pectin lyases are

obtained from saprophytic/opportunistic fungi in the genera Aspergillus and Penicillium and from

some pathogens such as Colletotrichum gloeosporioides. The organism used in the current

industrial benefits in the production of several carbohydrate degrading enzymes. In pectinases

research, there are few studies have been done on the pectinases production via R. pusillus. It is

important to mention that; no studies have been done on the production of PNL enzyme or PNL

gene isolation using R. pusillus. There is a lack of information on the database related to this topic.

This made the topic interesting to study as well as challenging to conduct. In this chapter, we

report for the first time the isolation of the Rppnl gene, which encodes the pectin lyase of R.

pusillus. The identification of this gene was carried out at the genomic DNA level. The encoding

PNL gene (Rppnl gene) has been identified by specific primers was designed to depend on the

available sequences of PNL gene in the NCBI database. Furthermore, a comparative analysis of

the nucleotide and the deduced amino acid sequence of Rppnl gene based on reported sequences

of PNLs from other sources was performed. Both analyses revealed a significant homology with

pectin lyases from those found in fungi with the obtained Rppnl gene. The future work will be an

expression of Rppnl gene in an expression host, analysed of the DNA message, evaluation of

protein expression, study the enzyme structure, protein identification, and application.

177


178

7. Identification of the pectin lyase coding gene

Pectin lyase (PNL) is a member of pectin degrading enzymes, which acts on the pectic substances.

The pectic substances occur as structural polysaccharides in the middle lamella and primary cell

walls of higher plants. This enzyme has potential industrial applications: food, paper and textile

industries [1]. However, the research works on PNL has been done for the last six decades using

different fungal and bacterial strains but there is no exclusive investigation on PNL by zygomycete

fungi mainly for Rhizoumucor so far available in the literature [2]. The current study aims to fill

this gap by providing for the first time relevant information for corresponding pectin lyase gene

(Rppnl gene) by R. pusillus. Herein, the work enclosed in the identification of PNL encoding gene

and alignment analysis with different PNLs genes from other organisms. Moreover deduced amino

acids sequence was predicted to evaluate the similarity on the protein level.

7.1. Isolation of PNL coding gene (Rppnl)

Genomic DNA of strain Rhizomucor pusillus was isolated. The corresponding pectin lyase gene

(Rppnl gene) has been amplified from by using primers designed from conserved motifs of genes

encoding extracellular pectin lyase of different microorganisms. Gradient PCR was conducted to

optimize the annealing temperature (50, 56, 60, 65, and 70 oC). The PCR amplifications are

presented in (Figure 7.1). The PCR product was obtained with a molecular weight approximately

1kb which is the expected size of pectin lyase gene. The PCR amplification was repeated after

selection of optimal annealing temperature 60 oC as it is shown in (Figure 7.2).


179

Figure 7.1: Amplification of pectin

lyase coding gene (Rppnl) using

genomic DNA of Rhizomucor pusillus

by gradient PCR using different

annealing temperatures: a) 50, b) 56,

c) 60, d) 65, e) 70 oC and f) 2- log DNA

ladder (0.1-10kb).

Figure 7.2: Amplification of Rppnl

gene using genomic DNA of

Rhizomucor pusillus at the optimal

annealing temperature of 56 oC: a)

and b) 2- log DNA ladder (0.1-10kb).

f e d c b a

b a


180

In literature, several forms of pectin lyases are produced by filamentous fungi and various of the

pectin lyase genes families have been isolated and characterized from Aspergillus niger [3,

4], Aspergillus oryzae [5] and Penicillium griseoroseum [6]. P. griseoroseum CCT6421 has been

tested for the isolation of two PNL encoding genes plg1 and followed by characterization and

expression regulation using northern [7].

7.2 Multiple alignments of different PNL gene sequences

The amplified PCR product was subjected to sequencing. The Nucleotide sequence of the Rppnl

PCR product is represented in (Figure 7.3). The obtained sequence was used for DNA alignment.

Analysis of a homologous sequence of the PCR generated fragment was in the database was

performed by using the DNA-Blast (Basic Local Alignment Search Tool, NCBI) computer search

algorithm [8] and resulted in the identification of several PNL genes from different

Figure 7.3: Pectin lyase coding gene (Rppnl) nucleotide sequence for amplified PCR product

produced from genomic DNA of Rhizomucor pusillus.

ACCAAACGTCTACCCCGACACTATCGATGAGCTGGTCTCCTACCTTGGTGACGATGAGGCCCGCGTCATTGTCCTGACCAAGACCTTCGACTTCACCGACAGCGAAGGTACCACCACTGGCACTGGTTGCGCTCCCTGGGGTACCGCTTCCGCTTGCCAGGTTGCTATTGACCAGGACGACTGGTGCGAGAACTACGAGCCCGATGCTCCCTCTGTCAGCGTTGAATAGTATGTCCTTGCCGGCTGTCATCCGCTTTTGATCTCGTATCTAACCTAAATAGCTACAACGCTGGTACCCTCGGTATCACCGTCACCTCCAACAAGTCCCTCATCGGTGAGGGCTCCTCTGGTGCCATTAAGGGCAAGGGTCTCCGCATTGTCAGCGGTGCCGAGAACATCATCATCCAGTAGGTTATACTTGGTGACATTAGGAAATTGCTCTAACAAAATCAGGAACATCGCCGTTACCGACATCAACGCCAAGTACGTCTGGGGTGGTGATGCTATTACTCTTGATGACTGCGACCTGGTCTGGATCGACCACGTTACTGTAGGCCTTCACTTCTTCAGTTTACTAAATCAAGAGCATCAAGTTAACAAATGATAGACCGCCCGCATTGGTCGCCAGCACTACGTCCTCGGAACCAGCGCCGACAACCGCGTCTCTCTCACCAACAACTACATTGACGGTGTCTCCGACTACTCCGCCACTGCGATGGCTACCACTACTGGGCCATCTACCTCGACGGTGATGCCGACTTGGTCACCATGAAGGGCAACTACATCTACCACACCTCCGGCCGTTCCCCCAAGGTCCAGGACAACACTCTCCTCCACGCTGTAAGTTCTATATCTGCCGGTCACCTTCGACTCAACTAACCACCAACACAGGTCAACAACTACTGGTACGACATCTCCGGCCACGCCT


181

The multiple sequence alignment including PNL gene indicated that a fragment of PNL gene was

isolated with significant similarities with the available genes in the data base (Figure 7.4). The

obtained Rppnl sequence exhibits the highest nucleotide homology with pectin lyase A(pelA),

complete cdc from A. niger strain EIM-6 with identity value of 96%. The homology value was

decreased to 77% with Penicillium citrinun clone GCEL PNL010 pectin lyase gene, partial cdc.

The lowest value gained with A. oryae pel2 gene for pectin lyase 2, complete cdc to reach 76%.

(Figure 7.5).

Figure 7.4: Multiple nucleotide sequences alignment of the amplified Rppnl fragment obtained

by R. pusillus DSM1331 and various PNL genes in NCBI database.


182

W

Figure 7.5: Phylogentic tree of Rppnl from R. pusillus and PN

L enzymes, w

ith hightest sequence smilarity, from

other organisms m

aily fungal strains. The tree w

as performed using N

CBI B

last tree viewer.

R. pusillus (Rppnl)


183

Several fungal strains are recognized to secrete numerous PNLs, which act on highly esterified

pectin, some bacteria produce a diversity of altered pectate lyases which are Ca 2 +dependent and

are able to depolymerize polygalacturonate as well as low methoxyl-pectins [9].

7.3. Isolation of the Rppnl using cDNA

The total RNA was isolated from Rhizomucor pusillus mycelia. The pectin lyase encoding gene

(Rppnl) was amplified by RT-PCR from total RNA, using specific primers derived from the PNL

sequence of Aspergillus niger (GenBank accession no. JQ665723.1). Gradient PCR was performed

to optimize the annealing temperatures. The amplified DNA fragments have a molecular weight

of approximately 1kb (Figure 7.6). The amplification was repeated at the optimal annealing

temperatures to reproduce the expected fragment (Figure 7.7).

The gene coding for pectin lyase belongs to a multigene family including several number genes,

and hence it is important to study the structure of these genes and the factor influencing the gene

expression. There has been a substantial investigation on pectin lyase gene expression, and some

pectin lyase genes has been cloned from diverse organisms however most of them are from

Aspergillus sp [4, 10]. The ability of the organisms to produce extracellular enzymes, especially

pectinases such as pectate lyase (Pel), polygalacturonase (Peh) and pectin lyase (Pnl). These

enzymes are involved in tissue maceration by degrading plant cell wall components [11].


184

Figure 7.6: Amplification of Rppnl

gene using cDNA of Rhizomucor

pusillus via gradient PCR using

different annealing temperatures: a)

58.5, c) 60.8 oC, and b) 2- log DNA

ladder (0.1-10kb)

Figure 7.7: Amplification of Rppnl gene

using cDNA of Rhizomucor pusillus at

optimal annealing temperature: a) 59 oC

and b) 2- log DNA ladder (0.1-10kb)

a b c c

b a


185

The PCR product obtained from cDNA was sequenced, and the Nucleotide sequence of Rppnl gene

amplified from cDNA of Rhizomucor pusillus is presented in (Figure 7.8). An alignment for the

Rppnl gene sequence was performed to find out the similarities with the known pectin lyase in

database.

Figure 7.8. The nucleotide sequence of Rppnl gene amplified from cDNA of Rhizomucor pusillus.

The Phylogenetic tree containing a compassion between the Rppnl sequences obtained from the

amplified Rppnl fragment obtained by R. pusillus DSM1331 and PNL sequences in the database

is presented in (Figure 7.9). Herein, the highest similarity of Rppnl with PNL gene from

Aspergillus niger organisms. It is important to mention that, the similarity is varied in

comparison with different fungal strains. in NCBI database

GATTGTCTGGCGTCGGCGTGTCCGGCTCTGTTGTCTATGACAAACGGCGTGTCGGGCTCTGTGTCTATAACAAAACGTGTCTCGGGAACCTGTGTCTATAACAAAAGCCGTGGAGGGAAACTTTGTATATCAAAAAAACCAAGGTACCACCACTGGGACTGGATGCGCTCCCTGGGGTACCGCTTCCGCTTGCCAGGTTGCTTTTGACCACGACGACTGGTGCGAAAACTACAACCCCGATGCTCCCTCTGTCAGCGATGAATAGTATGCCCTTGCCGGCTGTCCTCCGTTTTTGATCTCGTATCTAACCTATTCAGCTCCTTCGCTGGTACCCTCTTTATCACCGTCACCTCCAACAAGTCCCTCATCGGTGAGGGCTCCTCTGGTGCCATTAAGGGCCAGGGTCTCCTCATTGTCAGCGGTGCCGAGAACATCATCATCCATTAGGTTATACTTGGTGACATTAGGAAATTGCTCTAACAATATCGGGAACATCGCCGTTACCGACATCAACGCCAAGTACGTCTGGGGTGGTGATGCTATTACTCTTGAAGACTGCGAGCTGGTCTGGATCGACTACTTTACTGTAGGCCTTCACTTCTTCATTTTACTAAATCAAAAGCATCAAGTTACTAAATGATAGACAGCCCGCGTTGTCGTCAGCACTACATCGTCGGAACCCGTGCCTACAACCGCATCTCTCTCACAACAACTACATTGACGGTGTCTCCGACTACTCCGCACCTGCGATCGGCTACCATCTACTGTGGCCATCTACCTCGACGGTGATAGCTATTCTGGTCCACATGAAGGGAAACTACTTCTAACAATGCCTCGACGATTCGCCACATGATCAAGGACAACACTCCTCCTCTTTGCTAGAAAGTCTAGTACTCTGCCGGATCCCTACGACTCACTTACCTATTACATGCAGTTCACACACCTTACTGGAATGACATTCCCGGACATGCCACTCAATGGGTGGAGGCTGGTCCACGGTCATGTCGCTTTGCAG


186

Figure 7.9. Phylogentic tree of the cDN

A sequences obtained from

the amplified Rppnl fragm

ent obtained by

R. pusillus DSM

1331. The sequence was com

pared with PN

Ls enzymes, w

ith hightest smilarity, from

other

organisms m

aily fungal strains.different in PNL proteins in N

CBI database.

R. pusillus (Rppnl)


187

7.4. Protein homology

The obtained sequence for the amplified Rppnl gene was translated to amino acid sequence using

(http://www.fr33.net/translator.php) and (http://www.expasy.org). Six predicted amino acid

sequences Frames were obtained and proposed for database alignment. The sequence deduced

amino acid is presented in (Figure 7.10).

MKYSTIFSAA AAVFAGSAAA VGVSGSAEGF AEGVTGGGDA TPVYPDTIDE LVSYLGDDEA

RVIVLTKTFD FTDSEGTTTG TGCAPWGTAS ACQVAIDQDD WCENYEPDAP SVSVEIVYNAG

VLGITVTSNK SLIGEAPLVQ SRARVSVLSA VLRTSSSRNI AVTDINPKYV WGGDAITLDD

CDQVWIDHVT VGLHFSVYYI RKLLYKLGTS PLLTSTPSTS GVVMLLLLMT ATRSGSTMLLL

AFTFQVTNY FYDISGHAFE IGEGGYVLAE GNVFQNVDTV LETYEGAAFT VPSTTAGEVC

STYLGRDCVI NGFGSSGTFS EDSTSFLSDF EGKNIASASA YTSVASSVVANAGQGNL

Figure 7.10: Deduced amino acid sequence of Rppnl gene amplified of Rhizomucor pusillus.

The deduced amino acids showed a significant homology with PNL protein from different

organisms. As presented in Table 7.1, the highest similarity was observed with Aspergillus niger

pectin lyase A gene (AFJ80126.1) 76%. However, at DNA level the similarity percentage was

88% with Aspergillus ficuun (clone GCEL-PNL015 pectin lyase gene, partial cds). The differences

in the homology values can be explained because of the strain type and the gene structure.

Additionally, the lack of information in gene banks, since the genome sequence of Rhizomucor

pusillus is not released.


188

Table 7.1

The highest significant homology of sequences with Rppnl gene of Rhizomucor pusillus by alignments on

sequences on DNA level and deduced amino acid on protein level.

Organism

Alignment

level

Max

Score

Total

score

Query

cover

E

value

Ident

Accession

Aspergillus ficuun

(clone GCEL-

PNL015 pectin lyase

gene, partial cds)

DNA

880

880

75%

0.0

88%

JF447771.1

Aspergillus niger

(Pectin lyase A)

Protein

500

500

100%

3e-175

76%

AFJ80126.1

The amino acid sequences of PNLs from different source organisms was analyzed using various

bioinformatics tools to reveal the sequence level similarity. Multiple sequence alignment of

different PNL protein sequences from different organisms can provide an opportunity to design

degenerate primers which can be used for PCR amplification of PNL gene family. Several Motifs

have been proposed for PNL gene [12].

In comparison with these motifs, the current results showed significant similarities with one of the

published motifs with a width of 41 amino acid and with 74% (Table 7.2). These results confirm

the presence of pectin lyase coding gene at both genomic and transcriptomic level [12].


189

Table 7.2

Homology analysis of the deduced amino acid obtained from the amplified Rppnl fragment

obtained by R. pusillus DSM1331with conserved amino acid sequences of one motif commonly

observed in PNL sequences.

Motif

Best possible match

Width

Max

score

Total

score

Query

cover

E-

value Ident

1 QNI A I TD INPKY VWGGDA I

TLDDCDMVWI DHV T TAR I GRQH

41 64.3 64.3 10% 4e-19 74%

7.5. Conclusion

The pectin lyase coding gene (Rppnl) was successfully isolated from R. pusillus DSM1331. The

isolated gene contains significant similarities with different pectin lyase of Family 1 of

polysaccharide lyases. This is the primary step to understanding the pectinolytic genes in R.

pusillus. The nucleotidic and the deduced amino acid sequences show a significant similarity to

other fungal pectin lyase genes. Also, we performed a phylogenetic analysis of the deduced amino

acid sequence of Rppnl depend on the reported sequences of PNLs from other sources and

compared those of other organisms. The analyses revealed an early separation of bacterial pectin

lyases from those found in fungi and oomycetes. These results were confirmed by comparison

analysis of conserved PNL motifs. Future work, southern analysis, and northern blotting analysis

are planned to understand the genetic message and to detect gene distribution inside R. pusillus

genome. Moreover, expression of the pectinase coding gene will be conducted and identified using

mass spectroscopy.


190

7.6. References


2016. 6(1): p. 47.

2. Yadav, S., et al., Pectin lyase: A review. Process Biochemistry, 2009. 44(1): p. 1-10.

3. Gysler, C., et al., Isolation and structure of the pectin lyase D-encoding gene from

Aspergillus niger. Gene, 1990. 89.

4. Qiang, H., et al., [Expression of a pectin lyase A gene from Aspergillus niger in Pichia

pastoris GS115]. Sheng wu gong cheng xue bao= Chinese journal of biotechnology, 2009.

25(12): p. 1962-1968.

5. Kitamoto, N., et al., A second pectin lyase gene (pel2) from Aspergillus oryzae KBN616:

its sequence analysis and overexpression, and characterization of the gene products. J

Biosci Bioeng, 2001. 91.

6. Trigui-Lahiani, H. and A. Gargouri, Cloning, genomic organisation and mRNA expression

of a pectin lyase gene from a mutant strain of Penicillium occitanis. Gene, 2007. 388.

7. Bazzolli, D.S., et al., Molecular characterization and expression profile of pectin-lyase-

encoding genes from Penicillium griseoroseum. Can J Microbiol, 2006. 52.

8. Altschul, S.F., et al., Gapped BLAST and PSI-BLAST: a new generation of protein

database search programs. Nucleic Acids Res, 1997. 25.



45-60.

10. Harmsen, J.A.M., M.A. Kusters-van Someren, and J. Visser, Cloning and expression of a

second Aspergillus niger pectin lyase gene (pelA): Indications of a pectin lyase gene family

in A. niger. Curr Genet, 1990. 18.



12. Yadav, P., et al., In silico analysis of pectin lyase and pectinase sequences. Biochemistry

(Moscow), 2009. 74(9): p. 1049-1055.

Chapter 8

Discussion and remarks

Discussion and remarks Chapter 8

192

8.1. Discussion and remarks

In latest years, fungal enzyme production is a particularly crucial and fast-growing sector in the

fermentation industry. According to Global Industry Analysts Inc., the global market for industrial

enzymes is forecast to reach US$ 3.74 billion by the year 2015

(http://prweb.com/releases/industrial_enzymes/proteases_carbohdrases/prweb8121185.htm).

Amongst these enzymes, pectinases are one of the most significant type of industrial enzymes and

their production represents about 10% of the overall manufacturing of enzyme.

Pectinases are essential in a broad range of industrial applications, and one of the furthermost

important enzymes in the food and beverage industries. As the world industrial production

increases, it is necessary to search for the extension to cover the market demand [1]. The necessity

for pectinolytic enzymes has started exceeding the supply amount in the market, and an important

development in the enzyme production is required [2, 3]. Another striking element that hinders the

use of the available pectinases is their lack of thermal stability, which prevents them from covering

several industrial applications. Furthermore, the major complications in the exploitation of

commercial enzymes are their yield, specificity, and the production cost. Novel enzymes for use

in commercial applications, with desired biochemical and physio-chemical characteristics and

inexpensive cost of production, are required. Therefore a potential solution to alleviate the

technical challenges described before is the identification of pectinolytic enzymes with enhanced

specificity to cover the specific conditions for the specific industrial application [4].


193

In previous literature, the emphasis has been on fermentation optimization, biochemical

characterization, genetics and strain improvement for pectinase production from fungi. However,

solid-state fermentative production, kinetic studies and pilot scaling up are not well investigated

in the available literature. Based on the previous challenges, the current project was conducted to

provide an effective production of pectinase enzyme with a reduction of process cost [5].

Rhizomucor pusillus is an unexplored candidate for Pectolyase production. Moreover, the

application of strain development and genetic recombination is not well studied by Rhizomucor

pusillus. The lack of information related to R. pusillus genome sequence leads to propose that the

current research is an interesting as well as challenging topic.

In order to economize the process, different cheaper substrates such as lemon peel, wheat bran,

sugarcane bagasse and sugar beet were used as a sole carbon source for the production of

pectolyase. Fermentation kinetics of R. pusillus from different low-cost substrates was studied.

The higher yield of pectolyase was observed due to the rich content of pectin on the fermentation

media. In submerged fermentation, maximum activity was attained by using orange peel extract,

giving a result of 28 U/ mL for R. pusillus. The results highlight the importance of pectin reached

substrates to induce the pectinolytic activities. These come with an agreement with several

microbial strains which are recognized as significant pectinases producers [2, 6-8].

Another important parameter that influence pectinases production is mycelial morphology. The

formation of pellets exhibits an efficient secretion of pectinolytic enzymes. Herein, utilization of

lemon peel via submerged fermentation and moderate shaking speed provided pellet formation by

R. pusillus.


194

The process avoids the formation of clumps which is not preferable for enzyme production. The

influence of pellet formation in correlation to enzyme activities was previously proven by [9-11].

The importance of defining the efficient fermentation process is one of the main key elements in

enzyme production. A sequential optimization of process parameters and fermentation media is

required for improvement of enzyme production [12-15].

The present study reports on the utilization of various agro-industrial residues to produce

pectolyase from R.pusillus via solid-state fermentation. Production of PNL was optimized at the

laboratory scale and scaled-up utilizing a rotating drum bioreactor.

The maximum PNL activity was achieved with a solid media containing wheat bran, lemon peel

powder, and sugarcane bagasse. These findings support the hypothesis of using the agriculture

residues to improve both enzyme production and reduce the cost [15, 16].

Strain development is a second key factor to improve enzyme production. Herein, Genome

shuffling (GS) is an efficient approach for rapid microbial phenotype improvement used for

industrial purposes. This approach is a conventional breeding technology, recently introduced for

strains development of the desirable phenotype [17]. It combines the benefit of multi-parental

crossing and several recursive fusion rounds which allow the entire genomes recombination based

on protoplast fusion [18, 19]. Moreover, fusants (hybrids) produced by GS can be used safely in

food industries as they are not deliberated as genetically modified.

Herein, a firsthand R. pusillus type strain for pectinase production was developed using GS.

Pectolyase activity was improved and reached 12.4, which is 3 times higher than A. sojae and R.

pusillus. The fusant strain had 18.4 times in enzyme productivity when compared to M5/6 by

submerged fermentation (SmF).


195

It is important to mention that there is no report to date for GS application in pectinase production

by R. pusillus. The current study can be considered as a potent tool for extending genome shuffling

application and opening a new area in pectinase research in the development of desired hybrids

that meet market demand [17, 20, 21].

The physicochemical properties of the pectolyase enzyme is a crucial part of the industrial process.

The effects of the optimal pH and temperature lead to the specific industrial application [22-24].

Here, the filamentous fungus (R. pusillus and AR9-fusant) displays characteristics that make the

secreted crude extract an efficient enzyme complex for industrial applications. For instance, In

juice and wine production,

enzymes have been used to improve the yield, decrease the viscosity, clarify the juices and increase

product stability. In this process, a thermal treatment is essential, and the pectinase enzyme should

be thermostable [25, 26]. In comparison with the current results, the optimal temperature of PNL

enzyme produced by R. pusillus and AR9 fusant was 40 and 45 ºC. The obtained data is suitable

for several industries that need a heat treatment [27].

The ability to isolate a gene coding for a particular enzyme is vital for overexpression and studying

the regulation of the target gene. In research on pectinases, the gene coding for different pectinases

was isolated and mainly expressed in Aspergillus strains [28].

Nevertheless, on pectin lyase by R. pusillus, no research has been done. There is a lack of

information on the database related to this topic. It makes the topic interesting to study as well as

challenging to conduct. In this investigation, for the first time, the Rppnl gene which encodes the

pectin lyase of R. pusillus was isolated. The identified gene will be used for expression.


196

8.2. Future outlook

In enzyme production, solid state fermentation has gained attention from both researchers and

industry. Several papers have performed on the utilization of SSF, with studies on the effects of

different factors on the potential for different metabolites production by fungi. The main focus of

these articles were SSF processes at laboratory-scale. Conversely, very few works have been

conducted on the engineering aspects and problems of scale-up [29, 30].

Scaling-up of the fermentation process at reactor level is very challenging, and this provides the

focus on the differences between lab-scale in comparison with industrial-scale [31]. In the current

study, AR9-fusant produces pectin lyase five times more than the parental strain R. pusillus at flask

level. The main goal now to evaluate the production efficiency using rotating drum bioreactor and

optimize the operating parameters for the successful scaling-up process by the developed fusant.

Another important research point is the application of the enzyme complex in the different food

process. It is well known the role of pectinases in a wide industrial process, and several reviews

have summarized their application [1, 32, 33]. Nevertheless, the new objectives are in the

utilization of pectinase in human nutrition, which includes the industrial production of functional

foods [23]. Regarding this concern, both AR9-fusant and R. pusillus have shown significant

potential in the secretion of different PDEs complexes via different fermentation modes. It is

important now to test the obtained complexes for diverse industrial applications such as different

type of juice clarfication, oil extraction and tea fermentation.


197

Crude extract characterization is an important element to determine the suitable applications. In

this concern, mass spectroscopy analysis of the secreted proteins in the crude extract is a need for

the obtained complexes to identify the existing pectinases activities. Herein, several trials have

been done during the current study, and various PDEs corresponding proteins were identified.

However, several proteins were not identified because of lack of genome sequence data. A great

focus is needed in the current point to understand more the type of the secreted protein as a function

with fermentation mode, cultivation media, and strain type.

One more important research point is the expression of Rppnl gene. The gene has been identified

for the first time from R. pusillus. The expression can be performed using different hosts either

bacteria, yeast or fungi. In the previous studies, pectin lyase coding gene has been isolated from

various microorganisms either bacteria or fungi such as Colletotrichum lindemuthianum and [34], Geobacillus stearothermophilus [35], Penicillium purpurogenum [36] and Penicillium occitanis

[37]. The information from this part will be important in protein identification using the expressed

protein sequences as a reference.


198

8.3. References


2016. 6(1): p. 47.

2. Sethi, B.K., P.K. Nanda, and S. Sahoo, Enhanced production of pectinase by

Aspergillusterreus NCFT 4269.10 using banana peels as substrate. 3 Biotech, 2016. 6(1):

p. 36.

3. Pasha, K.M., Molecular and biochemical characterization of pectinolytic potential of

microbes isolated from industrial fruit waste. 2015.

4. Fernandes, P., Enzymes in Food Processing: A Condensed Overview on Strategies for

Better Biocatalysts. Enzyme Research, 2010. 2010: p. 19.

5. Pitol, L.O., et al., Production of pectinases by solid-state fermentation in a pilot-scale

packed-bed bioreactor. Chemical Engineering Journal, 2016. 283: p. 1009-1018.

6. Mahmood, A.U., J. Greenman, and A.H. Scragg, Orange and potato peel extracts: Analysis

and use as Bacillus substrates for the production of extracellular enzymes in continuous

culture. Enzyme and Microbial Technology, 1998. 22(2): p. 130-137.

7. Andrade, M.V.V.d., et al., Production and partial characterization of alkaline

polygalacturonase secreted by thermophilic Bacillus sp. SMIA-2 under submerged culture

using pectin and corn steep liquor. Food Science and Technology (Campinas), 2011. 31(1):

p. 204-208.

8. Baffi, M.A., et al., Fungi isolated from olive ecosystems and screening of their potential

biotechnological use. New Biotechnology, 2012. 29(3): p. 451-456.

9. Tari, C., N. Gögus, and F. Tokatli, Optimization of biomass, pellet size and

polygalacturonase production by Aspergillus sojae ATCC 20235 using response surface

methodology. Enzyme and Microbial Technology, 2007. 40(5): p. 1108-1116.




11. Ahmed, I., et al., Bioprocessing of citrus waste peel for induced pectinase production by

Aspergillus niger; its purification and characterization. Journal of Radiation Research and

Applied Sciences, 2016. 9(2): p. 148-154.


199

12. Baladhandayutham, S. and V. Thangavelu, Optimization and Kinetics of Solid-State

Fermentative Production of Pectinase by Aspergillus awamori. International Journal of

ChemTech Research, 2011. 3(4): p. 1758-1764.

13. Demir, H., et al., Optimization process parameters for the utilization of orange peel to

produce polygalacturonase by solid-state fermentation from an Aspergillus sojae mutant

strain. Turk J Biol, 2012. 36: p. 394-404.

14. Embaby, A.M., et al., Raw agro-industrial orange peel waste as a low cost effective

inducer for alkaline polygalacturonase production from Bacillus licheniformis SHG10.

SpringerPlus, 2014. 3(1): p. 327.

15. Koser, S., et al., Utilization of Aspergillus oryzae to produce pectin lyase from various

agro-industrial residues. Journal of Radiation Research and Applied Sciences, 2014. 7(3):

p. 327-332.


polygalacuronase from agro-based products by Aspergillus sojae 2011. Vol. 6. 2011.

17. Leja, K., K. Myszka, and K. Czaczyk, Genome shuffling: a method to improve

biotechnological processes. BioTechnologia. Journal of Biotechnology Computational

Biology and Bionanotechnology, 2011. 92(4).

18. Zhang, Y.-X., et al., Genome shuffling leads to rapid phenotypic improvement in bacteria.

Nature, 2002. 415(6872): p. 644-646.

19. Petri, R. and C. Schmidt-Dannert, Dealing with complexity: evolutionary engineering and

genome shuffling. Current opinion in biotechnology, 2004. 15(4): p. 298-304.

20. Gong, J., et al., Genome shuffling: progress and applications for phenotype improvement.

Biotechnology Advances, 2009. 27(6): p. 996-1005.

21. Stephanopoulos, G., Metabolic engineering by genome shuffling. Nat Biotech, 2002. 20(7):

p. 666-668.

22. Kashyap, D., et al., Applications of pectinases in the commercial sector: a review.


23. Khan, M., E. Nakkeeran, and S. Umesh-Kumar, Potential application of pectinase in

developing functional foods. Annual review of food science and technology, 2013. 4: p.

21-34.


200



25. Li, K., et al., Two thermophilic fungal pectinases from Neosartorya fischeri P1: Gene

cloning, expression, and biochemical characterization. Journal of Molecular Catalysis B:

Enzymatic, 2015. 118: p. 70-78.



45-60.

27. Tapre, A. and R. Jain, Pectinases: Enzymes for fruit processing industry. International

Food Research Journal, 2014. 21(2): p. 447-453.

28. Yadav, S., et al., Pectin lyase: A review. Process Biochemistry, 2009. 44(1): p. 1-10.

29. Thomas, L., C. Larroche, and A. Pandey, Current developments in solid-state fermentation.

Biochemical Engineering Journal, 2013. 81: p. 146-161.

30. Hussain, A., et al., Influence of operational parameters on the fluid-side mass transfer

resistance observed in a packed bed bioreactor. AMB Express, 2015. 5: p. 25.

31. Farinas, C.S., Developments in solid-state fermentation for the production of biomass-

degrading enzymes for the bioenergy sector. Renewable and Sustainable Energy Reviews,

2015. 52: p. 179-188.

32. Araujo, R., M. Casal, and A. Cavaco-Paulo, Application of enzymes for textile fibres

processing. Biocatalysis and Biotransformation, 2008. 26(5): p. 332-349.

33. Kohli, P. and R. Gupta, Alkaline pectinases: A review. Biocatalysis and Agricultural

Biotechnology, 2015. 4(3): p. 279-285.

34. Lara-Márquez, A., et al., Cloning and characterization of a pectin lyase gene from

Colletotrichum lindemuthianumand comparative phylogenetic/structural analyses with

genes from phytopathogenic and saprophytic/opportunistic microorganisms. BMC

Microbiology, 2011. 11(1): p. 260.

35. Demir, N., et al., Purification and characterization of a pectin lyase produced by

Geobacillus stearothermophilus Ah22 and its application in fruit juice production. Annals

of microbiology, 2011. 61(4): p. 939-946.


201

36. Pérez-Fuentes, C., M. Cristina Ravanal, and J. Eyzaguirre, Heterologous expression of a

Penicillium purpurogenum pectin lyase in Pichia pastoris and its characterization. Fungal

Biology, 2014. 118(5–6): p. 507-515.

37. Trigui-Lahiani, H. and A. Gargouri, Cloning, genomic organisation and mRNA expression

of a pectin lyase gene from a mutant strain of Penicillium occitanis. Gene, 2007. 388.

List of Publications

202


The thesis results is presented in the following articles:

1- Rodrigo Mora-lugo, Patrik R. Judith Zimmermann, Amira M. Rizk and Marcelo

Fernandez-Lahore, Development of a transformation system for Aspergillus sojae based on the

Agrobacterium tumefaciens-mediated approach “Published in BMC Microbiology 2014, 14:

274”.

2- Amira Mohamed Abd Elaal Rizk, Sonja Diercks-Horn, Rodrigo Mora-lugo, and Marcelo

Fernandez-Lahore, Pectolyase from solid-state cultures of Rhizomucor pusillus DSM 1331

“Peer reviewer in Process Biochemistry 2018”.

3- Amira Mohamed Abd Elaal Rizk, Martin Kangaw and Marcelo Fernandez-Lahore,

Genome shuffling: an innovative in improvement of pectin depolymerizing enzymes

production by Rhizomucor pusillus DSM 1331 “In preparation to be submitted in Bioprocess

Technology BMC Microbiology”.

4- Amira Mohamed Abd Elaal Rizk and Marcelo Fernandez-Lahore, Screening and

Production of pectin depolymerizing enzymes using a new strain zygomycetes strain using

different fermentation mode “In preparation to be submitted in Journal of Biotechnology”.

5- Amira Mohamed Abd Elaal Rizk, and Marcelo Fernandez-Lahore, Comparative study of

biochemical characterization and proteomic analysis of novel extracellular pectin degrading

enzymes secreted by Rhizomucor pusillus DSM 1331 “In preparation to be submitted in J

Bioprocess Technology”.

6- Amira Mohamed Abd Elaal Rizk, and Marcelo Fernandez-Lahore, Molecular

Identification of Novel pectin lyase encoding gene from Rhizomucor pusillus “In preparation

to be submitted in Current Genetic”.


203

List of Conferences (Oral presentation /Poster/ Attendance) and workshops were

participated:

1- The 16th European Congress on Biotechnology on 13-16 July 2014 Edinburg, Scotland

(Poster)

2- Bioprocess platform for the Aspergillus sojae PGzyme systems with the acronym PGSYS

3rd meeting on 26-29 May 2014, Izmir, Turkey (Oral Presentation).

3- NAFI-2014 International Food Congress on 26-29 May 2014, Izmir, Turkey (Attendance).

4- Bioprocess platform for the Aspergillus sojae PGzyme systems with the acronym PGSYS

2nd meeting on 9-11 July 2013 Puerto Vallarta, Mexico (Oral Presentation).

5- The Eighth International Aspergillus Congress ASPERFEST on 8 March 14-15, 2011

Asilomar Conference Center Pacific Grove, California, USA (Poster)

Documents

Production of pectolyase from Rhizomucor pusillus by solid