~l l>h.::>bt>A • ~ NU.l O 1 ~b 7

. C1 - --- - - -- ~v: ~~~oL UUUO l : ~~0~g ~U1Nb~ OF TH~

J T_ UN AL ACAb~M I 0 ~

Proceedings OF THE

. . MAY 1987

VOLUME 84

NUMBER 10

National Academy of Sciences ()f 'I H~~ UNI1 ED STATES OF AMERICA

PFIZER EX. 1032 Page 1

t (

Proceedings OF THE

National Academy of Sciences OF THE UNITED STATES OF AMERICA

Officers of the Academy

Editorial Board of the Proceedings

-----~----------~-- --- - ---------- -- -- --

FRANK PRESS, President JAMES D. EBERT, Vice President BRYCE CRAWFORD, JR., /lome Secretary WILLIAM E. GoRDON, Foreign Secretary ELKAN R. BLOUT, Treasurer

ROBERT H. ABELES GORDON /\.. BA YM WILLIAM F. BRACE RONALD BRESLOW MICHAEL J. CHAMBERLIN

MAXINE F. SINGER, Chairman MARY-DELL CIIILTON EDWARD E. DAVID, JR. STUART 11.. KoRNFELD DANIEL E. KosHLAND, JR. PETER D. LAX DANIEL NATIIANS

Mana~:ing Editor: FRANCES R. ZWANZIG Senior Associate Editor: GARY T. CocKs Associate Editor: CAY Bun.ER Associate Editor: JoliN M. MALLOY t1ssociate Editor: MARILYN J. MASON A~·sociate Editor: JANET L. MoRGAN Associate Editor: T. PEARSON Associate l:..aitor: DoROTHY P. SMITH Associate Editor: Cou;NE WALDEN

HERBERT E. SCARF SoLoMoN H. SNYDER HAROLD V ARM US THOMAS /\.. WALDMANN FRANK II. WESTIIEIMER

Assistant Managing Editor: JoANNE D'AMICO

Senior Production Editor: LYNN II.. WASSYNG Production Editors: BARBARA II.. BACON, RUTII E. CROSSGROVE, ScotT C. HERMAN,

MARGARET M. MADELEINE, JANET L. OVERTON, KATIILEEN RUBY, DoN C. TIPI'MAN, DEBORAH J. WEINER

Administrative Assistants: DELORES DANKS, CYNDY MATHEWS Manuscript Coordinators: EVELYN JARMON, JACQUELINE PERRY Circulation: JULIA LITTLE, VIRGINIA TREADWAY

Editorial correspondence: PROCEEDINGS OF TilE NATIONAL 1\.CADEMY OF SCIENCES, 2101 Con~titution /\.venue, Washing­ton, DC 20418.

Business correspondence: Circulation Office of the PROCEEDINGS, Nationalll.cadcmy of Sciences, 2101 Constitution Ave­nue, Washington, DC 20418.

Information for Contributors: See issue Number 1, January 1987.

Copyright: The National Academy of Sciences has copyrighted this journal as a collective work and does not own copy­rights for individual articles. Requests for permission to reproduce parts of individual articles or for reprints of individual articles should be addressed to the authors. Microforms of complete volumes arc available to regular sub~cribcrs only and may be obtained from University Microfilms, Xerox Corporation, Ann Arbor, MI 48103.

Subscriptions: 11.11 correspondence concerning subscriptions should be addressed to the Circulation Office of the PROCEED­INGS. Subscriptions are entered on a calendar year basis only. For 1987, subscription rates arc as follows-in the United States; student/postdoctoral, $65; personal, $185; institutional, $215; elsewhere; student/postdoctoral, $100; personal, $220; institutional, $250. Information regarding air mail postage rates is available from the Circulation Office. Subscribers are requested to notify the Circulation Office of the PROCEEDINGS 6 weeks in advance of any change of address; also the local postmaster. The Academy is not responsible for nonreceipt of issues because of an improper address unless a change of address is on file. The notice of address change should list both the old and new addresses. Claims for replacement cop~es will not be honored more than 60 days after the issue date for domestic subscribers and not more than 90 days after the 1ssuc date for foreign subscribers.

Back /~sues: Volumes 79-83, January 1982 and thereafter, arc available from the Circulation Office of the PROCEEDINGS. The pnce of a single issue is $13.00.

Second class postage paid at Wa.rhington, DC, and ill additional mailing offices. PRINTED IN TilE USA

~ROCEEDI~GS OF TilE NATIONAL 1\.CADEMY OF SCIENCES OF THE UNITED STATES OF /\.MERICA (ISSN-0027-8424) is pub­lished semunonth/y by THE NATIONAL ACADEMY OF SCIENCES, 2101 Constitution Avenue, Washington, DC 20418.

iD 1987 by THE NATIONAL ACADEMY OF SCIENCES OF TilE UNITED STATES OF /\.MERICA.

POSTMASTER: Send address changes to: PROCEEDINGS OF TilE NATIONAL ACADEMY oF SCIENCES OF TilE UNITED STATES OF AMERICA, 2101 Constitution Ave., Washington, DC 20418.

PFIZER EX. 1032 Page 2

Proceedings OF THE

National Academy of Sciences

OF THE UNITED STATES OF AMERICA

May 1987 Volume 84, Number 10 pp. 3081-3536

Table of Contents

AUTHOR INDEX

Physical Sciences

CHEMISTRY

Phytotoxins from the pathogenic fungi Drechslera maydis and Drechslera sorghicola

Accessible surface areas as a measure of the thermodynamic parameters of hydration of peptides

Discrete wave mechanics: Multidimensional systems

MATHEMATICS

Algebraic K-theory of discrete subgroups of Lie groups

Biological Sciences

BIOCHEMISTRY

Specific inhibition of Trypanosoma cruzi neuraminidase by the human plasma glycoprotein "cruzin"

Regulation of actomyosin ATPase activity by troponin-tropomyosin: Effect of the binding of the myosin subfragmcnt 1 (S-l)·ATP complex

F. Sugawara, G. Strobel, R. N. Strange, J. N. Siedow, G. D. VanDuyne, and J. Clardy

Tatsuo Ooi, Motohisa Oobatake, George Nemethy, and Harold A. Scheraga

Frederick T. Wall

F. T. Farrell and L. E. Jones

R. P. Prioli, I. Rosenberg, and M. E. A. Pereira

Lois E. Greene, David L. Williams, Jr., and Evan Eisenberg

vii

3081

3086

3091

3095

3097

3102

-------------------------------------------------------------------------- ----- -

PFIZER EX. 1032 Page 3

Contents

Deduced amino acid sequence of bovine retinal Goa: Similarities to other guanine nucleotide-binding proteins

Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

Sequences from a prokaryotic genome or the mouse dihydrofolate reductase gene can restore the import of a truncated precursor protein into yeast mitochondria

Thyroid hormone regulates expression of a transfected a-myosin heavy-chain fusion gene in fetal heart cells

Properties of the duplex DNA-dependent ATPase activity of Escherichia coli RecA protein and its role in branch migration

Crystal structure of a snake venom cardiotoxin

Insulin stimulates phosphorylation of a 120-kDa glycoprotein substrate (pp120) for the receptor-associated protein kinase in intact H-35 hepatoma cells

Properties of a genetically engineered G domain of elongation factor Tu

Secretin stimulates cyclic AMP and inositol trisphosphate production in rat pancreatic acinar tissue by two fully independent mechanisms

Synchrotron x-ray diffraction studies of actin structure during polymerization

Cotranslational insertion of selenocysteine into formate dehydrogenase from Escherichia coli directed by a UGA codon

Temporal and tissue-specific expression of mouse ets genes

Apparent lack of discrimination in the reading of certain codons in Mycoplasma mycoides

Aberrant splicing events that are induced by proviral integration: Implications for myb oncogene activation

Reaction of argininosuccinase with bromomesaconic acid: Role of an essential lysine in the active site

A nonsense mutation causes hereditary goitre in the Afrikander cattle and unmasks alternative splicing of thyroglobulin transcripts

Role of DNA topoisomerase I in the transcription of supercoiled rRNA gene

Endonuclease IV of Escherichia coli is induced by paraquat

Identification and synthesis of a recognition signal for the attachment of glycosaminoglycans to proteins

lac repressor blocks in vivo transcription of lac control region DNA

RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia of latently infected mice

Rat ce.llular retinol-binding protein: eDNA sequence and rapid retmol-dependent accumulation of mRNA

Purification, properties, and immunocytochemical localization of human liver peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase

Isolation of a cytochrome aa3 gene from Bradyrhizobium japonicum

ii

Krisa P. Van Meurs, C. William Angus, Sukadev Lavu, Hsiang-Fu Kung, Susanne K. Czarnecki, Joel Moss, and Martha Vaughan

Hugh G. Griffin, Timothy J. Foster, Simon Silver, and Tapan K. Misra

Alison Baker and Gottfried Schatz

Thomas A. Gustafson, Bruce E. Markham, Joseph J. Bah!, and Eugene Markin

Stephen C. Kowalczykowski, Jennifer Claw, and Renee A. Krupp

B. Rees, J.P. Samama, J. C. Thierry, M. Gilibert, J. Fischer, H. Schweitz, M. Lazdunski, and D. Moras

Nicola Perrotti, Domenico Accili, Bernice Marcus-Samuels, Robert W. Rees-Jones, and Simeon I. Taylor

Andrea Parmeggiani, Guido W. M. Swart, Kim K. Mortensen, Michael Jensen, Brian F. C. Clark, Luciana Dente, and Riccardo Cortese

E. R. Trimble, R. Bruzzone, T. J. Biden, C. J. Meehan, D. Andreu, and R. B. Merrifield

Paul Matsudaira, Joan Bordas, and M. H. J. Koch

F. Zinoni, A. Birkmann, W. Leinfelder, and A. Bock

Narayan K. Bhat, Robert J. Fisher, Shigeyoshi Fujiwara, Richard Ascione, and Takis S. Papas

Tore Samuelsson, Youssef S. Guindy, Florentyna Lustig, Tomas Boren, and Ulf Lagerkvist

Dan Rosson, Debbie Dugan, and E. Premkumar Reddy

C. J. Lusty and S. Ratner

M. H. Ricketts, M. J. Simons, J. Parma, L. Mercken, Q. Dong, and G. Vassart

Lalit C. Garg, Susan DiAngelo, and Samson T. Jacob

Emily Chan and Bernard Weiss

Mario A. Bourdon, Tom Krusius, Steven Campbell, Nancy B. Schwartz, and Erkki Ruoslahti

Marguerite A. Sellitti, Pamela A. Pavco, and Deborah A. Steege

Anne M. Deatly, Jordan G. Spivack, Ehud Lavi, and Nigel W. Fraser

David R. Sherman, R. Stephen Lloyd, and Frank Chytil

M. Kumudavalli Reddy, Nobuteru Usuda, M. Narahari Reddy, Edward R. Kuczmarski, M. Sambasiva Rao, and Janardan K. Reddy

Mark R. O'Brian and Robert J. Maier

3107

3112

3117

3122

3127

3132

3137

3141

3146

3151

3156

3161

3166

3171

3176

3181

3185

3189

3194

3199

3204

3209

3214

3219

PFIZER EX. 1032 Page 4

Contents

Partial amino acid sequence of apolipoprotein(a) shows that it is homologous to plasminogen

BIOPHYSICS

Single acetylcholine receptor channel currents recorded at high hydrostatic pressures

CELL BIOLOGY

Expression of p21"" in normal and malignant human tissues: Lack of association with proliferation and malignancy

The very late antigen family of heterodimers is part of a superfamily of molecules involved in adhesion and embryogenesis

Immunoglobulin A stimulates growth of the extrahepatic bile duct in BALB/c mice

Cytoskeletal association of human a-interferon-receptor complexes in interferon-sensitive and -resistant lymphoblastoid cells

An insulin-like growth factor (IGF) binding protein enhances the biologic response to IGF-1

Periodic crosslinking of microtubules by cytoplasmic microtubule-associated and microtubule-corset proteins from a trypanosomatid

Firefly luciferasc is targeted to peroxisomes in mammalian cells

Functional epithelial cell line cloned from rat parathyroid glands

Differential regulation of colony-stimulating factors and interleukin 2 production by cyclosporin A

Coinduction of glucose-regulated proteins and doxorubicin resistance in Chinese hamster cells

Growth factor(s) produced during infection with an adenovirus variant stimulates proliferation of nonestablished epithelial cells

Protein import into chloroplasts requires a chloroplast ATPase

A high molecular weight component of the human tumor necrosis factor receptor is associated with cytotoxicity

Chemical carcinogen-induced decreases in genomic 5-methyldeoxycytidine content of normal human bronchial epithelial cells

DEVELOPMENTAL BIOLOGY

Cell patterning in pigment-chimeric eyes in Xenopus: Germinal cell transplants and their contributions to growth of the pigmented retinal epithelium

EVOLUTION

A molecular phylogeny of the hominoid primates as indicated by two-dimensional protein electrophoresis

Geographic dialects in blind mole rats: Role of vocal communication in active speciation

iii

Dan L. Eaton, Gunther M. Fless, William J. Kohr, John W. McLean, Qin-Tu Xu, Chad G. Miller, Richard M. Lawn, and Angelo M. Scanu

S. H. Heinemann, W. Stiihmer, and F. Conti

Pilar Garin Chesa, Wolfgang J. Rettig, Myron R. Melamed, Lloyd J. Old, and Henry L. Niman

Y oshikazu Takada, Jack L. Strominger, and Martin E. Hemler

Sheila Fallon-Friedlander, Jeffrey R. Boscamp, Rachel Morecki, Frank Lilly, MarshallS. Horwitz, and Joy H. Glaser

Lawrence M. Pfeffer, Nowell Stebbing, and David B. Donner

R. G. Elgin, W. H. Busby, Jr., and D. R. Clemmons

Gregory T. Bramblett, Sulie Chang, and Martin Flavin

Gilbert-Andre Keller, Stephen Gould, Marlene Deluca, and Suresh Subramani

Kazushige Sakaguchi, Arthur Santora, Mark Zimering, Francesco Curcio, Gerald D. Aurbach, and Maria Luisa Brandi

M. Bickel, H. Tsuda, P. Amstad, V. Evequoz, S. E. Mergenhagen, S. M. Wahl, and D. H. Pluznik

J. Shen, C. Hughes, C. Chao, J. Cai, C. Bartels, T. Gessner, and J. Subjeck

Margaret P. Quinlan, Neil Sullivan, and Terri Grodzicker

Debkumar Pain and Gunter Blobel

Abla A. Creasey, Ralph Yamamoto, and Charles R. Vitt

Vincent L. Wilson, Ruth A. Smith, Jim Longoria, Mary Anne Liotta, Cynthia M. Harper, and Curtis C. Harris

R. Kevin Hunt, Jerry S. Cohen, and Barbra J. Mason

David Goldman, P. Rathna Giri, and Stephen J. O'Brien

Eviatar Nevo, Giora Heth, Avigdor Beiles, and Eliezer Frankenberg

3224

3229

3234

3239

3244

3249

3254

3259

3264

3269

3274

3278

3283

3288

3293

3298

3302

3307

3312

PFIZER EX. 1032 Page 5

Contents

GENETICS

Homology between the DNA-binding domain of the GCN4 regulatory protein of yeast and the carboxyl-terminal region of a protein coded for by the oncogene jun

A family of short, interspersed repeats is associated with tandemly repetitive DNA in the human genome

Random cloning of genes from mouse chromosome 17

Structure and expression of human dihydropteridine reductase

Gene tandem-mediated selection of coliphage >..-receptive Agrobacterium, Pseudomonas, and Rhizobium strains

Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique

Expression of retrovirally transduced genes in primary cultures of adult rat hepatocytes

Comparative anatomy of the human APRT gene and enzyme: Nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

Sequence analysis of spontaneous mutations in a shuttle vector gene integrated into mammalian chromosomal DNA

Molecular cloning and characterization of esterase-6, a serine hydrolase of Drosophila

Measurement of low levels of x-ray mutagenesis in relation to human disease (Correction)

IMMUNOLOGY

Molec~la; cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rap1d 1mmunoselection procedure

Biosynthesis: gl~cosylation, and partial N-terminal amino acid sequence of the T-cell-actlvatmg protein TAP

Resistance of cytotoxic T lymphocytes to lysis by a clone of cytotoxic T lymphocytes

Regulation of murine class I genes by interferons is controlled by regions located both 5' and 3' to the transcription initiation site

1a,25-Dihydroxyvitamin D3 inhibits y-interferon synthesis by normal human peripheral blood lymphocytes

Co~plete supp.ression of in vivo growth of human leukemia cells by specific 1mmunotoxms: Nude mouse models

Lymphocyte major histocompatibility complex-encoded class II structures may act as sperm receptors

Working principles in the immune system implied by the "peptidic self' model

MEDICAL SCIENCES

Interferon 'Y induces lung colonization by intravenously inoculated 816 melanoma cells in parallel with enhanced expression of class I major histocompatibility complex antigens

iv

Peter K. Vogt, Timothy J. Bos, and Russell F. Doolittle

Brion Mermer, Mark Colb, and Theodore G. Krontiris

Masanori Kasahara, Felipe Figueroa, and Jan Klein

Jean Lockyer, Richard G. Cook, Sheldon Milstien, Seymour Kaufman, Savio L. C. Woo, and Fred D. Ledley

Robert A. Ludwig

Walter W. Noll and Mary Collins

Jon A. Wolff, Jiing-Kuan Yee, Harold F. Skelly, Jane C. Moores, James G. Respess, Theodore Friedmann, and Hyam Leffert

Thomas P. Broderick, Dennis A. Schaff, Amy M. Bertino, Michael K. Dush, Jay A. Tischfield, and Peter J. Stambrook

Charles R. Ashman and Richard L. Davidson

J. G. Oakeshott, C. Collet, R. W. Phillis, K. M. Nielsen, R. J. Russell, G. K. Chambers, V. Ross, and R. C. Richmond

Charles Waldren, Laura Correll, Marguerite A. Sognier, and Theodore T. Puck

Brian Seed and Alejandro Aruffo

Hans Reiser, John Coligan, Baruj Benacerraf, and Kenneth L. Rock

David M. Kranz and HermanN. Eisen

Bette Korber, Leroy Hood, and Iwona Stroynowski

Helmut Reichel, H. Phillip Koeffler, Andreas Tobler, and Anthony W. Norman

Hideki Hara and Ben K. Seon

Ellyn R. Ashida and Virginia L. Scofield

Philippe Kourilsky, Gerard Chaouat, Chantal Rabourdin-Combe, and Jean-Michel Claverie

K. Taniguchi, M. Petersson, P. Hoglund, R. Kiessling, G. Klein, and K. Kiirre

3316

3320

3325

3329

3334

3339

3344

3349

3354

3359

3364

3365

3370

3375

3380

3385

3390

3395

3400

3405

PFIZER EX. 1032 Page 6

Contents

Recognition of tau epitopes by anti-neurofilament antibodies that bind to Alzheimer neurofibrillary tangles

Recognition of Alzheimer paired helical filaments by monoclonal neurofilament antibodies is due to crossreaction with tau protein

Purification and characterization of rat liver nuclear thyroid hormone receptors

Development of a monoclonal antibody specifically reactive to gastrointestinal goblet cells

Linkage of the Wiskott-Aldrich syndrome with polymorphic DNA sequences from the human X chromosome

Glucagon-like peptide I stimulates insulin gene expression and increases cyclic AMP levels in a rat islet cell line

Chimeric mouse-human IgG1 antibody that can mediate lysis of cancer cells

Androstenedione may organize or activate sex-reversed traits in female spotted hyenas

Monoclonal antibodies to the human insulin receptor that activate glucose transport but not insulin receptor kinase activity

Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23

Tis~ue distribution and clearance kinetics of non-transferrin-bound iron in the hypotransferrinemic mouse: A rodent model for hemochromatosis

MICROBIOLOGY

Isolation and characterization of the a-sialyl-{3-2,3-galactosyl-specific adhesin from fimbriated Escherichia coli

NEUROBIOLOGY

Cholinergic phosphatidylinositol modulation of inhibitory, G protein-linked, neurotransmitter actions: Electrophysiological studies in rat hippocampus

Neurofilament gene expression: A major determinant of axonal caliber

Calcium-dependent effect of the thymic polypeptide thymopoietin on the desensitization of the nicotinic acetylcholine receptor

Monoclonal antibody analysis of keratin expression in the central nervous system

Multiple neuropeptides in cholinergic motor neurons of Aplysia: Evidence for modulation intrinsic to the motor circuit

Quinolinic acid phosphoribosyltransferase: Preferential glial localization in the rat brain visualized by immunocytochemistry

Activation of a potassium current by rapid photochemically generated step increases of intracellular calcium in rat sympathetic neurons

v

Hanna Ksiezak-Reding, Dennis W. Dickson, Peter Davies, and Shu-Hui Yen

Nobuyuki Nukina, Kenneth S. Kosik, and Dennis J. Selkoe

Kazuo Ichikawa and Leslie J. DeGroot

M. Vecchi, S. Sakamaki, B. Diamond, A. B. Novikoff, P. M. Novikoff, and K. M. Das

Monica Peacocke and Katherine A. Siminovitch

Daniel J. Drucker, Jacques Philippe, Svetlana Mojsov, William L. Chick, and Joel F. Habener

Alvin Y. Liu, Randy R. Robinson, Karl Erik Hellstrom, E. David Murray, Jr., C. Paul Chang, and lngegerd Hellstrom

Stephen E. Glickman, Laurence G. Frank, Julian M. Davidson, Erla R. Smith, and P. K. Siiteri

John R. Forsayeth, Jose F. Caro, Madhur K. Sinha, Betty A. Maddux, and Ira D. Goldfine

F. Wang, C. D. Gregory, M. Rowe, A. B. Rickinson, D. Wang, M. Birkenbach, H. Kikutani, T. Kishimoto, and E. Kieff

C. M. Craven, J. Alexander, M. Eldridge, J. P. Kushner, S. Bernstein, and J. Kaplan

Thomas Moch, Heinz Hoschiitzky, Jorg Hacker, Klaus-D. Kroncke, and Klaus Jann

Paul F. Worley, Jay M. Baraban, Madeline McCarren, Solomon H. Snyder, and Bradley E. Alger

Paul N. Hoffman, Don W. Cleveland, John W. Griffin, Phillip W. Landes, Nicholas J. Cowan, and Donald L. Price

Frederic Revah, Christophe Mulle, Christian Pinset, Tapan Audhya, Gideon Goldstein, and Jean-Pierre Changeux

Maryellen C. Franko, Clarence J. Gibbs, Jr., Dorothy A. Rhoades, and D. Carleton G~dusek

Elizabeth C. Cropper, Philip E. Lloyd, William Reed, Renata Tenenbaum, Irving Kupfermann, and Klaudiusz R. Weiss

Christer Kohler, Etsuo Okuno, Per R. Flood, and Robert Schwarcz

Alison M. Gurney, Roger Y. Tsien, and Henry A. Lester

3410

3415

3420

3425

3430

3434

3439

3444

3448

3452

3457

3462

3467

3472

3477

3482

3486

3491

3496

PFIZER EX. 1032 Page 7

Contents

y-Aminobutyric acid exerts a local inhibitory action on the axon terminal of bipolar cells: Evidence for negative feedback from amacrine cells

Identification and purification of an irreversible presynaptic neurotoxin from the venom of the spider llololena curta

Neuropeptide Y-like immunoreactivity in rat cranial parasympathetic neurons: Coexistence with vasoactive intestinal peptide and choline acetyltransferase

Cloning and sequence analysis of eDNA for the canine neurotensin/neuromedin N precursor

Correlation of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine neurotoxicity with blood-brain barrier monoamine oxidase activity

Human immunodeficiency virus can productively infect cultured human glial cells

Social Sciences

PSYCHOLOGY

Initial localization of the acoustic conditioned stimulus projection system to the cerebellum essential for classical eyelid conditioning

vi

Masao Tachibana and Akimichi Kaneko

Chauncey W. Bowers, Heidi S. Phillips, Pamela Lee, Yuh Nung Jan, and Lily Y. Jan

Gabrielle G. Leblanc, Barry A. Trimmer, and Story C. Landis

Paul R. Dobner, Diane L. Barber, Lydia Villa-Komaroff, and Colleen McKiernan

Rajesh N. Kalaria, Mary Jo Mitchell, and Sami I. Harik

Cecilia Cheng-Mayer, James T. Rutka, Mark L. Rosenblum, Thomas McHugh, Daniel P. Stites, and Jay A. Levy

Joseph E. Steinmetz, Christine G. Logan, Daniel J. Rosen, Judith K. Thompson, David G. Lavond, and Richard F. Thompson

3501

3506

3511

3516

3521

3526

3531

PFIZER EX. 1032 Page 8

Proc. Nat/. Acad. Sci. USA Vol. 84, pp. 3439-3443, May 1987 Medical Sciences

1 Chimeric mouse-human JgG 1 antibody that can mediate lysis of cancer cells, ', · -

/-

(immunoglobulin domain eDNA/DNA transfection/tumor antigen/complement-dependent cytolysis/antibody-dependent cellular cytotoxicity)

ALVIN Y. Lru*t, RANDY R. ROBINSON*, KARL ERIK HELLSTROM:j:§, E. DAVID MURRAY, JR.*~, c. PAUL CHANG*, AND INGEGERD HELLSTROM:j:ll

*International Genetic Engineering, Inc., 1545 17th Street, Santa Monica, CA 90404; toncogen, 3005 First Avenue, Seattle, WA 98121; and Departments of §Pathology and IIMicrobiology, University of Washington Medical School, Seattle, WA 98195

Communicated by Paul D. Boyer, January 28, 1987 (received for review December 22, 1986)

ABSTRACT , A chimeric mouse-human antibody has been created that recognizes an antigen found on the surface of cells from many carcinomas. Immunoglobulin constant (C) domains of the mouse monoclonal antibody L6, Cy2a and CK, were substituted by the human Cyt and CK by recombining eDNA modules encoding variable or C domains. The eDNA constructs were transfected into lymphoid cells for antibody production. The chimeric antibody and mouse L6 antibody bound to carcinoma cells with equal affinity and mediated complement­dependent cytolysis. In the presence of human effector cells, the chimeric antibody gave antibody-dependent cellular cytotox­icity at 100 times lower concentration than that needed for the mouse L6 antibody. The chimeric antibody, but not the mouse L6 antibody, is effective against a melanoma line expressing small amounts of the L6 antigen. The findings point to the usefulness of the chimeric antibody approach for obtaining agents with strong antitumor activity for possible therapeutic usc in man. '>

The presence of tumor-associated antigens at the cell surface is a characteristic of many cancers. Since these antigens are either absent or found in much lower amounts in normal cells, it should be possible to use antibodies for targeting of tumors. A sizeable collection of relatively tumor-specific monoclonal antibodies (mAb) of mouse origin is available (1). Some of these mAb possess tumoricidal activity in the presence of human effector cells [antibody-dependent cellular cytotox­icity (ADCC)] or serum [complement-dependent cytotoxicity (CDC)] (2, 3). It has been shown (4) that partial tumor regression can be achieved when mAb possessing such functional activity are given to patients. One complication preventing repeated use of mouse mAb in man is that they are immunogenic. Furthermore, mouse mAb may interact less efficiently with human effector cells to mediate tumor de­struction.

A method made possible by recombinant DNA technology was chosen to generate chimeric mouse-human antibodies. It entails the replacement of the mouse constant (C) domain regions with the corresponding human equivalents (5-7). In principle, antibody molecules obtained by this approach should retain their specificity for antigen and thus their usefulness for targeting, be much less immunogenic to man, and perhaps have increased antitumor activity.

The mouse mAb L6 [IgG2a(K)] binds to a carbohydrate antigen found at the surface of cells from human carcinomas of the lung, breast, colon, and ovary (8). L6 can mediate CDC with human complement or ADCC with human effector cells (2). mAb L6 may thus be of use for tumor targeting, either in its native form or after conjugation of anticancer agents.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

3439

In this study we have generated a mouse-human chimeric L6 antibody in which the mouse constant domains Cy2a and C" are substituted by the human C.,1 and C". First, the cDNAs encoding the immunoglobulin genes were isolated. Next, restriction enzyme recognition sites were created in the eDNA sequences at the V /C junction (where V stands for variable) (9) by in vitro mutagenesis using oligodeoxyribo­nucleotides (10). The chimeric cDNAs thus constructed were then introduced into lymphoid cells by DNA transfection. The chimeric antibody isolated from the transfectants was compared with the mouse L6 for effector functions.

MATERIALS AND METHODS

DNA Transfection of Mouse Sp2/0 Lymphoid Cells. Expres­sion plasmid piNG2114 (50 f.Lg), linearized at a unique site (Aat II) in the nonessential bacterial region (see Fig. 3A), was transfected into 107 mouse Sp2/0 cells (CRL 1581, ATCC) by electroporation (11, 12). Transformants were selected in Dulbecco's modified Eagle's medium (DMEM) supplement­ed with 10% (vol/vol) fetal bovine serum (HyClone, Log~n, UT) and G418 at 0.8 mg/ml (GIBCO). The transfectwn frequency was between w-5 and 10-4• Human antibody in the medium was detected by ELISA (13).

Isolation of Chimeric Antibody. Antibody-producing ~ells were grown to a density of 106 cells per ml and then shtfted to serum-free DMEM 24 hr before harvest. Antibody secret­ed by the cells was concentrated by ultrafiltration, then chromatographed on a DEAE-cellulose column equilibrated in 40 mM NaCl/10 mM sodium phosphate, pH 8.0. The antibody in the flow-through was further purified to ap~arent homogeneity on protein A-Sepharose (14). For production of ascites fluid 106 cells were injected into pristane-primed BALB/c mi~e. The chimeric antibody was purified by anti­human IgG-Sepharose chromatography (14).

Functional Tests of the Chimeric L6 Antibody. The follow­ing tests were included: (i) measurement of antibody binding to target cells, either positive or negative for reactivity with the mouse L6; (ii) competitive inhibition of binding of L6 to these cells; (iii) assays for CDC and ADCC. The binding tests were performed using a Coulter model EPIC-C cell sorter (8). The assays for CDC and ADCC were carried out on 51Cr­labeled target cells (2, 3) that were exposed to antibodies and human serum or peripheral blood leukocytes over a 4-hr period.

Abbreviations: V, variable; C, constant; J ,joining; mAb, monoclonal antibody(ies); CDC, complement-dependent cytolysis; ADCC, an­tibody-dependent cellular cytotoxicity; SV40, simian virus 40; H, heavy. tTo whom reprint requests should be addressed. ~Present address: Department of Biochemistry, University of Cali­fornia, Riverside, CA 92521.

PFIZER EX. 1032 Page 9

3440 Medical Sciences: Liu et al. Proc. Nat!. A cad. Sci. USA 84 ( 1987)

A Lb Vn

met asp tro leu C2JAGTTTG'l'CTTAAGGCACCACTGAGCCCAAGTCTTAGACA'l'CATG GAT TGG CTG

BAL31del.

G'l'CGACTCT Aft If

Sail leader pept1de IFR1 trp asn leu leu phe leu met ala ala ala gln ser ala gln ala qln 'l'GG AAC TTG CTA T'l'C C'l'G ATG GCA GC'l' GCC Cl\l, AG'l' GCC Cl1l\ GCJ\ Cl\G

ile gln leu val gln s~r gYy p~o gYu l~u l~s l~s p~o gly qYu thr l\TC Cl\G 'I"l'G G'l'G Cl\G TCT GGA CCT GAG C'I'G 1\l\G Al1G CC'l' GG!1 GM; 1\Cl\

val lys ile ser cys lys ala ser qly tyr thr rohe t~R;1c~~~~ tyr qly GTC 1\l\G l\TC TCC TGC AAG GCT TCT GGG TAT ACC TTC 1\C!\ J,f,C T/\T c;r;r,

Bgl II

CDR11FR2 Ff121 met asn trp val lys gln ala pro qly lys gly leu lys trp met qly ATG AAC TGG G'l'G AAG CAG GCT CCI\ GGJ\ 1\l\G GGT TT!1 AM; TCr; l\TG c;r;c

Aha Ill

CDR2 trp ile asn thr tyr thr gly gln pro thr tyr ala asp asD rohe lys TGG ATA AAC ACC TAC ACT GGA CAG CCA ACA TAT GCT GAT GAC TTC AAG

Nde I

CDR21FR3 gly ara phe ala Dhe ser leu glu thr ser ala tyr thr ala tyr leu GGA CGG TTT GCC TTC TCT TTG GAA ACC TCT GCC TAC ACT GCC TAT TTG

gln ile asn asn leu lys asn glu aso met ala thr tyr ohe cys ala Cl,G l\'l'C 1\l\C 1\l\C CTC 1\l,l\ l\1\'l' GAG GAC ATG GCT l1Cl1 Tl\'1' TTC TG'I' CCI\

FR31CDR3 CDR31FR4 arq phe ser tyr gly asn ser arg tyr ser asro tyr tro qly qln gly AGA 'l'T'l' AGC 'l'A'l' GG'l' !1/\C TCA CG'l' TAC 'l'CT r;r,c 'l'AC TGG GGC Cl\!1 c;r~c

Dsp2,2

---------------JH2

thr thr leu thr val ser ser ala lys thr thr ala pro ser l\CC l\C'l' CTC ACA G'I'C 'l'CC 'l'CA GCC l\!1!. 1\Cl'. 1\C!, GCC CC!1 TCG-------

----------------- GC -----Ac;- G -----MJH2 Apo I

B L6 Vr:

leader pcpt1de met asp phe qln val gln ile ohe ser nhe leu leu

CgCCCCl\l\Gl\Cl\1\l\l\'l'G GAT TTT CAl\ GTG CAG ATT TTC AGC TTC CTG CTA

---eTc------------------ s· Sol 1

ile ser ala ser val ile met ser arg qlyl~ln ile val leu ser qln ATC AGT GCT 'I'CA G1'C l\1'/\ ATG 'I'CC 1\Gl\ GG!1 CM, A'l'T G'I"l' C'I'C 'I'CC C!1C

ser pro ala ile leu ser ala ser pro gly glu l~s vgl t~r l2u thr TCT CCI\ GCA A'l'C C'l'G 'I'CT GCA TC'I' CCI\ GGC GAG AN; r;Tc T1Cl\ 'l"l'r; AC'I'

~RliCD§l o o o o o o o C9,R11FR3 0

o cys arg ala ser ser ser val ser phe met asn trp tyr qln gln l~s TGC AGG GCC AGC 'l'CA AGT G'l'A ACT TTC ATG AAC TGG TAC ~AC CAG AAG

Kpn I

P~o gly ser ser pro lys pro trp ile :;:1~0l~ thr ser asn leu ala CCI\ GGA 'I'CC 'I'CC CCC AAA CCC TGG A'I''I' TAT CCC ACA TCC AAT TTG GC'l'

Bam HI

CDR21FR3 ser glu phe pro gly arg phe ser gly glu trn ser gly thr ser tyr 'l'C'I' GAG TTC CCT GG'l' CGC 'I"l'C AGT CCC GAG 1~G 'l'CT GGG ACC TCT TAC

ser leu ala ile ser arg val qlu ala glu a~o ala aYa t~r t~r t;r 'l'CT CTC GCA ATC AGC AGA G'!'G GAG GC'l' GAA GAT GCT GCC ACT '!'AT TAC

----------------------------JK5-FR31CDR3 o 0 0 CDR31FR4 c~s gin gln t~p asn s~r a~n pro l3u thr phe gly ala gly thr lys TGC CAG CAG TGG AAT AGT AAC CCI\ CTC ACG TTC GGT GC'l' GGG l\CC AAC

leu qlu leu lys C'l'G GAG C'l'G /\All-------------------------------------------

FIG. 1. Nucleotide sequence~ and predicted amino acid sequences of the L6 V11 (A) and V. (B). The framework CFR) and complementarity deter­mining region (CDR) segments arc indicated. The diversity (0) segment in V11 is underlined. Circles above the amino acid residues indicate that these residues matched to those obtained from peptide sequencing. The V 11 sequence is present in plasmid pH3-6a. The C23 at the 5' end was removed by BAL-31 nuclease digestion. The resultant DNA sequence at the 5' end h shown below the first line. An Apa I site was introduced by the oligo~ucko­tide primer MJH2Apal. The V. ~equence IS pres­ent in plasmid pL3-12a. The Cn at the 5' end was removed by oligonucleotide-mediated mutagene­sis. A //indlll site was introduced by the oligonu­cleotide primer J KHindlll.

PFIZER EX. 1032 Page 10

Medical Sciences: Liu et a/.

RESULTS Isolation of Mouse eDNA. A eDNA library was generated

from the L6 hybridoma cells by priming poly(A)+ RNA with oligo(dT) as described (9, 15). The probes used to screen the library were a JK5 oligonucleotide, d(GGTCCCAGCAC­CGAACG), for the light chain and a JH2 oligonucleotide, d(TGGCTGAGGAGACTGTGAGAG) for the heavy chain (where J stands for joining and H stands for heavy). Two methods (16, 17) were used to determine that the L6 K mRNA contains JKS sequences and that the L6 -y2a mRNA contains J 112 sequences.

Preparation of Mouse V-Region eDNA Modules. Restricti~n enzyme sites were engineered into the immunoglobulin eDNA around the V /C border for recombining mouse V regions to human C modules. The oligonucleotide MJH2Apai [d(ATGGGCCCTTTGTGCTGGCTGAGGAGACTGT) (with the restriction enzyme site underlined)] was used for mutagenesis of the V11 eDNA; and the oligonucleotide JKHindlll [d(CTCAAGCTTGGTCCC)] for that of the V K

eDNA. Restriction sites on the 5' side of the ATG codon were also created. The oligonucleotide d(GAAAATCCATTT­TGTCGACGGG) was used to generate a Sal I site eight residues on the 5' side of the V K ATG codon. By cleaving with Sal I the oligo[d(GC)] segment on the 5' side of the eDNA insert was removed. To remove the oligo[d(GC)] segment on the 5' side of the V11 eDNA, the nuclease BAL-31 (18) was used. The digested products were inserted into the vector M13mp19 (19) in such a way that the Ml3 Sal I site became a convenient site on the 5' side of the ATG codon. The DNA sequences of V H and V K arc shown in Fig. 1.

Human C-Region eDNA Modules. Human C-region cDNAs were isolated from libraries generated from the mRNA from two human lymphoblastoid cell lines, GM1500 and GM2146 (Human Genetic Mutant Cell Repository). The human Cyt

module has been described (9). The eDNA clone pGMH6 contains an Apa I site 16 nucleotide residues on the 3' side of the V /C border (Fig. 2).

The human CK module is a composite of two K cDN~s isolated from the GM1500 and GM2146 libraries. In plasmid pGML60, the 3'-untranslated region was derived from the K

mRNA of GM2146 while the coding region was from that of GM1500. The J KHindiii oligonucleotide described above was used to engineer a l/indlll recognition site at a position of the human J K segment analogous to that in the mouse J K

segment. Chimeric L6 Heavy- and Light-Chain Expression Plasmids.

The eDNA constructs were inserted into the vector se­quences of plasmid piNG2012E (9). Directionality of inser­tion was achieved by using a Sal I-BamHI bracket. piNG2012E contains regulatory sequences derived from plasmid pLl (20) that furnished the early promoter and splice donor-acceptor of simian virus 40 (SV40); and from plasmid pSV2neo (21) that furnished the transcription termination/ polyadenylylation signals of SV40. We added the mouse immunoglobulin heavy-chain gene transcription enhancer,

pGMl!6 humiln Cyl module

Proc. Nat/. A cad. Sci. USA 84 ( 1987) 3441

placed upstream of the SV40 promoter (9). The selectable marker is the Tn5 neogene that confers resistance to the drug 0418.

The heavy-chain plasmid piNG2111 was constructed by first joining the mouse VH eDNA module in a Sal 1-Apa I DNA fragment with the human Cy1 eDNA module in an Apa I-BamHI DNA fragment. The ligated fragments were then inserted into piNG2012E cleaved by Sal 1-BamHI. The light-chain plasmid piNG2119 was constructed by joining the mouse VK eDNA module in a Sal I-Hindlll DNA fragment with the human CK eDNA module in a Hindiii-BamHI DNA fragment. The same vector fragment was used (Fig. 3A). In both plasmids the eDNA gene is placed 11 nucleotide residues downstream of the SV 40 19S 3' -splice acceptor (9). The eDNA ends in a segment approximately A70G2o, where it is joined to the SV 40 transcription-termination/polyaden­ylylation sequences. Fig. 3B shows the incident nucleotide sequence changes made at the V /Cjunction as a result of the gene construction.

A two-gene plasmid, piNG2114, was constructed fro~ piNG2111 and piNG2119 in which the light- and heav~-chat.n gene transcription units are in tandem (Fig. 3A). By usm~ this plasmid, we introduced an equal ratio of heavy- and light­chain genes into recipient cells. Unexpectedly, we observed that there was a consistently higher expression of heavy than of light chain in all transfected cell lines examined (dat~ not shown). The two transcription units differ in that the ltght­chain gene is about 700 base pairs shorter than the heavy­chain gene, and the CK gene segment has a higher A+ T content. This imbalance was reduced by introducing more light-chain gene copies carried on a second plasmid with a different selectable marker [plNG2121a, an Eco-gpt (22) version of plNG2119].

Two initial Sp2/0 transformants, D7 and 3E3, obtained by transfection with piNG2114 were cultured for the isolation of chimeric antibody. D7 secretes 10% of the antibody produced by 3E3-K (17 J.Lg/liter) and y (77 J.Lg/liter) chains for D7 compared to K (100 J.Lg/liter) and y (700 J.Lg/liter) chains for 3E3.

Binding Characteristics of Chimeric Versus Mouse ~6 An­tibody. Table 1 shows that the chimeric L6 antibody bmds to cells from a human colon carcinoma (line C-3347) that express 5 x 105 molecules per cell of the antigen defined by the mouse L6 mAb (8). In a competition assay, 50% inh~biti~n of binding was achieved by the same amount of the chimer~c and mouse L6 (Fig. 4). Cells from a T-cellline, HSB-2, did not bind either mouse L6 or the chimeric antibody. Data on the melanoma line M-2669, clone 13 (3), are also included in Table 1 since this line, which expresses a low level of the L6-defi~ed antigen, was used for the functional studies (see below).

Chimeric L6 Antibody Mediates CDC and ADCC. Fig. 5 shows that both the chimeric and mouse L6 antibodies lysed tumor cells in the presence of human complement. The experiment further showed that the chimeric L6 gave higher CDC at all dilutions of the complement.

--- G 1 GTC Ace GTC TC'l' 'l'Cl\ I Gee ·rcc Ace l\l\G GGc cpA TCG G ------ost E II Apo I

FIG. 2. Human C-domain eDNA gene modules. The relevant sequences at the V /C junction of human Cy, and C. eDNA clones are shown. The Cyl clone contains a BstEII and an Apa I site that can be used to recombine with different V-domain eDNA genes. The c. clone does not contain a convenient recombination site; and an oligonucle­otide containing a l/ind!II site was used to introduce this site into the eDNA. The C-domain eDNA modules are pGMH6 and pGML60.

pGML60 humiln CK module

--------JK4------------------------------------Gl\T Cl\'l' C'l'C CCT C'l'C l\CT 'l''l'C GGC GGl\ GGG l\CC l\7\G G'I'G Gl\G l\TG l\l\!1-

I Sau 3A I

----------:1- C-T-­Hind Ill

PFIZER EX. 1032 Page 11

3442 Medical Sciences: Liu et al.

A

-CTC ACA GTC TCC T;;~ 1 ~~C AGC l\Cl\ l\1\G GGC CCI\ "1'-Apa I

mo hu

-ACC J'>!AG CTa) GAG ®TG AM CGI\ 1\CT ---Hlnd Ill

FIG. 3. (A) Expression plasmids. plNG2111 is the heavy-chain and p!NG2119 is the light-chain expression plasmid. They were used to construct piNG2114, a two-gene plasmid. Solid circles, mouse heavy-chain immunoglobulin gene enhancer; small arrows, SV40 early promoter; diamonds, bidirectional SV 40 transcription termination/polyadenylylation signals. (B) Nucleotide changes made in the V /C junction. Dotted residues in the V HCy1 junction were introduced by oligonucleotide-mediated mutagenesis. They are silent changes. Circled residues in the V .c. junction are residues contrib­uted by the human eDNA module to the mouse V. gene.

Fig. 6 shows ADCC tests with cells from two cell lines. At a ratio of 100:1 human peripheral blood leukocytes to the colon carcinoma line C-3347 cells, the chimeric L6 killed a greater fraction of the target cells (a maximum of98% versus 63%) and gave 50% ADCC at 100 times lower concentration than the mouse L6 (0.01 p,g/ml versus 1 p,g/ml, Fig. 6A). Significant ADCC of C-3347 cells (24% as compared to 3% lysis with lymphocytes alone) was observed down to a 3:1 ratio of effector cells to target cells when the chimeric L6 (at 2.5 p,g/ml) was used (Fig. 6B). Cell killing was specific because ADCC was not observed with the following three cell lines lacking detectable L6 antigens: B-celllines DHL-10 (Fig. 6C) and T51 (data not shown) and the T-cellline HSB-2

100

c 80 0

::g 60

:.c ~ 40

~ 20

50% Inhibition : Mouse L6= 1.9)Jg/ml Chimeric L6 = 1.9 )Jg/ml

1 10

Inhibiting Antibody (j.Jg/ml) 100

FIG. 4. Comparison between chimeric and standard mouse L6 in antibody inhibition assays, performed by fluorescence-activated cell sorting. C-3347 cells were incubated with the blocking antibodies before fluorescein isothiocyanate-conjugated mouse L6 (3 !Lg/ml) was added.

Proc. Nat!. A cad. Sci. USA 84 ( 1987)

Table 1. Binding of chimeric L6 and mouse L6 antibodies to cell lines used as targets for functional assays

Antibody

Antibody concentration,

!Lg/ml

Human colon carcinoma line C-3347 Mouse L6 30

10 3

Chimeric L6 (ascites) 30 10 3

Chimeric L6 (cell culture) 30 10 3

Human melanoma line M-2669 (clone 13) Mouse L6 30

Chimeric L6 (cell culture)

Human T-cell line HSB-2 Mouse L6 Chimeric L6 (ascites) Chimeric L6 (cell culture)

10 3

30 10 3

10 10 10

Binding ratio*

GAM GAH

38 49 40

2 2

7 3 1

NT NT NT

4 4 3

108 84 42

105 86 44

NT NT NT

4 2

*The binding ratio is the number of times a test sample is brighter than a control sample when treated with GAM (fluorescein isothio­cyanate-conjugated goat anti-mouse immunoglobulin) or with GAH (fluorescein isothiocyanate-conjugated goat anti-human immuno­globulin). For example, a ratio of 1 means that the test sample is as bright as the control; a ratio of2 means that the test sample is twice as bright as the control. NT, not tested.

(data not shown). Efficacy of the chimeric L6 was further demonstrated by its ability to lyse M-2669 melanoma cells (35% at 10 p,g/ml, 27% at 0.1 p,g/ml); the mouse L6 had no effect on these cells (9% at 10 p,g/ml, as compared to 10% lysis with lymphocytes alone, Lj: Table 1).

DISCUSSION

The mouse mAb L6 recognizes a carbohydrate antigen present in abundance in a variety of carcinomas. Normal tissues express only trace amounts of the antigen (8). Based on this specificity there is justification in considering L6 for cancer treatment with the mAb used either alone (2) or as a carrier of anticancer agents. However, the immunogenicity of mouse L6 mAb in man is a disadvantage for its sustained use in patients, and its functional activity (ADCC and CDC) may be insufficient to effect optimal tumor destruction at the

100

Z' 80 ·u ')< 60 0 0 -;:., 40 u ~

C-3347 Cells

(Chimeric L6

1:4 1:2 Undiluted

Dilution of Human Serum

FIG. 5. Titration of human serum (as a source of complement) in the presence of chimeric or mouse L6 at 2.5 iL£/ml.

PFIZER EX. 1032 Page 12

Medical Sciences: Liu et a/.

A 100

80

.£ ·~ 60 0 0 8- <10

~

C·3347 Cells E/T,100/I

I

,/;;---___ _ P:/~Chimeric L6 (I)

0~~--~----~~----L-----~--~~--00001 0.001 0.01 0.1 1 10

B 100

.z:-80 ·u § 60

0 ;;.. 40 u

c 100

0

Antibody ( }Jg/ml)

rMouse L6

~--..,_ _ __,r_Ly:._mphocyles alone

20 40 60 80 100

Effector Cells per Target Cell

DHL-10 Cells EIT,100/I

(IF5

~L6 002 0.2 2

Antibody ( }Jg/ml)

FIG. 6. (A) Titration of chimeric and mouse L6 antibodies in ADCC assays with human peripheral blood leukocytes. E/T, ef­fector-target cell ratio. Two preparations of chimeric L6 were used. <B) Titration of human peripheral blood leukocyte effector cells mediating ADCC in the presence of antibodies (2.5 J,Lg/ml). (C) Titration ofL6 (chimeric and mouse) in ADCC assays on the DHL-10 T-ccll line. 1F5 is a mouse mAb that recognizes the DHL-10 cells.

concentrations that can be attained in tumors after intrave­nous administration.

It is estimated that a mqjor immunogenic site resides in the Cu2 region (23) of the IgG molecule. As one approach to decrease this problem, one could generate chimeric mouse­human antibodies thereby replacing the immunogenic C do­mains of the mouse immunoglobulins with those of human immunoglobulins. We did this using eDNA rather than cloned genomic DNA (24, 25). We show here that this is a useful approach for producing chimeric antibody. In cell line 3E3 and its subclones close to 1 ttg/ml of IgGl protein was detected.

The chimeric antibody was found to bind to tumor cells as well as the mouse L6 antibody. The chimeric antibody was much more efficient than L6 in ADCC assays, killing a greater fraction of target cells at a concentration lower by a factor of 100. Furthermore, the chimeric L6 killed cells from a melanoma line that was refractory to ADCC by the mouse L6. In patients one may speculate that the chimeric L6 would remain longer in the circulation. This, in combination with

Proc. Nat/. Acad. Sci. USA 84 (1987) 3443

the functional attributes of chimeric L6, should make it a strong candidate for therapeutic trials. Some of the antibodies induced in man to mouse mAb were directed to idiotypic determinants (26, 27). It remains to be seen whether the immunogenicity of those determinants of the chimeric L6 will be different from that of the mouse L6.

The advantage of the eDNA approach lies in the ease with which immunoglobulin gene cDNAs can be isolated. The technology used for the present work should make it possible to convert many other mouse mAb to chimeric antibodies with improved antitumor activity via ADCC and CDC mechanisms. The chimeric antibodies will augment the relatively few human mAb currently used in the treatment of cancer (28).

We thank Cathy Shapiro, Phil Mack, Phil Mixter, Pam Smith, Susan Azemove, Grethe Lovold, and Pat McGowan for excellent technical assistance. We also thank Randy Wall for discussion, and Randy Wall, Carol Hersh, Arup Sen, Gary Wilcox, Perry Fell, Jeff Ledbetter, Peter Linsley, and Erik Milner for useful comments on the manuscript. The work was supported by INGENE and ONCOGEN.

1. Hellstrom, K. E. & Hellstrom, I. (1985) in Monoclonal Antibodies for Cancer Detection and 1!Jerapy, eds. Baldwin, R. S. & Byers, V. S. (Academic, New York), pp. 17-51.

2. Hellstrom, I., Beaumier, P. L. & Hellstrom, K. E. (1986) Proc. Nat/. Acad. Sci. USA 83, 7059-7063.

3. Hellstrom, I., Brankovan, V. & Hellstrom, K. E. (1985) Proc. Nat/. Acad. Sci. USA 82, 1499-1502.

4. Houghton, A. N., Mintzer, D., Cordon-Cardo, C., Welt, S., Fliegel, B., Vadhan, S., Carswell, E., Melamed, M. R., Oettgen, H. F. & Old, L. J. (1985) Proc. Nat/. Acad. Sci. USA 82, 1242-1246.

5. Morrison, S. L., Johnson, M. J., Herzenberg, L. A. & Oi, V. T. (1984) Proc. Nat/. Acad. Sci. USA 81, 6851-6855.

6. Boulianne, G. L., Hozumi, N. & Shulman, M. J. (1984) Nature (London) 312, 643-646.

7. Neuberger, M. S., Williams, G. T., Mitchell, E. B., Jouhal, S. S., Flanagan, J. G. & Rabbitts, T. H. (1985) Nature (London) 314, 268-270.

8. Hellstrom, I., Horn, D., Linsley, P., Brown, J.P., Brankovan, V. & Hellstrom, K. E. (1986) Cancer Res. 46, 3917-3923.

9. Liu, A. Y., Mack, P. W., Champion, C. I. & Robinson, R. R., Gene, in press.

10. Zoller, M. J. & Smith, M. (1982) Nucleic Acids Res. 10, 6487-6500. 11. Potter, H., Weir, L. & Leder, P. (1984) Proc. Nat/. Acad. Sci. USA

81, 7161-7165. 12. Toneguzzo, F., Hayday, A. C. & Keating, A. (1986) Mol. Cell.

Bioi. 6, 703-706. 13. Mixter, P. F., Wu, S. V., Studnicka, G. M. & Robinson, R. R.

(1986) J. Immunol. Methods 91, 195-203. 14. Johnstone, A. & Thorpe, R. (1982) Immunochemistry in Practice

(Blackwell Scientific, Oxford), pp. 27-76. 15. Gubler, U. & Hoffman, B. J. (1983) Gene 25, 263-269. 16. White, B. A. & Bancroft, F. C. (1982) J. Bioi. Chem. 257,

8569-8572. 17. Nobrega, F. G., Dieckmann, C. L. & Tzagoloff, A. (1983) Anal.

Biochem. 131, 141-145. 18. Legerski, R. J., Hodnett, J. L. & Gray, H. B., Jr. (1978) Nucleic

Acids Res. 5, 1445-1463. 19. Messing, J. (1983) Methods Enzymol. 101, 20-78. 20. Okayama, H. & Berg, P. (1983) Mol. Cell. Bioi. 3, 280-289. 21. Southern, P. J. & Berg, P. (1982) J. Mol. App/. Genet. I, 327-341. 22. Mulligan, R. C. & Berg, P. (1981) Proc. Nat/. Acad. Sci. USA 78,

2072-2076. 23. Novotny, J., Handschumacher, M. & Haber, E. (1986) J. Mol.

Bioi. 189, 715-721. 24. Sun, L. K., Curtis, P., Rakowicz-Szulczynska, E., Ghrayeb, J.,

Morrison, S. L., Chang, N. & Koprowski, H. (1986) Hybridoma 5 Suppl. 1, S17-S20.

25. Sahagan, B. G., Dorai, H., Saltzgaber-Muller, J., Toneguzzo, F., Guindon, C. A., Lilly, S. P., McDonald, K. W., Morrissey, D. V., Stone, B. A., Davis, G. L., Mcintosh, P. K. & Moore, G. P. (1986) J. Immuno/. 137, 1066-1074.

26. Goodman, G. E., Beaumier, P. L., Hellstrom, I., Fernyhough, B. & Hellstrom, K. E. (1985) J. Clin. Onco/. 3, 340-352.

27. Koprowski, H., Herlyn, D., Lubeck, M., DeFreitas, E. & Sears, H. F. (1984) !'roc. Nat/. Acad. Sci. USA 81, 216-219.

28. Irie, R. F. & Morton, D. L. (1986) !'roc. Nat/. Acad. Sci USA 83, 8694-8698.

PFIZER EX. 1032 Page 13