Upload
doankhue
View
221
Download
0
Embed Size (px)
Citation preview
Prevalence of ESBL among Esch. coli and
Klebsiella spp. in a tertiary care hospital
and molecular detection of important ESBL
producing genes by multiplex PCR.
Dr. Taslima Yasmin MBBS
Department of Microbiology & Immunology Mymensingh Medical College
Mymensingh January 2012
id2322062 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
Declaration
I hereby declare that the whole work submitted as a thesis entitled �Prevalence of
ESBL among Esch. coli and Klebsiella spp. in a tertiary care hospital and molecular
detection of important ESBL producing genes by multiplex PCR.� in the department
of the microbiology at Mymensingh Medical College, Mymensingh, Dhaka
University, for the Degree of Master of philosophy is the result of my own
investigation and was carried out under the supervision of Professor Dr. Md. Akram
Hossain.
I, further declare this thesis or part thereof has not been concurrently submitted for the
award of any Degree or Diploma anywhere.
Dr. Taslima Yasmin
TO WHOM IT MAY CONCERN
This is to certify that Dr. Taslima yasmin, a student of thesis part has completed the
thesis entitled �Prevalence of ESBL among Esch. coli and Klebsiella spp. in a tertiary
care hospital and molecular detection of important ESBL producing genes by
multiplex PCR.� in the Department of Microbiology, Mymensingh Medical College
under my guidance and supervision and this is up to my satisfaction. Her protocol was
approved by protocol approval committee of the Department of Microbiology and
Ethical review committee of Mymensingh Medical College.
Dated, Mymensingh The
Professor Dr. Md. Akram Hossain Head of the Department of Microbiology
Mymensingh Medical College Mymensingh, Bangladesh
ACKNOWLEDGEMENTS
All praises belongs to Almighty Allah, the most merciful, the most beneficent and the
most kind for giving me the opportunity, courage and enough energy to carry out and
complete the entire thesis work.
I am very grateful and deeply indebted to my honourable teacher and guide Professor
Dr. Md. Akram Hossain, Head of the Department of Microbiology, Mymensingh
Medical College. It is my great pleasure to express my deepest regards and whole
hearted indebtedness to him for his inspiring encouragement, continuous guidance,
active cooperation, constant supervision, valuable suggestions, constructive criticism
and help in carrying out this work successfully.
I would like to express my deepest regards and gratitude to my respected teacher Dr.
Shaymol Kumar Paul, Assistant Professor, Department of Microbiology,
Mymensingh Medical College, Mymensingh, for his constructive criticism in
correcting this thesis with his wise advice and active cooperation in correcting the
manuscript.
I owe my gratitude to respected teacher Md. Chand Mahamud, Assistant Professor,
Department of Microbiology, Mymensingh Medical College, Mymensingh for
valuable advice and cordial cooperation.
I am cordially expressing my respect and complements to Dr. Md. Ashraful Alam,
Assistant Professor, Department of Microbiology, Mymensingh Medical College,
Mymensingh for his cordial cooperation, & thoughtful suggestions in my thesis work.
I also grateful to Professor Nobumichi Kobayashi, Sapporo Medical University of
Japan for providing with us primers of PCR and technical assistance for this study and
also greatful to Professor Jalaluddin Ashraful Hoque, Professor of BIRDEM and
Ibrahim medical college for valuable advice.
I like to express gratitude to all other teachers, M.Phil students, laboratory
technologist and other staffs of Microbiology department, Mymensingh Medical
College, Mymensingh for their constant help and sincere cooperation during the entire
study period.
I also grateful to Dr. Md.Aminul Haque, Ex. Principal, Mymensingh Medical College,
Mymensingh for his kind cooperation & permitted me to complete this work.
I express my gratitude to my parents, who always inspired me for higher studies and
are my constant source of inspiration and encouragement in every step of my life.
I remained incomplete if I do not express wholehearted thanks and gratitude to my
elder sister Suraya yasmin, Sanjida yasmin, my younger sister Sharmin Yasmin and
my brother for his all support about computer and for their blessings, affectionate
support and spearing me so much time in this job from all sorts of social and familial
responsibilities.
I would like to convey my greatest regards and sincere thanks to my dear husband Dr.
Md. Golam Mowla for his patience, devoted cooperation and assistance in collecting
specimens and sensible sharing of my pains and pleasures. I would like to express
love to my only sweet daughter Jarin Tasnim Maliha whom I could give very little
time and attention during this work.
Lastly I am indebted to all those persons from whom I have collected samples. May
Allah help us? Thanks again.
Mymensingh, January 2012. Dr. Taslima Yasmin
SUMMARY
Background: The development of antibiotic resistance in bacteria following
introduction of antimicrobial agents has emerged as an important medical problem
everywhere in the world including Bangladesh. Extended spectrum beta lactamases
(ESBLs) are rapidly evolving group of beta lactamase enzymes produced by the Gram
negative bacteria. At present, ESBLs has been increasing as a serious nosocomial and
community pathogen having the property multidrug resistance.It is a great challenge
for clinician to treat this bacteria. So, the present study was undertaken to detect the
prevalence of these bacteria by different methods. The enzymes are predominantly
plasmid mediated and are derived from broad spectrum beta lactamase TEM or SHV
by a limited number of mutations. Very recently CTX-M genes are the most common
â-lactamases throughout the world.
Methods: A total of 300 Gram negative isolates of Escherichia coli and Klebsiella
pneumoniae obtained from various clinical samples; urine, skin wound. The isolates
were screened for resistance to third generation Cephalosporins (3GCs) by disc
diffusion test. The ESBL status was confirmed by double disc diffusion test (DDDT)
comprising CAZ/CAZC, CTX/CTXC and minimum inhibitory concentration (MIC)
by agar dilution method. Molecular characterization of the ESBL producing strains
were done by multiplex PCR specific for TEM, SHV and CTX-M genes and clusters
of CTX-M type (CTX-M -3,CTX-M-14).
Results: The present study revealed a higher occurrence of multidrug resistant ESBL
producing Klebsiella spp (80%), Proteus spp (72%), Enterobacter spp. (71.4%) E.coli
(67.3%) and pseudomonas spp (88.8%) from various clinical isolates. Among the 300
isolates tested by two phenotypic methods 214 (71.3%) were ESBLs positive isolates.
In Among the 214 ESBL producing bacteria 90.1% (193/214) were positive by
CAZ/CAZC method and 82.8% (176/214) were positive by CTX/CTXC method. In
this study 3GCs sensitive drugs were also tested, among them 54.6% (35/64) were
ESBL producing bacteria. TEM, CTX-M and SHV beta-lactamases were found
50.5%, 46.7% and 18.7% respectively. Among the CTX-M gene group-1 (CTX-M-3)
and group-9 (CTX-M-14) gene were present 78.0% and 80.0% respectively.
Conclusion: Results indicate that routine ESBL detection should be made mandatory
by both combined methods and strains should be taken both 3GCs sensitive and
resistant. .Irrational use of third generation cephalosporins must be discouraged to
reduce multidrug resistant bacteria, to increase patients� compliance and to make an
antibiotic policy.
CONTENTS
Page No.
LIST OF TABLE vi
LIST OF PHOTOGRAPH vii
LIST OF ABBREVIATION viii
SUMMARY III
CHAPTER 1: INTRODUCTION & OBJECTIVE 1
CHAPTER 2: REVIEW OF LITERATURE 6
CHAPTER 3: METHODOLOGY 53
CHAPTER 4: RESULTS 66
CHAPTER 5: DISCUSSION 85
CONCLUSION AND RECOMMENDATIONS 95
LIMITATION 96
LIST OF REFERRENCES 97
PHOTOGRAPH I
APPENDICES IX
List of table
Table No
Title of table Page
I. Distribution of sample from various specimens 68
II. Detection rate of different isolates in the study population 69
III. Pattern of organisms isolated from the community and hospital 70
IV. Showed distribution of E.coli, Klebsiella spp, Proteus spp and
Pseudomonas spp. in different specimens both from hospital and
community
72
V. Antibiotic resistance pattern of Esch.coli and Klebsiella spp. isolated
from community hospital and community by disc diffusion method
74
VI. Rate of detection of ESBL production by DDDT from different
organisms
75
VII. Pattern of distribution of ESBL producing isolates in hospital and
community
76
VIII. Rate of isolation of ESBL positive Esch.coli, Klebsiella spp. Proteus
spp.from different clinical specimen
77
IX. Antimicrobial resistant pattern in hospital and community acquired
ESBL positive strain
78
X. Detection of ESBL by Double Disc Diffusion test as confirmatory
test
79
XI. Cross tabulation between CAZ/CAZC and CTX/CTXC of ESBL
detection
79
XII. Pattern of ESBL production among 3GCs sensitive and resisatant
isolates
80
XIII. Rate of ESBL positive by phenotypic and genotypic method 81
XIV. Pattern of distribution of TEM, SHV and CTX-M genes among
phenotypic confirmed ESBL producers
82
XV. Pattern of CTX-M-3, CTX-M-14 distribution in different isolates 83
XVI. Pattern of TEM, SHV and CTX-M gene distribution among hospital 84
and community
List of photograph
Figure No
Title of photograph Page
1. Mechanism of drug resistance 9
2. Mechanism of drug resistance by horizontal transfer 11
3. Showing beta lactam ring destruction by beta lactamases enzyme 13
4. Structure of Beta lactamase enzyme 15
5. Showing double disc synergy test 43
6. Showing double disc diffusion test 45
7. MacConkey agar media showing klebsiella pneumoniae I
8. MacConkey agar media showing Proteus spp. I
9. MacConkey ager media showing Esch. coli II
10. TSI ager media showing Esch. coli II
11. Citrate ager media showing Esch. coli III
12. Citrate ager media showing klebsiella pneumoniae III
13. Indole test showing Esch. coli IV
14. Showing antibiogram of GNB IV
15. Showing double disc diffusion test V
16. Showing MIC (by agar dilution method) test V
17. PCR of CTX � M gene VI
18. Multiplex PCR of TEM & SHV gene VII
19. Multiplex PCR of CTX-M-3 & CTX-M-14 gene VII
20. Steps of preparing & processing PCR VIII
LIST OF ABBREVIATION
AmpC � Ampicillin resistant gene
ATCC � American Type Culture Collection
BA � Blood Agar
BEL � Belgium Extended-spectrum ß-Lactamase
BES � Brazilian Extended-Spectrum ß-lactamase
bp � Base pairs
BSAC � British Society for Antimicrobial Chemotherapy
CA � Clavulinic acid
CDC � Center for Disease Control and Prevention
Cfu � Colony forming unit
CLSI � Clinical laboratory standard institute.
CMY � Cphamycine
CRE � carbapenem-resistant Enterobacteriaceae
CTX-M � Cefotaxime resistant gene
CWT � Cell wall transamidase
DDM � Disc diffusion method
DDST � Double disc synergy test
DNA � Deoxyribonucleic acid
dNTP � Deoxynucleoside triphosphate
E test � Epsilon test
EDTA � Ethylene diamine tetraacetic acid
EHEC � Enterohaemorrhagic E. coli
EPEC � Enteropathogenic E.coli
ESBL � Extended spectrum beta lactamase
ESC � Extended spectrum cephalosporin�s
et al � at alia (all others)
GES � Guyana Extended-Spectrum ß-lactamases
GNR � Gram negative rods
HGT � Horizontal gene transfer
HUM bug � Hydrocarbon-using microorganism
HUS � Haemolytic uremic syndrome
IBCs � Intracellular bacterial communities
ICDDRB � International Center for Diarrrhoeal Diseses and
Research Bangladesh
kbp � Kilo base pair
KPC � Klebsiella pneumoniae Carbapenemase
LPS � lipopolysaccharide
MA � MacConkeys agar
MBL � Metalo beta lactamase
MDDDT � Modified double disc diffusion test
MDR � Multidrug resistant
MHA � Mueller Hinton agar
MHC � Major Histocompatibility Complex
MIC � Minimum inhibitory concentration
MRSA � Methicillin resistant Staphylococcus aureus
NA � Nutrient agar
NAG � N-acetylglucosamine
NAM � N-acetylmuramic
NCCLS � National Committee for Clinical Laboratory Standards
OM � Outer membrane
OPD � Out patient department
OXA � Oxacillinase gene
PBP � Penicillin binding protein
PBP � Penicillin binding protein
PBS � Phosphate buffer saline
PCR � Polymerase chain reaction
PCR � Polymerase chain reaction
PER � Pseudomonas Extended Resistance
PRSP � Penicillin resistant Streptococcus pneumoniae
RFLPs � Restriction fragment length polymorphimosm
SENTRY �
SHV � Sulfhydril variable gene
SLT � Shiga like toxine
T2SS � Type 2 Secretory system
Taq � Thermus aquaticus
TBE � Tris/Borate/EDTA
TEM � Temoniera gene
TMP-SMX � Trimethoprim�sulfamethoxazole
VEB � Vietnam Extended-spectrum ß-lactamase
VGT � Vertical gene transfer
VIM � Verona integron-encoded metallo-â-lactamase
VRE � Vancomycin-resistant enterococci
WHO � World health organization
INTRODUCTION
B-Lactam antibiotics are commonly used to treat bacterial infections. The groups of
antibiotics in this catagory include penicillins, cephalosporins, carbapenems &
monobactams. Increased use of antibiotics, particularly the third generation of
cephalosporins, has been associated with the emergence of â-Lactamases mediated
bacterial resistance, which subsequently led to the development of ESBL producing
bacteria. ESBLs are enzymes that mediate resistance to extended spectrum e.g., third
generation cephalosporins as well as monobactams such as aztreonam (CLSI, 2010).
These enzymes catalyze the hydrolysis of the â-lactam ring of antibiotic, thereby
destroying the antimicrobial activity. ESBLs have been reported worldwide in many
different genera of enterobactericeae and Pseudomonas aeroginosa (Friedman et al.
2008). However, these are most common in Klebsiella pneumoniae & E. coli
(Agrawal et al. 2008). ESBL producing organisms are often resistant to several other
classes of antibiotics, as the plasmids with the gene encoding ESBLs often carry other
resistance determinants. Initially ESBL producing organisms were isolated from
nosocomial infections but these organisms are now also being isolated from
community (Pitout and Laupland 2008).The colonization rate for K. pneumoniae is
low in healthy individuals in the general population. But it is increased in hospitalized
patients especially with long care facilities, health care manipulations. e. g., use of
catheters (Yusha�u et al. 2010).
The first plasmid mediated â-lactamase in Gram-negative bacteria, TEM-1, was
described in the early 1960s (Datta 1965). Afterwards it was detected from Klebsiella
in Europe 1980, in Germany 1983, and in France 1985 (Perez 2007). Genetic control
of beta-lactamase production resides either on plasmids or on the chromosome, while
expression is either constitutive or inducible (Chiang and Liaw 2005).
The development of extended spectrum cephalosporins in the early 1980 s was
regarded as a major addition to our therapeutic armamentarium in the fight against
beta-lactamase mediated bacterial resistance. The emergence of Escherichia coli and
Klebsiella pneumoniae resistant to ceftazidime & other cephalosporins seriously
compromised the efficacy of these life saving antibiotics (Perez et al. 2007). The new
bacterial beta-lactamases present in these common enteric bacilli (the parent TEM -1
and SHV-1 enzymes) demonstrated unique hydrolytic properties (Shobha et al. 2007).
ESBLs are inhibited in vitro by â-lactamase inhibitors such as clavulanic acid and
tazobactam. Some ESBLs are derived from earlier, broad-spectrum â-lactamases (e.g.,
the TEM, SHV and OXA enzyme families) and differ from the parent enzyme by a
few point mutations, which confer an extended spectrum of activity (Hawkey 2008).
Point mutations in the SHV and TEM genes that resulted in single amino acid
changes, (Gly 238 �ser, Glu 240-Lys arg 164-ser, arg164- His, Asp 179- Asn & Gul
(Asp) 104- Lys) ( Perez et al. 2007). More recently another family of ESBLs, the
CTX-M types, has emerged and these ESBLs are becoming increasingly common
(Hawkey 2008).
ESBLs have been reported from all parts of the world. However, prevalence varies
widely even in closely related regions. The true incidence is difficult to determine
because of the difficulty in detecting ESBL production & due to inconsistencies in
testing & reporting (Yusha�u et al. 2010). Prevelance of ESBL in many parts of the
world was (10-40%) among E. coli and Klebsiella pneumoniae (Rupp and Paul 2003).
The prevalence of ESBLs in Europe is higher than in the USA but lower than in Asia
and South America (Girlich et al. 2004). In 2007 in Asia pacific region was found to
harbour plasmid borne ESBLs 62% and 75% in E. coli and Klebsiella spp.
respectively (Bell et al. 2007). ESBL production rate was 43%, 73.8%, 96% and 70%
in E. coli and 60% in Klebsiella spp. in Pakistan, Iraq, Iran and India respectively in
2009, 2011 and last two were in 2010 (Ali 2009; Al- Charrakh et al. 2011; Nasehi et
al. 2010; Sharma et al. 2010). There were a limited number of studies on prevalence
of ESBL showing a high rate in Bangladesh, where E. coli and K. pneumoniae were
43.2% and 39.5% respectively in 2004 (Rahman et al. 2004) and at Rajshahi in
Bangladesh it was 57.89% in Klebsiella spp followed by Proteus spp. 50.0%, E. coli
47.83% and pseudomonas spp 31.35% in 2010 (Haque and Salam 2010). In France
CTX-M-1, CTX-M-3 and CTX-M 14 â lactamases from Enterobacteriaceae was
isolated in 2002 (Dutour et al. 2002). Again in Iran SHV, CTX-M, TEM, PER were
26%, 24.5%, 18%, 7.5% respectively in 2010 (Nasehi et al. 2010). In India in 2006
CTX-M-15 was 73% in E. coli and 72% in Klebsiella spp. and in 2010 TEM and SHV
were 30% and 38% respectively (Ensor et al. 2006; Sharma et al. 2010). Very recently
in 2011 in India Manoharan and his collegues found TEM and CTX-M were
predominantly found in E. coli (39.2%) while, among the Klebsiella spp., TEM, SHV
and CTX-M occurred together in 42.6% of the isolates. (Manoharan et al.
2011).Proper use of antibiotics is very important for various reasons. It reduces
unnecessary expenses, reduces development of resistance to useful and life saving
antibiotics, and minimizes many side effects. Bangladesh does not have any
systematic program for studying the antibiotic resistance pattern. Proper use of
antibiotics is ensured by formulating an antibiotic policy. ESBL screening as a routine
test has not yet been practiced in Bangladesh. ESBL occurs at an alarming rate among
enterobactericeae isolates among the hospitalized patients which can result in an
outbreak in the community that may be difficult to treat. To our knowledge so far, no
data was published regarding gene detection of ESBL in Bangladesh. So, the present
study was undertaken to see prevalence of ESBL by different phenotypic methods,
which provided a base line survey of drug resistance pattern in Mymensingh and to
see the molecular epidemiology of ESBL producing strains.
Objectives
General objective
To determine prevalence of extended spectrum beta lactamase (ESBL) among
Escherichia coli and Klebsiella spp. in a tertiary care hospital and to detect main
ESBL producing genes by multiplex PCR.
Specific objectives
1. To screen Escherichia coli and Klebsiella spp.resistant to 3rdgeneration
cephalosporins by disc diffusion method.
2. To confirm ESBL by double disc diffusion test and minimum inhibitory
concentration (MIC) by Agar dilution method.
3. To compare different double disc diffusion methods-e.g.
Ceftazidime (CAZ) + Clavulinic acid
Cefotaxime (CTX) + Clavulinic acid.
4. To detect TEM, SHV and CTX-M genes by multiplex PCR.
Review of Literature
Extended spectrum beta lactamase
Extended-spectrum b-lactamases (ESBLs) are rapidly evolving group of â-lactamase
enzymes, with the ability to hydrolyse and cause resistance to the oxyimino-
cephalosporins (i.e. cefotaxime, ceftazidime, ceftriaxone, cefuroxime and cefepime)
and monobactams (i.e. aztreonam), but not the cephamycins (i.e. cefoxitin and
cefotetan) or carbapenems (i.e. imipenem, meropenem, and ertapenem), produced by
the Gram negative bacteria more commonly in Escherichea coli and Klebsiella
pneumoniae (Lal et al. 2007; Rupp and Fey 2003; Peirano and Pitout 2010).
Emergence of drug resistance
Most of the resistance microbes which are now difficult to treat are of genetic origin
and transferable between species and genera of bacteria (Rahman et al. 2004).The
inappropriate use of antimicrobial agents does not achieve the desired therapeutic
outcomes and is associated with the emergence of resistance. Lack of access,
inadequate dosing, poor adherence and sub-standard antimicrobials may play as
important a role as overuse. All antimicrobial agents have the potential to select drug-
resistant subpopulations of microorganisms. With the widespread use of
antimicrobials, the prevalence of resistance to each new drug has increased. The
prevalence of resistance varies between geographical regions and over time, but
sooner or later resistance emerges to every antimicrobial (WHO 2001).Most of the
resistance microbes which are now difficult to treat is of genetic origin and
transferable between species and genera of bacteria.
Mechanism of resistance to antimicrobials
Resistance to antimicrobials is a natural biological phenomenon. The introduction of
every antimicrobial agent into clinical practice has been followed by the detection in
the laboratory of strains of microorganisms that are resistant, i.e. able to multiply in
the presence of drug concentrations higher than the concentrations in humans
receiving therapeutic doses. Such resistance may either be a characteristic associated
with the entire species or emerge in strains of a normally susceptible species through
mutation or gene transfer. Resistance genes encode various mechanisms which allow
microorganisms to resist the inhibitory effects of specific antimicrobials. These
mechanisms offer resistance to other antimicrobials of the same class and sometimes
to several different antimicrobial classes (WHO). Gram negative bacteria use four
mechanisms of resistance to survive to the antibiotic treatment:
Efflux of antibiotics from bacteria
Efflux pumps play a major role in antibiotic resistance and also serve other functions
in bacteria such as the uptake of essential nutrients and ions, excretion of metabolic
end products and deleterious substances as well as the communication between cells
and environment (Li and Nikaido 2004).
Outer membrane (OM) permiability
The OM of Gram negative bacteria is a barrier to both hydrophobic and hydrophilic
compounds. By combining a highly hydrophobic lipid bilayer with pore forming
proteins of specific size-exclusion properties, the OM acts as a selective barrier. The
permeability properties of this barrier have a major impact on the susceptibility of the
microorganism to antibiotics, which are essentially targeted at intracellular processes.
Small hydrophilic antibiotics, such as, â-lactams, use the pore forming proteins (water
filled channel proteins embedded in the outer membrane, e.g., OmpF in E. coli and
OprD in Pseudomonas aeroginosa) to gain access to the cell interior, while
macrolides and other hydrophobic antibiotics diffuse across the lipid bilayer. The
existance of antibiotic-resistant strains in a large number of bacterial species due to
modifications in the lipid or protein composition of the OM indeed highlights the
importance of the OM barrier in antibiotic sensitivity (den Engelsen et al.2009).
Target modifications
This mechanism is based on alterations of bacterial sites that are targeted by
antibiotics and thus preventing the antibiotic from binding to its site of action. For
example fluoroquinolone resistance is attributed to mutations within the drug�s target
(DNA gyrase and topoisomerase) (Livermore 2003).
Enzymatic modification of the antibiotic
Enzymes that modify antibacterial antibiotics are devided into two general classes: a)
â-lactamase that degrade antibiotics and b) others (including the macrolide and
aminoglycoside-modifying proteins) that perform chemical transformations to render
the antibiotic inefficient (Livermore 2003).
Fig. 1. Mechanism of drug resistance
The acquisition and spread of antibiotic resistance in bacteria
Multiple drug resistant strains of some bacteria have reached the proportion that
virtually no antibiotics are available for treatment.
Antibiotic resistance in bacteria may be an inherent trait of the organism (e.g. a
particular type of cell wall structure) that renders it naturally resistant, or it may be
acquired by means of mutation in its own DNA or acquisition of resistance-conferring
DNA from another source (Toder 2008).
Inherent (natural) resistance
Bacteria may be inherently resistant to an antibiotic. For example, an organism lacks a
transport system for an antibiotic; or an organism lacks the target of the antibiotic
molecule; or, as in the case of Gram-negative bacteria, the cell wall is covered with an
outer membrane that establishes a permeability barrier against the antibiotic.
Acquired resistance
Several mechanisms are developed by bacteria in order to acquire resistance to
antibiotics. All require either the modification of existing genetic material or the
acquisition of new genetic material from another source.
Vertical gene transfer
The spontaneous mutation frequency for antibiotic resistance is on the order of about
of about 10-8- 10-9. Once the resistance genes have developed, they are transferred
directly to all the bacteria's progeny during DNA replication. This is known as vertical
gene transfer or vertical evolution.
Horizontal gene transfer
Lateral or horizontal gene transfer (HGT) is a process where genetic material
contained in small packets of DNA can be transferred between individual bacteria of
the same species or even between different species.
There are at least three possible mechanisms of HGT, equivalent to the three
processes of genetic exchange in bacteria. These are transduction, transformation or
conjugation.
Conjugation
Occurs when there is direct cell-cell contact between two bacteria (which need not be
closely related) and transfer of small pieces of DNA called plasmids takes place. This
is thought to be the main mechanism of HGT.
Transformation
It is a process where parts of DNA are taken up by the bacteria from the external
environment. This DNA is normally present in the external environment due to the
death and lysis of another bacterium.
Transduction
Occurs when bacteria-specific viruses (bacteriophages) transfer DNA between two
closely related bacteria (Toder 2008).
Fig. 2. Mechanism of drug resistance by horizontal transfer
Beta lactam
Humans have been plagued with the threat of bacterial infection since before the
dawn of recorded history, and have thus always had a keen interest in finding a
suitable treatment for these maladies. Folk medicine is replete with accounts of the
use of various materials for the treatment of bacterial infection (moldy bread, moldy
cheese, plant and animal preparations), which we now assume were effective due to
the presence of some unknown antibacterial agent (Toder 2008).
In 1928 Alexander Fleming observed that culture plate on which Staphylococci were
being grown had become contaminated with a mold of the genus Penicllium and that
bacterial growth in the vicinity of the mold had been inhibited. He isolated the mold
in pure culture and demonstrated that it produced an antibacterial substance Penicillin
(Abraham and Chain1940). Abraham and Chain (1940) have shown that certain
bacteria produce an enzyme named penicillinase, which destroy penicillin (Woodruff
and Foster 1945).
With in a few years of introduction of penicillin into clinical use, penicillinase
producing Staphylococcus aureus started to proliferate in hospitals. To overcome
this problem, penicillinase resistant penicillins came into picture. Shortly afterward,
the broad spectrum penicillins and first generation cephalosporins were introduced.
They remained a first line of defense against microbes for over 20 years, before
resistance due to â-lactamases produced by gram negative bacilli became a serious
problem (Medeiros 1997).To counter this threat, the pharmaceutical industry
marketed six novel classes of â lactam antibiotics (cephamycins, oxyimino
cephalosporins, carbapenems, monobactams and clavam and penicillianic acid sulfone
inhibitors) within a relatively short span of 7-8 years. Although, novel â-lactamases
had emerged gradually after the introduction of new â lactam agents, their number
and variety accelerated at an alarming rate (Chaudhary and Aggarwal 2004).
Beta lactam antimicrobials are the most common treatment for gram positive, gram
negative and anaerobic bacterial infection (Ambler 1980; Kotra et al, 2002; Holten
and Onusko 2000).Beta lactams are a family of antimicrobial agents consisting of four
major groups: penicillins, cephalosporins, monobactum, and carbapenems (Kotra et
al, 2002).
They all have a beta lactum ring, which can be hydrolyzed by beta lactamases.The
groups differ from each other by additional rings e.g. Thiazolidine ring for penicillin,
Cephem nucleus for cephalosporin, None for monobactum, Double ring structure for
carbapenem (Levinson 2010) .They act on bacteria by two mechanisms: at first, they
in corporate in bacterial cell wall and inhibit the action of transpeptidase, responsible
for completion of cell wall. Secondly, they attach to the penicillin binding proteins
(PBPs) that normally suppress cell wall hydrolases, thus freeing these hydrolases,
which in turn act to lyses the bacterial cell wall. To by pass these antimicrobial
mechanisms of action, bacteria resist by producing beta lactam inactivating enzymes
(beta lactamases) (Samaha-Kfoury and Araj 2003).
Figure:3. Showing beta lactam ring destruction by beta lactamases enzyme
Beta lactamase enzyme
Cell wall is comprised of peptidoglycan made up of repeating units of N-
acetylglucosamine (NAG) and N-acetylmuramic acid (NAM) in polymeric chain
form. The final step in cell wall biosynthesis is a transamidation reaction, catalyzed
by cell wall transamidase (CWT) (Woster 2010). The crosslinking process is
extremely sensitive to beta lactam antibiotics .CWT is also known as penicillin
binding protein 1 (PBP-1). Various penicillins bind differently to different PBP's,
producing a variety of effects. Binding to PBP-1 (a transpeptidase or transamidase)
produces cell lysis, while binding to PBP-2 (also a transpeptidase) leads to oval cells
which cannot divide (Woster 2010).
Beta lactamases are enzymes that catalyze the hydrolysis of beta lactam. Presently,
there are more then 500 different beta lactamases have been found in nature (CLSI
2010) .These versatile enzymes are present in both Gram positive and Gram negative
bacteria (Holten and Onusko 2000). Beta lactamase producing Gram positive bacteria
release the enzyme into the surroundings medium. But Gram negative bacteria release
the enzyme into the periplasmic space. So, this is called group protection for Gram
positive bacteria and individual protection for Gram negative bacteria (Samaha-
Kfoury and Araj 2003).
Beta-lactamases were present in bacteria long before the introduction of penicillins
(Woodruff and Foster 1945), and genes encoding these ancient enzymes were
originally located on the bacterial chromosome (Hanson et al.1999; Yusha�u et al.
2010). Furthermore, these enzymes are inducible and constitutively expressed in low
quantities. In 1965, the first report of a plasmid-encoded beta-lactamase in a Gram-
negative bacterium appeared from Greece (Datta and Kontomichalou 1965). â-
lactamase producing bacteria are increasing in number and causing more sever
infections (Shobha et al. 2007; Andrews 2009).
Figure: 4. Structure of Beta lactamase enzyme
Extended spectrum cephalosporin�s (ESCs)
The first generation cephalosporins are active primarily against gram positive cocci.
Similar to penicillins; new cephalosporins were synthesized with expansion of activity
against gram negative rods. These new cephalosporin�s were categorized into second,
third, fourth generations, with each generations having expanded coverage against
certain gram negative rods e.g.ceftazidime, cefotaxime and ceftriaxone (Levinson
2010).
Extended spectrum beta lactamase (ESBLs)
Extended spectrum â lactamases (ESBLs) are a group of enzymes with the ability to
hydrolyse and cause resistance to the oxymino-cephalosporins (i.e.cefotaxime,
ceftazidime, ceftriaxone, cefuroxime and cefepime) monobactams (i.e. aztreonam)
(Peirano and Pitout 2010).
Beta-lactamases are among the most heterogeneous group of resistance enzymes.
These globular proteins are composed of alpha-helices and beta pleated sheets.
Despite a significant amount of amino acid sequence variability, beta lactamases share
a common overall topology (Perez et al. 2007).
Criteria
1. Are capable of inactivating extended spectrum cephalosporin�s (first, second, third,
fourth-generations and the monobactam aztreonam).
2. Are inhibited by beta lactases inhibitors, such as clavulanic acid, cabapenem-
sulbactum,tozabactum and to temocillin (CLSI 2010).
These new enzymes were given the name ESBLs that reflect the fact that they were
the older beta lactamases and had a new capability to hydrolyze a broader spectrum of
beta lactam drugs (Jacoby et al. 1988)
Mechanism of action
a) A common mechanism of bacterial resistance to beta-lactam antibiotics is the
production of beta-lactamase enzymes that break down the structural beta-lactam ring
of penicillin-like drugs (Chaudhary and Aggarwal R 2004; Paterson and Yu 1999).
b) A point mutation which alters the configuration around the active site of TEM and
SHV type enzymes that specify resistance to ampicillin and had a new capability to
hydrolyze a broader spectrum of beta lactam drugs (Philippon 1898).
c) Medical use of antibiotics can considerably accelerate the selection pressure for
diversification and dissemination of mutant extended spectrum beta lactamase
(Farkosh 2007).
d) ESBLs have serine at their active site and attack the amide bond in the lactam ring
of antibiotics causing their hydrolysis (Chaudhary and Aggarwal 2004).
ESBL stands for �extended-spectrum beta lactamase.� ESBLs producing bacteria are
different from other super bugs, because �ESBL� does not refer to one specific kind
of bacteria. (For instance, MRSA refers specifically to methicillin-resistant strains of
S. aureus.) Multiple drug resistant organisms that have been encountered include:
MRSA-Methicillin/oxacillin �resistant Staphylococcus aureus.
VRE � Vancomycin-resistant enterococci
ESBLs � Extended spectrum beta lactamases
PRSP-Penicillin resistant Streptococcus pneumoniae (Toder 2008).
Synthesis and mode of transfer
The synthesis of â lactamases is either chromosomal (constitutive), as in
Pseudomonas aeruginosa, or plasmid mediated (inducible), as in E.coli and
Staphylococcus aureus (Livermore 1995; Rayamajhi et al. 2008; Rupp and Paul
2003). Plasmids are a major cause of bacterial resistance spreading (Peirano and
Pitout 2010). The genes encoding these â lactamases are often located on large
plasmid (80kbp) that also encode genes for resistance to other antibiotics, including
aminoglycosides, tetracycline, sulfonamides, trimethoprime and chloramphenicol
which can easily be transferred between isolates (Sasirekha et al 2010 ; Perez 2007).
Evolution and Epidemiology
Organisms encoding multiple antibiotic resistance genes are becoming increasingly
prevalent (Hanson et al.1999). The first plasmid mediated â-lactamase in Gram-
negative bacteria, TEM-1, was described in the early 1960s (Turner 2005). In 1983,
the first report came from Germany by Knothe et al. of a mutant of SHV-1 named
SHV-2 in a K. pneumoniae strain, which was capable of hydrolysing oxyimino-
cephalosporins (Knothe et al.1983) .Two years later, SHV-2 was transferable between
bacteria (Kliebe et al.1985). Just a few years� later reports came from French hospitals
of problems attributed to Enterobacteriaceae carrying mutated TEM-derivates which
acted like SHV-2 (Brun-Buisson et al. 1987). The term �extended broad- spectrum
beta-lactamases� was coined (Livermore 2008). The beta-lactamases had thereby an
�extended broadspectrum� activity as compared with the �broad-spectrum� classic
TEM and SHV enzymes. The term �broad� was lost and the term became extended
spectrum â-lactamases (ESBLs) are derived from earlier, broad-spectrum â-
lactamases (eg, the TEM, SHV and OXA enzyme families) and differ from the parent
enzyme by a few point mutations, which confer an extended spectrum of activity
(Hawkey 2008). The amino acid substitutions responsible for the ESBL phenotype
cluster around the active site of the enzyme and change its configuration, allowing
access to oxyimino-beta-lactam substrates. Opening the active site to beta-lactam
substrates also typically enhances the susceptibility of the enzyme to b-lactamase
inhibitors, such as clavulanic acid. Single amino acid substitutions at positions 104,
164, 238, and 240 produce the ESBL phenotype, but ESBLs with the broadest
spectrum usually have more than a single amino acid substitution (Bradford 2001).
The rapidity of the development and spread of resistance is a common process that is
influenced by selective pressure, pre-existance of resistance genes and use of infection
control measures (Rupp and Paul 2003).
In CTX M-1 each of the amino acid changes contributes to resistance. By it self the
change at position 102 mainly enhance resistance to ceftazidime, while changes at
position 236 predominantly resistance to cefotaxime (Rahman et al.2004). Occurrence
and distribution of ESBLs differs from country to country and from hospital to
hospital (Ali 2009).Initially ESBL producing organisms were usually isolated from
nosocomial infections but these organisms are now also being isolated from
community (Helfand and Bonomo 2005.). The continuous pressure exerted by the use
of newer expanded-spectrum beta-lactams promoted the development of new TEM
and SHV derivates (Pin heiro et al. 2008). There are so many types of ESBLs like
TEM, SHV, CTX-M, OXA, AmpC but majority of the ESBLs are derivatives of TEM
or SHV enzymes and these enzymes are most commonly found in E.coli and
K.pneumoniae (Sharma et al. 2010) and studies showed that new ones are being found
every week. The rapid emergence of the ESBL-production among Enterobacteriaceae
has already had serious clinical implications.
ESBLs of the CTX-M type were rare until the end of the 1980s, but Japan,Argentina
and Germany reported almost concomitantly findings of this ESBL type.
Predominance of CTX-M â-lactamases may be due to the selective pressure of
increased use of ceftriaxone (Pin heiro et al. 2008; Samaha-Kfoury and Araj 2003).
The genes encoding CTX-Ms have been mobilised from Klyuviera spp. by several
genetic events and mechanisms (Perez et al. 2007).With the emergence of the CTX-
M, there has been a marked shift in the epidemiology of ESBLs (Coque et al. 2006).
The predominance of CTX-Ms has not only been observed in hospitals but also in the
community, from nursing homes and long-term facilities.CTX-M-15 is the most
commonly reported ESBL-enzyme in Europe (Pitout and Laupland 2008.). CTX-M-
15 is derived from CTXM-3 by a single amino acid substitution at position 240 (Asp
→ Gly). This substitution confers an increased catalytic activity against ceftazidime
(Peirano and Pitout 2010). The CTX-M 14 gene was not mobilized by conjugation.
The nucleotide sequences of CTX-M genes are highly related to the nucleotide sequence
of Kluyvera spp. The results of the conjugation experiment showed that CTX-M-15 was
carried on a conjugative plasmid (Peirano and Pitout 2010).
CTX-M type ESBLs typically hydrolyze Cefotaxime and Ceftriaxone more efficiently
than Ceftazidime but point mutations around the active site belonging to the CTX-M-
1 and CTX-M-9 groups having ability to hydrolyze Ceftazidime significantly (Pitout
2010).Unlike most ESBLs that have been found in E.coli,K. pneumoniae and other
Enterobacteriaceae, OXA type ESBLs have been found mainly in P.aerugenosa and
only rarely Enterobacteriaceae (Girlich et al.2004). Although ESBLs still constitute
the first cause of resistance to beta-lactams among Enterobacteriaceae, other �new
beta-lactamases� conferring resistance to carbapenems, such as metallo-beta-
lactamases (MBL) and KPC carbapenemases, or to cephamycins, such as CMY
enzymes, have more recently emerged and are often associated with ESBLs (Coque et
al. 2008 ). ESBLs should be distinguished from other beta lactamases capable of
hydrolyzing extended spectrum Cephalosporins e.g. AmpC and Carbapenemases.
Carbapenemases maybe further grouped as either metallo-beta lactamases (class B) or
serine carbapenemases (Class A and D ) (Jacoby 2009; Poirel et al. 2007 ).
â-lactamases (>500) > 50% ESBLs
Plasmid encoded
1983 SHV-type (>130) �The oldies�
1985 TEM-type (> 180)
1989 CTX-M-type (> 100) �ESBLs of growing
importance�
1988 SFO-1 Serratia FOnticola
1991 TLA-1 TLAhuicas (indian tribe)
1991 PER (7) Pseudomonas Extended Resistance
1996 VEB (7) Vietnam Extended-spectrum ß-lactamase
1996 BES-1 Brazilian Extended-Spectrum ß-lactamase
1998 GES (16) Guyana Extended-Spectrum ß-lactamases
2005 BEL (2) Belgium Extended-spectrum ß-Lactamase
2005 TLA-2 ???? (Plasmid, waste water)
1998 KPC (10) Klebsiella pneumoniae Carbapenemase
1991 OXA-ESBL (18) (OXA-2, -10, -13 derivatives,
OXA-18, OXA-45)
Epidemiology of ESBLs genes are rapidly changing and shows marked geographic
differences in distribution of genotypes of CTX-M â-lactamases (Coque et al. 2008).
Rupp ME in 2003 encoded- in many parts of the world (10-40%) of strains of E. coli
�infrequent ESBLs�
PeculiarESBLs
and Klebsiella pneumoniae express ESBLs (Rupp and Paul 2003) also noted in the
introduction, ESBLs were first described in 1983 from the Germany. The success of
the CTX-Ms over the classical ESBL-enzymes SHVs and TEMs is linked to the way
by which CTX-M enzymes are spread. Through mobile genetic elements, resistance
genes disseminate within the same species and also between bacteria of different
species (Coque et al. 2008).The prevalence of ESBLs in Europe is higher than in the
USA but lower than in Asia and South America (Girlich et al. 2004).
A study performed in Turkey showed a prevalence of 21% ESBL producers among E.
coli causing community acquired urinary tract infection (UTI) during 2004 and 2005
(Coque et al. 2008). In Norway, a prospective survey of clinical E. coli isolates with
reduced susceptibility to oxyimino-cephalosporins demonstrated the dominance of
CTX-M-15 (46%) and CTX-M-9-like (30%) enzymes among ESBL-positive E. coli
and of SHV-5 (47.4%) and SHV-2 (21.0%) among ESBL-positive K. pneumoniae
isolates (Coque et al. 2008). In Italy, the prevalence of ESBL producers among
clinical isolates has also increased over the past ten years. The most prevalent ESBL-
positive species are E. coli among hospitalised patients and Proteus mirabilis among
outpatients. A predominance of TEM enzymes (45.4%), SHV-12, and the emergence
of non-TEM, non-SHV enzymes (CTX-M-type in E. coli and K. pneumoniae, and
PER-type in P. mirabilis) has been described. More recent studies performed in single
institutions showed the frequent recovery of CTX-M-15-producing E. coli and other
variants from this group such as CTX-M-1 and CTX-M-32 (Caccamo et al.2006).
The prevalence of ESBLs is over 10% in Hungary, Poland, Romania, Russia and
Turkey. K. pneumoniae is the most frequent ESBL-producing species in Hungary and
Russia, and an increase in the percentage of ESBL producers among K. pneumoniae
isolates has been reported from Poland, Turkey, Bulgaria, and Romania (Edelstein et
al. 2003)The emergence and wide spread of the CTX-M-15 enzyme in most European
countries, including those with previous low rates of ESBLs, is one of the most
relevant findings associated with the current epidemiology of ESBL in Europe (Lytsy
et al. 2008; Oteo et al. 2006 ).
Percentage of organisms expressing ESBL phenotype in the Meropenem Yearly
Susceptibility Test Information Collection study in 1997-2003, the highest rate among
K. pneumoniae isolated is seen in Eastern Europe and South America, where more
than 50% of isolates are potential ESBL producers this contrasts with North America
and Northern Europe, where only 12.3% and 16.7% of the isolates, respectively, are
potential ESBL producer (Turner et al. 2005).Asia probably has a long history of the
occurrence of extended-spectrum â-lactamase (ESBL)-producing bacteria (Kim et al.
2007). There were no comprehensive reports on the incidence of ESBLs from
countries in the region in the 1980s and early 1990s. There were, a number of
sporadic reports of ESBLs, notably of the SHV-2 type, from China in 1988 (Rupp et
al. 2003), and the TOHO-1 ESBL produced by Escherichia coli from Japan in 1993
(Ishii et al. 1995) ESBL phenotypes were reported for three centres in northern
Taiwan, contributing to the 1998�2002 SENTRY programme, with overall rates of
ESBL production of 13.5% in K. pneumoniae and 5.6% in E. coli (Turner et al. 2005).
ESBLs mediated resistance in Klebsiella spp. Ranged from 20-40% through out
Southeast Asia, China and Japan (Rupp et al. 2003). CTX-M-15 has probably been
present in India for some considerable time, and is present in both E. coli and
Klebsiella spp. at a high frequency and it is assumed that spreads of CTX-M-15 from
India to other countries is more likely. Two very early members of the CTX-M group
were identified in Japan: TOHO-1 and -2. These have not spread or evolved de novo
outside Japan, except for one reported single isolate producing TOHO-1 from
Argentina (Bonnet 2004) .The pattern of ESBL genotypes in Japan is quite different
from that seen in surrounding countries, although universally successful types, e.g.,
CTX-M-14, have recently become more common (Hirakata et al. 2005) Both India
and Pakistan have reported high rates of ESBLs since the 1990s (Grover et al.2006;
Mathai et al.2002)
With the populations of India and China these two countries surely represent the
largest reservoirs of CTX-M ESBL genes in the world. Increasing travel and trade
will contribute to the worldwide spread of locally evolved CTX-M genotypes
(Hawkey et al. 2008). Prevalence of ESBLs vary from country to country, hospital to
hospital even very closely related region. There were several studies in India in 2002,
2007, 2007, 2008 were 60%, 60.9%, 46.5%, 51.4% in E.coli respectively ( Mathai et
al. 2002; Sharma et al.2007; Shivaprokasha et al. 2007; Varaiya et al 2008 ).
In India in 2006 CTX-M -15 was 73%. In 2010 there were different studies from
different countries e.g. in Iran it was 96%, ESBLs where SHV, CTX-M, TEM, PER
was 26%, 24.5%, 18%, 7.5% respectively, in Corea E.coli and Klebsiella were 17.7%
and 26.5% respectively. In India it was 61.1% and 40.6% for E.coli and Klebsiella
respectively (Sasirekha 2010), another study in India ESBLs for 70% and 60% for
E.coli and Klebsiella respectively, where TEM, SHV were 56% and 60% respectively
(Sharma 2010).
Classification
Because of the diversity of enzymatic characteristics of the many â lactamases
discovered so far, many attempts have been made to categories and classify them
since the late 1960s. These classifications involve two major approaches: the first and
older one is based on the biochemical and functional characteristics of the enzyme;
the second approach is based on the molecular structure of the enzyme (Bush, Jacoby
and Medeiros 1995).
Evolution of functional classification of â lactamases
Year Author Basis of classification of â lactamases
1968 Sawai et al Used cephalosporins versus penicillins as substrates
1973 Richmond and Sykes Expanded substrate profile and suggested five major
groups (Ia-d, II, III, IV, V)
1976 Sykes and Matthew Differentiated the plasmid mediated â lactamases on
the basis of isoelectric focusing
1981 Mitsuhachi and Inoue Added the category �cefuroxime hydrolysing â
lactamase�
1989 Bush Expanded further the substrate profile, added the
reaction with EDTA, correlated between functional
and molecular classification
1995 Bush, Jacoby, and
Medeiros
Expanded the Bush scheme and used biochemical
properties, molecular structure, and nucleotide
sequence.
Functional Classification
Group 1
CEPHALOSPORINASE, Molecular Class C (not inhibited by clavulanic acid)
Group 1 is cephalosporinases not inhibited by clavulanic acid, belonging to the
molecular class C
Group 2
Group 2 are penicillinases, cephalosporinases, or both inhibited by clavulanic acid,
corresponding to the molecular classes A and D reflecting the original TEM and SHV
genes. However, because of the increasing number of TEM- and SHV-derived {beta}-
lactamases, they were divided into two subclasses, 2a and 2b.
GROUP 2a
PENICILLINASE, Molecular Class A
The 2a subgroup contains just penicillinases.
GROUP 2b
BROAD-SPECTRUM, Molecular Class A
2b Opposite to 2a, 2b are broad-spectrum {beta}-lactamases, meaning that
they are capable of inactivating penicillins and cephalosporins at the same
rate. Furthermore, new subgroups were segregated from subgroup 2b:
GROUP 2be
EXTENDED-SPECTRUM, Molecular Class A
Subgroup 2be, with the letter "e" for extended spectrum of activity, represents
the ESBLs, which are capable of inactivating third-generation cephalosporins
(ceftazidime, cefotaxime, and cefpodoxime) as well as monobactams
(aztreonam)
GROUP 2br
INHIBITOR-RESISTANT, Molecular Class A (diminished inhibition by
clavulanic acid)
The 2br enzymes, with the letter "r" denoting reduced binding to clavulanic
acid and sulbactam, are also called inhibitor-resistant TEM-derivative
enzymes; nevertheless, they are commonly still susceptible to tazobactam,
except where an amino acid replacement exists at position met69.
GROUP 2c
CARBENICILLINASE, Molecular Class A
Latersubgroup 2c was segregated from group 2 because these enzymes
inactivate carbenicillin more than benzylpenicillin, with some effect on
cloxacillin.
GROUP 2d
CLOXACILANASE, Molecular Class D or A
Subgroup 2d enzymes inactivate cloxacillin more than benzylpenicillin, with
some activity against carbenicillin; these enzymes are poorly inhibited by
clavulanic acid, and some of them are ESBLs.
The correct term is "OXACILLINASE". These enzymes are able to inactivate
the oxazolylpenicillins like oxacilli, cloxacilli, dicloxacillin. The enzymes
belong to the molecular class D not molecular class A.
GROUP 2e
CEPHALOSPORINASE, Molecular Class A
Subgroup 2e enzymes are cephalosporinases that can also hydrolyse
monobactams, and they are inhibited by clavulanic acid
GROUP 2f
CARBAPENAMASE, Molecular Class A
Subgroup 2f was added because these are serine-based carbapenemases, in
contrast to the zinc-based carbapenemases included in group 3.
Group 3
METALLOENZYME, Molecular Class B (not inhibited by clavulanic acid)
Group 3 are the zincbased or metallo {beta}-lactamases, corresponding to the
molecular class B, which are the only enzymes acting by the metal ion zinc, as
discussed above. Metallo B-lactamase is able to hydrolyse penicillins,
cephalosporins, and carbapenems. Thus, carbapenems are inhibited by both
group 2f (serine-based mechanism) and group 3 (zinc-based mechanism)
Group 4
PENICILLINASE, No Molecular Class (not inhibited by clavulanic acid)
Group 4 are penicillinases that are not inhibited by clavulanic acid, and they
do not yet have a corresponding molecular class.
Molecular classification
The molecular classification of â lactamases is based on the nucleotide and amino
acid sequences in these enzymes. To date, four classes are recognised (A-D),
correlating with the functional classification .Classes A, C, and D act by a serine
based mechanism, whereas class B or metallo â lactamases need zinc for their action.
Genes encoding ESBLs
In the early years the most common beta lactamases were TEM and SHV varieties
(Pitout et al.2010; Shobha et al. 2007; Florijn et al. 2002). TEM-2 and SHV-2 ESBL
are derived from parental TEM-1 and SHV-1 by point mutation, which was
mentioned before. TEM-1 and SHV-2 are non ESBL, but CTX-M enzymes are not
derived from non ESBL and consequently all CTX-M enzymes are ESBL (Al-Agamy
et al. 2009). Now, CTX-M enzymes are being discovered throughout the world and
becoming the most prevalent beta lactamase (Xu et al. 2005).ESBLs (group 2be) are
encoded on mutated TEM-1 and SHV-1 genes carried on plasmids that are readily
transmissible to other organisms (Jemima and Verghese 2008).
TEM and SHV
The TEM -1 enzyme was first reported from an E.coli isolate in 1965 and is now the
commenest beta lactemase found in Enterobactereceae(Fonze et al. 1995) and the
older TEM is derived from Temoniera, a patient from whom the strain was first
isolated in Greece(Turner 2005). TEM-1 is the most commonly-encountered beta-
lactamase in Gram-negative bacteria. Up to 90% of ampicillin resistance in E. coli is
due to the production of TEM-1. Also responsible for the ampicillin and penicillin
resistance that is seen in H. influenzae and N. gonorrhoeae in increasing numbers.
Although TEM-type beta-lactamases are most often found in E. coli and K.
pneumoniae, they are also found in other species of Gram-negative bacteria with
increasing frequency. Based upon different combinations of changes, currently 195
TEM-type enzymes have been described. TEM-2,the first variant described, differed
from TEM-1 through the substitution of a lysine for a glutamine at position 39 (Rupp
et al. 2003). TEM and SHV are transferred by both plasmid and chromosome (Sharma
2010).TEM -3 most common in France (Livermore 1995). TEM-10, TEM-12, TEM-3
and TEM -26 seem most common in the USA (Farkosh 2007).
SHV-1 shares 68 percent of its amino acids with TEM-1 and has a similar overall
structure. SHV stands for Sulf hydril variable (Turner 2005). The SHV-1 beta-
lactamase is most commonly found in K. pneumoniae and is responsible for up to
20% of the plasmid-mediated ampicillin resistance in this species. ESBLs in this
family also have amino acid changes around the active site, most commonly at
positions 238 or 238 and 240. More than 60 SHV varieties are known. They are the
predominant ESBL type in Europe and the United States and are found worldwide.
SHV-5 and SHV-12 are among the most common (Farkosh 2007). SHV varients are
important worldwide (Rahman et al. 2004). Among the SHV type of ß-lactamases,
SHV-5 was found to be responsible for outbreaks of nosocomial infection in several
countries (Jmima and Verghes 2008).
CTX-M beta lactamases
Acquired resistance to beta-lactams is mainly mediated by extended-spectrum beta-
lactamases (ESBLs) that confer bacterial resistance to all beta-lactams except
carbapenems and cephamycins, which are inhibited by other beta lactamase inhibitors
such as clavulanic acid. A shift in the distribution of different
ESBLs has recently occurred in Europe, with a dramatic increase of CTX-M enzymes
over TEM and SHV variants (Coque et al. 2008; Livermore and Canton 2007). CTX-
M âlactamases (i.e. �active on CefoTaXime, first isolated in Munich�) were first
reported from Japan in 1986 (the enzyme was initially named TOHO-1 and was later
changed to CTX-M) (Matsumoto 1988). During the 1990s, general dissemination and
occasional nosocomial outbreak, mostly of CTX-M-2-producing Enterobacteriaceae,
were reported from South America (especially Argentina) (Peirano and Pitout 2010).
However, since 2000, E.coli producing CTX-M â-lactamases have emerged
worldwide as an important cause of community-onset urinary tract infections (UTIs)
and this has been called �the CTX-M pandemic�(Gutkind and Cátedra de 2001). These
enzymes were named for their greater activity against cefotaxime than other
oxyimino-beta-lactam substrates (e.g., ceftazidime, ceftriaxone, or cefepime)
(Pitout,et al, 2008). Rather than arising by mutation, they represent examples of
plasmid acquisition of beta-lactamase genes normally found on the chromosome of
Kluyvera species, a group of rarely pathogenic commensal organisms (Coque et al.
2008). These enzymes are not very closely related to TEM or SHV beta-lactamases in
that they show only approximately 40% identity with these two commonly isolated
beta-lactamases. The change at position 102 mainly enhances resistance to
Ceftazidime, while the change at position 236 predominantly augments resistance to
Cefotaxime, with a slight effect for Ceftazidime (Rahman et al. 2004). More than 80
CTX-M enzymes are currently known, they are currently devided into 5 clusters on
the basis of amino acid sequence: CTX-M-1,CTX-M-2, CTX-M-8, CTX-M-9 and
CTX-M-25 ( Al-Agamy et al. 2009; Smet et al. 2010) named after the enzyme first
discovered for each lineage (Pagani et al. 2003). Despite their name, a few are more
active on ceftazidime than cefotaxime. CTX-M-15 belongs to the CTX-M-1 cluster
and is derived from CTX-M-3 by one amino acid substitution at position 240
(Asp→Gly); however, the flanking sequences of the â-lactamases can be very
different (Peirano et al 2010). The gene encoding CTX-M-14 differs from that
encoding CTX-M-9 by only one amino acid change, at position 231 (Ala3Val),
whereas CTX-M-13 differs from CTX-M-9 by four amino acid substitutions, at
positions 3 (Val3Met), 53 (Val3Lys), 154 (Ala3Glu), and 231 (Ala3Val). Between
CTX-M-13 and CTX-M-14, there are three amino acid substitutions at positions 3, 53,
and 154 (Chanawong et al. 2002).
The initial observation of infections caused by bacteria harboring ESBLs in hospitals
would suggest that CTX-M arose in the nosocomial setting and spread to the
community (Perez et al. 2007). The epidemiology of organisms producing CTX-M
enzymes is very different from those that produce TEM-derived and SHV-derived
ESBLs (Pitout et al 2008). Epidemiological reports demonstrate that some enzymes
are more frequently reported than others, that predominant enzyme type varies with
country and that diverse CTX-M types often exist within a single country (Ensor et al.
2006). CTX-M-15-producing E. coli are emerging worldwide, especially since 2003,
as an important pathogen causing community-onset and hospital-acquired infections
(Pirano et al 2010). CTX-M enzymes (most often CTX-M-14 and -27) have been
described in Asia especially since the late 1990s and early 2000s.Reports on the
presence of CTX-M-15 in Asia remains relatively scarce outside of those studies from
the subcontinent (i.e. India and Pakistan) (Hawkey P. M., 2008). Reports from India
indicate that E. coli producingCTX-M-15 is very common in the community as well
as hospital settings (Ensor et al 2006). India represents a significant reservoir and
source of E. coli producing CTX-M-15 â-lactamases (Pirano et al 2010). CTX-M-15
was found 73% in India in 2006 by (Ensor et al. 2006). A strain that is thought to be
responsible for the pandemic dissemination of the CTX-M-15 enzyme (Coque et al.
2008). CTX-M-15 have been reported from most countries in Europe ,Asia, Africa,
North America, South America and Australia ( Pirano et al. 2010). Group 9 (CTX-M-
9 and 14) enzyme is dominant in Spain and Group 1 enzymes (particularly CTX-M 3
and CTX-M-15) is everywhere (Livermore2007). The bowel is a rich environment for
genetic exchange between commensal Enterobacteriaceae. Faecal carriage of CTX-M
producing bacteria has been described. It is plausible to suggest that conditions of
overcrowding and poor sanitation, and the selective pressure created by overuse of
antibiotics in India has enabled such widespread dispersal of CTX-M-15 (Ensor et al.
2007).
OXA beta-lactamases (class D)
OXA beta-lactamases were long recognized as a less common but also plasmid-
mediated beta-lactamase variety that could hydrolyze oxacillin and related anti-
staphylococcal penicillins. These beta-lactamases differ from the TEM and SHV
enzymes in that they belong to molecular class D and functional group 2d. The OXA-
type beta-lactamases confer resistance to ampicillin and cephalothin and are
characterized by their high hydrolytic activity against oxacillin and cloxacillin and the
fact that they are poorly inhibited by clavulanic acid. Amino acid substitutions in
OXA enzymes can also give the ESBL phenotype (Wikipedia 2010).
Others
Other plasmid-mediated ESBLs, such as PER, VEB, GES, and IBC beta-lactamases,
have been described but are uncommon and have been found mainly in P. aeruginosa
and at a limited number of geographic sites. PER-1 in isolates in Turkey, France, and
Italy; VEB-1 and VEB-2 in strains from Southeast Asia; and GES-1, GES-2, and
IBC-2 in isolates from South Africa, France, and Greece (Wikipedia 2010).
Inhibitor-resistant â-lactamases
Although the inhibitor-resistant â-lactamases are not ESBLs, they are often discussed
with ESBLs because they are also derivatives of the classical TEM- or SHV-type
enzymes. These enzymes were at first given the designation IRT for inhibitor-resistant
TEM â-lactamase; however, all have subsequently been renamed with numerical
TEM designations. There are at least 19 distinct inhibitor-resistant TEM â-lactamases.
These beta-lactamases have primarily been detected in France and a few other
locations within Europe (Wikipedia 2010).
AmpC-type â-lactamases (Class C)
AmpC type â-lactamases are commonly isolated from extended-spectrum
cephalosporin-resistant Gram-negative bacteria. AmpC â-lactamases (also termed
class C or group 1) are typically encoded on the chromosome of many Gram-negative
bacteria including Citrobacter, Serratia and Enterobacter species where its
expression is usually inducible; it may also occur on Escherichia coli but is not
usually inducible, although it can be hyperexpressed. AmpC type â-lactamases may
also be carried on plasmids (Wikipedia 2010).
Carbapenemases
Carbapenems are famously stable to AmpC â-lactamases and extended-spectrum-â-
lactamases. Carbapenemases are a diverse group of b-lactamases that are active not
only against the oxyimino-cephalosporins and cephamycins but also against the
carbapenems.
VIM (Verona integron-encoded metallo-â-lactamase)
A second growing family of carbapenemases, the VIM family, was reported from
Italy in 1999 and now includes 10 members, which have a wide geographic
distribution in Europe, South America, and the Far East and have been found in the
United States. VIM-1 was discovered in P. aeruginosa in Italy in 1996 (Wikipedia
2010).
OXA (oxacillinase) group of â-lactamases (Class D)
The OXA group of â-lactamases occurs mainly in Acinetobacter species and is
divided into two clusters. OXA carbapenemases also tend to have a reduced
hydrolytic efficiency towards penicillins and cephalosporins (Wikipedia 2010).
KPC (K. pneumoniae carbapenemase) (Class A)
A few class A enzymes, most noted the plasmid-mediated KPC enzymes, are effective
carbapenemases as well. Three variants are known, distinguished by one or two
amino-acid substitutions. KPC-1 was found in North Carolina, KPC-2 in Baltimore
and KPC-3 in New York. Plasmid �borne KPC enzymes are emerging among K.
pneumoniae and other Enterobactericeae(13). The class A Klebsiella pneumoniae
carbapenemase (KPC) is currently the most common carbapenemase, which was first
detected in North Carolina, USA, in 1996 and has since spread worldwide.A later
publication indicated that Enterobacteriaceae that produce KPC were becoming
common in the United States (Rhee 2010).
NDM-1 (New Delhi metallo-â-lactamase)
Originally described from New Delhi in 2009, this gene is now widespread in
Escherichia coli and Klebsiella pneumoniae from India and Pakistan. As of mid-2010,
NDM-1 carrying bacteria have been introduced to other countries (including the USA
and UK), presumably by medical tourists undergoing surgery in India. Inhibitor-
Resistant â-Lactamases (Wikipedia 2010).
Organism responsible for ESBL:
ESBLs are most common in E.coli and Klebsiella pneumoniae but do occure in other
Enterobacteroceae specially Enterobacter, Proteus, Pseudomonas aeroginosa,
Morganella morganii (Shobha 2007; Sasirekha et al. 2010; Peirano et al. 2010).
Risk group
Patients at high-risk for ESBL include:
� Neutropenic patients
� Transplant recipients
� Premature neonates
� Elderly persons
� Prolonged/extensive antibiotic use (e.g., cephalosporins)
� Post-gastrointestinal surgery
Consider screening all admissions to high risk units. High risk units include:
� Intensive care units
� Hematology/oncology units
� Transplantation units
� Long term/ chronic care facility (Peirano et al. 2010; Farkosh 2007).
Use of extended spectrum antibiotics exerts a selective pressure for emergence of
ESBL producing Gram negative rods (GNR) (Farkosh et al. 2007).
ESBL CARRIAGE
Patients with known ESBL carriage should have their records flagged consistent with
established policies. Upon readmission consider screening for ESBL. Sites most often
sampled for carriage are those where the microorganisms are typically found -
perianal/rectal and urine (Champs et al. 1989).
Patients with persistent carriage (e.g., 3 consecutive positive samples taken at least a
week apart and the continuation of ESBL-associated risk factors) do not require
continued screening during an admission. It is need to re-screen during the admission
if there are changes in ESBL-associated risk factors. Re-screening should be
determined on an individual patient basis. Factors to consider include: continuing use
of antibiotics, predicted invasive interventions, or proposed removal of precautions
(Friedman et al. 2004; Shobha et al. 2007).
During discharge the antibiotics should be informed about a patient�s ESBL-carriage
as with any antimicrobial-resistant microorganism (Friedman et al. 2004).
Reservour
Most colonized patients are asymptomatic and may be a source of transmisssion to
others (Friedman et al. 2004) .The bowel is a rich environment for genetic exchange
between commensal Enterobacteriaceae (Ensor et al. 2006).
Transmission
CTX-M gene mobilizes 10x more frequently than SHV & TEM gene (CLSI 2010).
The molecular epidemiology of ESBL outbreaks indicates that the mechanism of
spread may be clonal strain dissemination, clonal plasmid dissemination and selection
among polyclonal strains or both (Perez et al. 2007). The typical method of
transmission includes clonal dissemination of an ESBL producer strain or the
dissemination of a plasmid carrying an ESBL gene (Coque et al. 2008). Selective
antibiotic pressure then leads to colonization of patient�s bowel and skin with a risk of
subsequent infection. Thus, fecal colonization may play a critical role in facilitating
spread (Ensor et al. 2007). Outbreaks associated with procedures, e.g., catheterization,
and contamination of medical devices has been reported (Pitout et al. 2008). Spread
then appears to occur mainly through healthcare personnel hands. Endemic strains
may persist in health care settings for years because of patient colonization,
environmental contamination, and hand transmission (Friedman et al. 2004).
Patient to patient transfer of microorganisms via the hands of healthcare workers is
thought to be the main mode of transmission for ESBLs, although some ESBL
outbreaks have been attributed to contaminated medical devices (e.g., ultrasound gel).
Thus hand hygiene should be the most effective preventive measure (Friedman et al.
2004).
Prevention
Hand hygiene is a simple and effective infection control intervention. Dirty or
contaminated hands can transmit microorganisms which may cause infection .Hand
washing with soap and water is effective (Friedman et al. 2004).
Contact precautions in addition to other infection prevention measures, e.g., hand
hygiene, environmental cleaning, and restriction of antibiotics, have been shown to be
effective in preventing transmission in outbreak situations, use of gloves and
aprons/gowns. No additional precautions are required in outpatient or home care
settings (Friedman et al. 2004).
Patient placement
Single (private) room is preferred. Spatial separation may be used. Cohorting of
known cases, particularly in clusters/outbreaks, is acceptable. If there are limited
single room accommodations in a facility or if sharing a room with a non-ESBL
patient is required (e.g., long-term care facility, nursing homes, residential home),
consideration should be given to the following: ensure the non-ESBL patient does not
have risk factors, such as indwelling devices, neutropenia, history of transplantation,
etc., and the non-ESBL patient has good hygiene practices (Friedman et al. 2004).
Monitoring and control of usage of extended spectrum cephalosporins and regular
surveillance of antibiotic resistance patterns as well as efforts to decrease use as
empirical therapy is indicated (Rupp et al. 2003).
Laboratory procedure
The methods for detection of ESBLs can be broadly divided into two groups:
phenotypic methods that use non-molecular techniques, which detect the ability of the
ESBL enzymes to hydrolyse different cephalosporins; and genotypic methods, which
use molecular techniques to detect the gene responsible for the production of the
ESBL.
Clinical diagnostic laboratories use mostly phenotypic methods because these tests are
easy to perform and are cost effective also. Many different techniques exist for
confirming ESBL production but those utilizing similar methodology to standard
susceptibility tests are the most convenient for the routine diagnostic laboratory.
These all depend on detecting synergy between clavulanic acid and the indicator
cephalosporins used in the primary screening. Failure to detect ESBL production by
routine disk-diffusion tests has been well documented (Tenover et al. 1999; Paterson et
al. 1999).
The current CLSI recommendations (2010) for detection of ESBL's in Klebsiella spp.
and E. Coli includes an initial screening test with any two of the following beta-
lactam antibiotics: cefpodoxime, ceftazidime, aztreonam, cefotaxime, or ceftriaxone.
Isolates exhibiting a MIC > 1µg/ml should be confirmed phenotypically using
ceftazidime plus ceftazidime/clavulanic acid and cefotaxime plus
cefotaxime/clavulanic acid.
Screening test for ESBLs
Disc diffusion method
According to the CLSIs guidelines, isolates showing inhibition zone size of ≤ 22 mm
with Ceftazidime (30 µg), ≤ 25 mm with Ceftriaxone (30 µg), ≤ 27 mm with
Cefotaxime (30 µg) , ≤ 27 mm with Aztreonam (30 µg) and ≤ 22 mm with
Cefpodoxime (10 µg), was identified as potential ESBL producers and short listed
for confirmation of ESBL production. Recently ,chromogenic media designed
specifically for screening and identification of ESBLs producing Enterobacteriaceae,
have become comercially available (Black et al. 2005).The use of Cefotaxime,
Ceftazidime and Ceftriaxone individually as the indicator of ESBLs screening can no
longer be recommended. If only one indicator antibiotic would be used for screening,
Cefpodoxime has proven to be the best molecule for screening all types ESBLs
producers in clinical sample (CLSI 2010).
MIC (Minimum inhibitory concentration): It is done by tow test: Agar dilution
method and Broth dilution method. Advantages and disadvantages have in both
method e.g. Agar versus Broth dilution method:
By using an inoculums replicating apparatus, a fairly large number of strains (25-36) ,
may be tested at a time by agar dilution method.
Microbial concentration, if any, can be detected, more easily, as compared to broth
dilution method.
In agar dilution method for particular type of organism blood and blood product can
be easily mixed, which cannot reliably be done in broth dilution method.
The disadvantage of agar dilution method is the time consuming and labour intensive
task of preparing the plates and inoculums.
Table showing MIC and Inhibition Zone criteria for the detection of ESBLs in K
.pneumoniae and Esch. coli (CLSI 2010) (Appendix-XII).
Confirmatory tests for ESBLs
Many methods for the detection of ESBLs , plasmid mediated AmpC â-lactamases
and carbapenemases have been proposed, but some procedures are technically
demanding and time consuming, others are hard to interpret and still others require.
Double disc synergy test
The disc synergy test (DDST) is the oldest method for phenotypic confirmation of
ESBLs producing organisms, first proposed in 1980 (Jarlier et al. 1988).
A ceftazidim 30 mg disc and amoxycillin/ clavulanic acid 20+ 10 mg disc will be
placed 25 -30 mm apart, centre to centre. Following overnight incubation in an air at
370 C, ESBL production is inferred when the zone of inhibition around the ceftazidim
disc is expanded by the clavulanate.
Fig. 5. Showing double disc synergy test
The disc on the left is cefotaxime (30mg): the disc in the centre is
coamoxyclav(20+10 mg): the disc on theright is ceftazidime (30 mg). Note the
expansion of the zones around the cefotaxime and ceftazidime discs adjacent to the
co-amoxyclav.
Modified double disc diffusion test
Mueller Hinton agar media will be inoculated with standardized inoculum
(corresponding to 0.5 McFarland tube) using sterile cotton swab . Augmentin (20 g
amoxycillin and 10 g clavulinic acid �AMC ) disc will be placed in the center of the
plate and test discs of 3 rd generation cephalosporins (Ceftazidim � CA,-30 g
,Ceftriaxone-CRO 30g, Cefotaxime �CTX 30 g , Aztreonam ATM -30 g) discs will
be placed at 15 mm distance from the Augmentin disc. The plate will be incubated
overnight at 37o C . ESBL pproduction will be considered positive if the zone of
inhibition around the test discs increased towards the Augmentin disc or neither disc
will be inhibitory alone but bacterial growth will be inhibited where the two
antibiotics diffuse together. Enhancement of the zone of inhibition around one or
more of the â-lactam-containing discs towards the clavulanic acid-containing disc is
indicative of ESBL production. Precise placement of discs is important (a distance of
15mm between the discs is recommended) and interpretation is subjective.
Fig. 5. Showing modified double disc diffusion test
Disc replacement method for ESBL confirmation
Two amoxyclav (AMC 30) discs will be placed on Mueller Hinton agar inoculated
with the bacterial isolates. After 1 hour at room temperature, the discs were removed
and replaced with Ceftazidim (RP-30) and Ceftriaxone (AUF -30). Each
Cephalosporin disc will be placed independent of the initial augmentin discs and the
plates will be incubated at 370 C for 18-24 hours and read for evidence of ESBL
production. Positive disc replacement method will be indicated by an increase in
inhibition zone of 5 mm and above between the inhibition zones formed by the
augmentin- replaced cephalosporin discs and those placed independently.
The following two procedures will be carried out in the present study as per CLSI
guidelines:
Phenotypic confirmatory test with combination disk
This test requires the use of a third-generation cephalosporin antibiotic disk alone and
in combination with clavulanic acid. In this study, two combinations will be used,
firstly a disk of Ceftazidime (30µg) alone and a disk of Ceftazidime + Clavulanic acid
(30 µg/10 µg) and secondly Cefotexime(30µg) alone and a disc of
Cefotaxime+Clavulanic acid
(30µg/10µg) will be used. Both the disks will be placed at least 25 mm apart, center
to center, on a lawn culture of the test isolate on Mueller Hinton Agar (MHA) plate
and incubated overnight at 37°C. Difference in zone diameters with and without
clavulanic acid was measured.
Fig. 6. Showing double disc diffusion test
Interpretation: When there is an increase of ≥ 5 mm in inhibition zone diameter
around combination disk of Ceftazidime + Clavulanic acid versus the inhibition zone
diameter around Ceftazidime disk alone, it confirms ESBL production.
Control strain used to validate susceptibility tests will be E. coli ATCC 25922.
Vitek ESBL cards
Laboratories using conventional Vitek cards risk incorrectly reporting ESBL
producing organisms as susceptible to cephalosporins when MICs are ≤ 8 µg/ml. The
Vitek ESBL test (bioMerieux Vitek, Hazelton, Missouri) utilize cefotaxime and
ceftazidime, alone (at 0.5 µg/ml), and in combination with clavulanic acid (0.4
µg/ml). Inoculation of the cards is identical to that performed for regular Vitek cards.
Analysis of all wells is performed automatically, once the growth control well reached
a set threshold (4 to 15 hr of incubation). A predetermined reduction in the growth of
the cefotaxime or ceftazidime wells containing clavulinic acid, compared with the
level of growth in the well with the cephalosporin alone, indicates a positive result.
Sensitivity and specificity of the method exceed 90%.
BD Phonex Automated Microbiology System
Bacton Dickison Biosciences (Sparks, Md) have introduced a short incubation
systemfor bacterial identification and susceptibility testing, known as BD Phoenix.
The Phoenix ESBL test uses growth response to cefpodoxime, ceftazidime,
ceftriaxone and cefotaxime, with or without clavulinic acid, to detect the production
of ESBLS. The test organism has been identified by Sanguinetli et al. (2003). Results
are usually available within 6 hours.
The E test method (Epsilon test)
Produced by AB Biodisk (Solna, Sweden) and Bio-Stat (Stockport, UK) is a plastic
drug-impregnated strip, one end of which generates a stable concentration gradient of
cephalosporin (i.e., ceftazidime 0.5�32 µg/ml, cefotaxime and cefepime 0.25�16
µg/ml) and the remaining end of which generates a gradient of cephalosporin (i.e.,
ceftazidime and cefepime 0.064�4 µg/ml, cefotaxime 0.016�1 µg/ml) plus a constant
concentration of clavulanate (4 µg/ml). ESBL production is inferred if the MIC ratio
for cephalosporin alone/cephalosporin plus clavulanate MIC is ≥ 8 (Health Protection
Agency, 2005). Accurate and precise (but more expensive than combination disks)
these tests are suggested by the BSAC as a confirmatory test for ESBL production.
Significantly, BASC recommends the cefepime/clavulanate Etest for Enterobacter
spp. (Health Protection Agency, 2005). In fact, neither ceftazidime/clavulanate nor
cefotaxime/clavulanate Etest strips are able to detect the ESBLs in Enterobacter spp.
In contrast, the cefepime/clavulanate strip is the only commercially available and
highly reliable test that permits accurate detection of ESBLs within this group of
organisms (Rupp, et al, 2003). Florigin, et al, found that E- test was more sensitive
than the disc diffusion test ( Florigin, et al, 2002).
Currently CLSI does not recommend any specific tests to detect AmpC production in
Enterobacteriaceae. Several phenotypic tests for detection of these enzymes have
been described but at this time no assay has been sufficiently evaluated for CLSI to
make a recommendation to test for AmpC beta-lactamase. Like ESBL detection
assays, AmpC detection assays are not recommended by CLSI for making treatment
decisions (CLSI 2010).
Phenotypic ESBL confermation tests for routine are based on in vitro inhibition of
ESBL by clavulinic acid (CA). These tests are tailored to detect ESBLs in Klebsiella
spp. but are equally applicable to other Enterobactriaceae with little or no
chromosomal â- lactamase activity, such as E.coli and Proteus mirabilis. False
negative result can be obtained e.g.
Strains that coproduce an inducible chromosomal or plasmid mediated AmpC beta
lactamase. Because AmpC enzymes may be induced by clavulanate (which inhibit
them poorly) and may then attack the cephalosporins , masking synergy arising from
inhibition of the ESBL (Pfaller et al. 2006).
Also false positive results are obtained using inhibitor based ESBL detection: Mainly
in Klebsiella oxytoca isolates, hyperproducing the chromosomal â-lactamase
(Wiegand et al. 2007).
The phenotypic detection of ESBLs in bacteria other than E coli, Klebsiella spp, and
Proteus spp remains a problematic and controversial issue. The reason for this is that
the clavulanate effect noticed with these ESBL-producing species is not always
present in species such as enterobacter and citrobacter (Pitout et al. 2008).
Genotypic detection
Phenotypic methods are not able to distinguish between the specific enzymes
responsible for ESBL production (SHV, TEM, and CTX-M types). Several research
or reference laboratories use genotypic methods for the identification of the specific
gene responsible for the production of the ESBL, which have the additional ability to
detect low-level resistance (i.e, can be missed by phenotypic methods). Furthermore,
molecular assays also have the potential to be done directly on clinical specimens
without culturing the bacteria, with subsequent reduction of detection time.
The determination of whether a specific ESBL present in a clinical isolate is related to
TEM and SHV enzymes is a complicated process because point mutations around the
active sites of the TEM and SHV sequences have led to amino acid changes that
increase the spectrum of activity of the parent enzymes, such as in TEM-1, TEM-2,
and SHV-1 (Farkosh 2007). The molecular method commonly used is the PCR
amplification of the TEM and SHV genes with oligonucleotide primers, followed by
sequencing. Sequencing is essential to discriminate between the non-ESBL parent
enzymes (eg, TEM-1, TEM-2, or SHV-1) and different variants of TEM or SHV
ESBLs (eg, TEM-3, SHV-2, etc).
Molecular methods that do not use sequencing have been developed to characterise
ESBLs and include PCR with RFLPs, PCR with single-strand conformational
polymorphism, ligase chain reaction, restriction site insertion PCR, and real-time
PCR. PCR amplification followed by nucleotide sequencing remains the gold
standard for the identification of specific point mutation of TEM or SHV ESBL
genes. This is not always straightforward and cost effective because clinical isolates
often have multiple copies of ESBL genes. Sequencing is the only method for
identifying CTX-M genes, which is labourintensive, time-consuming and expensive.
Xu and his collegues report the development of a rapid and accurate multiplex PCR
assay for simultaneous amplification of all CTX-M genes and differentiation of the
five clusters (Xu, et al, 2005).
Treatment
The presence of ESBLs complicates the selection of antibiotics, particularly in
patients with serious infections such as bacteraemia. The reason for this is that ESBL-
producing bacteria are often multiresistant to various antibiotics, and CTX-M-
producing isolates are co-resistant to the fluoroquinolones. Antibiotics that are
regularly used for empirical therapy of serious community-onset infections, such as
the third-generation cephalosporins (eg, cefotaxime and ceftriaxone), are often not
effective against ESBL-producing bacteria. This multiple drug resistance has major
implications for the selection of adequate empirical therapy regimens. Empirical
therapy is prescribed at the time when an infection is clinically diagnosed, while the
results of cultures and antimicrobial susceptibility profiles are awaited. Infections
caused by ESBL-producing bacteria. A major challenge when selecting an empirical
regimen is to choose an agent that has adequate activity against the infecting
organism(s). Empirical antibiotic choices should
be individualized based on institutional antibiograms.
Beta lactam /Beta lactamases inhibitor
As ESBL producing Enterobacteriaceae are frequently susceptible in vitro to Beta
lactam/ Beta lactamase inhibitor combinations, it is logical to assume these
combinations would also be clinically effective .But here we have to know that AmpC
enzymes are normally resists.
Carbanepem
(e.g., imipenem,meropenem,ertapenem) choice of drug for treating the ESBL
producing bacteria (Samaha-Kfoury and Araj 2003).
Quinolones
If there is in vitro susceptible to ciprofloxacin, a satisfactory clinical response can be
achieved by using quinolones (Samaha-Kfoury and Araj 2003).
Aminoglycosides
As in the case with quinolones, aminoglycosides are effective therapy against ESBL
producing pathogens .Susceptibility to amikacin seems to be preserved, in contrast to
gentamicin and tobramycin, thus justifying its use as empiric therapy (Samaha-Kfoury
and Araj 2003).
Tigecycline
Tigecycline, a novel, first in class glycycline and an analogue of the semisynthetic
antibiotic minocycline, is a potent, broad spectrum antibiotic that acts by inhibition of
protein translation in bacteria by binding to the 30S ribosomal subunit and blocking
the entry of amino-acyl to RNA molecules into the A site of the ribosome (Amaya et
al. 2009).CLSI criteria to interpret susceptibility testing of tigecycline are not yet
established. In vitro data supports the notion that tigecycline can be considered an
alternative to carbapenems for treatment of infections due to ESBL-producing
Enterobacteriaceae. However, clinical experience with tigecycline is still evolving
(Rupp and Fey 2003).
Fosfomycin
Fosfomycin tromethamine is a soluble salt of fosfomycin with improved
bioavailability over fosfomycin. It inactivates the enzyme pyruvyltransferase, which
is required for the synthesis of the bacterial cell wall peptidoglycan (Amaya et al.
2009). The excellent in vitro activity of fosfomycin against ESBL-producing E. coli
and K. pneumoniae strains has been recently reported. Further studies are required to
assess the efficacy of fosfomycin for the treatment of UTIs caused by ESBL-
producing enterobacteria (Rupp and Fey 2003).
Colistin
Although once considered a toxic antibiotic, clinicians have now turned to colistin as
a last resort agent for the treatment of infections caused by multidrug resistant gram-
negative bacteria, against which this cationic detergent-like compound remains
active.The antimicrobial target of colistin is the bacterial cell membrane,where the
polycationic peptide ring interacts with the lipid A of Lipopolysacharides, allowing
penetration through the outer membrane by displacing Ca + and Mg + . Insertion
between the phospholipids of the cytoplasomic membrane leads to loss of membrane
integrity and to bacterial cell death (Amaya et al. 2009).
As mentioned above, carbapenem resistance mediated by KPC is emerging among
enterobacteria. Their implication in outbreaks, as seen in hospitals in New York City,
has created a context in which the empiric use of colistin is necessary.
The cephamycins, including cefoxitin and cefotetan, are stable to hydrolysis by ESBL
producing Enterobactericeae. However, there is a general reluctance to use these
agents because of the relative ease by which some isolates may decrease the
expression of outer
membrane proteins, thus creating resistance to these agents during therapy.
Materials and methods
Study design
Descriptive type cross sectional study.
Place of study
Department of Microbiology, Mymensingh Medical College, Mymensingh.
Period of study
The study was carried out form july 2010 to June 2011.
Study population
All clinical isolates of Gram negative bacilli, from urine, pus and wound swab from
the in patients of Gynae, Surgery, Medicine and Orthopedics ward and from
community.
Sample size
Three hundreds (300).
Data collection
By a predesigned data sheet.
Sampling technique
Non probability purposive type of sampling.
Data analysis
Data were analyzed by using computer based programmed excel and statistical
package for social science (SPSS) version 16.0.
Sample size determination=
Z2 pq
n = --------------
d2
n = Desired sample size,
p= Prevalence of the disease / problem in
community,
q= (1-p),
d= Degree of accuracy (it is .05),
z= Confidence interval (usually
we take 95% CI, in which z=
1.96),
n = (1.96) 2 ×0.47 ×0.53
(0.05)2
= 3.84×0.47× 0.53
0.0025
= 0.956
0.0025
= 382
Collection of urine sample
Patients included in the study were given a sterile, dry, test tube and request for 10-20
ml specimen. The first urine passed by the patient at the beginning of the day was
collected for examination (clean catch, mid stream). The female patients were advised
to clean the area around the urethral opening with clean water, dry the area and collect
the urine with the labia apart .The male patients were advised to wash the hands
before collecting the specimen (Cheesbrough 2006).
Collection of skin wound
A sterile technique was applied to aspirate or collect pus or wound swab from abscess
or wound infection, either by disposable syringe or by sterile swab stick. Specimen
was collected in a sterile test tube plugged with cotton, before an antiseptic dressing is
applied. Special care was taken to avoid contamination with commensal organisms
from the skin (Cheesbrough 2006).
Inoculation of samples
All samples were routinely cultured on MacConkey and blood agar plates. These
plates were routinely incubated at 370C aerobically and after overnight incubation,
they were checked for bacterial growth. The organisms were identified by their
colony morphology, staining characters, pigment production, motility and other
relevant biochemical tests as per standard laboratory methods of identification.
Isolation and identification of organisms
Suspected Gram negative organisms were identified by colony characteristics,
motility, oxidase reaction, citrate utilization, indole and gas production and sugar
fermentation reactions .Triple sugar iron agar was used for H2S production, sugar
fermentation.
Grams staining
A drop of normal saline was taken on the centre of a clear glass slide and a colony
was taken by a sterilized inoculating loop to make a thinemulsion. A very thin film
was prepared by spreading the emulsion uniformly. This film was fixed by passing it
over the flame for two or three times. Smear was covered with crystal violet stain for
30 -60 seconds. Then stain was washed with distilled water and cover with Lugol�s
iodine for 30-60- seconds. Again stain was washed with distilled water and
decolourize with acetone alcohol and washed with distilled water .The back of the
slide was wiped and placed it in a draining rack, for the smear to air dry .Test
specimen was examined and compared with positive and negative control under
microscope (Cheesbrough 2006).
Spot Oxidase test (Cytochrome oxidase)
This test was used to identify the organisms, which produce the enzyme oxidase. A
strip of filter paper was impregnated with 1% w/v aqueous tetra methyl p-phenylene
diamin dihydrochloride solution. A speck of culture from the primary plate was
immediately rubbed on it with a sterile toothpick. A positive reaction indicates by a
deep purple blue within 5-10 seconds (Baily and Scott 2006).
Motility test
Motility test medium was used to test the motility of the bacteria. Semisolid media
(0.5%) was used for this purpose. The organism was inoculated by stabbing a
straight wire carrying the inoculums once vertically into the center of the agar butt.
After overnight incubation, motility was shown by a spreading turbidity from the
stab line or turbidity through out the medium (Baily and Scott 2006).
Citrate utilization test
Simon�s citrate agar media was used for differentiating the intestinal bacteria and
other micro organisms on the basis of citrate utilization. Very light inoculums were
picked with a straight wire and the organism was inoculated to the surface of Simon�s
citrate agar slant. Citrate utilization is followed by alkaline reaction e.g., change of
color from light green to blue (Baily and Scott 2006).
Test for indole production
Indole production was tested for some bacteria, which has the ability to degrade
tryptophan to indole. Indole production was detected by Kovac�s reagent (4-dimethyl
amino benzaldehyde, isoamyl alcohol, hydrochloric acid). The test organism was
cultured in peptone broth which contains tryptophan. This broth was inoculated at
350C for overnight and Kovac�s reagent was added. Development of red colour ring
over the surface in the broth within 10 minutes indicates positive test (Cheesbrough
2006).
Triple sugar iron agar (TSI)
This media was used for initial identification of Gram negative bacilli, particularly
members of enterobacteriaceae. Three primary characteristics of a bacterium was
detected by this media, include ability to ferment carbohydrate (lactose, sucrose,
glucose,), ability to produce gas, and the production of hydrogen sulfide gas. To
inoculate a slope and butt medium, a small amount of growth from a pure culture
colony was picked onto a straight wire and inoculated to this media by stabbing the
butt and streaking the surface of the slant slope in a zigzag pattern of the tube all the
way to the bottom. This tube was incubated at 350 C for over night to observe the
colour change of the slant and butt for differentiation of enterobacteriaceae (Baily
and Scott 2010) as mentioned in the appendix (Appendix - VII).
Maintenance and preservation of culture strains
Organisms grown in appropriate media for 18 hours were preserved in a nutrient agar
slant at 2-80 C in a refrigerator and this culture was used within two weeks for routine
laboratory works. For long term preservation, strains were stored in brain heart
infusion broth with 20% glycerol and stored frozen without significant loss of
viability at -200 C until further study (Cheesbrough 2006).
Antimicrobial susceptibility test done by modified Kirby-Bauer sensitivity testing
method
Inoculation of isolated bacteria and placement of discs
Modified Kirby-Bauer sensitivity testing method was used for this purpose. Muller
Hinton agar media was used, which has PH 7.2-7.4. Media was transfer in to 90 mm
diameter sterile Petri dishes to a depth of 4 (four) mm. The surface was lightly and
uniformly inoculated by cotton swab in three directions rotating the plate
approximately 600, to ensure even distribution. Prior to inoculation, the swab stick
was dipped into bacterial suspension having visually equivalent turbidity to 0.5
McFarland standards (Appendix-XIV). The swab stick was then took out and
squeezed on the wall of the test tube to discard extra suspension. Inoculated plates
were incubated at 37 0C for 24 hours. On the next day, plates were read by taking
measurement of zone of inhibition. Antimicrobial discs used for Gram negative
bacteria were Ampicillin (10 µg), Amoxycillin-clavulanic acid (20/10 µg),
Piperacillin (100 µg), Cephotaxime (30 µg), Ceftriaxone (30 µg), Ceftazidime (30
µg), Gentamicin (10 µg), Amikacin (30 µg), Netilmicin (30 µg), Tetracycline (30 µg),
Ciprofloxacin (5 µg), Chloramphenicol (30µg), Imipenem (10 µg) and Azythromycin
(30 µgm). Antimicrobial disks used for Pseudomonas spp.were Amoxycillin-
clavulanic acid (20/10 µg), Piperacillin (100 µg), Cephotaxime (30 µg), Ceftriaxone
(30 µg), Ceftazidime (30 µg), Gentamicin (10 µg), Amikacin (30 µg), Netilmicin (30
µg), Tetracycline (30 µg), Ciprofloxacin (5 µg), Chloramphenicol (30µg), Imipenem
(10 µg) and Azythromycin (30 µgm) (CLSI 2010).
Screening test for ESBLs
Isolates were screened for ESBL production by using disc Diffusion of cefotaxime
(CTX), ceftazidime (CAZ), ceftriaxone (CRX) and Aztreonam(AZM) placed on
inoculated plates containing Muller Hinton agar according to the CLSI
recommendations. Isolates showing inhibition zone size of ≥22 mm with ceftazidime
(30ìg), ≥25 mm with ceftriaxone (30ìg), ≥ 27 mm with cefotaxime (30ìg) ,≥ 27 mm
with Aztreonam (30 µg) were suspected for ESBL production. But both the strains
were resistant as well as sensitive to 3GCs were included. E. coli ATCC 25922 was
used as a negative control (Appendix-XII)
Confirmatory test for ESBLs
Phenotypic confirmatory test for ESBL producers were done by double disc diffusion
test (DDDT) and MIC reduction methods, for all the ESBL producing isolates as per
CLSI 2010 guidelines as well as initially sensitive to 3GCs (Tenover et al. 1999;
Paterson and Yu 1999).
Double disk diffusion method (DDDT)
In this test a disc of ceftazidime (30ìg), cefotaxime (30µg) alone and a disc of
ceftazidime and cefotaxime in combination with clavulanic acid (30/10ìg) were used
for each isolates. Both the discs were placed 25 mm apart, centre to center, on a lawn
culture of the test isolate on Muller Hinton agar plate and incubated overnight at 370
C. A ≥5 mm increase in zone diameter for either antimicrobial agent tested in
combination with clavulinic acid versus its zone when tested alone was designated as
ESBL positive. (Figure-)
Fig. 15. Showing double disc diffusion test
Interpretation: When there is an increase of ≥ 5 mm in inhibition zone diameter
around combination disk of Ceftazidime + Clavulanic acid versus the inhibition zone
diameter around Ceftazidime disk alone, it confirms ESBL production.
MIC reduction test
All the isolates were further confirmed for ESBL production by this test. For
ceftazidime a break point of MIC, ≥16 ìg/ml was taken ESBL positive. (Appendix-
XII).
Determination of MIC by Agar plate dilution method
Agar plate dilution test was used to determine the minimal inhibitory concentration
(MIC) of an antimicrobial agent required for inhibiting or killing a microorganism.
Preparation of antimicrobial agents
Ceftazidime was dissolved in distilled water and then added to melted agar. The
different antibiotic concentration (l/ml) was used in the MIC. The concentration of
stock solution of antibiotics was 50 mg/ml and stored at -200C. MIC range was
followed according to the CLSI guidelines (CLSI, 2010).
Preparation of plates
100 ml Muller-Hinton medium of each flask was autoclaved and allowed to cool at
500C in water bath. Then different concentration of antibiotic solution was added to
each flask, mixed thoroughly and antibiotic-containing media was poured
immediately on the plate. Two fold (Log2) serial dilutions of the antimicrobials were
added with agar medium. The concentration of the ceftazidime in different plates was
32 g/ml, 16 g/ml, 8 g/ml used in different plates. Plates were stored at 40C in
plastic bag and use within one week of preparation. Before inoculation, plates were
dried. Control plates of Muller-Hinton agar containing no antimicrobial agent was
also prepared to ensure the effectiveness of the medium in sustaining the growth of
organism.
Turbidity Standard for MIC inoculum preparation
To standardize the inoculum density for a susceptibility test, a 0.5 McFarland standard
was prepared as described in CLSI 2010.
Inoculation and Incubation of the medium
Agar surface of the plates containing different concentration of ceftazidime and the
control plate contained no antimicrobial agents were spot inoculated with a digital
micropipette. A volume of 2 l suspension of the 104 CFU/ml organisms was spot
inoculated. Inoculation was done from the plate containing lowest concentration of
antimicrobial and the control plate was inoculated lastly. At least 30 different strains
were tested at a time in each plate. Inoculated agar plates was allowed to stand until
the inoculums spot was completely absorbed and afterwards it was incubated at 350C
for overnight. Control strains E. coli ATCC 25922 was used in each plate.
Interpretation of results
The MIC represents the concentration of antimicrobial at which there is complete
inhibition of growth. In reading the end points, a barely visible haze of growth or a
single colony is disregarded. The results were interpreted according to the
recommendation chart CLSI 2010 (Appendix -XII) as resistant (R) and Susceptibility
(S) .
Genotypic detection
Multiplex PCR for detecting TEM, SHV and CTX-M genes:
Steps:
A) DNA extraction from colony.
B) DNA amplification in thermal cycler.
C) Gel electrophoresis and Visualization under UV lights by transilluminator.
A) DNA extraction from colony was done by alkaline lysis method
A single colony of each organism was inoculated from MacConkey agar into 5ml of
Luria-Bertanii broth (LB) and incubated for 20 h at 37º C. Cells from 1.5ml of the
overnight culture was harvested by centrifugation at 12,000 rpm for 5 min. 1.5 ml
from LB media containing cells was taken appendrof tube, than 100 µl TNE buffer
was mixed. The mixture was centrifuged for 1 min at 10000 rpm and supernatant was
discarded. Again 100 µl NaOH (50 mM) was added to pellet. After heating at 400C in
water bath for 1 min, 60 µl of IM Tris HCl (PH 6.7) was added. Vortex, centrifuge at
10000 rpm for1 min was done. Then supernatant was used as template (1µl) (Medici
et al. 2003 with some modification).
B) DNA amplification in thermal cycler
PCR analysis for beta lactamase genes of the family TEM, SHV, CTX-M and CTX-
M-3, CTX-M-14, were carried out. Primers obtained from Japan used for TEM, SHV
and CTX-M was kindly supplied by Prof. Nobumichi Kobayashi.
Primer used for TEM, SHV, CTX-M-U, CTX-M-3, CTX-M-14 were
Target gene Primers Sequences Amplicon size
TEM TEM F CTTCCTGTTTTTGCTCACCCA 717 bp
TEM R TACGATACGGGAGGGCTTAC
SHV SHV F TCAGCGAAAAACACCTTG 471 bp
SHV R TCCCGCAGATAAATCACC
CTX-M-U CTX-MU1 (5_-ATGTGCAGYACCAGTAARGT) 593 bp
CTX-MU2 (5_TGGGTRAARTARGTSACCAGA)
CTX-M-3 CTX-M-3 F AATCACTGCGCCAGTTCACGCT 479 bp
CTX-M-3 R GAACGTTTCGTCTCCCAGCTGT
CTX-M-14 CTX-M 14 F TACCGCAGATAATACGCAGGTG 355 bp
CTX-M 14 R CAGCGTAGGTTCAGTGCGATCC
Preparation of reaction mixture
For PCR amplification, 1 µl of template DNA was added to 50 µl of master mixture
containing 4 µl of Dntp mixture (2.5mM of each) , 10X PCR buffer 5 µl (Ex
Taq),0.5 µl of Taq polymerase (250 U) , 1 µl of each primer stock solution (50pmol/
µl), and remaining 38.5 µl volume was fulfilled by neuclease free water (Takara
Japan).
Amplification
The prepared PCR tubes with master mixture were placed in the eppendrof thermal
cycler. Amplification was carried out according to the following thermal and cycling
condition:
For TEM, SHV gene
Initial denaturation at 940C for 3 minute
Denaturation at 940C for 30 sec
Annealing at 500C for 30sec 35 cycles
Extension at 720C for 2 min
Final extension at 720C for 10 minutes
For CTX-M gene
Initial denaturation at 940C for 7 minute
Denaturation at 940C for 50 sec
Annealing at 500C for 40sec 30 cycles
Extension at 720C for 1 min
Final extension at 720C for 5 minutes
C) Gel electrophoresis and Visualization under UV lights by transilluminator
Agarose gel electrophoresis
The PCR products were analyzed after electrophoresis in 1.0% agarose gel to detect
specific amplified product by comparing with standard molecular weight marker.
Preparation of agarose gel
One percent agarose gel was prepared by melting 2.0 gm agarose in 200 ml of diluted
TBE Buffer using a microwave woven. The melted agarose was allowed to cool to
about 50ºC and 20 µl ethidium bromide was mixed and shacked and was poured into
gel tray and combs were placed. After solidification of the gel, the comb was
removed. During electrophoresis, the gel was placed in a Horizontal electrophoresis
apparatus containing TBE buffer and ethidium bromide.
Loading and electrophoresis of the sample
Five µl of amplified PCR product was mixed with 2.0 µl of loading buffer. The
mixture was slowly loaded into the well using disposable micropipette tips. Hundred
bp molecular weight marker was loaded in one well to determine the size of the
amplified PCR products. Electrophoresis was carried out at 100 volts for 35 minutes .
Visualization of the gel
The amplified products of the study samples were visualized by trans-illuminator.
And the gel was photographed by a digital camera and transferred data to computer
for further documentation ((Sharma et al. 2010; Lal et al. 2007; Pagani et al. 2003).
RESULTS During the one year period, a total of 300 Gram negative isolates from various clinical
specimens were included in the study. The isolated organisms were characterized for
their antibiogram, MIC, production of ESBLs and presence of TEM, SHV, and CTX-
M genes and different clusters of CTX-M â-lactamases.
The distribution of various specimens are given in Table -I. The specimens were urine
216 (72%), wound swab 45 (15 %), pus 39 (13%).
Table -I Distribution of sample from various specimens
Type of specimen Total no
Urine 216 (72)
Wound swab 45 (15)
Pus 39 (13)
Total 300 (100)
Note: Figures in parentheses represent percentage
Out of 300 Gram negative isolates in this study majority were Esch. coli 156 (52%),
followed by Proteus spp. 55 (18.3%), Klebsiella spp. 45 (15%), Pseudomonas spp. 9
(3%) and others (Enterobacter spp., Citrobacter spp.) 35 (11.7%). (Table -II).
Table � II Detection rate of different isolates in the study population
Name of the organisms Total No Percent
Esch. coli 156 52.0
Proteus spp. 55 18.3
Klebsiella spp. 45 15.0
Pseudomonas spp. 9 3.0
*Others 35 11.7
Total 300 100.0
* Others - Enterobacter spp., Citrobacter spp
Table-III Showed pattern of organisms isolated from the community and hospital.
Klebsiella spp. (62%), was found to be the most prevalent organisms isolated from the
community followed by, Esch. coli 57% Proteus spp. 45%, Pseudomonas spp 44.4%.
On the other hand Proteus spp. 54.5% was found to be the most prevalent organisms
isolated from the community followed by Esch. coli 42.9%, Klebsiella spp. 37.7%,
Pseudomonas spp (5/9, 55.5%).Pseudomonas spp were found to be the least prevalent
isolates.
Table- III Pattern of organisms isolated from the community and hospital
Name of the
organisms No. of total isolates
No. of clinical
isolated from
community
No. of clinical
isolated from
hospital
Esch. coli 156 (52) 89 (57) 67 (42.9)
Klebsiella spp 45 (15) 28 (62) 17 (37.7)
Proteus 55 (18.3) 25 (45.4) 30 (54.5)
Pseudomonas
spp 9 (3.0) 4 (44.4) 5 (55.5)
*Others 35 (11.7) 22 (62.85) 13 (37.1)
300 (100) 168 (56) 132 (44)
Note: Figures in parentheses represent percentage
* Others - Enterobacter spp., Citrobacter spp
Table IV Showed distribution of Esch.coli, Klebsiella spp. Proteus spp. Pseudomonas
spp. found from different clinical specimens both from community and hospital.
Detection of Esch.coli, 63.6% is more from hospital acquired isolates from pus;
Klebsiella spp. 18.1% from urine sample from community, Proteus spp. 29.4% was
most prevalent in urine both from community and hospital.
Table-IV showed distribution of E.coli, Klebsiella spp, Proteus spp and
Pseudomonas spp. in different specimens both from hospital and community
Type of specimen Isolated organism
Community
Hospital
Esch.coli Klebsiell
spp.
Proteus
spp.
Pseudomon
as spp
Others
10 (58.8) 1 (5.8) 5 (29.4) 1 (5.8) 0 (0) Pus n= 17/22
14 (63.6) 3 (13.6) 5 (22.7) 0 (0) 0 (0)
79 (53.0) 27 (18.1) 18 (12.0) 3 (2.01) 22 (14.7) Urine n=149/67
39 (58.2) 9 (13.4) 14 (20.8) 0 (0) 5 (7.5)
0 (0) 0 (0) 2 (100) 0 (0) 0 (0) Wound swab,
n=2/43 14 (32.5) 5 (11.6) 11 (25.6) 5 (11.6) 8 (18.6)
Total, n=300 156 45 55 9 35
Note: Figures in parentheses represent percentage
* Others - Enterobacter spp., Citrobacter spp
C � Community, H � Hospital.
Table V Showed antimicrobial resistance pattern of both hospital and community
acquired isolates. Aztreonam, Ampicillin, Amoxyclave and Piperacillin were more
resistant. Among them in Klebsiella spp. was more resistant than Esch. coli. All the
isolated organism in this study were 100% sensitive to Imepenem and 98% sensitive
to Nitrofurantoin.
Table �V Antibiotic resistance pattern of Esch.coli and Klebsiella spp. isolated
from community hospital and community by disc diffusion method
Esch. coli Klebsiella spp. Antimicrobials
Hospital
isolates n=67
Community
isolates n=89
Hospital
isolates n=17
Community
isolates n=28
Aztreonam 67 (100) 89 (100) 17 (100) 28 (100)
Piperacillin 62 (92.5) 85 (95.5) 15 (88.3) 27 (96.4)
Amoxiclave 63 (94.0) 83 (93.2) 16 (94.1) 26 (92.8)
Ampicillin 64 (95.5) 80 (89.8) 16 (94.1) 25 (89.2)
Ceftriaxone 57 (85.0) 70 (78.6) 15 (88.2) 23 (82.1)
Ciprofloxacin 56 (83.5) 64 (71.9) 15 (88.2) 22 (78.5)
Cefotaxime 53 (79.1) 63 (70.7) 14 (82.3) 22 (78.5)
Ceftazidime 41 (61.1) 63 (70.7) 14 (82.3) 22 (78.5)
Azethromicine 54 (80.5) 52 (58.4) 14 (82.3) 16 (57.1)
Gentamicin 39 (58.2) 42 (47.1) 11 (64.7) 17 (60.7)
Amikacin 12 (17.9) 11 (16.4) 3 (17.6) 6 (21.4)
Nitrofurantoin 2 (2.9) 3 (3.3) 1 (5.8) 1 (3.6)
Imipenem 0 (0) 0 (0) 0 (0) 0 (0)
Note: Figures in parentheses represent percentage
Table V I Showed prevalence of ESBL producing isolates from different clinical
specimen by double disc diffusion test (DDDT). Among them Klebsiella spp. were
the leading bacteria 36/45 (80 %), followed by Proteus spp. 40/55 (72.7%), Esch. coli
105/156 (67.3 %) and others 25/35 (71.4 %).
Table �VI Rate of detection of ESBL production by DDDT from different
organisms
Name of organism Total ESBL positive (%)
Klebsiella spp 45 36 (80)
Proteus spp 55 40 (72.7)
E.coli 156 105 (67.3)
Pseudomonas spp 9 8 (88.8)
others * 35 25 (71.4)
Total 300 214 (71.3)
Note: Figures in parentheses represent percentage
* Others - Enterobacter spp., Citrobacter spp
Table VII Showed ESBL producing isolates distributed in hospital and community.
Rate of ESBL production among Klebsiella spp. and Esch. coli is more in community
than hospital, it was 63.8 % and 60.9 % respectively. But in case of Proteus spp.52.5
%, it was more in hospital isolates.
Table -VII Pattern of distribution of ESBL producing isolates in hospital and
community
Isolated
organism
Rate of ESBL positive
isolates in hospital
Rate of ESBL positive
isolates in community
Klebsiella spp.
n=36
13 (36.1) 23 (63.8)
Proteus spp.
n= 40
21 (52.5) 19 (47.5)
Esch. coli
n=105
41 (39.0) 64 (60.9)
Pseudomonas
spp. n=8
5 (62.5) 3 (37.5)
*Others n=25 9 (36) 16 (64)
Total 89 (41.6) 125 (58.4)
Note: Figures in parentheses represent percentage
Others - Enterobacter spp., Citrobacter spp
n= Number.
Table VIII Showed the overall isolation rate of ESBL positive Klebsiella spp.,
Proteus spp., E.coli, from different clinical specimen was 80%, 72.7% and 67.3%
respectively. Of them detection rate of ESBL production among E.coli and Proteus
spp. were highest in urine sample were 80%, 81.1% respectively. But in case of
Klebsiella spp. ESBL production was higher in pus 80.5%.
Table VIII Rate of isolation of ESBL positive Esch.coli, Klebsiella spp. Proteus
spp.from different clinical specimen
Type of specimen
Rate of ESBL
positive Esch. coli
Rate of ESBL
positive Klebsiella
spp.
Rate of ESBL
positive Proteus
spp.
Urine, n=180 84 (80.0) 29 (80.5) 26 (81.2)
Pus, n=28 16 (66.6) 4 (100) 8 (25.0)
Wound swab, n=14 5 (35.7) 3 (60.0) 6 (46.1)
total,n=156 105 (67.3) 36 (80.0) 32 (72.7)
Note: Figures in parentheses represent percentage
Others - Enterobacter spp., Citrobacter spp
n= Number
Table IX Showed antimicrobial resistance pattern in hospital and community among
ESBL producers. All the antibiotics used were more resistant in hospital acquired
ESBL producers. Among them Ampicillin, Aztreonam, Amoxyclave were more
resistant, on the other hand Amikacin, are 16.7%, 20% resistant in hospital and
community respectively more sensitive and Imepenem are 100% sensitive.
Table IX Antimicrobial resistant pattern in hospital and community acquired
ESBL positive strain
Name of
antimicrobials
Rate of resistance to ESBL
positive in hospital n=89
Rate of resistance to ESBL
positive in community n=125
Aztreonam 89 (100) 125 (100)
Ampicillin 88 (98.9) 125 (100)
Amoxiclave 88 (98.9) 124 (99.2)
Piperacillin 86 (96.6) 120 (96 )
Ceftazidime 84 (94.4) 108 (86.4)
Ceftriaxone 82 (92.1) 93 (74.4)
Cefotaxime 75 (84.3) 107 (85.6)
Ciprofloxacin 67 (75.29) 87 (69.44)
Azethromicine 60 (67.4) 102 (81.8)
Gentamicin 43 (48.4) 48 (38.7)
Amikacin 15 (16.7) 25 (20)
Nitrofurantoin 1 (1.1) 1 (0.8)
Imipenem 0(00) 0(00)
Note: Figures in parentheses represent percentage
Table X Showed phenotypic confirmation of ESBL positive bacteria by DDDT using
tow combinations, ceftazidime alone and with the combination of clavulinic acid
(CAZ/CAZC) and cefotaxime alone and with the combination of clavulinic acid
(CTX/CTXC). Most of the bacteria showed ESBL positive by both combination
(CAZ/CAZC, and CTX/CTXC). Esch.coli and Klebsiella spp showed maximum
ESBLs production in CAZ/CAZC combination. Both the CAZ/CAZC and
CTX/CTXC methods were statistically significant
Table X Detection of ESBL by Double Disc Diffusion test as confirmatory test
Name of organism CAZ/CAZC CTX/CTXC Both
Esch. coli n=105 23 (21.5) 13 (12.3) 69 (65.7)
Klebsiella spp. n=36 5 (13.8) 3 (8.3) 28 (77.7)
Proteus spp. n=40 5 (12.5) 2 (5.0) 33 (82.5)
Pseudomonas spp. n=8 1 (12.5) 1 (12.5) 6 (75.0)
*Others n=25 4 (16.0) 2 (8.0) 19 (76.0)
Total n = 214 38 (17.7) 21 (9.8) 155 (72.4)
Table X (a) Cross tabulation between CAZ/CAZC and CTX/CTXC of ESBL
detection
CAZ/CAZC Combined
ESBL positive 193 155
ESBL negative 21 59
Total n = 300 214 214
x2 value 22.1 at df 3, p <0.001, highly significant
CTX/CTXC Combined
ESBL positive 176 155
ESBL negative 38 59
Total n = 300 214 214
x2 value 5.8 at df 3, p <0.01, highly significant
Note: Figures in parentheses represent percentage
*Others - Enterobacter spp., Citrobacter spp
n= Number
Table XI Showed comparison of ESBL production among 3GCs sensitive and
resistant isolates. Out of 64 sensitive to 3GCs, 35 (54.6 %) were ESBL positive, on
the other hand 236 resistant to 3GCs, 179 (75.8%) were ESBL positive.
Table XI Pattern of ESBL production among 3GCs sensitive and resisatant
isolates
ESBL positive ESBL negative
Sensitive to 3GCs 35 (54.6) 29 (45.3)
Resistance to 3GCs 179 (75.8) 57 (24.1)
Total 300 214 (71.3) 86 (28.7)
x2 value 11.02 at df 3, p <0.001, highly significant
Note: Figures in parentheses represent percentage
Table XII Showed ESBLs positive by phenotypic and genotypic method by different
isolates .ESBLs production rate by Klebsiella spp (80%) were more in phenotypic
method and Esch.coli 84.3% were more in genotypic method.
Table XII Rate of ESBL positive by phenotypic and genotypic method
Name of isolates Rate of detection of
ESBL by phenotypic
method
Rate of production of
ESBL by specific gene
amplification
Esch. coli 105/156 (67.0) 43/51 (84.3)
Klebsiella spp. 36/45 (80.0) 18/23 (78.2)
Proteus spp 40/55 (72.7) 15/17 (88.2)
Pseudomonas spp 8/9 (88.0 ) 4/5 (80.0)
*Others 25/35 (71.4) 9/11 (81.8)
Total 214/300 (71.3 ) 89/107 (83.1)
Note: Figures in parentheses represent percentage
*Others - Enterobacter spp., Citrobacter spp
Table XIII Showed distribution of ESBLs gene in different isolates, among them
Esch.coli carry more TEM, CTX-M genes, E.coli, Klebsiella spp and Proteus spp
contain more than one gene were 17, 8, and 6 respectively. Rate of TEM, SHV and
CTX-M genes present in study population were 50.46%, 18.69% and 46.72%
respectively.
Table XIII Pattern of distribution of TEM, SHV and CTX-M genes among
phenotypic confirmed ESBL producers
Name of gene, No. Percentage (%) Single *Combined
TEM n=54 50.46 19
SHV n=20 18.69 3
CTX-M n=50 46.72 20
31
** SHV, CTX-M gene =5
TEM, CTX-M gene =14
TEM, SHV, CTX-M =8
Table XIV Showed CTX-M-3 and CTX-M-14 were 78.0 % (39/50) and 80.0 %
(40/50) respectively.
Table XIV Pattern of CTX-M-3, CTX-M-14 distribution in different isolates
Isolates Group -1 (CTX-M-3) Group -9 (CTX-M-14)
E.coli 27 (54) 28 (56.0)
Klebsiella spp. 9 (18.0) 9 (18.0)
Proteus spp. 01 (2.0) 01 (2.0)
Pseudomonas
spp.
01 (2.0) 01 (2.0)
Others 1 (2.0) 1 (2.0)
Total 39 (78.0) 40 (80.0)
Table XV Showed rate of presence of ESBLs genes among the hospital and
community acquired isolates. TEM and SHV genes were more in community acquired
isolates 70.3% and 70.0%. On the other hand CTX-M gene was more in hospital
acquired isolates.
Table XV Pattern of TEM, SHV and CTX-M gene distribution among hospital
and community
Name of gene Rate of gene present in
hospital
Rate of gene present in
community
TEM n=54 16 (29.6) 38 (70.3)
SHV n=20 6 (30.0) 14 (70.0)
CTX-M n=56 32 (57.1) 24 (42.8)
Note: Figures in parentheses represent percentage
n= Number
DISCUSSION Now a days antibiotics have been used extensively and newer antibiotics are
continuously being added for the treatment of various infections. An extensive use of
â-lactam antibiotics in hospital and community has created a major problem leading
to increased morbidity, mortality and health care costs. Proper use of antibiotics is
very important for various reasons. Development of bacterial resistance against newer
antibiotics makes the main focus of research.
In the present study, a total of 300 Gram negative strains were isolated from various
clinical specimens of which majority of the organisms were isolated from urine 72%
(216/300) followed by wound swab 15% (45/300), pus 13% (39/300) (Table -1).
Among the isolated organisms Esch. coli was the most prevalent 52% (156/300),
followed by Proteus spp. 18.3% (55/300), Klebsiella spp. 15% (45/300) and
Pseudomonas spp. 3% (9/300) (Table -II). Irrespective of specimens among the
identified bacteria Klebsiella spp. 62% (28/45) was the leading bacteria from the
community acquired isolates, followed by Esch.coli 57% (89/156), Proteus spp.
45.5% (25/55) and Pseudomonas spp. 44.4% (4/9) (Table III). In (table III) Klebsiella
spp. now also found in community acquired isolates more than hospital which
indicate that hospital strains circulate in the community. In the present study isolation
of Esch.coli was 55.6% and 61.2% from both urine and pus respectively, (Table - IV)
which are in aggrement with findings done by Haque et al. (2009) and Parveen et al.
(2009) in the same institute. In India (2005) Marcus and associates found the same
figure.
In Bangladesh, it has been reported that 65-92% of commensal Enterobacteriaceae
and other organisms isolated from urine is resistant to commonly used antibiotics like
ampicillin, tetracycline, co-trimoxazole etc (Chowdhury et al. 1994). Now a day�s
organism encoding multiple antibiotic resistance genes are becoming increasingly
prevalent (Perez et al.2007). In this study aztreonam, ampicillin, amoxyclauve were
found 95-100% resistant (Table -V), this is in agreement with other studies (Sasirekha
et al. 2010; Ullah et al. 2009). Cephalosporins specially third generation have been
used for Gram negative bacterial treatment (Samaha-Kfoury et al. 2003). In the
present study ceftriaxone, ceftazidime and cefotaxime were found 85%, 61%, 79%
from hospital acquired and 78.6%, 70.7%, 70.7% resistant among community
acquired E.coli respectively (Table V). It correlates with the study done by Sasirekha
et al. (2010) and Singh and Goyal (2003) in India where they found 84% resistance to
cefotaxime and 75%, 85% resistant for ceftriaxone and ceftazidime respectively.
Klebsiella spp. were found resistant to ceftriaxone, ceftazidime and cefotaxime in
88.2%, 82.3%, and 82.3% in hospital acquired isolates and 82.3%, 78.5%, 75.5% in
community acquired isolates respectively (Table -V). Hospital acquired isolates were
more resistant than the community acquired isolates, it may be due to lack of
antibiotic policy, irrational use of 3GCs mainly ceftriaxone in the hospital (Shova
2007) and the emergence of antibiotic-resistant organisms in hospitals in concert with
the use of high levels of antibiotics use caused the emergence of resistant organisms
and they might be inherently more virulent than the organisms are sensitive (CDC
2002). It was also noted that Klebsiella spp were more resistant than Esch. coli which
may be due to Klebsiella spp. have some virulence factor like hyperviscosity,
polysaccharide capsule and production of endotoxine, carbapenemases, which make it
more resistant (Highsmith and Jarvis1985; Lin et al. 2011). Thomson and associates
found Klebsiella spp. was more resistance to cefotaxime and ceftazidime (Thomson
1991).This indicate over use and irrational use of 3GCs give the world brand new
resistant bacteria that can produce many other drug resistance enzymes.
In this study observed resistance to ciprofloxacin was 78% and 88% for Esch.coli
and Klebsiella spp. (Table-V) respectively. These findings were in accordance with
the study by Haque and Salam (2010) from Bangladesh and it was 90.9%. Another
study by Sasirekha from India where they found 68% resistant to ciprofloxacin.
Aminoglycosides have good activity against clinically important gram negative bacilli
(Gonzalez and Spencer 1998). In the present study 82.1% isolates were susceptible to
amikacin, followed by 41.8% to gentamicin, it was similar to Sasirekha et al. (2010).
Several studies showed that amikacin was more sensitive than gentamicin but if it is
over used than it may also become resistant. In 2010 gentamicin was 59% resistant in
India and 55.5% in Bangladesh (Haque and Salam 2010; Sasirekha et al. 2010; Ullah
et al. 2009). These variations may be due to increased use of gentamicin, caused by
selection pressure of aminoglycosides in different region (Miller and Sabatelli 1997).
Carbapenems are the drugs of choice for many infections caused by Gram positive
and Gram negative bacteria (Ullah et al. 2009). In this study imipenem was 100%
sensitive (Table �V and Table VIII). These findings were similar to study done by
Haque and Salam in (2010) but one study showed 3.1% resistant to imipenem in
Bangladesh (Rashid et al. 2007). Amikacin was the second most common sensitive
drug after imipenem. So, these drug resistance organisms have limited theraputic
options and necessitated the increased use of carbapenems. But very recently new
beta lactamases are developed e.g., K. pneumoniae carbapenemase (KPC) which is
resistant to imipenem and has been spread world wide (Rhee et al. 2010). So there is
very limited options to treat imipenem resistant strains and colistin may be the drug of
choice (Amaya et al. 2009), though it has many side effect.
ESBLs are the product of the over use of third generation cephalosporins (Paterson
and Yu 1999). It is difficult to make valid comparison of the prevalence of ESBLs,
because of variations in study design (Friedman et al. 2005). In Bangladesh (2004)
ESBL was found in 43.2% and 39.5% isolates of Esch.coli and Klebsiella spp.
respectively (Rahman 2004). Another study from Bangladesh (2010) showed 57.89%
ESBL production for Klebsiella spp. followed by Proteus spp. 50.0%, Esch. coli
47.83% and pseudomonas spp 31.35% (Haque and Salam 2010). In the present study
ESBLs prevalence was 71.3%, which was very similar to the study done by Sharma et
al. (2010) in India who find 70% ESBLs rate. Few studies from Pakistan in 2005, it
was 40% and two other studies in 2009 were 43% and 58.7% ESBLs producers (Ali
2009; Jabeen 2005; Ullah 2009). Studies from India reported as ESBL producers were
60.98%, 51.4% and 53.4% in 2004, 2007 and 2010 respectively (Babypadmini 2004;
Shivaprakasha 2007; Sasirekha 2010). In Nigeria ESBL production rate was 66.7%
(Yusha�u 2010). The frequency of ESBL producer in our study was 71.3% in general
which was higher than the previous studies in Bangladesh, India and other countries.
It may be due to steadily increasing the incidence of ESBL producing strains among
the clinical isolates, also it indicate the possibility of treatment failure caused by
resistant organisms (Chaudhary 2004; Haque and Salam 2010) .Two study (2010) in
Iran and India ESBLs production rate were 96% and 97% respectively (Lal 2007;
Naehi 2010). The studies done in Iran and India (2010) was higher than the present
study and it may be due to fact that they consider only 3GCs resistant organisms,
while we take some samples were sensitive to 3GCs sensitive (Sharma 2010; Naehi
2010). In the present study overall Klebsiella spp 80% (36/45) was the leading ESBL
producers followed by Proteus spp 72.7% (40/55), Esch.coli 67.3% (105/156) and
Pseudomonas spp 88.8% (8/9) (Table -VI), which correlates with studies done by
Livrelli et al. (1996) and Lal et al. (2007) where they found Klebsiella spp. was the
leading bacteria. The high occurrence of ESBLs in Klebsiella spp is of great concern
since infections caused by this bacterium were very common and resistance of the
organism may be due to the presence of capsule that gives some level of protection to
the cells, presence of multidrug resistance efflux pump, they also spread easily,
pathogenic and efficient at acquiring and disseminating resistance plasmid
(Chaudhary and Aggarwal 2004; Gruteke 2003; Yusha�u 2010). In the present study
most of the samples were collected from the community, Pseudomonas spp. is more
in hospital acquired isolates (Sheryll et al. 2004) and sample size for Pseudomonas
spp. was very small so, the occurrence of ESBLs observed among the Pseudomonas
spp. 88.8% (8/9), might not reflected the actual picture.
Originally ESBLs were most commonly reported to be a hospital based problem but it
is now common among community acquired isolates, especially Esch. coli (Helfand
and Bonomo 2005;Heffernan and Woodhouse 2006). In the present study Esch.coli
and Klebsiella spp. were found 60.9% and 63.8% respectively in the community
(Table-VIII), on the other hand Proteus spp. and Pseudomonas spp.were 52.5% and
62.5% in hospital respectively (Table-VIII). Denholm and associates found Esch.coli
the most common community acquired isolates among the ESBLs (Denholm 2009).
In the present study ESBL producing hospital acquired isolates were more resistance
to third generation cephalosporins than community acquired isolates and it was from
84%-94% (Table-VIII), it was similar with the study done by Babypadmini and
Appalaraju (2004), who found 84% resistant, Sasirekha and associates (2010) found
75%-85%, Haque and Salam (2010) found 72%-100% resistant. This was due to
irrational and wide use of third generation cephalosporins in both the hospital and
community and is beleived to be the major cause of mutations in these enzymes that
has lead to the emergence of the ESBLs (Chaudhury and Agrawal 2004). Aztreonam
was found 100% resistant in this study, which correlates with the study done by
Sasirekha et al. (2010). Most of the ESBL producing organisms were found to be co
resistance to flouroquinolones, aminoglycosides and co-trimoxazole, which correlates
with the study done by Denholm (2009) and Jabeen (2005). This was due to the genes
encoding these â-lactamases were often located on large plasmids that also encode
genes for resistance to others antibiotics, including aminoglycosides, tetracycline,
sulfonamides, trimethoprime and chloramphenicol (Perez et al. 2007). We found such
associated resistance with gentamicin 48.7% and fluroquinolones 84.4%.
In this study we used two combinations with clavulanic acid (CAZ/CAZC and
CTX/CTXC) and found that E.coli and Klebsiella spp showed maximum ESBLs
production in CAZ/CAZC combination, which correlates with other studies (Rahman
2004; Thomson 1991). Ceftazidime plus clavulinic acid (CAZ/CAZC) was the best
single disc diffusion test was recommended by George et al. (2006). In the present
study some samples were taken in accounts which were sensitive to 3GCs and
subsequently showed positive for ESBLs production by DDDT 54.6% (35/64,).
Failure to detect ESBL production by routine disc-diffusion tests has been well
documented (Tenover 1999; Paterson 1999). Screening with 3GCs, with clavulinic
acid more than one combination increased the rate of ESBL detection, but the
combination of ceftazidime and cefotaxime still missed two strains producing the
SHV-5 and SHV-7 ESBLs (George et al. 2006). Use of only one combination may
fail to detect ESBL positive strains and thus might cause low prevalence (Rahman et
al. 2004). So, laboratory practitioner should do the ESBLs confirmatory test both
from 3GCs sensitive and resistant strains. The use of Cefotaxime, Ceftazidime and
Ceftriaxone as the only indicator of ESBLs screening can no longer be recommended.
If only one indicator antibiotic would be used for screening, Cefpodoxime has proven
to be the best molecule for screening all types ESBLs producers in clinical sample
(Black et al. 2005). Occurrence and distribution of ESBLs differs from country to
country and from hospital to hospital (Ali 2009). These types of discrepancies
between susceptibility data and disc diffusion results have increased the need for an
improved method of ESBL detection and incorporate it into routine susceptibility
procedure.
Since no previous data is available about the prevalence of genes responsible for
ESBLs production in Bangladesh, it is assumed that this high rate of ESBLs by
phenotypic method, may be due to mutation of first two parent gene TEM-1, SHV-1
and newer most prevalent gene CTX-M in the world (Peirano et al. 2010). CTX-M
gene now the most coomon in Esch.coli in community and it may be due to overuse
of ceftriaxone or due to faecal carriage and transfer gene by horizontal transmission
(Cavaco et al. 2008; Ensor et al. 2006; Pitout and laupland 2008; Perez et al. 2007). In
the present study, TEM, SHV and CTX-M genes were found in 50.5%, 18.7% and
46.72% from phenotypically confirmed ESBLs producers respectively (Table -XII).
ESBLs belonging to the TEM (TEM-24, TEM-4, TEM-52), SHV (SHV-5, SHV-12)
and CTX-M (CTX-M-9, CTX-M-3, CTX-M-14 or CTX-M-15) families are
predominant in Europe (Coque et al. 2008).In India in 2006 CTX-M-15 was found
75%, out of them 73% of total Esch.coli and 72% of Klebsiella spp.( Ensor et al.
2006). In this study Esch.coli is more in genotypic method it may be due to we used
three primers, which were most common in Esch. coli. Epidemiological study
demonstrates that some enzymes are more frequently reported then others, but
predominant enzyme type varies with country and that diverse CTX-M types often
exist within a single country (Livermore and Woodford 2006). In Macao in 2010
TEM and CTX-M -9 gene were 100% and 87% respectively, which was much more
than the present study (Yan-fang et al. 2011). In Iran, 2009 CTX-M, TEM and SHV
was 24.5%, 18% and 7.5% respectively (Nasehi et al. 2010). In India (2007) both
TEM and SHV, TEM, SHV were 67.3%, 20%, 804% respectively and (2010) it was
56%, 60% for TEM and SHV genes respectively from phenotypic confirmed ESBLs
positive isolates (Lal et al. 2007; Sharma et al. 2010). CTX-M may be increased due
to wide use of third generation cephalosporins, especially ceftriaxone and it is more
resistant to cefotaxime. In this study among the 56 CTX-M genes present among them
47 were cefotaxime resistant and rest are ceftriaxone resistant. In the present study
Esch. coli was 84.3% (43/51), because TEM, CTX-M is more common in Esch.coli
(Table-XII), in Pseudomonas spp. it was 80%, it may be due to AmpC beta
lactamases are more common in Pseudomonas spp. that primer was not used in this
study. CTX-M was more prevalent that may be due to they represent examples of
plasmid acquisition of beta lactamase gene from normally found chromosome of
Kluyvera spp. a group of rarely pathogenic commonsal organism (Coque et al. 2008).
In the present study CTX-M was found 46.72%, among them 57.1% (32/56) and
42.8% (24/56) were from hospital and community respectively (Table - XIV). Among
54 TEM gene, 26 were present in Esch.coli, 13 were in Klebsiella spp., 7 were in
proteus spp., 1 was in Pseudomonas and rest 7 were from others as a single gene, on
the other hand TEM and CTX-M combine were 14 and TEM, SHV and CTX-M were
8. SHV was detected as a single gene in Klebsiella spp. Proteus spp and
Pseudomonas spp. one in each. In the present study among the CTX-M positive
Esch.coli 16.1% (9/56) were leading bacteria followed by Klebsiella spp. 7.1% (4/56)
Proteus spp8.9% (5/56) and for Pseudomonas spp. was 3.6% (2/56). In the present
study among 54 TEM gene, 26 were present in Esch.coli, 13 were in Klebsiella spp., 7
were in proteus spp., 1 was in Pseudomonas and rest 7 were from others as a single
gene, on the other hand TEM and CTX-M combine were 14 and TEM,SHV and CTX-
M were 8. Klebsiella spp. Proteus spp and Pseudomonas spp. contain 3 SHV genes,
one for each.
Among the five groups of CTX-M gene (CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9,
CTX-M-25) group 1 includes CTX-M-1, CTX-M-3, CTX-M-15, CTX-M-22, CTX-
M-25 and others, group 9 includes CTX-M-13, CTX-M-14, CTX-M-16, CTX-M-18
and others (Pitout and Laupland 2008; Chanawong et al. 2002). As there was no
previous genetic study in Bangladesh, we take some study from India. In India (2006)
CTX-M-15 was 73% (Ensor 2006). In Pakistan 75% CTX-M was found and CTX-M -
14 (group III) in Canada in 2005 was predominant wide outbreak (Pitout 2005; Mirja
2006). Again in China predominant CTX-M genes are similar to that seen in South
America that is CTX-M-9, CTX-M-13, CTX-M-14 (Chanawang et al. 2002), it is also
similar to Tawiwan in 2005 where SHV-12 and CTX-M -3, CTX-M-14 were 40.2%,
32.6% and 18.0% respectively (Chia 2005). CTX-M-15 producing Esch.coli are
emerging world wide (Hawkey 2008). In Europe CTX-M become predominant
among them group 9 (CTX-M-9 and CTX-M14) and group 1 (CTX-M-3 and CTX-M-
15) dominant (Liver et al. 2997). In India in 2011 TEM and CTX-M were
predominantly found in E. coli (39.2%) while, among the Klebsiella spp., TEM, SHV
and CTX-M occurred together in 42.6% of the isolates (Monoharan 2011). In the
present study CTX-M-3 (like group 1) and CTX-M-14 (like group 9) were 78.0 %
(39/50) and 80.0% (40/50) respectively, which correlates with other studies found in
the world and India. The information found from this study would be helpful for
formulation of an antibiotic policy for its rational use.
CONCLUSION AND RECOMMENDATIONS
Considering various findings of the present study, it can be concluded that Extended
spectrum beta lactamases are gradually increasing in Bangladesh with co resistance to
some other classes of antibiotics is very alarming. There was a limited number of
drugs sensitivity for these bacteria only and drug of choice is imipenem, followed by
amikacin in injectable form. But most probably in near future, if this irrational use is
not stopped, infection with that Gram negative bacteria increase the rate of resistant to
drugs that are now sensitive, resulting increase morbidity and mortality. This study
shows that K. pneumoniae is essential for the prompt recognition of antimicrobial-
resistant organisms, as it is more resistant than Esch.coli. Infection-control
practitioners and clinicians need the clinical laboratory to rapidly identify and
characterise different types of resistant bacteria specially ESBLs efficiently to
minimise the spread of these bacteria and help to select more appropriate antibiotics.
It is very dangerous for laboratory practitionar that some amounts of ESBLs are
present in 3GCs sensitive bacteria. So ESBLs must be detected by double disc
diffusion test. The epidemiology of ESBL-producing bacteria is becoming more
complex with increasingly blurred boundaries between hospitals and the community.
Further studies are required to investigate MDR bacteria and ESBL from other parts
of Bangladesh using more isolates. Studies of molecular epidemiology of these
resistant genes can also be used for comparison with genes already isolated from other
parts of the world.
Limitation
Although utmost sincerity and dedication was investigated to carry out the study it
could not go beyond limitations as the sample size was not large enough, moreover
the genetic analysis of resistant bacteria could be done by other type of gene primer
that could help finding the actual cause behind the emerging drug resistance, we could
not do that due to lack of proper logistic support
REFERENCES
Adams-Haduch, JM, Potoski, BA, Sidjabat, HE, Paterson, DL, Doi, Y, 2009, Activity
of Temocillin against KPC-Producing Klebsiella pneumoniae and Escherichia coli.
Antimicrob Agents Chemother.
Adeline, SY, TingCarol, HC, Tan and Aw, CS, 2009, Hydrocarbon-degradation by
isolate Pseudomonas lundensis UTAR FPE2, Malaysian Journal of Microbiology;
vol.5, no. 2, pp104-108.
Agrawal, P, Ghosh, A, Kumar, S, Basu, B, Kapil, K, 2008, Prevalence of extended
spectrum â lactamases among E. coli and K. pneumoniae isolates in tertiary care
hospital, Indian journal Pathology Microbiology, vol. 51, pp- 139-42.
Aibinu, Ibukun, EA, Folake, RP, Kehinde, OA, Adesida, Solayide, AA, Mathew,
OO,and Odugbemi, T, 2007, Multidrug Resistance in E .coli 0157 Strains and the
Public Health Implication , Journal of American Science,vol. 3, no. 3.
Akram, M, Shahid, M, 2007, Etiology and antibiotic resistance patterns of
community-acquired urinary tract infections in JNMC Hospital Aligarh, India. Ann.
Clin. Microbiol. Antimicrob, vol.6, no. 4.
Al- Charrakh, AH, Yousif, SY, and Al- Janabi, HS, 2011, Occurence and detection of
Extended Spectrum â-lactamases in Klebsiella isolates in Hilla, Iraq, African Journal
of Biotechnology, vol. 10 no. 4, pp- 657-665.
Al-Agamy, MH, Shible, AM, Tawfik, AF, 2009, Prevelance and molecular
characterization of extended spectrum â-lactamase- producing Klebsiella Pneumoniae
in Riyadh, Saudi-Arabia, Annals of Saudi Medicine, vol. 29, no. 4, pp- 253-257.
Ali, AM, 2009, Frequency of Extended Spectrum Beta Lactamase (ESBL) Producing
Nosocomial Isolates In A Tertiary Care Hospital In Rawalpindi, A journal of Army
medical corps, 3 ISSN 0030-9648.
Amaya, E, Caceres, M, Fang, H, Ramirez, AT, Palmgren, AC, Nord, CE,
Weintraub,A, 2009, Extended spectrum beta lactamase-producing Klebsiella
pneumoniae in a neonatal intensive care unit in Leon, Nicaragua, International
Journal of Antimicrobial Agents, vol. 33, pp- 386-7.
Ambler, RP, 1980, The structure of beta-lactamases, Philos Trans R Soc Lond B Biol
Sci, vol. 16, no. 289, pp- 321-31.
Anderson, MJ, Janoff, EN, 1998, Klebsiella endocarditis: report of two cases and
review. Clinical Infectious Disease, vol. 26, no. 2, pp 468-74.
Andrews, J, 2009, Dectection of extended spectrum â lactamases (ESBLs) in E.coli
and Klebsiella species, British society for antimicrobial chemotherapy BSAC, pp -
674.
Begum, S, Ahmed, I, Alam, F, Samsuzzaman, Hassan, P, Absar, N, Haq, JA, 2009,
Isolation of a 29.5 kb plasmid confirring multiple drug resistance in Pseudomonas
aerugnosa, J. bio-sci, vol. 17, pp- 95-100.
Bell, JM, Chitsaz, M, Turnidge, JD, Barton, M, Walters, LJ, and Jones, RN, 2007,
Prevalence and Significance of a Negative Extended-Spectrum â-Lactamase (ESBL)
Confirmation Test Result after a Positive ESBL Screening Test Result for Isolates of
Escherichia coli and Klebsiella pneumoniae: Results from the SENTRY Asia-Pacific
Surveillance Program, Journal of Clinical Microbiology, vol. 45, no. 5, pp-1478�1482
.
Black, JA, Thomson, KS, Buynak, JD, and Pitout, JD, 2005, Evaluation of â �
lactamase inhibitors in disc tests for detection of plasmid-mediated AmpC â
lactamases in well characterized clinical strains of Klebsiella spp., Journal Clinical
Microbiology, vol. 43 pp. 4161-4171.
Bonnet, R, 2004, Growing Group of Extended-Spectrum â-Lactamases: the CTX-M
Enzymes, Antimicrobial Agents and Chemotherapy, vol. 48, no. 1, pp. 1-14.
Bradford, PA, 2001, Extended-Spectrum â-Lactamases in the 21st Century:
Characterization, Epidemiology, and Detection of This Important Resistance Threat,
Clinical Microbiology Review, vol.14, no.4, pp. 933-951.
Brun-Buisson, C, Legrand, P, Philippon, A, Montravers, F, Ansquer, M, Duval, J,
1987, Transferable enzymatic resistance to third-generation cephalosporins during
nosocomial outbreak of multiresistant Klebsiella pneumoniae, Lancet, vol. 2, no.
8554, pp.302-6.
Brüssow, H, Canchaya, C, Hardt, WD, 2004, "Phages and the evolution of bacterial
pathogens: from genomic rearrangements to lysogenic conversion" Microbiology
Moecular Biology Review, vol. 68, no. 3, pp- 560�602.
Bush, K, Jacoby, GA, and Medeiros, AA, 1995, Updated Functional Classification of
â-Lactamases , Antimicrob. Agents Chemother, vol.39, pp.1211-1233.
Caccamo, M, Perilli, M, Celenza, G, Bonfiglio, G, Tempera, G, Amicosante, G, 2006,
Occurrence of extended spectrum beta-lactamases among isolates of
Enterobacteriaceae from urinary tract infections in southern Italy, Microb Drug
Resist, vol.12, no. 4, pp-257-64.
Cavaco, LM, Abatih, E, Aarestrup, FM, and Guardabassi, L, 2008, Selection and
Persistance of CTX-M producing Esch. coli in the intestinal Flora of Pigs Treated
with Amoxicillin, Ceftiofur or Cefquinome, Antimicrob Agents Chemothr, vol. 52,
no.10, pp. 3612-3616.
Champs, DC, Sauvant, MP, Chanal, C, Sirot, D, Gazuy, N, Malhuret, R, Baguet, JC,
Sirot, J, 1989, Prospective survey of colonization and infection caused by expended
spectrum beta lactamase- producing members of the family Enterobacteriaceae in an
intensive care unit, Journal Clinical Microbiology , vol. 27, pp. 2887-2890.
Chanawong, A, Lulitanond, A, Kaewkes, W, Lulitanond, V, Srigulbutr, S,
Homchampa, P, 2007, CTX-M Extended spectrum â lactamases among clinical
isolates of Enterobacteriaceae in a thai university hospital, Faculty of associated
medical sciences, Vol. 38, No. 3.
Chaudhary, U, Aggarwal, R, 2004, Extended spectrum beta lactamases(ESBL)- An
emerging threat to clinical theraputics, Indian Journal of Medical Microbiology, vol.
22, no. 2, pp. 75-80.
Chia, J, Chu, C, Su, L, Chiu, C, Kuo, A, Sun, C, and Wu,T, 2005 Detection System
for Detection of Some SHV and CTX-M â-Lactamases of Escherichia coli, Klebsiella
pneumoniae, and Enterobacter cloacae in Taiwan, Journal of Clinical Microbiology,
vol.43, no. 9, pp. 4486-4491.
Chessbrough, M 2006, District laboratory practice in tropical countries, Part-2,
Newyork, USA: Cambridge university. pp. 184- 186.
Chiang, CS, Liaw, GJ, 2005, Presence of â lactamase Gene TEM-1 DNA Sequence in
Commercial Taq DNA Polymerase, Journal of clinical Microbiology, vol. 43, no. 1,
pp.530-531.
Chowdhury, MA, Yamanaka, H, Miyoshi, S, Aziz, KM, and Shinoda,S, 1989,
Ecology of Vibrio mimicus in aquatic environments, Appl Environ Microbiol, vol. 55,
no. 8, pp. 2073-2078
CLSI. Performance Standards for Antimicrobial Susceptibility Testing, Twentieth
Informational Supplement, CLSI Document M100-S20, Wayne, PA: Clinical and
Laboratory Standards Institute, 2010 .
Coque, TM, Baquero, F, Canton, R, 2008, Increasing prevalence of ESBL-producing
Enterobacteriaceae in Europe, Eurosurveillance, vol.13, no.47.
Datta, N, Kontomichalou, P, 1965, Penicillinase Synthesis Controlled By Infectious R
Factors In Enterobacteriaceae, Nature, vol. 208, pp. 239-241.
Davis, CP, 1996, Normal flora, In: Baron S, Medical Microbiology, 4th edition.
University of Texas Medical Branch at Galveston.
den Engelsen, C, vander, Werf, C, Matute, AJ, Delgado, E, Schurink, CA,
Hoepelman,,AI, 2009, Infectious diseases and the use of antibiotics in outpatients at
the emergency department of the University Hospital of León, Nicaragua, Intional
Journal Infectious Dis. vol. 13, no. 3, pp. 349-54.
Denholm, JT, Huysmans, M, and Spelman, D, 2009, Community acquisition of
ESBL-producing Escherichia coli: a growing concern, Medical Journal Australia, vol.
190, no.1, pp. 45-46.
Driscoll, JA, Brody, SL, Kollef ,MH, 2007, The epidemiology, pathogenesis and
treatment of Pseudomonas aeruginosa infections, Drugs, vol. 67, no. 3, pp 351-68.
Dutour, C, Bonnet, R, Marchandin, H, Boyer, M, Chanal,C, Sirot, D, and Sirot, J,
2002, CTXM-1,CTX-M-3 and CTX-M-14 â- lactamases from Enterobacteriaceae
Isolated in France, Antimicrobial Agents and Chemotherapy, vol. 46, no. 2, pp. 534-
537.
Edelstein, M, Pimkin, M, Palagin, I, Edelstein, I, and Stratchounski, L, 2003,
Prevalence and Molecular Epidemiology of CTX-M Extended-Spectrum â-
Lactamase-Producing Escherichia coli and Klebsiella pneumoniae in Russian
Hospitals, Antimicrob Agents Chemother, vol. 47, no. 12, pp.3724-3732.
Ensor, VM, Shahid, M, Evans, JT, and Hawkey, PM, 2006, Occurrence, prevalence
and genetic environment of CTX-M b-lactamases in Enterobacteriaceae from Indian
hospitals, Jourmal Antimicrobial Chemotherapy, vol. 58, pp. 1260-1263.
Evans, J, Doyle, J, Dolores, Evans,G, "Escherichia Coli" Medical Microbiology, 4th
edition. The University of Texas Medical Branch at Galveston. Archived from the
originalon2007-11-02.http://web.archive.org/web/20071102062813/
http://www.gsbs.utmb.edu/microbook/ch025.htm. Retrieved 2007-12-02.
Farkosh, MS, 2007, Extended-Spectrum betalactamase Producing Gram Negative
Bacilli. http://nosoweb.org/infectious diseases/esbl.htm.
Feng, P, Weagant, S, Grant, M, 2007, "Enumeration of Escherichia coli and the
Coliform Bacteria" Bacteriological Analytical Manual (8th ed.). FDA/Center for
Food Safety & Applied Nutrition. http://www.cfsan.fda.gov/~ebam/bam-4.html.
Finegold, SM, 1996, Anaerobic Gram-Negative Bacilli, In: Baron S, Medical
Microbiology, 4th edition. University of Texas Medical Branch at Galveston.
Florijn, A, Nijssen, S, Smitz, F, Verhoef, J, Fluit, A, 2002, Comperison of E-tests and
double disk diffusion tests for the detection of Extended Spectrum Beta �lactamases
(ESBLs), Europian Journal of Clinical Microbiology and Infectious Disease, vol. 21,
pp. 241-243.
Fonze, E, Charlier, P, Toth, M, Vermeire, M, Raquet, X, Dubus, A, and Frere, J-M,
1995, Commonly used â-lactam resistance markers in molecular biology, Acta Cryst,
vol.51, pp. 682-694.
Friedman, C, Callery, S, Jeanes, A, Piaskowski, P, Scott, L, 2005, Best Infection
Control Practices for Patients with Extended Spectrum Beta Lactamase
Enterobacteriacae, International Infection Control Council.
George, A, Jacoby, MD, and Silvia Munoz-Price, LS, 2005, "mechanisms of disease:
The New beta-Lactamases." N Engl J Med, vol.35 pp.380-91.
Girlich, D, Naas, T, and Nordmann, P, 2004, Biochemical Characterization of the
Naturally Occurring Oxacillinase OXA-50 of Pseudomonas aeruginosa, American
Society for Microbiology, vol. 48, no. 6, pp. 2043-2048.
Girlich, D, Naas, T, and Nordmann, P, 2004, Biochemical Characterization of the
Naturally Occuring Oxacillinase OXA-50 of Pseudomonas aeruginosa. Antiicrobial,
Agents and Chemotherapy, vol. 48, no. 6, pp. 2043-2048.
Gonzalez, LS, Spencer, JP, 1998, Aminoglycosides: a practical review, Am. Fam.
Physician, vol. 58, no.8, pp. 1811-20.
Grover, SS, Sharma, M, Chattopadhya, D, Kapoor, H, Pasha, ST, Singh, G, 2006,
Phenotypic and genotypic detection of ESBL mediated cephalosporin resistance in
Klebsiella pneumoniae: emergence of high resistance against cefepime, the fourth
generation cephalosporin, Journal Infectious disease, vol. 53, no.4, pp. 279-88.
Grover, SS, Sharma, M, Chattopadhya, D, Kapoor, H, Pasha, ST, Singh, G, 2006,
Phenotypic and genotypic detection of ESBL mediated cephalosporin resistance in
Klebsiella pneumoniae: emergence of high resistance against cefepime, the fourth
generation cephalosporin, Journal Infectious disease, vol. 53, no. 4, pp. 279-88.
Gruteke, P, Goessens, W , Gils, JV, Peerbooms, P, Toom, NL, Santen-Verheuvel, M,
V, Belkum, AV, and Verbrugh, H, 2003, Pattern of Resistance Associated with
Integrons,the Extended-Spectrum â lactamase SHV-5 Gene and a Multidrug Efflux
Pump of Klebsiella pneumoniae Causing a Nosocomial Outbreak.Journal of Clinical
Microbiology, vol. 41, no. 3, pp.1161-1166.
Gutkind, GO, Cátedra de, 2001,Third-Generation Cephalosporin Resistance in
Shigella sonnei, Argentina, Emerging Infectious Diseases, vol. 7, no. 3.
Hanson, ND, Thomson, KS, Moland, ES, Sanders, CC, Berthold, G, Penn, PG, 1999,
Molecular chacterization of a multiply resistant Klebsiella pneumoniae encoding
ESBLs and a plasmid mediated AmpC, Oxford journals,Journal of Antimicrobial
Chemotherapy; vol. 44, no. 3, pp. 377-380.
Haque, R, Salam, MA, 2010, Detection of ESBL producing nosocomial gram
negative bacteria from a tertiary care hospital in Bangladesh, Pk J Med Sci , vol. 26,
no. 4, pp.887-891.
Hawkey, PM, 2008, Prevalence and clonality of extended-spectrum â-lactamases in
Asia. Clinical Microbiology and Infection vol. 14, pp. 159�165.
Heffernan, H, Woodhouse, R, 2006, Prevalence of extended spectrum â lactamases
among Escherichia coli and Klebsiella in Newzealand in 2006, Antibiotic Referance
Laboratory.Communicable Disease Group;ESR Porirua.
Helfand, MS, Bonomo, RA, 2005, Extended spectrum â-lactamases in Multidrug �
Resistant Eschechia coli: Changing the therapy for Hospital-Acquired and
Community �Acquired Infections, Oxford Journals, vol. 43, no. 11, pp. 1415-1416.
Herrera-Luna, C, Klein, D, Lapan, G, Revilla-Fernandez, S, Haschek, B, Sommerfeld-
Stur, I, Moestl, K, Baumgartner, W, 2009, Characterization of virulence factors in
Escherichia coli isolated from diarrheic and healthy calves in Austria shedding
various enteropathogenic agents, Veterinarni Medicina, vol. 54, no. 1, pp 1-11.
Highsmith, AK, Jarvis, WR, 1985, Klebsiella pneumoniae: selected virulence factors
that contribute to pathogenicity, Infection controle, vol. 6, no. 2, pp. 75-77.
Hirakata, Y, Matsuda, J, Miyazaki, Y, et al, 2005, Regional variation in the
prevalence of extended-spectrum beta-lactamase-producing clinical isolates in the
Asia-Pacific region SENTRY 1998�2002, Diagn Microbiology Infectious Disease,
vol. 52, pp. 323�329.
Holten, KB, and Onusko, EM, 2000, Appropriate Prescribing of Oral Beta-Lactam
Antibiotics, American Family Physician, vol. 62, pp. 611-20.
Ishii, Y, Ohno, A, Taguchi, H,Imajo, S,Ishiguro, M, and Matsuzawa, H,1995, Cloning
and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase
isolated from Escherichia coli, Antimicrobial Agents and Chemotherapy, vol. 39, no.
10, pp. 2269-2275.
Jabeen, K, Zafar, A, Hasan, R. 2005, Frequency and sensitivity pattern of extended
spectrum beta lactamase producing isolates in a tertiary care hospital laboratory of
Pakistan, Journal Pakistan Medical Association, vol. 55, pp 436�439.
Jacoby, GA, 2009, AmpC âLactamases, Clinical Microbiology Review, vol. 22, no.1,
pp. 161-182.
Jacoby, GA, Medeiros, AA, O�Brien, TF, Pinto, ME, Jiang, H,1988, Broad-spectrum,
transmissible beta-lactamases, New Engandl Journal Medcine, vol. 319, pp. 723�724.
Japoni, A, Farshad, S, Alborzi, A, 2009, Pseudomonas aeruginosa: Burn Infection,
Treatment and Antibacterial Resistance, Iranian Red Crescent Medical Journal, vol.
11, no. 3, pp.244-253.
Jarlier, V, Nicolas, MH, Fournier, G, Philippon, A, 1988, Extended spectrum beta
lactamases conferring transferable resistance to newer beta lactam agents in
Enterobacteriaceae : hospital al prevalence and susceptibility patterns, Rev Infect Dis
, vol. 10, pp. 867-878.
Jemima, SA, and Verghese, S, 2008, Multiplex PCR for blaCTX-M & blaSHV in the
extended spectrum beta lactamase (ESBL) producing Gram-negative isolates, Indian
Journal Medical Resarch, vol. 128, pp. 313-317.
Johnson, JR, 1991, Virulence factors in Escherichia coli urinary tract infection,
Clinical Microbiology Review, vol. 4, no. 1, pp. 80-128.
Karim, A, Poirel, L, Nagarajan, S, Nordann, P, 2001, Plasmid-mediated extended-
spectrum beta-lactamase (CTX-M-3 like) from India and gene association with
insertion sequence ISEcp1, FEMS Microbiol Lett, vol. 201, pp. 237�241.
Keller, R, Pedroso, MZ, Ritchmann, R, and Silva, RM, 1998, Occurrence of
Virulence-Associated Properties in Enterobacter cloacae, Infection and Immunity,
vol. 66, no. 2, pp.645-649.
Khaled, Z, El-Baghdady, Mohammad, M, Abooulwafa, Madeha, O, Ghobashy and
Hassan, M, Gebreel1, 2009, Plasmid mediated virulence factors of some Proteus
isolates, Egypt. Acadamic Journal biological Science, vol. 1, no. 1, pp. 7-22.
Kim, MH, Lee, HJ, Park, KS, and Suh, JT, 2010, Molecular Characteristics of
Extended spectrum â- Lactamases in Escherichia coli and Klebsiella pneumoniae and
the prevalence of qnr in Extended spectrum â Lctamase Isolates in a tertiatiary Care
Hospital in Korea, Yonesei Medical Journal, vol. 51, no. 5, pp. 768-774.
Kim, S, Hu, J, Gautom, R, Kim, J, Lee, B, and Boyle, D, 2007, CTX-M Extended-
spectrum â-Lactamases, Washington State, Emerging Infectious Disease, vol. 13, no.
3, pp. 513-516.
Kliebe, C, Nies, BA, Meyer, JF, Tolxdorff-Neutzling, RM, and Wiedemann, B, 1985,
Evolution of plasmid-coded resistance to broad-spectrum cephalosporins, Antimicrob
Agents Chemotherapy, vol. 28, no. 2, pp. 302-307.
Knothe, H, Shah, P, Krcmery, V, Antal, M, Mitsuhashi, S, 1983, Transferable
resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of
Klebsiella pneumoniae and Serratia marcescens, Infection , vol. 11, no.6, pp.315-7.
Kotra, LP, Samama, J, Mobashery, S, 2002, Beta-lactamases and resistance to beta-
lactam antibiotics. In: Lewis K, Salyers AA, Taber HW,Wax RG, eds. Bacterial
resistance to antimicrobials, pp.123-60.
Lal, P, Kapil, A, Das, BK, and Sood, S, 2007, Occurence of TEM and SHV gene in
extended spectrum beta lactamases (ESBLs) producing Klebsiella spp.isolated from a
tertiary care hospital, Indian Journal Medical, 125, pp. 173-178.
Levinson, W, 2010, Review of medical microbiology and immunology. 11th ed. New
York: Lange, pp. 85-93.
Li, XZ, Nikaido, H, 2004, Efflux-mediated drug resistance in bacteria, Drugs, vol.
64, no. 2, pp. 159-204.
Lin, Y, Lu, M, Hui-Ling Tang, H, Liu, H, Chen, C, Liu, K, Lin, C, Chiou, C, Chiang,
M, Chen, C,Yi-Chyi Lai, Y, 2011, Assessment of hypermucoviscosity as a virulence
factor for experimental Klebsiella pneumoniae infections: comparative virulence
analysis with hypermucoviscosity-negative strain, Bio Med Central Microbiology,
vol. 11, no. 50.
Livermore, DM, 1995, â-Lactamases in laboratory and clinical resistance, Clinical
Microbial Review, vol.8, no. 4, pp. 557-84.
Livermore, DM, 2003, Bacterial resistance: origins, epidemiology, and impact, Clin
Infect Dis. vol. 15, no. 36, S- 111-23.
Livermore, DM, Hawkey, PM, 2008, CTX-M: changing the face of ESBLs in the UK.
2005, Defining an extended-spectrum beta-lactamase, Clinical Microbiology
Infection, vol. 14, Suppl 5, pp.21-4.
Livermore, DM, Woodford, N, 2006, The beta-lactamase threat in Enterobacteriaceae,
Pseudomonas and Acinetobacter, Trends Microbial, vol. 14, no. 9, pp. 413-420.
Livrelli, V, Champs, CD, Martino, PD, Michaud, AD, Forestier, C, Joly, B, 1996,
Adhesive Properties and Antibiotic Resistance of Klebsiella, Enterobacter, and
Serratia Clinical Isolates Involved in Nosocomial Infections, Journal of Clinical
Microbiology, vol. 34, no. 8, pp.1963-1969.
Lytsy, B, Sandegren, L, Tano, E, Torell, E, Andersson, DI, Melhus, A, 2008,The first
major extended-spectrum beta-lactamase outbreak in Scandinavia was caused by
clonal spread of a multiresistant Klebsiella pneumoniae producing CTX-M-15,
APMIs. Vol. 116, no. 4, pp. 302-8.
Manoharan, A, Premalatha, K, Chatterjee, S, Mathai, D, 2011, Correlation of TEM,
SHV and CTX-M extended-spectrum beta lactamases among Enterobacteriaceae with
their in vitro antimicrobial susceptibility, Indian Journal of Medical
Microbiology,vol. 29, no. 2, pp. 161-164.
Marcus, N, Ashkenazi, S, Yaari, A, Samra, Z, Livni, G, 2005, Non-Escherichia coli
versus Escherichia coli community-acquired urinary tract infections in children
hospitalized in a tertiary center: relative frequency, risk factors, antimicrobial
resistance and outcome, Pediatr Infect Dis J Vol. 24, no. 7, pp.581-585.
Mathai, D, Rhomberg, PR, Biedenbach, DJ, Jones, RN, 2002, Evaluation of the
in vitro activity of six broad-spectrum beta-lactam antimicrobial agents tested against
recent clinical isolates from India: a survey of ten medical center laboratories, Diagn
Microbiol Infect Dis, vol. 44, pp. 367�377.
Matsumoto, Y, Ikeda,F, Kamimura,T, Yokota, Y, Mine,Y, 1988,Novel plasmid-
mediated beta-lactamase from Escherichia coli that inactivates oxyimino-
cephalosporins, Antimicrob. Agents Chemother , vol. 32, no.8, pp.1243-1246.
Medeiros, AA, 1997, Evolution and dissemination of beta-lactamases accelerated by
generations of beta-lactam antibiotics, Clin Infect Dis, vol. 24, no. 1, S19-45.
Medici, DD, Croci, L, Delibato, E, Pasquale, SD, Filetici, E and Toti, L, 2003,
Evaluation of DNA Extraction Methods for Use in Combination with SYBR Green I
Real-Time PCR To Detect Salmonella enterica Serotype Enteritidis in Poultry,
Applied and Environmental Microbiology, vol. 69, no. 6, pp. 3456-3461.
Miller, GH, Sabatelli, FJ, 1997, The most frequent aminoglycosideresistance
mechanisms--changes with time and geographic area: areflection of aminoglycoside
usage patterns? Aminoglycoside Resistance Study Groups, Clin. Infect. Dis. vol. 24,
no.1, pp. 46-62.
Mirza, SH, Salman, M, Khurshid,U, Wiqar, MA, 2006, CTX-M ESBL enzyme in
Escherichia coli from urology patients in Rawalpindi, Pakistan, Dec, vol. 56, no.12,
pp. 576-8
Munday, CJ, Xiong, J, Li, C, Shen, D, Hawkey, PM,2004, Dissemination of CTX-M
type beta-lactamases in Enterobacteriaceae isolates in the People�s Republic of China,
Int J Antimicrob Agents, vol. 23, pp 175�180.
Muratani, T, Matsumoto, K, 2006, Urinary tract infection caused by fluoroquinolone-
and cephem-resistant Enterobacteriaceae. Int J Antimicrob Agents; 28S: S10�S13.
National Committee for Clinical Laboratory standards. Methods for dilution
Antimicrobial susceptibility tests for bacteria that grow aerobically .2003; M7-A6.
Nieradko, J, Kurlenda, J, 2004, Characteristics of selected virulence factors of
Enterobacter cloacae strains isolated from clinical specimens, Medycyna doswiadcz
alna i mikrobiologia, vol. 56, no. 4, pp.351-8.
Oteo, J, Navarro1, C,Cercenado, E, Delgado-Iribarren, A, Wilhelmi, I, Orden, B,
García, C, Miguelañez, S, Pérez-Vázquez, M, García-Cobos, S, Aracil1, B, Bautista,
V, and Campos, J, 2006, Spread of Escherichia coli Strains with High-Level
Cefotaxime and Ceftazidime Resistance between the Community, Long-Term Care
Facilities, and Hospital Institutions , Journal Clinical Microbiology, vol. 44, no. 7 ,
PP.2359-2366.
Pagani, L, Amico, ED, Migliavacca, R, D�Andrea, MM, Giacobone, E, Amicosante,
G, Romero, E, and Rossolini, GM, 2003, Multiple CTX-M-Type Extended-Spectrum
â-Lactamases in Nosocomial Isolates of Enterobacteriaceae from a Hospital in
Northern Italy, Journal of Clinical Microbiology, vol. 41, no. 9, pp. 4264-4269.
Pai H.1998. The characteristics of extended-spectrum beta-lactamases in Korean
isolates of Enterobacteriaceae. Yonsei Med J; 39: 514�519.
Parveen, US, Hossain, MA, Musa, AK, Mahmud, C, Islam, MT, Haque, N,
Muhammad, N, Khan, SI, Mahmud, NU, 2009, Pattern of Aerobic Bacteria with
Antimicrobial Susceptibility Causing Community Acquired Urinary Tract Infection.
Vol.18, no. 2, pp. 148-153.
Paterson, DL,Yu VL, 1999, Extended spectrum beta lactamases: a call for improved
detection and control, Clin Infect Dis , vol. 29, pp.1419-22.
Peirano, G, Pitout, JDD, 2010, Molecular epidemiology of Escherichia coli producing
CTX-M â Lactamases : worldwide emergence of clone ST131 025:H4.International
journal of Antimicrobial Agents, vol.35, pp. 316-321.
Perez, F, Endimiani, A, Hujer, KM, Bonomo, RA, 2007, The continuing challenge of
ESBLs. Current Opinion in Pharmacology, vol. 7, no. 5, pp. 459-469 .
Pfaller, MA, Segreti, J, 2006, Overview of the epidemiological profile and laboratory
detection of extended-spectrum beta-lactamases, Clin Infect Dis, vol.15, no. 42,
pp.153-63.
Philippon, A, Labia, R, Jacoby, G, 1989, Extended-spectrum ß-Lactamases,
Antimicrob Agents Chemother, vol.33, pp.1131-6.
Pinheiro, MRS, Larcerda, HR, Melo, RGL, and Maciel, MA, 2008, Pseudomonas
aureginosa Infections : Factors Relating to Mortality with Emphasis on Resistance
Pattern and Antimicrobial treatment, The Brazilian Journal of Infectious Deseasese,
vol. 12, no. 6, pp. 509-515.
Pitout, JD, 2010, Infections with extended-spectrum beta-lactamase-producing
enterobacteriaceae: changing epidemiology and drug treatment choices, Drugs, vol.
70, no. 3, pp. 313-33.
Pitout, JDD, Gregson, DB, Church, DL, Elsayed, S, and Laupland, KB, 2005,
Community wide outbreaks of Clonally Related CTX-M-14 â-lactamase-producing
Escherichia coli Strains in the Calgery health region, Journal Clinical Microbiology,
vol. 43, no. 6, pp. 2844-2849.
Pitout, JDD, Laupland, KB, 2008, Extended Spectrum â Lactamase producing
Enterobacteriaceae : an emerging public health concern. Lancet infect Dis, vol. 8,
pp.159-66Poirel, L, Pitout, JD, Nordmann, P, 2007, Carbapenemases: molecular
diversity and clinical consequences.Future Microbiol ; vol. 2, no. 5, pp- 501-512.
Poole, K, 2004, Efflux-mediated multiresistance in Gram-negative bacteria,Clinical
Microbiology and infection, vol.10, no.1, pp 12-26.
Postgate, J, 1998, Nitrogen fixation, 3rd ed.. Cambridge University Press.
Radice, M, Gonzéález, C, Power, P, Vidal, MC, and Gutkind, G, 2001, Third-
generation cephalosporin resistance in Shigella sonnei, Argentina,Antimicrob Agents
Chemother, vol.7, no. 3, pp. 442-443.
Rahman, MM, Haque, JA, Hossain, MA, Sultana, R, Islam, F, AHM, Islam, S, 2004,
Prevalence of extended spectrum beta lactamase-producing Escheria coli and
Klebsiella pneumoniae in an urban hospital in Dhaka Bangladesh, International
journal of antimicrobial agents, vol.24, no. 5, pp. 508-510.
Rashid, A., Chowdhury, A., Rahman, SH, Begum, SA, and Muazzam, N,
2007,Infections by Pseudomonas aeruginosa and Antibiotic Resistance Pattern of the
Isolates from Dhaka Medical College Hospital, Bangladesh Journal of Medical
Microbiology, vol.01, no.02, pp. 48-51.Rayamajhi, N, Kang, SG, Lee, SI, Park,KY,
Lee, HS, and Yoo, HS, 2008, Characterization of TEM, SHV and AmpC type â-
lactamases from cephalosporin-resistant Enterobacteriaceae isolated from swine,
International Journal of food Microbiology, vol. 124, no. 2, pp- 183-187.
Rhee, YJ, Park, YK, Lee, MY, Peck, KR, Soo, KK, 2010, KPC-Producing Extreme
Drug-Resistant Klebsiella pneumoniae Isolated from a patient with Diabetes Mallitus
and Chronic Renal Failure on Haemodialysis in South Korea, Antimicrobial Agents
and Chemotherapy, vol. 54, no. 5, pp. 2278-2279.
Rozalski, A, Sidorczyk, Z, Kotelko, K, 1997, Potential Virulence Factors of Proteus
Bacilli, Microbiology and Molecular Biology Review, vol. 61, no. 1, pp.65-89.
Rupp, ME, and Paul, D, 2003, �Extended Spectrum â-Lactamase (ESBL) �Producing
Enterobacteriaceae,� Drugs Vol. 63, no. 4, pp. 353-356.
Saha, SK, Hanif, M, Dutta, P, Chowdhury, MF, 1995, Emergence of high-level
fluoroquinolone-resistant Escherichia coli in Bangladesh, International Journal
Antimicrobial Agents, vol. 5, no. 2, pp.119-21.
Sahm, DF, Thornsberry, C, Mayfield, DC, Jones, ME, Karlowsky, JA, 2001,
Multidrug-resistant urinary tract isolates of Escherichia coli: prevalence and patient
demographics in the United States in 2000, Antimicrob Agents Chemother, vol. 45,
no. 5, pp. 1402-6.
Samaha-Kfoury, JN, Araj, GF, 2003, Recent developments in â lactamases and
extended spectrum â lactamases, Bairut Medical Journal, vol. 327, no. 22, pp.1209-
1213.
Sandel, DC, Wang, C, Kessler, S, 2002, Urinary Tract Infections and a Multidrug-
Resistant Escherichia coli Clonal Group, N England Journal Medical, vol. 346,
pp.535-536.
Sasirekha, B, Manasa, R, Ramya, P, and Sneha, R, 2010, Frequency and
Antimicrobial Sensitivity Pattern Of Extended Spectrum â- Lactamases Producing
E.coli And Klebsiella Pneumoniae Isolated In A Tertiary Care Hospital, Al Ameen
journal Medical science, vol.3, no.4, pp. 265-271.
Sharma, J, Sharma, M, and Roy, P, 2010, Detection of TEM and SHV genes in
Escheria coli and Klebsiella pneumoniae isolates in a tertiary care hospital from
India, Indian J Med, Res 132, pp.332-336.
Sharma, S, Bhat, GK, Shenoy, S, 2007, Virulence factors and drug resistance in
Escherichia coli isolated from extrintestinal infections, Indian Journal of Medical
Microbiology, vol. 25, no. 4, pp.369-373.
Sheryll, L, Magalit, MD, Maria, Tarcela, S, Gler, MD, and Thelma, E, Tupasi, MD,
2004, Increasing Antimicrobial Resistance Patterns of Community and Nosocomial
Uropathogens in Makati Medical Center antibiotics, Phil J Microbiol lnfect Dis,
vol.33, no.4, pp. 143-148.
Shivaprakasha, S, Radhakrishnan, K, Gireesh, AR, Shamsulkarim, PM, 2007, Routin
screening for ESBL Production, A necessity of Today. The Internet Journal of
Microbiology vol. 3, no. 1.
Shobha, KL, Gowrish, RS, Sugandhi, R, Sreeja, CK, 2007, Prevalence of Extended
Spectrum â Lactamases in Urinary Isolates of Escherichia coli, Klebsiella and
Citrobacter Species and their Antimicrobial Susceptibility Pattern in tertiary care
hospital, Indian journal for the Practicing Doctor; vol. 3, no. 6, pp. 01 -02.
Singh, NP, Goyal, R, 2003, Changing trends in bacteriology of burns in the burns
unit, Delhi, India, Burns. vol. 29, no.2, pp. 129-32.
Smet, A, Van Nieuwerburgh, F, Vandekerckhove, TTM, Martel,A, Deforce, D, et al,
2010, Complete Nucleotide Sequence of CTX-M-15 Plasmids from Clinical
Escherichia coli Isolates Insertional Events of Transposons and Insertion Sequences,
PLoS ONE , vol. 5, no. 6, e 11202.doi: 10.1371/ journal. Pone.0011202.
Subha, A, Ananthan, S, 2002, Extended spectrum beta lactamase (ESBL) mediated
resistance to third generation cephalosporins among klebsiella pneumoniae in
Chennai, Indian Journal Medical Microbiology, vol. 20, issue. 2, pp. 92-95.
Tenover, FC, Mohammed, MJ, Gorton, TS, Dembek, ZF, 1999 Detection and
reporting of organisms producing extended spectrum beta-lactamases: survey of
laboratories in Connecticut. Journal Clinical Microbiology, vol.37 , pp 4065-70.
Tenover, FC, Mohammed, MJ, Gorton, TS, Dembek, ZF, 1999, Detection and
reporting of organisms producing extended spectrum beta-lactamases: survey of
laboratories in Connecticut, Journal Clinical Microbiology , vol. 37, pp. 4065-70.
Thomson, KS, Sanders, cc, and Washington, JA, 1991, High-level resistance to
cefotaxime and ceftazidime in Klebsiella pneumoniae isolates from Cleveland, Ohio.
Antimicrob Agents Chemother; vol. 35, no. 5, pp. 1001�1003.
Toder, DS, Gambello, MJ, and Iglewski, 2008, Bacterial resistance to Antibiotic in
Toders Online Textbook of Bacteriology, Kinneth Toder Unerversity of Wisconsin-
Medison.Department of Bacteriology.
Turner, PJ, 2005, Extended Spectrum â-lactamases. Clinical Infectious Disease, vol.
41,no. 4, pp. 273-5.
Turng, B, Votta, M, Turner, D, Pollitt, J, Callihan, D, Wulff, S, Wiles, T, 2002,
Detection of Extended Spectrum Beta-Lactamase Among Enterobacteriaceae Using
Phoenix� Automated Microbiology System with BDXpert� System, Interscience
Conference on Antimicrobial Agents and Chemotherapy (ICAAC).
Ullah, F, Malik, SA, Ahmed, J, 2009, Antimicrobial susceptibility pattern and ESBL
prevalence in Klebsiella pneumoniae from urinary tract infections in the North �West
of Pakistan, African Journal of Microbiology, vol.3, no. 11, pp.670-680.
Varaiya, A, Dogra, J, Kulkarni, M, Bhalekar, P, 2008, Extende spectrum beta
lactamase (ESBL) Producing Escherichia coli and Klebsiella pneumoniae in diabetic
foot infection, Indian Journal of Medical Microbiology, vol. 26, no. 3.
WHO Global Strategy for Containment of Antimicrobial Resistance, 2002.
Wiegand, I, Geiss, HK,Mack, D, Sturenburg, E, Seifert, H, 2007, Detection of ESBL
among Enterobacteriaceae by use of semiaotomated microbiology systems and
manual detection procedures, J Clin Microbiol, vol. 45, pp. 1167-74.
Wiener, J, Quinn, JP, Bradford, PA, Goering, RV, Nathan, C, Bush, K, Weinstein,
RA, 1999, Multiple antibiotic-resistant Klebsiella and Escherichia coli in nursing
homes, Journal American Medical Association, vol. 281, no. 6, pp. 517-23.
Wikipedia, 2010, Beta-lactamase. Accessed on December 10, 2010.
Willems, EA, 2011, Evaluation and Development of a phenotypic Screening Strategy
for emerging â - lactamases in Gram negative bacilli, Critically Appraised Topic,
pp.1-25.
Woodruff, HB, and Foster, JW, 1945, Microbiological Aspects of Penicillin, Journal
of Bacteriology; vol. 49, no. 1, pp. 19-29.
Xu, L,Ensor,V, Gossain,S, Nye, K, Hawkey, P, 2005, Rapid and simple detection of
CTX-M genes by multiplex PCR assay, Journal of Medical Microbiology, vol. 54, pp.
1183-1187.
Yusha�u, MM, Kumurya, AS, and Suleiman, L, 2010, Prevalence of Extended
spectrum â lactamases among Enterobacteriaceae in Murtala Mohammed specialist
hospital, Kano,N, Journal of Pure and Applied Sciences, vol.3, no.1, pp.169- 172.
Zaborina, O, Kohler, JE, Wang, Y, Bethel, C, Shevchenko, O, Wu, L, Turner, JR and
Alverdy, JC, 2006, Identification of multi-drug resistant Pseudomonas aeruginosa
clinical isolates that are highly disruptive to the intestinal epithelial barrier, Annals oF
Clinical Microbiology and AntimicrobialS, vol. 5, no.14.
Zwadyk, P, 1992, Enterobacteriaceae: Salmonella and Shigella, Intestinal pathogens.
In: Joklik, WK, Willet, HP, Amos, B, and Wilfert, CM, eds. Zinsser Microbiology,
20th ed. USA: Appleton & Lange, pp. 556-565.
APPENDICES
APPENDIX-I
Data sheet
Title:�Phenotypic detection and molecular characterization of ESBL producers
among Escherichia coli and Klebsiella pneumoniae�.
Project Title:
A. S.L No: Identification
number
B. Particulars of the patients:
1. Name:
2. Age:
3. Sex: Male/Female
4. Father/Mother/Husbands name:
5. Address:
Village: P.O: Union:
Thana: Dist :
6. Admitted patients: Ward no; Bed no; Reg. no:
7. Date of admission:
8. Socio-economic condition:
9. History of relapse UTI: a) Yes b) No
10. Time of disease start and taking antibiotic:
11. Duration of hospital stay: month: week:
12. H/O long care facilities health care manipulation: catheter: canula:
C. Clinical findings:
1. Fever: a) Yes b) No
2. Anemia: a) Yes b) No
3. Presenting rash: a) Yes b) No
4. Frequency of micturation : a) Yes b) No
5. Burning sensation during micturation : a) Yes b) No
D.Laboratory findings:
1. Culture: Lactose farmenter / non lactose farmenter.
2. Microscopy: Gram negative bacilli.
3. Antibiogram :
4. Screening by third generation cephalosporins:
Name of antibiotic Resistance Sensitive
Ceftriaxone
Ceftazidime
Aztreonam
Cefotaxime
5. Double disc diffusion test: positive/negative.
6. PCR: TEM, SHV and CTX-M genes present /not.
ANTIBIOGRAM OF ISOLATES
Zone diameter Antimicrobial
agents
Disk content
S (mm) R (mm)
Aztreonam 30 µg 27 27
Ampicillin 10 µg 16 14
Amoxiclave 20/10 µg 18 14
Piperacillin 30 µg 18 14
Ceftazidime 30 µg 22 18
Cefotaxime 30 µg 27 22
Ceftriaxone 30µg 25 22
Amikacin 30 µg 16 14
Gentamicin 10 µg 16 14
Nitrofurantoin 50 µg 16 14
Ciprofloxacin 5 µg 20 14
Imipenem 10 µg 20 14
S-Sensitive, R-Resistant
APPENDIX-II
Nutrient agar medium
Composition
Ingredients gram/liter
Peptic digest of Animal Tissue 5.00
Sodium Chloride 5.00
Beef Extract 1.50
Yeast Extract 1.50
Agar 15.00
Twenty-eight grams of dehydrated nutrient agar medium was added to 1000 ml of
cold distilled water in a flask and boiled to dissolve the medium completely. The
medium was then sterilized in an autoclave at 1210C and 15 lbs pressure for 15
minutes. The sterile media were stored in a refrigerator at 40C for future use.
APPENDIX-III
Blood agar medium
Composition
Ingredients gram/liter
Heart infusion 500.00
Tryptose 10.00
Sodium chloride 5.00
Agar 15.00
Forty grams of the dehydrated blood agar medium was suspended in 1000 ml cold
distilled water in a flask and boiled to dissolve the medium completely. It was then
sterilized by autoclaving at 1210C and 15 lbs pressure for 15 minutes. The autoclaved
materials were allowed to cool to a temperature of 450C in a water bath. Defibrinated
5-10% sheep blood was then added to the medium aseptically and distributed to
sterile petridishes. Sterile media was stored in refrigerator at 40C for future use.
APPENDIX-IV
Muller Hinton agar medium
Composition
Ingredients gram/liter
Beef dehytrated infusion 300
Casein hydrolysate 17.50
Starch agar 17.00
Agar 17.00
Thirty-eight grams of dehydrated Mueller Hinton agar medium was suspended in
1000 ml cold distilled water and boiled to dissolve the medium completely. The
solution was then sterilized by autoclaving at 1210C and 15 lbs pressure for 15
minutes. The autoclaved media was stored at 40C
APPENDIX-V
MacConkey agar medium
Composition
Ingredients gram/liter
Peptone 19.0
Lactose 10.0
NaCl 5.0
Na- Deoxycholate 1.0
Neutral Red 0.03
Crystal Violet 0.001
Agar 15.0
Fifty-two grams of dehydrated MacConkey agar medium was suspended in 1000 ml
cold distilled water and boiled to dissolve the medium completely. The solution was
then sterilized by autoclaving at 1210C and 15 lbs pressure for 15 minutes.
APPENDIX-VI
Brain Heart Infusion (BHI) broth
Composition
Ingredients gram/liter
Calf Brain infusion solid 12.5
Beef Heart infusion solid 5.0
Glucose 2.0
NaCl 5.0
Di-sodium phosphate 2.5
Thirty-seven gm of dehydrated Brain Heart Infusion agar medium (Hi-media, India)
was suspended in 1000 ml distilled water and dissolved the medium completely. The
solution was then sterilized by autoclaving, for best result, the medium should be used
on the day it is prepared, otherwise, it should be boiled or steamed for a few minutes
and then cooled before use.
APPENDIX-VII
Triple suger irone agar media
Composition
Ingredients gram/liter
Beef extract 3
Yeast extract 3
Peptone 20
Glucose 1
Lactose 10
Sucrose 10
Ferric citrate 0.3
Sodium chloride 5
Sodium thiosulphate 0.3
Agar 12
Phenol red,0.2% solution 12
Triple suger irone agar test to show Enterobacteriaceae:
Species OX Cit Ind slant butt H2S gas
E. coli - - + Y Y - +
Klebsiella - + - Y Y - +
Proteus - d + Y Y + d
Pseudomonas
Enterobacter
+ + - R R - -
OX: Oxidase; Cit: Citrate test; Ind:Indole test; d=different strains give different
results R: Red(Pink),Alkaline; Yellow, Acid; + : Positive reaction; - : Negative
reaction.
APPENDIX-VIII
Simmon�s Citrate medium
This is modification of Koser�s medium with agar and an indicator added.
Ingredients amount
Koser�s medium 1 litre
Agar 20g
Bromothymol blue,0.2% 40ml
APPENDIX-IX
Indole test
Composition
Ingredients amount
Peptone 20g
Sodium chloride 5g
Distilled water 1 L
After adjustment of the pH to 7.4 , sterilize by autoclaving at 1210 C for 15 min.
Kovac�s reagent
Amyl or isoamyle alcohol 150ml
p � Dimethyl-aminobenzaldehyde 10g
Hydrocloric acid 50ml
Dissolve the aldehyde in the alcohol and slowly add the acid and store in the refrigerator.
APPENDIX-X Oxidase reagent
Composition
Distilled water 10ml
Tetramethyl-P- phenylenedimine 0.1 g
APPENDIX-XI TNE buffer
TE (Tris-EDTA) buffer (pH 7.4 to 8.0) - 1L
10 mM Tris, 1 mM EDTA - pH is determined by the pH of the Tris-Cl
100 ml 1 M Tris-Cl
20 ml 0.5 M EDTA pH 8.0
880 ml ddH2O
Equipments for PCR
1. Centrifuge 5415 R with refrigerator
2. Vortex mixture (Digi system VM-2000).
3. Micropipette (company -Eppendrof)
4. Laminar flow cabinet (company stremline).
5. Microwave oven for gel preperation.
6. Electric water bath
7. Thermal cycler (Model-master cycler personal).
8. Gel apparatus (Major science mini S-30).
APPENDIX-XII CLSI 2010
Old (M100-S19) Revised (M100-S20) Disk diffusion breakpoints (mm): Agent
Susc Int Res Susc Int Res
Cefazolin ≥18 15-17
≤14 NA NA NA
Cefotaxime ≥23 15-22
≤14 ≥26 23-25 ≤22
Ceftizoxime ≥20 15-19
≤14 ≥25 22-24 ≤21
Ceftriaxone ≥21 14-20
≤13 ≥23 20-22 ≤19
Ceftazidime ≥18 15-17
≤14 ≥21 18-20 ≤17
Aztreonam ≥22 16-21
≤15 ≥21 18-20 ≤17
MIC breakpoints (ìg/ml):
Old (M100-S19) Revised (M100-S20) Agent Susc Int Res Susc Int Res
Cefazolin ≤8 16 ≥32 ≤1 2 ≥4
Cefotaxime ≤8 16-32 ≥64 ≤1 2 ≥4
Ceftizoxime ≤8 16-32 ≥64 ≤1 2 ≥4
Ceftriaxone ≤8 16-32 ≥64 ≤1 2 ≥4
Ceftazidime ≤8 16 ≥32 ≤4 8 ≥16
Aztreonam ≤8 16 ≥32 ≤4 8 ≥16
APPENDIX-XIII
The composition and methods of preparation of different stains, diluents and
chemicals used in this study are given below
Crystal violet Gram stain:
Crystal violet 20g
Ammonium oxalate 9g
Ethanol or methanol, absolute 95ml
Distilled water to 1 liter
Lugol�s iodine solution
Potassium iodide 20g
Iodine 10g
Distilled water 1 liter
Alcohol fixative solution
To make 200ml
Ethanol (ethyl alcohol), absolute 180ml
Acetic acid, glacial 10ml
Distilled water 10ml
Immerse the fixative for 20 minutes. Rinse with 95% ethanol and allow the smear to
dry.
Carbol fuchsin
Basic fuchsin 10g
Ethanol or methanol 100ml
Phenol 50g
Distilled water 1 liter
APPENDIX-XIV
Physiological saline solution
To make 1000 ml of Physiological saline solution, 0.9 gm of chemically pure sodium
chloride was added in 1000 ml of distilled water in a sterile conical flask. The solution
was then sterilized by autoclave at 1210C maintaing a pressure of 15 lbs per square
inch for 15 minutes. After sterilization, the sterile physiological saline solution was
cooled and stored in a refrigerator at 40C for future use.
McFarland Standard 0.5
Composition and preparation 1 % (V/V) solution of chemically pure (0.36N)
Sulphuric acid and 1.175 % (W/V) solution of chemically pure (0.048M) barium
chloride was prepared in two separate sterile flasks. Then 9.9 ml of sulphuric acid and
o.1 ml of barium chloride were added to the clean screw capped test tube and sealed.
The barium sulphate suspension corresponds approximately to McFarland standard
tube No.1 with corresponding cell density of 3 × 108 organisms/ml. To made the
turbidity standard of cell density to one half of the McFarland standard tube No.1
which correspond to cell density of 1.5 × 108 organism/ml for determination of
antibiotic sensitivity by Kirby-Bauer inoculated technique 0.5 ml of 1.7 %(W/V)
barium chloride (Bacl2 2H2O) was added to 99.5 ml of 1 % (V/V) Sulphuric acid
(0.36N), mixed well and 5- 10 ml was distributed in sterile capped test tubes and
sealed.
Master mixture for PCR amplification
DDW 38.5µl
10 X buffer 5µl
dNTP 4µl
Primer mixture 1µl
Taq polymerase 0.5µl
+
Extracted DNA 1µl.
APPENDIX-XV
STATISTICAL FORMULA Sample size determination=
Z2pq
n = --------------
d2
n= Desired sample size,
p= Prevalence of the disease / problem in
community,
q= (1-p),
d= Degree of accuracy (it is .05),
z= Confidence interval (usually we take 95% CI, in
which z= 1.96),
Formula for mean
n
xx
x = mean of observations
x = individual observations
n = number of observation
Formula for Chi-square test (2):
E
EO 22
Here,
O = Observed frequencies
E = Expected frequencies
df = Degrees of freedom = (c-1) (r-1)
= Summation.
APPENDIX-XVI
Groups and examples of â lactam antimicrobial agents
â lactam groups Examples of antimicrobial agents
Penicillins Penicillin G, penicillin
Penicillinase resistant penicillins: methicillin, nafcillin, oxacillin, cloxacillin
Aminopenicillins: ampicillin, amoxicillin
Carboxypenicillins: carbenicillin, ticarcillin
Ureidopenicillins: mezlocillin, piperacillin, Cephalosporins
First generation: cefazolin, cephalothin, cephalexin
Second generation: cefuroxime, cefaclor, cefamandole, cefamycins
(cefotetan, cefoxitin)
Third generation: cefotaxime, ceftriaxone, cefpodoxime,
ceftizoxime, cefoperazone, ceftazidime
Fourth generation: cefepime, cefpirome
Carbapenems Imipenem, meropenem, ertapenem
Monobactams Aztreonam
Adopt from Kotra et al. 2002.
APPENDIX-XVII
Functional
Classification of
Beta-lactamases
Group
Molecular
Class
Preferred
Substrate
Inhibited
by CA*
Examples
1 C Cephalosporins - AmpC, MIR-1
2a A Penicillins + Gram positive
penicillinases
2b A Penicillins,
Cephalosporins
+ TEM-1 and 2, SHV-1
2be A Penicillins,
extended
spectrum
Cephalosporins
, monobactams
+ TEM-3 to 26, SHV-2
to 6
2br A Penicillins +/- TEM-30 to 36
2c A Penicillins,
Carboxypenicilli
ns
+ PSE-1, 3 and 4
2d D Penicillins,
Cloxacillin
+/- OXA-1 to 11
2e A Cephalosporins + P. vulgaris
2f A Penicillins,
Cephalosporins
, carbapenems
+ NMC-A
3 B Beta-lactams - CcrA
4 ? Penicillins - B. cepacia
CONTENTS
Page No.
List of Tables vi
List of Figures vii
List of Abbreviations viii
1. Summary 1
2. Introduction 3
3. Aims and objectives 9
4. Review of Literature 10
5. Materials and Methods 60
6. Results 69
7. Discussion 90
8. Bibliography 99
9. Appendices 117
LIST OF TABLES
Table No. Title Page No.
1. Age and sex distribution of cases 70
2. Age and sex of controls 73
3. Socioeconomic condition of subjects 74
4. Rate of isolation of Salmonella typhi among study cases 76
5. Result of Widal test in paired sera of blood culture negative
typhoid cases showed rise of antibody titre 77
6. Comparison of Blood culture, Widal test and DOT EIA on first
sample among clinically suspected typhoid cases 78
7. Category of cases. 79
8. Category wise result of DOT EIA. 80
9. Results of Widal test on 1st sample and DOT EIA in different
study groups 83
84 10. Result of DOT EIA and Widal test in first and second sample
among confirmed typhoid cases ( Group I & Group II )
11. Sensitivity and specificity of DOT EIA ( IgM ) in confirmed
typhoid cases 85
12. Sensitivity and specificity of Widal test on single sample 86
13. Comparative results among DOT EIA, single Widal test
and paired Widal test 87
LIST OF FIGURES
Figure No. Title Page No. 1. Age distribution of cases 71
2. Age and sex distribution of cases 72
3. Comparative sensitivity of DOT EIA, single
and paired Widal test 88
4. Specificity of DOT EIA and Widal test 89
5. Photograph of blood culture. Right: bottle containing
trypticase soya broth. Left: Inoculated broth 130
6. Photograph of growth of Salmonella typhi on
MacCokey�s agar media 131
7. Photograph of reaction of Salmonella typhi on
TSI medium 132
8. Photograph of DOT EIA reaction tray containing
antigen dotted strips 133
9. Photograph of DOT EIA test strip showing positive
and negative result 134
LIST OF ABBREVIATIONS
BMAC Bone-marrow-aspirate culture
CMIR Cell-mediated immune responses
DSCC Duodenal string-capsule culture DTH Delayed-type hypersensitivity response
EIA Dot enzyme immunoassay
ELISA Enzyme-linked immunosorbent assay
et al. et alia ( and others )
H2S Hydrogen Sulphide
ICDDRB International Center for Diarrrhoeal
Diseses and Research, Bangladesh
IROMPs Iron-regulated outer-membrane protein
Kda Kilo dalton
LDC Lysine decarboxylase
LMI Leucocyte migration inhibition test
LPA Lysophosphatidic acid
LPS Lipopolysaccharide
MDRTF Multi Drug Resistant typhoid fever
NPV Negative Predictive value
n Number
OMPs Outer membrane proteins
PPV Positive Predictive value
PPs Peyer's patch
RSC Rectal-swab culture
RTI Respiratory tract infection
SPS Sodium polyanethol sulfonate
SD Standard Deviation
TTSSs Type III Secretion Systems
TSI Triple sugar iron
TSB Trypticase soya broth
UTI Urinary tract infection
Vs Versus
WHO World Health Organization
Appendix - II For Control Group :
AeMwZµ�g m¤§wZcÎ
GB m¤§wZc�Îi D�Ïk¨ Avcbv�K cÖ�qvRbxq Z_¨ cÖ̀ vb Kiv, �h Z_¨¸�jv Avcbv�K wm×v�� wb�Z mvnvh¨
Ki�e, Avcbvi �ivMx/�ivMxbx GB M�elYvq AskMÖnb Ki�e wKbv bv?
D�Ïk¨ I c×wZ
Gw�Uev�qvwUK �iwR�óÝ evsjv�`�k GKwU mvaviY mgm¨v| Avgvi M�elYvi D�×k¨ n�jv Gw�Uev�qvwUK
�iwR�óÝ wbY©q Kiv Ges �ivM wbY�©qi mnRZg c×wZ �ei Kiv| G�Z cieZx©�Z mwVK mí mg�q Ges
mnRZg c×wZ�Z B.Gm.we.Gj. wbY©q K�i gvbz�li Gw�Uev�qvwUK �iwR�óÝ RwVjZv Kg�e|
Avcwb hw` Avcbvi �ivMx/�ivMx�K GB M�elYvq AskMÖnY Kiv�Z m¤§Z _v�Kb Zvn�j Avcbvi/Avcbvi
�ivMxi Amy¯ �Zv Ges wPwKrmv m¤úwK©Z wKQz cÖk � Kiv n�e Ges Zv bw_�Z msi¶Y Kiv n�e| M�elbvi Rb¨
Avcbvi cÖkvªve, cyuR �bqv n�e|
M�elYvi SzuwK
GB M�elYvq AskMÖn�Y �Kvb kvixwiK SzuwKi m¤¢vebv �bB|
LiP
M�elYvq AskMÖn�Yi Rb¨ Avcbvi �ivMx/�ivMxi �ivM wbY� ©qi �Kvb LiP bvB ev Avcbv�K Avw_©K mn�hvMxZv
Kivi Rb¨ e¨e¯ �v bvB|
�MvcbxqZv
M�elYv PjvKvjxb I cieZx©�Z cÖk � �_�K cÖvß Z_¨ I j¨ve�iUix �_�K cÖvß Z_¨ K�Vvifv�e �Mvcb ivLv
n�e|
M�elYvq AskMÖnY
GB M�elYvq AskMÖnY m¤ú~Y© �¯^�Qvg~jK| Avcwb M�elYvq AskMÖn�Y A¯x̂K�wZ Rvbv�Z cv�ib A_ev M�elYv
PjvKvjxb �h�Kvb mg�q M�elYv �_�K Avcbvi �ivMx/�ivMx�K cªZ¨vnvi K�i wb�Z cv�ib| GB di�g ¯v̂¶i
Ki�j Avcbvi AvBbMZ �Kvb AwaKvi Le© n�e bv| Avcbvi �ivMx/�ivMxi wPwKrmv h_vh_fv�e Pj�e| hw`
Avcbvi �Kvb cÖk � _v�K, Avcwb wRÁvmv Ki�Z cv�ib, Avgiv Zvi DËi cÖ̀ vb Kivi h_vmva¨ �Póv Kie|
m¤§wZ ¯x̂Kv�ivw³
Avwg M�elYvq wb�qvwRZ wPwKrm�Ki mv�_ GB M�elYv wb�q Av�jvPbvq m��wó cÖKvk KiwQ| Avwg m¤§wZc�Îi
kZ©̧ �jv c�owQ/Avi m¤§y�L cwVZ n�q�Q Ges �¯̂�Qvq Avgvi �ivMx/�ivMx�K M�elYvq AskMÖnY Ki�Z m¤§wZ
Ávcb KiwQ|
mv¶vrMÖnYKvixi ¯v̂¶i
ZvwiL t
Awffve�Ki ¯v̂¶i/e �×v½yjxi Qvc
ZvwiL t