Poliovirus Rocket rRT-PCR ITD - WPRO · Expanded 1 Programme on Immunisation Poliovirus Rocket rRT-PCR ITD A kit for the serotyping of L20B positive cell cultures and intratypic differentiation

1Expanded Programme on

Immunisation

Poliovirus Rocket rRT-PCR ITD A kit for the serotyping of L20B positive cell cultures and intratypic differentiation of polioviruses in support of the Global Polio Eradication Initiative Kit components The kit is supplied in one box containing six vials of primers and probes in Buffer A (Serotype 1, Serotype 2, Serotype 3, Pan-Poliovirus, Pan-Enterovirus, Sabin Multiplex), two vials of Buffer B (to which DTT and enzymes should be added prior to the first use) and one vial of DTT. The box also contains the appropriate positive controls for each primer set, a tube of water and one copy of this package insert. Additional required reagent and enzymes, not supplied with the kit, are Protector RNase inhibitor, Transcriptor Reverse Transcriptase, and Taq DNA polymerase from Roche Applied Science. The listed products were used in the development and evaluation of this kit and do not constitute a specific product endorsement. Enzyme availability from manufacturers may vary with each laboratory. Therefore, it is the responsibility of each laboratory to find appropriate substitutes when necessary. Real-time RT-PCR Reactions

1) Fill out PCR worksheet with name, date, primers, samples, and sample order, as well as thermocycler and program identifiers.

a) Name wells using thermocycler software for samples and controls (positive and reagent).

b) One positive control: non-infectious control RNA supplied with Polio rRT-PCR kit.

c) One reagent control: Buffer A + B with no template. 2) Thaw virus isolates and PCR reagents at room temperature. 3) Making Buffer B + enzyme mix: The first time a vial of Buffer B 1mL is used, add

2.8 µµµµl 1 M DTT, 27.6 µµµµl 40 U/µµµµl RNase inhibitor, 18.0 µµµµl 20 U/µµµµl RT (or 14.4 µµµµl

25 U/µµµµl RT), and 54.8 µµµµl 5 U/µµµµl Taq polymerase (CAUTION, do not use error correcting Taq polymerases like Pfu and Pwo; they will not work with inosine primers) and mix. The enzyme mix should be stable for 6 months at 4°C. Once the enzymes have been added, mark “+E” on the cap with an indelible marker. For long term storage (>6 months), aliquot & freeze Buffer B +E at -20C.

4) Making reaction solution: For each primer set, mix 19 µl Buffer A (vortex to

resuspend probe before use) and 5 µl Buffer B +E; dispense 24 µl reaction solution into each well. For testing large sample numbers, create a master mix of

Buffers A + B (i.e. 8 samples x 19 µl Buffer A = 152 µl; 8 x 5 µl Buffer B = 40 µl),

and dispense 24 µl of the A + B master mix per reaction well. (We recommend using the first well on your 8-well strip to make the A + B master mix since some commercial eppendorf tubes may bind the probe).

5) Sample preparation: Take 50 µl virus cell culture and place into a tube and spin it (bench top micro centrifuge at 5,000 rpm or full speed (max rpm 6,400) of Tube-Strip PicoFuge) at room temperature for 2 minutes. (Once the samples have been spun, they can be stored at -20°C and re-used if needed. You need to re-spin the sample after being stored at -20ºC).

6) Take 0.5 µl of cell culture supernatant (or 1µl of Control RNA) for each sample and add into the appropriate reaction strip/plate well. rRT-PCR does NOT


Immunisation

require a 95°C heat step. One µl of extracted RNA can be used, but it’s not generally required.

7) Place strips in real-time thermocycler and cycle as shown below. If using a thermocycler with a rapid ramp speed, program the ramp from 44°C to 60°C for 45 sec (note for the ABI 7500, you can use 25% ramp speed between the anneal and extension temperatures for all assays). Thermocyclers with regular ramp speeds can use the default ramp time; Stratagene Mx3000P and similar machines do not have adjustable ramp capabilities. An additional intermediate step between the lower and higher temperature in the PCR cycle compensates for the inability to adjust the ramp time between anneal and extension):

a) RT reaction, 42°C, 45 min. b) Inactivate RT, 95°C, 3 min. c) PCR cycles (all primer sets):

Using a Stratagene MX3000P: 95°C for 24 sec, 44°C for 24 sec, 52°C for 30 sec, 60°C for 24 sec for 15 cycles, followed by Stage 2: 95°C for 24 sec, 47°C for 24 sec, 57°C for 10 sec, 65°C for 24 sec for 40 cycles Using an ABI 7500: Stage 1: 95°C for 24 sec, 44°C for 30 sec, then a 25% ramp speed to 60°C for 24 sec, for 15 cycles, followed by Stage 2: 95°C for 24 sec, 47°C for 30 sec, then a 25% ramp speed to 65°C for 24 sec for 40 cycles. The end point fluorescent data is collected at the end of the Stage 2 anneal step.

d) Select the appropriate dye filter to correspond with the assay being used.

Interpretation You must first check the negative and positive control data to validate your assay before reading data from samples. The cycle threshold value (Ct) is the cycle number where a PCR product is seen via fluorescence. The results are interpreted by looking for a Ct value of between 10-28. These Ct values are calculated automatically by the Stratagene (or ABI 7500) software. However, you may have to manually adjust the baseline Ct threshold to reflect your actual negative controls (this is especially true with the ABI 7500 software). The Ct value cutoff is 30, with values less than 30 as positive and values more than 30 as negative. You are actually looking for a nice logarithmic curve as shown in the examples below. Samples with Ct values from 28-32 should be re-analyzed using extracted RNA for those samples. Samples which have a Ct value <30 but have a flat fluorescence profile, or a profile that rises just barely rise above the X axis are most likely negative, but should be repeated as well, using extracted RNA.. Below is an example with an ABI 7500.

S2,3 EV S1 PV PV3 PV1,2 NTC


Immunisation

Troubleshooting-Common Errors

Problem Possible causes

All reactions negative, including positive control

Component missing, wrong thermocycler profile used or bad reagent.

No Ct value( i.e. negative) with positive control; some sample reactions positive

Control RNA degraded or not added.

Positive Ct values with one or more Sabin pairs, but corresponding Serotype pairs and/or PanPV are negative

Ensure that serotype PCR was performed with 44°C annealing temperature. Ensure that ramp time for 44°C to 60°C step is approximately 40-45 seconds (~0.4ºC/sec.).

Failure to select the correct dye filter for an assay

Re-run the assay with the correct dye filter (ABI 7500 will record all dyes regardless. Select filter and reanalyze results

No fluorescence data collected Bubbles in the well (or on the cap) Inhibition of rRT-PCR due to cell debris in the sample or too much clarified cell culture used

Positive reaction (Ct value) with PanPV primers, but all serotype pairs are negative Or negative Ct value with PanPV, but positive for a serotype Or if results are negative (discordant) after repeating at least one time

The isolate should be referred to a Specialized Reference Laboratory for identification.

Concave curve along X axis High virus titer = positive


Immunisation

Real-time PCR Primers/Probes

Specificity

Primer or probe (Polarity)

Primer or probe sequence (5′→3′)

Pan-Enterovirus

PCR-1 (A) PCR-2 (S) PanEV Probe (S)

GCGATTGTCACCATWAGCAGYCA GGCCCCTGAATGCGGCTAATCC FAM-CCGACTACTTTGGGWGTCCGTGT-BHQ1

*Pan-Poliovirus

panPV/PCR-1 (A) panPV/PCR-2 (S) panPV Probe 21A (A)

AYRTACATIATYTGRTAIAC CITAITCIMGITTYGAYATG FAM-TGRTTNARIGCRTGICCRTTRTT-BHQ1

*Serotype 1 seroPV1A (A) seroPV1,2S (S) seroPV1 Probe 16A (A)

ATCATIYTPTCIARPATYTG TGCGIGAYACIACICAYAT FAM-TGICCYAVICCYTGIGMIADYGC-BHQ1

*Serotype 2 seroPV2A (A) seroPV1,2S (S) seroPV2 Probe 5S (S)

AYICCYTCIACIRCICCYTC TGCGIGAYACIACICAYAT FAM-CARGARGCIATGCCICARGGIATNGG-BHQ1

*Serotype 3 seroPV3A (A) seroPV3S (S) seroPV3 Probe 11S (S)

CCCCIAIPTGRTCRTTIKPRTC AAYCCITCIRTITTYTAYAC FAM-CCRTAYGTNGGITTRGCVAAYGC-BHQ1

Sabin 1 Sab1/PCR-1 (A) Sab1/PCR-2 (S) Sab1/Probe (A)

CCACTGGCTTCAGTGTTT AGGTCAGATGCTTGAAAGC CY5-TTGCCGCCCCCACCGTTTCACGGA-BHQ3

Sabin 2 Sab2/PCR-1 (A) Sab2/PCR-2 (S) Sab2/Probe (S)

CGGCTTTGTGTCAGGCA CCGTTGAAGGGATTACTAAA FAM-ATTGGTTCCCCCGACTTCCACCAAT-BHQ1


TTAGTATCAGGTAAGCTATC AGGGCGCCCTAACTTT ROX-TCACTCCCGAAGCAACAG-BHQ2

Degenerate primers: K = G and T; M = A and C; R = A and G; Y = C and T; I = Inosine; p = (TC). * Use degenerate PCR conditions with these primer sets. References

1. Kilpatrick, D. R., B. Nottay, C. F. Yang, S. J. Yang, M. N. Mulders, B. P. Holloway, M. A. Pallansch, and O. M. Kew. 1996. Group-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residue at positions of codon degeneracy. J. Clin. Microbiol. 34:2990-6.

2. Kilpatrick, D. R., B. Nottay, C. F. Yang, S. J. Yang, E. Da Silva, S. Penaranda, M. Pallansch, and O. Kew. 1998. Serotype-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residues at positions of codon degeneracy. J. Clin. Microbiol. 36:352-7.

3. Yang, C.-F., L. De, B.P. Holloway, M.A. Pallansch, and O.M. Kew. 1991. Detection and identification of vaccine-related polioviruses by the polymerase chain reaction. Virus Res. 20:159-179.

4. Yang, C.-F., L. De, S.-J. Yang, J. Ruiz Gómez, J. Ramiro Cruz, B. P. Holloway, M. A. Pallansch, and O. M. Kew. 1992. Genotype-specific in vitro amplification of sequences of the wild type 3 polioviruses from Mexico and Guatemala. Virus Res. 24:277-296.

5. Expanded Programme on Immunization. 2000. Molecular characterization of polioviruses (laboratory manual). World Health Organization, Geneva.

6. Kilpatrick, D. R., C. F. Yang, K. Ching, A. Vincent, J. Iber, R. Campagnoli, M. Mandelbaum, L. De, A. Nix, and O. M. Kew. 2009. Rapid Group, Serotype and Vaccine Strain-Specific Identification of Poliovirus Isolates by Real-Time Reverse Transcription-PCR Using Degenerate Primers and Probes Containing Deoxyinosine Residues. J. Clin Microbiol. 47(6): 1939-1941.

Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. Email: [email protected], [email protected], [email protected], [email protected]. For research use only. Not for use in diagnostic procedures.


Immunisation

Poliovirus Rocket rRT-PCR ITD A kit supplement for the intratypic differentiation of polioviruses in support of the Global Polio Eradication Initiative PCR Positive Control RNA Positive controls should be reconstituted before initial usage. Briefly spin the tubes to concentrate the lyophilized pellet before resuspension. Each lyophilized control should

be reconstituted in 100µL dH2O to yield a working solution of 20pg/µL. After addition of dH2O, place in -20ºC overnight to allow proper rehydration of the RNA pellet. This

solution should then be aliquoted into 2 x 50µL volumes and stored at -20°C for future usage. Aliquoting will reduce risk of cross-contamination and the RNA hydrolyzing. Any one of the three serotype PV controls may be used for the PanPV and PanEV control during testing. Please do not repeatedly use the same serotype PV control RNA for every PanPV or PanEV test run, so you do not run out of that specific serotype PV control RNA.

Poliovirus Rocket rRT-PCR ITD kit

Tube Description Vol. Conc. Cap Insert # /box

PV1 primers/probe + Buffer A 1000µL 80µM Yellow Red 1

PV1 positive control RNA Yellow Yellow 1

PV2 primers/probe + Buffer A 1000µL 80µM Orange Red 1

PV2 positive control RNA Orange Yellow 1

PV3 primers/probe + Buffer A 1000µL 80µM Red Red 1

PV3 positive control RNA Red Yellow 1

Sabin primers/probes + Buffer A 1000µL 10µM Natural Red 1

Sabin positive control RNA Natural Yellow 1

PanEV primers/probe + Buffer A 1000µL 10µM Purple Red 1

PanPV primers/probe + Buffer A 1000µL 80µM White Red 1

Buffer B 1000µL Blue Blue 2

1M DTT 30µL Blue White 1

Sterile, RNase free Water 1000µL Natural Blue 1 Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. Email: [email protected], [email protected], [email protected], [email protected]. For research use only. Not for use in diagnostic procedures.


Immunisation

Poliovirus Diagnostic rRT-PCR A kit for the serotyping of L20B positive cell cultures and intratypic differentiation of polioviruses in support of the Global Polio Eradication Initiative Kit components The kit is supplied in one box containing six vials of primers and probes in Buffer A (Serotype 1, Serotype 2, Serotype 3, Pan-Poliovirus, Pan-Enterovirus, Sabin Multiplex), two vials of Buffer B (to which DTT and enzymes should be added prior to the first use) and one vial of DTT. The box also contains the appropriate positive controls for each primer set, a tube of water and one copy of this package insert. Additional required reagent and enzymes, not supplied with the kit, are Protector RNase inhibitor, Transcriptor Reverse Transcriptase, and Taq DNA polymerase from Roche Applied Science. The listed products were used in the development and evaluation of this kit and do not constitute a specific product endorsement. Enzyme availability from manufacturers may vary with each laboratory. Therefore, it is the responsibility of each laboratory to find appropriate substitutes when necessary. Real-time RT-PCR Reactions





2.8 µµµµl 1 M DTT, 27.6 µµµµl 40 U/µµµµl RNase inhibitor, 18.0 µµµµl 20 U/µµµµl RT (or 14.4 µµµµl

25 U/µµµµl RT), and 54.8 µµµµl 5 U/µµµµl Taq polymerase (CAUTION, do not use error correcting Taq polymerases like Pfu and Pwo; they will not work with inosine primers) and mix. The enzyme mix should be stable for 6 months at 4°C. Once the enzymes have been added, mark “+E” on the cap with an indelible marker. For long term storage (>6 months), aliquot & freeze Buffer B +E at -20C.



Buffers A + B (i.e. 8 samples x 19 µl Buffer A = 152 µl; 8 x 5 µl Buffer B = 40 µl),

and dispense 24 µl of the A + B master mix per reaction well. (We recommend using the first well on your 8-well strip to make the A + B master mix since some commercial eppendorf tubes may bind the probe).

5) Sample preparation: Take 50 µl virus cell culture and place into a tube and spin it (bench top micro centrifuge at 5,000 rpm or full speed (max rpm 6,400) of Tube-Strip PicoFuge) at room temperature for 2 minutes. (Once the samples have been spun, they can be stored at -20°C and re-used if needed. You need to re-spin the sample after being stored at -20ºC).



Immunisation

require a 95°C heat step. One µl of extracted RNA can be used, but it’s not generally required.

7) Place strips in real-time thermocycler and cycle as shown below. If using a thermocycler with a rapid ramp speed, program the ramp from 44°C to 60°C for 45 sec (note for the ABI 7500, you can use 25% ramp speed between the anneal and extension temperatures for all assays). Thermocyclers with regular ramp speeds can use the default ramp time; Stratagene Mx3000P and similar machines do not have adjustable ramp capabilities. An additional intermediate step between the lower and higher temperature in the PCR cycle compensates for the inability to adjust the ramp time between anneal and extension):

a) RT reaction, 42°C, 45 min. b) Inactivate RT, 95°C, 3 min. c) PCR cycles (all primer sets):

Using a Stratagene MX3000P: 95°C for 24 sec, 44°C for 24 sec, 52°C for 30 sec, 60°C for 24 sec for 40 cycles Using an ABI 7500: 95°C for 24 sec, 44°C for 30 sec, then a 25% ramp speed to 60°C for 24 sec, for 40 cycles

The end point fluorescent data is collected at the end of the anneal step. d) Select the appropriate dye filter to correspond with the assay being used.

Interpretation You must first check the negative and positive control data to validate your assay before reading data from samples. The cycle threshold value (Ct) is the cycle number where a PCR product is seen via fluorescence. The results are interpreted by looking for a Ct value of between 10-28. These Ct values are calculated automatically by the Stratagene (or ABI 7500) software. However, you may have to manually adjust the baseline Ct threshold to reflect your actual negative controls (this is especially true with the ABI 7500 software). The Ct value cutoff is 30, with values less than 30 as positive and values more than 30 as negative. You are actually looking for a nice logarithmic curve as shown in the examples below. Samples with Ct values from 28-32 should be re-analyzed using extracted RNA for those samples. Samples which have a Ct value <30 but have a flat fluorescence profile, or a profile that rises just barely rise above the X axis are most likely negative, but should be repeated as well, using extracted RNA.. Below is an example with an ABI 7500

8/14/2008 PV PV1 PV2 PV3 2

PV3

PV

PV2

PV1


Immunisation

Troubleshooting-Common Errors

Problem Possible causes





Positive Ct values with one or more Sabin pairs, but corresponding Serotype pairs and/or PanPV are negative

Ensure that serotype PCR was performed with 44°C annealing temperature. Ensure that ramp time for 44°C to 60°C step is approximately 40-45 seconds (~0.4ºC/sec.).


Re-run the assay with the correct dye filter (ABI 7500 will record all dyes regardless. Select filter and reanalyze results


Positive reaction (Ct value) with PanPV primers, but all serotype pairs are negative Or negative Ct value with PanPV, but positive for a serotype Or if results are negative (discordant) after repeating at least one time

The isolate should be referred to a Specialized Reference Laboratory for identification.


Immunisation

Real-time PCR Primers/Probes

Specificity

Primer or probe (Polarity)

Primer or probe sequence (5′→3′)

Pan-Enterovirus

PCR-1 (A) PCR-2 (S) PanEV Probe (S)

GCGATTGTCACCATWAGCAGYCA GGCCCCTGAATGCGGCTAATCC FAM-CCGACTACTTTGGGWGTCCGTGT-BHQ1

*Pan-Poliovirus

panPV/PCR-1 (A) panPV/PCR-2 (S) panPV Probe 21A (A)

AYRTACATIATYTGRTAIAC CITAITCIMGITTYGAYATG FAM-TGRTTNARIGCRTGICCRTTRTT-BHQ1

*Serotype 1 seroPV1A (A) seroPV1,2S (S) seroPV1 Probe 16A (A)

ATCATIYTPTCIARPATYTG TGCGIGAYACIACICAYAT FAM-TGICCYAVICCYTGIGMIADYGC-BHQ1

*Serotype 2 seroPV2A (A) seroPV1,2S (S) seroPV2 Probe 5S (S)

AYICCYTCIACIRCICCYTC TGCGIGAYACIACICAYAT FAM-CARGARGCIATGCCICARGGIATNGG-BHQ1

*Serotype 3 seroPV3A (A) seroPV3S (S) seroPV3 Probe 11S (S)

CCCCIAIPTGRTCRTTIKPRTC AAYCCITCIRTITTYTAYAC FAM-CCRTAYGTNGGITTRGCVAAYGC-BHQ1

Sabin 1 Sab1/PCR-1 (A) Sab1/PCR-2 (S) Sab1/Probe (A)

CCACTGGCTTCAGTGTTT AGGTCAGATGCTTGAAAGC CY5-TTGCCGCCCCCACCGTTTCACGGA-BHQ3


CGGCTTTGTGTCAGGCA CCGTTGAAGGGATTACTAAA FAM-ATTGGTTCCCCCGACTTCCACCAAT-BHQ1


TTAGTATCAGGTAAGCTATC AGGGCGCCCTAACTTT ROX-TCACTCCCGAAGCAACAG-BHQ2

Degenerate primers: K = G and T; M = A and C; R = A and G; Y = C and T; I = Inosine; p = (TC). * Use degenerate PCR conditions with these primer sets. References

1. Kilpatrick, D. R., B. Nottay, C. F. Yang, S. J. Yang, M. N. Mulders, B. P. Holloway, M. A. Pallansch, and O. M. Kew. 1996. Group-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residue at positions of codon degeneracy. J. Clin. Microbiol. 34:2990-6.

2. Kilpatrick, D. R., B. Nottay, C. F. Yang, S. J. Yang, E. Da Silva, S. Penaranda, M. Pallansch, and O. Kew. 1998. Serotype-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residues at positions of codon degeneracy. J. Clin. Microbiol. 36:352-7.

3. Yang, C.-F., L. De, B.P. Holloway, M.A. Pallansch, and O.M. Kew. 1991. Detection and identification of vaccine-related polioviruses by the polymerase chain reaction. Virus Res. 20:159-179.

4. Yang, C.-F., L. De, S.-J. Yang, J. Ruiz Gómez, J. Ramiro Cruz, B. P. Holloway, M. A. Pallansch, and O. M. Kew. 1992. Genotype-specific in vitro amplification of sequences of the wild type 3 polioviruses from Mexico and Guatemala. Virus Res. 24:277-296.

5. Expanded Programme on Immunization. 2000. Molecular characterization of polioviruses (laboratory manual). World Health Organization, Geneva.

6. Kilpatrick, D. R., C. F. Yang, K. Ching, A. Vincent, J. Iber, R. Campagnoli, M. Mandelbaum, L. De, A. Nix, and O. M. Kew. 2009. Rapid Group, Serotype and Vaccine Strain-Specific Identification of Poliovirus Isolates by Real-Time Reverse Transcription-PCR Using Degenerate Primers and Probes Containing Deoxyinosine Residues. J. Clin Microbiol. 47(6): 1939-1941.

Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. Email: [email protected], [email protected], [email protected], [email protected].


Immunisation

For research use only. Not for use in diagnostic procedures.

Poliovirus Diagnostic rRT-PCR A kit supplement for the intratypic differentiation of polioviruses in support of the Global Polio Eradication Initiative PCR Positive Control RNA Positive controls should be reconstituted before initial usage. Briefly spin the tubes to concentrate the lyophilized pellet before resuspension. Each lyophilized control should

be reconstituted in 100µL dH2O to yield a working solution of 20pg/µL. After addition of dH2O, place in -20ºC overnight to allow proper rehydration of the RNA pellet. This

solution should then be aliquoted into 2 x 50µL volumes and stored at -20°C for future usage. Aliquoting will reduce risk of cross-contamination and the RNA hydrolyzing. Any one of the three serotype PV controls may be used for the PanPV and PanEV control during testing. Please do not repeatedly use the same serotype PV control RNA for every PanPV or PanEV test run, so you do not run out of that specific serotype PV control RNA.

Poliovirus Diagnostic rRT-PCR Kit


PV1 primers/probe + Buffer A 1000µL 80µM Yellow Red 1


PV2 primers/probe + Buffer A 1000µL 80µM Orange Red 1


PV3 primers/probe + Buffer A 1000µL 80µM Red Red 1


Sabin primers/probes + Buffer A 1000µL 10µM Natural Red 1

Sabin positive control RNA Natural Yellow 1

PanEV primers/probe + Buffer A 1000µL 10µM Purple Red 1

PanPV primers/probe + Buffer A 1000µL 80µM White Red 1



Sterile, RNase free Water 1000µL Natural Blue 1 Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. Email: [email protected], [email protected], [email protected], [email protected].


Immunisation

For research use only. Not for use in diagnostic procedures.


Immunisation

VDPV rRT-PCR Screening A kit to screen for vaccine-derived polioviruses in support of the Global Polio Eradication Initiative Kit components The kit is supplied in one box. The box contains three vials of primers and probes in Buffer A (Sab1 VDPV, Sab2 VDPV, Sab3 VDPV) and appropriate positive controls for each primer set. The box also contains one vial of Buffer B (to which DTT and enzymes should be added prior to the first use), one vial of DTT, a tube of water and one copy of this package insert. Additional required reagent and enzymes, not supplied with the kit, are Protector RNase inhibitor, Transcriptor Reverse Transcriptase, and Taq DNA polymerase from Roche Applied Science. The listed products were used in the development and evaluation of this kit and do not constitute a specific product endorsement. Enzyme availability from manufacturers may vary with each laboratory. Therefore, it is the responsibility of each laboratory to find appropriate substitutes when necessary. Real-time RT-PCR Reactions





2.8 µµµµl 1 M DTT, 27.6 µµµµl 40 U/µµµµl RNase inhibitor, 18.0 µµµµl 20 U/µµµµl RT (14.4 µµµµl 25

U/µµµµl RT), and 54.8 µµµµl 5 U/µµµµl Taq polymerase (CAUTION, do not use error correcting Taq polymerases like Pfu and Pwo; they will not work with inosine primers) and mix. The enzyme mix should be stable for 6 months at 4°C. Once the enzymes have been added, mark “+E” on the cap with an indelible marker. For long term storage (>6 months), aliquot & freeze Buffer B +E at -20C.



Buffers A + B (e.g. 8 samples x 19 µl Buffer A = 152 µl; 8 x 5 µl Buffer B = 40 µl),

and dispense 24 µl of the A + B master mix per reaction well.

5) Sample preparation: Take 50 µl virus cell culture and place into a tube and spin it (bench top micro centrifuge at 5,000 rpm or full speed (max rpm 6,400) of Tube-Strip PicoFuge) at room temperature for 2 minutes. (Once the samples have been spun, they can be stored at –20°C and re-used with re-spin if needed).


require a 95°C heat step. One µl of extracted RNA can be used, but is not generally required.

7) Place strips in real-time thermocycler and run cycles as shown below. If using a thermocycler with a rapid ramp speed, program the ramp from 44ºC to 60ºC for 45 sec (note for the ABI 7500, you can use 25% ramp speed between the anneal and extension temperatures). Thermocyclers with regular ramp speeds can use


Immunisation

the default ramp time; Stratagene Mx3000P and similar machines do not have adjustable ramp capabilities. An additional intermediate step between the lower and higher temperature in the PCR cycle compensates for the inability to adjust the ramp time between anneal and extension.

a) RT reaction, 42°C, 45 min. b) Inactivate RT, 95°C, 3 min. c) PCR cycles:

Using a Stratagene MX3000P: 95°C for 24 sec, 50°C for 24 sec, 57°C for 10 sec, 65°C for 24 sec for 40 cycles. Using an ABI 7500: 95°C for 24 sec, 50°C for 30 sec, then a 25% ramp speed to 65°C for 24 sec, for 40 cycles. The end point fluorescent data is collected at the end of the anneal step.

d) Select the appropriate dye filter to correspond with the assay being used.

Interpretation

You must first check the negative and positive control data to validate your assay before reading data from samples. The results are interpreted by looking for a cycle threshold value (Ct) of between 10-28. These Ct values are calculated automatically by the Stratagene (or ABI 7500) software. However, you may have to manually adjust the baseline Ct threshold to reflect your actual negative controls (this is especially true with the ABI 7500 software). The Ct value cutoff is 30, with values less than 30 as positive and values more than 30 as negative. You are actually looking for a nice logarithmic curve as shown in the examples below. Samples with Ct values from 28-32 should be re-analyzed using extracted RNA for those samples. Samples which have a Ct value <30 but have a flat fluorescence profile, or a profile that just barely rises above the X axis are most likely negative, but should be repeated as well, using extracted RNA for those samples. Below is an example using an ABI 7500.

8/18/2008 VDPVs 10&15pm VP1 10pm 3D

8-15-08

2

S2VDPV assay

VP1

3D


Immunisation

Interpretation of VDPV Results

VP1 Result

Positive SL (Report)

Negative NSL (Report and Refer for Sequencing)

Troubleshooting - Common Errors

Problem Possible Causes






Re-run the assay with the correct dye filter (ABI 7500 will record all dyes regardless. Select filter and reanalyze results)



Immunisation

Sabin VDPV Real-time

Primer specificity Primer & Probe sequences 5’-3’ S1 VDPV VP1 Sense CATGCGTGGCCATTATA

Anti-Sense CAAATTCCATATCAAATCTA

VP1 Probe FAM-CACCAAGAATAAGGATAAGC-BHQ1

S1 VDPV 3D Sense GACACTAAGGAAATGCAAAAACTGC

Anti-Sense ATCGCACCCTACTGCTGA

3D Probe ROX-TCAGTGGCAATGAGAATGGCTTTTGGG-BHQ2

S2 VDPV VP1 Sense GACATGGAGTTCACTTTTG

Anti-Sense CTCCGGGTGGTATATAC

VP1 Probe FAM-CATTGATGCAAATAAC-BHQ1

S2 VDPV 3D Sense AGGAAATGCGGAGACTCTTA

Anti-Sense GGATCACAACCAACTGCACT

3D Probe ROX-CTTACCGCTTGTAACATATGT-BHQ2

S3 VDPV VP1 Sense CATTTACATGAAACCCAAAC

Anti-Sense TGGTCAAACCTTTCTCAGA

VP1 Probe FAM-TAGGAACAACTTGGAC-BHQ1

S3 VDPV 3D Sense CACCAAAGAAATGCAAAGACTTT

Anti-Sense GGATCGCATCCAACTGCACT

3D Probe ROX-CCTACCATTAGTGACATATGT-BHQ2

References

1. Kilpatrick, D. R., K. Ching, J. Iber, R. Campagnoli, C.J. Freeman, N.Mishrik, H. Liu, , M. A. Pallansch, and O. M. Kew. 2004. Multiplex PCR Method for Identifying Recombinant Vaccine-related Polioviruses. J. Clin. Microbiol. 42:4313-4315.

2. Kilpatrick, D. R., C. F. Yang, K. Ching, A. Vincent, J. Iber, R. Campagnoli, M. Mandelbaum, L. De, A. Nix, and O. M. Kew. 2009. Rapid Group, Serotype and Vaccine Strain-Specific Identification of Poliovirus Isolates by Ream-Time Reverse Transcription-PCR Using Degenerate Primers and Probes Containing Deoxyinosine Residues. J. Clin. Microbiol. 47(6): 1939-1941.

3. Kilpatrick, D.R., K. Ching, A. Vincent, J. Iber, Q. Chen, R. Campagnoli, M. Mandelbaum, and O. M. Kew. A Multiplex Real-time PCR Assay for Identifying Vaccine-Derived Polioviruses (VDPVs). Manuscript in preparation.

Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. email: [email protected], [email protected], [email protected], [email protected] For research use only. Not for use in diagnostic procedures.

VDPV rRT-PCR Screening


Immunisation

A kit supplement for the screening of vaccine-derived polioviruses in support of the Global Polio Eradication Initiative PCR Positive Control RNA Positive controls should be reconstituted before initial usage. Briefly spin the tubes to concentrate the lyophilized pellet before resuspension. Each lyophilized control should

be reconstituted in 100µL dH2O to yield a working solution of 20pg/µL. After addition of dH2O, place in -20ºC overnight to allow proper rehydration of the RNA pellet. [Vortex

and centrifuge] This solution should then be aliquoted into 2 x 50µL volumes and stored

at -20°C for future usage. Aliquoting will reduce risk of cross-contamination and the RNA hydrolyzing.

Sabin VDPV rRT-PCR Screening Kit


S1 VDPV primers/probes + Buffer A 1000µL 10µM Yellow Green 1


S2 VDPV primers/probes + Buffer A 1000µL 10µM Orange Green 1


S3 VDPV primers/probes + Buffer A 1000µL 10µM Red Green 1




Sterile, Rnase free Water 1000µL Natural Blue 1 Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. Email: [email protected], [email protected], [email protected], [email protected]. For research use only. Not for use in diagnostic procedures.


Immunisation

VDPV VP1 rRT-PCR Screening A kit to screen for vaccine-derived polioviruses in support of the Global Polio Eradication Initiative Kit components The kit is supplied in one box. The box contains three vials of primers and probes in Buffer A (Sab1 VDPV, Sab2 VDPV, Sab3 VDPV) and appropriate positive controls for each primer set. The box also contains one vial of Buffer B (to which DTT and enzymes should be added prior to the first use), one vial of DTT, a tube of water and one copy of this package insert. Additional required reagent and enzymes, not supplied with the kit, are Protector RNase inhibitor, Transcriptor Reverse Transcriptase, and Taq DNA polymerase from Roche Applied Science. The listed products were used in the development and evaluation of this kit and do not constitute a specific product endorsement. Enzyme availability from manufacturers may vary with each laboratory. Therefore, it is the responsibility of each laboratory to find appropriate substitutes when necessary. Real-time RT-PCR Reactions





2.8 µµµµl 1 M DTT, 27.6 µµµµl 40 U/µµµµl RNase inhibitor, 18.0 µµµµl 20 U/µµµµl RT (14.4 µµµµl 25

U/µµµµl RT), and 54.8 µµµµl 5 U/µµµµl Taq polymerase (CAUTION, do not use error correcting Taq polymerases like Pfu and Pwo; they will not work with inosine primers) and mix. The enzyme mix should be stable for 6 months at 4°C. Once the enzymes have been added, mark “+E” on the cap with an indelible marker. For long term storage (>6 months), aliquot & freeze Buffer B +E at -20C.



Buffers A + B (e.g. 8 samples x 19 µl Buffer A = 152 µl; 8 x 5 µl Buffer B = 40 µl),

and dispense 24 µl of the A + B master mix per reaction well.

5) Sample preparation: Take 50 µl virus cell culture and place into a tube and spin it (bench top micro centrifuge at 5,000 rpm or full speed (max rpm 6,400) of Tube-Strip PicoFuge) at room temperature for 2 minutes. (Once the samples have been spun, they can be stored at –20°C and re-used with re-spin if needed).


require a 95°C heat step. One µl of extracted RNA can be used, but is not generally required.

7) Place strips in real-time thermocycler and run cycles as shown below. If using a thermocycler with a rapid ramp speed, program the ramp from 44ºC to 60ºC for 45 sec (note for the ABI 7500, you can use 25% ramp speed between the anneal and extension temperatures). Thermocyclers with regular ramp speeds can use


Immunisation

the default ramp time; Stratagene Mx3000P and similar machines do not have adjustable ramp capabilities. An additional intermediate step between the lower and higher temperature in the PCR cycle compensates for the inability to adjust the ramp time between anneal and extension.

a) RT reaction, 42°C, 45 min. b) Inactivate RT, 95°C, 3 min. c) PCR cycles:

Using a Stratagene MX3000P: Stage 1: 95°C for 24 sec, 44°C for 24 sec, 52°C for 30 sec, 60°C for 24 sec for 5 cycles, followed by Stage 2: 95°C for 24 sec, 50°C for 24 sec, 57°C for 10sec, 65°C for 24 sec for 40 cycles. Using an ABI 7500: Stage 1: 95°C for 24 sec, 44°C for 30 sec, 60°C for 24 sec for 5 cycles, followed by Stage 2: 95°C for 24 sec, 50°C for 30 sec, then a 25% ramp speed to 65°C for 24 sec, for 40 cycles. The end point fluorescent data is collected at the end of the Stage 2 anneal step.

d) Select the appropriate dye filter, FAM to detect VP1.

Interpretation

You must first check the negative and positive control data to validate your assay before reading data from samples. The results are interpreted by looking for a cycle threshold value (Ct) of between 10-28. These Ct values are calculated automatically by the Stratagene (or ABI 7500) software. However, you may have to manually adjust the baseline Ct threshold to reflect your actual negative controls (this is especially true with the ABI 7500 software). The Ct value cutoff is 30, with values less than 30 as positive and values more than 30 as negative. You are actually looking for a nice logarithmic curve as shown in the examples below. Samples with Ct values from 28-32 should be re-analyzed using extracted RNA for those samples. Samples which have a Ct value <30 but have a flat fluorescence profile, or a profile that just barely rises above the X axis are most likely negative, but should be repeated as well, using extracted RNA for those samples. Below is an example using an ABI 7500.


Immunisation

Interpretation of VDPV Results

VP1 Result

Positive SL (Report)

Negative NSL (Report and Refer for Sequencing)

Troubleshooting - Common Errors

Problem Possible Causes






Re-run the assay with the correct dye filter (ABI 7500 will record all dyes regardless. Select filter and reanalyze results)



Immunisation

Sabin VDPV Real-time

Primer specificity Primer & Probe sequences 5’-3’ S1 VDPV VP1 Sense CATGCGTGGCCATTATA

Anti-Sense CAAATTCCATATCAAATCTA

VP1 Probe FAM-CACCAAGAATAAGGATAAGC-BHQ1

S2 VDPV VP1 Sense GACATGGAGTTCACTTTTG

Anti-Sense CTCCGGGTGGTATATAC

VP1 Probe FAM-CATTGATGCAAATAAC-BHQ1

S3 VDPV VP1 Sense CATTTACATGAAACCCAAAC

Anti-Sense TGGTCAAACCTTTCTCAGA

VP1 Probe FAM-TAGGAACAACTTGGAC-BHQ1

References

1. Kilpatrick, D. R., K. Ching, J. Iber, R. Campagnoli, C.J. Freeman, N.Mishrik, H. Liu, , M. A. Pallansch, and O. M. Kew. 2004. Multiplex PCR Method for Identifying Recombinant Vaccine-related Polioviruses. J. Clin. Microbiol. 42:4313-4315.

2. Kilpatrick, D. R., C. F. Yang, K. Ching, A. Vincent, J. Iber, R. Campagnoli, M. Mandelbaum, L. De, A. Nix, and O. M. Kew. 2009. Rapid Group, Serotype and Vaccine Strain-Specific Identification of Poliovirus Isolates by Ream-Time Reverse Transcription-PCR Using Degenerate Primers and Probes Containing Deoxyinosine Residues. J. Clin. Microbiol. 47(6): 1939-1941.

3. Kilpatrick, D.R., K. Ching, A. Vincent, J. Iber, Q. Chen, R. Campagnoli, M. Mandelbaum, and O. M. Kew. A Multiplex Real-time PCR Assay for Identifying Vaccine-Derived Polioviruses (VDPVs). Manuscript in preparation.

Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. email: [email protected], [email protected], [email protected], [email protected] For research use only. Not for use in diagnostic procedures.

VDPV VP1 rRT-PCR Screening


Immunisation

A kit supplement for the screening of vaccine-derived polioviruses in support of the Global Polio Eradication Initiative PCR Positive Control RNA Positive controls should be reconstituted before initial usage. Briefly spin the tubes to concentrate the lyophilized pellet before resuspension. Each lyophilized control should

be reconstituted in 100µL dH2O to yield a working solution of 20pg/µL. After addition of dH2O, place in -20ºC overnight to allow proper rehydration of the RNA pellet. [Vortex

and centrifuge] This solution should then be aliquoted into 2 x 50µL volumes and stored

at -20°C for future usage. Aliquoting will reduce risk of cross-contamination and the RNA hydrolyzing.

Sabin VDPV VP1 rRT-PCR Screening Kit


S1 VDPV primers/probes + Buffer A 1000µL 10µM Yellow Green 1


S2 VDPV primers/probes + Buffer A 1000µL 10µM Orange Green 1


S3 VDPV primers/probes + Buffer A 1000µL 10µM Red Green 1




Sterile, Rnase free Water 1000µL Natural Blue 1 Distributed by The WHO Collaborating Centre for Enteroviruses and Polioviruses, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Mailstop G-10, Atlanta, Georgia 30333 USA, +1-404-639-1341, Fax: +1-404-639-4011. Email: [email protected], [email protected], [email protected], [email protected]. For research use only. Not for use in diagnostic procedures.

Documents

Poliovirus Rocket rRT-PCR ITD - WPRO · Expanded 1 Programme on Immunisation Poliovirus Rocket rRT-PCR ITD A kit for the serotyping of L20B positive cell cultures and intratypic differentiation