Upload
pipeline-news
View
258
Download
9
Tags:
Embed Size (px)
DESCRIPTION
Pipeline News November 2011
Citation preview
PIPELINE NEWSSaskatchewan’s Petroleum Monthly Canada Post Publication No. 40069240
November 2011 FREE Volume 4 Issue 6
Co-opCo-opRe nery FireRe nery Fire
Page A2Page A2
Chasing the Chasing the hook: Skylifthook: Skylift
Page C1Page C1
CareerCareerOpportunities
Page C20Page C20
Sales • Lease • Service • Parts • RepairRegistered B620 Certifi ed Shop
All Types of Tankers, Vac Trailers, Gravel, Grain, Livestock, Goosenecks, Open and Enclosed
Recreational Trailers
Hwy. 16 West, Lloydminster, AB ∙ 1-866-875-7665 ∙ 1-780-875-7667 ∙ www.tnttankandtrailer.com
Heil DOT407 38 & 46 Cube, 1 & 2 CompartmentHeil & Hutchinson TC406 Crude 38 CubeNew 2011 27 Cube Acro ALum Dumping Vac Trailer
2011 used Hutchinson 18 Cube TC406 Crude Stiff Pole PupTremcar DOT407, 38 & 42 Cube, 1 & 2 Compartment Heil DOT407 Quad Wagon, 32 Cube
Hutchinson TC406 11 & 16 Cube
1985 Krohnert Tri Axle, Stainless, Insulated, Portable Water
North Country Triaxle End Dump
2055 Kenworth T800, 4” T&E Hyd Pump
1997 Polar 34 Cube, 306 Crude
Advance & Hutch, 34 Cube, Water Trailers (7 avail)
Crane business is pickingup
Mammoet, with the red crane, and Myshak Crane and Rigging, with the white crane, respond to a bridge collapse in Lloydminster caused by an over height load on Oct. 11. See story page A3. Photo by Geoff Lee
A2 PIPELINE NEWS November 2011
NewsNotes
Briefs courtesy Nickle’s Daily Oil Bulletin
We Also Have:We Also Have:40 Wheel Combo Trailer40 Wheel Combo Trailer30 Ton Tow Trucks 30 Ton Tow Trucks 40 Ton Sliding Boom Recovery Unit 40 Ton Sliding Boom Recovery Unit Air Cushion RecoveryAir Cushion Recovery30 Ton Winch Tractors30 Ton Winch Tractors
Our 60 Ton Tandem Our 60 Ton Tandem Tri-Drive Tow Truck Tri-Drive Tow Truck
Safely Tows All Your Safely Tows All Your Service Rigs,Service Rigs,
Coil Tubing,Coil Tubing,Flushbys, Picker TrucksFlushbys, Picker Trucks
780.875.HOOK780.875.HOOK4 6 6 5
Highway 16 West 10 Miles West of Lloydminster
Tri Drive 30 TonTri Drive 30 Ton
30 Ton Winch Tractor30 Ton Winch Tractor
By Brian ZinchukPipeline News
Regina – An explosion and subsequent fi re hit
the Consumers’ Co-operative Refi neries Ltd. com-
plex in Regina on Oct. 6 at approximately 2 p.m.
Th e fi re was quickly extinguished by the refi n-
ery’s response team. While city fi refi ghters were
staged in response, they were not required to put out
the fi re.
Th irteen people were transported to hospital, 10
by emergency medical services, and another three by
a contractor working on the site, according to Vic
Huard, Co-op vice-president of corporate aff airs.
Of the 13 taken to hospital, 10 were treated and
promptly released. One was treated and released
shortly thereafter. Of the two remaining in hospital,
one was released on Oct. 14 for further outpatient
treatment in Edmonton, while the fi nal person re-
mained in critical condition in Regina General Hos-
pital as of Oct. 14. Th e critically injured person was
reported as improving daily, according to a represen-
tative of the contractor that person was working for.
Both of the fi nal two victims were scaff olders
with Skyway Canada Ltd.
A further 23 people reported injuries to Oc-
cupational Health and Safety, but none of these re-
quired medical treatment at a hospital, according to
Huard.
Initial reports from Huard and other Co-op of-
fi cials in a press conference a little over an hour after
the explosion indicated a diesel and hydrogen fi re.
On Oct. 18 Huard told Pipeline News they did
not yet know the source, but what had burned was
diesel and hydrogen, which had apparently found
an ignition source. Th e refi nery is co-operating with
the independent investigation being conducted by
Regina Fire and Protective Services, Saskatchewan
Occupational Health and Safety, the Offi ce of the
Fire Commissioner, and the provincial boilers and
vessels branch.
Th e incident happened in an older area of the
plant that was being “revamped.” Th e refi nery com-
plex is currently undergoing a multi-year $1.9 billion
expansion and revamp. Th e expansion is intended to
increase production by 30,000 bpd next year. Th e fi re
is not expected to aff ect that expansion plan.
Th ere were approximately 2,500 people working
on the site at the time, the vast majority of whom
were contractors working on the revamp and the ex-
pansion. Huard reported they had accounted for all
the workers within the revamp area within 75 min-
utes.
Th e Co-op refi nery supplies a substantial por-
tion of the Prairie provinces’ diesel and gasoline
needs. As of Oct. 18, Huard said there would be a 20
per cent reduction of diesel production capacity until
May 2012. While gasoline production was initially
down 50 per cent for one week, they were able to get
it back up to 90 per cent of normal production.
Th e company is working on cross-purchase
agreements with other refi ners to fi ll in the gap.
To increase diesel production, the refi nery is
now using more light synthetic crude, but is process-
ing less heavy crude.
The Consumers’ Co-operative Re neries Ltd. complex in Regina suffered an explosion and re on Oct. 6. A total 36 people reported in-
juries, 13 of whom were treated at hospital, and of those, two remained in hospital for a signi cant time. This le photo was taken in August, 2010.
Explosion and re rock Regina Co-op re nery
Sask. rig count strong, down
slightlySaskatchewan’s drilling rig count remains
strong, but has slipped slightly in the early fall
compared to its sky-high summer numbers.
According to Nickle’s Rig Locator (www.ri-
glocator.ca) on Oct. 19, there were 96 drilling rigs
working in Saskatchewan, down from the 110
level seen for much of the previous three months.
It was still about a half dozen rigs more than what
was seen in 2010, and 30 more than the same time
in 2009.
Th e slight downward trend was in part due to
some substantial rain in southeast Saskatchewan.
One rig operator told Pipeline News the ground
has been so saturated from earlier in the year, it
didn’t take much to make it too wet to work, and
as a result they had some rigs down.
All told, Saskatchewan’s rig count has been
higher than 2010 numberd and substantially
higher than 2009 numbers for all the year except
for the period from mid-April to mid-June.
Diaz updates Lloydminster
wellsDiaz Resources Ltd. announced Sept. 28 that
its three recently drilled horizontal heavy oil wells
at Lloydminster, Alberta, had been on production
for 30 days and are averaging a combined rate of
200 bpd.
Th e new wells bring production from the Di-
az-operated pool to approximately 350 bpd.
Diaz has a 50 per cent working interest in the
Lloydminster pool and anticipates that addition-
al development drilling will begin in the fourth
quarter.
PIPELINE NEWS November 2011 A3
NewsNotes
Briefs courtesy Nickle’s Daily Oil Bulletin
Specialists in Internal & External Coating ApplicationsEpoxy Linings • Metalizing • Fiberglass • 100% Solids Epoxy
Pipe, Bends, Tanks & Vessels
“Industry Leading Quality and Service Since 1987”6150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A66150 - 76 Avenue, Edmonton, AB T6B 0A6
Phone: 780-440-2855 Fax: 780-440-1050Email: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.comEmail: [email protected] www.brotherscoating.com
By Geoff Lee Pipeline News
Lloydminster – Myshak Crane and Rigging
(MCR) proved to be Johnny-on-the-spot at the
scene of a collapsed Canadian Pacifi c rail overpass
on Highway 16 at the east end of Lloydminster on
Oct. 11.
Th e severed spur rail line serves the Lloydmin-
ster Husky Upgrader whose operations were not af-
fected as trains were re-routed to CP tracks east of
the accident location.
MCR, based in Edmonton, just happened to
have a 500-ton crane in town working at the ADM
canola processing plant where managers quickly
gave them the okay to respond to the transportation
emergency.
“I think it was a benefi cial thing that we were
in town,” said MCR crane supervisor Jason Tymo-
fi chuk.
“I heard on the radio that the mayor was happy.
A lot of people were shocked how quickly we got
that thing cleaned up.”
MCR teamed up with Mammoet who sent a
similar 500-ton crane to the scene from Edmonton
the next morning to help lift and load the girder
onto a fl atbed – all within 24 hours.
Th e steel overpass was struck by an overheight
excavator loaded on the back of an eastbound semi
the afternoon of Oct. 11, forcing a detour of all high-
way traffi c through the area.
“It’s worth noting this was an overheight load
being carried on the fl at deck truck,” said CP spokes-
person Mike Lovecchio from Vancouver.
“It was very simply a case of situational aware-
ness and a failure of situational awareness on the part
of the truck operator that led to this incident.”
Th e highway re-opened the evening of Oct. 12
with thanks from Lloydminster Mayor Jeff Mulli-
gan to MCR, ADM and emergency responders in a
message broadcasted that night.
“Fortunately, no one was seriously hurt in this
accident. And thanks to the dedicated work of many
talented and dedicated professionals, together with
help from ADM, who provided access to a crane
service that was working on-site on their project, we
were able to re-open the highway late tonight,” said
Mulligan.
Th e next morning, MCR crane supervisor Ja-
son Tymofi chuk told the Pipeline News he and crane
operator Tyson Seehagel got involved after hearing
about the accident on the radio while doing crane
work at the ADM plant in town. Page A6
MCR, Mammoet, adynamic duo in 911 job
A semi carrying an overheight backhoe struck the CP rail overpass on Highway 16 on Oct. 11 col-lapsing it onto the highway. Myshak Crane and Rigging (MCR) and Mammoet worked together to lift and remove the girder within 24 hours with the highway re-opening shortly thereafter. Cranes will be used again to reinstall the repaired girder in the coming weeks.
Tuscany Energy Ltd. announced Oct. 7 it had
placed a recently drilled Dina horizontal heavy oil
development well on production at Evesham, Sas-
katchewan, with an average fl ush production rate
of 110 (66 net) bpd.
Tuscany has a 60 per cent interest in this well
and is the operator.
Th e well was the fi rst to be drilled on the west
side of the pool, from a new production pad. Tus-
cany plans to drill two more wells from this pro-
duction pad in the fourth quarter.
At Macklin, Saskatchewan, Tuscany has
drilled a horizontal well into another Dina heavy
oil pool. Th e well was placed on production Sept.
18 at a fl ush production rate of 110 (60.5 net) bpd.
Tuscany has a 55 per cent working interest in the
well and is the operator. It plans to shoot addition-
al 3D seismic over the Macklin project to assist in
fi nalizing a development plan for 2012.
Th e company’s partner in the Macklin project,
Diaz Resources Ltd., holds the remaining 45 per
cent working interest.
Tuscany updates Evesha, Macklin drilling
Southern Paci cadds well pairs
At its STP-Senlac thermal project, Southern
Pacifi c Resources Corp. committed to its develop-
ment plan, which includes maintaining produc-
tion levels on an annual basis between 4,000 bpd
and 5,000 bpd. Over the past quarter, the property
achieved an average production rate of 4,829 bbls per
day, primarily a result of the recent addition of Phase
H, which consists of two SAGD well pairs placed on
production in April 2011.
As part of its development strategy, Southern
Pacifi c was now drilling in early October and pre-
paring Phase J for production. It consists of three
SAGD well pairs, which may not all be needed until
later in the fi scal year and will be layered into the
facility as capacity permits.
Southern Pacifi c recently completed a scheduled
bi-annual maintenance turnaround at STP-Senlac.
Th e turnaround took only nine days to complete
compared to the 14 days for which it had budgeted.
All the wells are now back on production.
Mission Statement:Pipeline News’ mission is to illuminate importance of Saskatchewan oil as an integral part of the province’s sense of community and to show the general public the strength and character of the industry’s people.
Pipeline NewsPublisher: Brant Kersey - Estevan
Ph: 1.306.634.2654
Fax: 1.306.634.3934
Editorial Contributions: SOUTHEAST
Brian Zinchuk - Estevan 1.306.461.5599
SOUTHWEST
Swift Current 1.306.461.5599
NORTHWEST
Geoff Lee - Lloydminster 1.780.875.6685
Associate Advertising Consultants:SOUTHEAST
• Estevan 1.306.634.2654
Cindy Beaulieu
Glenys Dorwart
Kristen O’Handley
Deanna Tarnes
Teresa Hrywkiw
SOUTHWEST
• Swift Current 1.306.773.8260
Doug Evjen
Stacey Powell
NORTHWEST
• Lloydminster Daniela Tobler 1.780.875.6685
MANITOBA
• Virden - Dianne Hanson 1.204.748.3931
• Estevan - Cindy Beaulieu 1.306.634.2654
CONTRIBUTORS
• Estevan - Nadine Elson
To submit a stories or ideas:
Pipelines News is always looking for stories or ideas
for stories from our readers. To contribute please
contact your local contributing reporter.
Subscribing to Pipeline News:
Pipeline News is a free distribution newspaper, but
is now available online at www.pipelinenews.ca
Advertising in Pipeline News:
Advertising in Pipeline News is a newer model cre-
ated to make it as easy as possible for any business
or individual. Pipeline News has a group of expe-
rienced staff working throughout Saskatchewan
and parts of Manitoba, so please contact the sales
representative for your area to assist you with your
advertising needs.
Special thanks to JuneWarren-Nickle’s Energy Groupfor their contributions and assistance with Pipeline News.
Published monthly by the Prairie Newspaper Group,
a division of Glacier Ventures International Corporation,
Central Offi ce, Estevan, Saskatchewan.
Advertising rates are available upon request and are sub-
ject to change without notice.
Conditions of editorial and advertising content: Pipe-
line News attempts to be accurate, however, no guarantee
is given or implied. Pipeline News reserves the right to re-
vise or reject any or all editorial and advertising content as
the newspapers’ principles see fi t. Pipeline News will not
be responsible for more than one incorrect insertion of an
advertisement, and is not responsible for errors in adver-
tisements except for the space occupied by such errors.
Pipeline News will not be responsible for manuscripts,
photographs, negatives and other material that may be sub-
mitted for possible publication.
All of Pipeline News content is protected by Canadian
Copyright laws. Reviews and similar mention of material
in this newspaper is granted on the provision that Pipeline
News receives credit. Otherwise, any reproduction with-
out permission of the publisher is prohibited. Advertisers
purchase space and circulation only. Rights to the adver-
tisement produced by Pipeline News, including artwork,
typography, and photos, etc., remain property of this news-
paper. Advertisements or parts thereof may be not repro-
duced or assigned without the consent of the publisher.
Th e Glacier group of companies collects personal infor-
mation from our customers in the normal course of busi-
ness transactions. We use that information to provide you
with our products and services you request. On occasion
we may contact you for purposes of research, surveys and
other such matters. To provide you with better service we
may share your information with our sister companies and
also outside, selected third parties who perform work for
us as suppliers, agents, service providers and information
gatherers.
A4 PIPELINE NEWS November 2011 EDITORIAL
Editorial
One way or another, it is highly likely Saskatch-
ewan will have a sovereign wealth fund by this time four
years from now.
Last month Pipeline News spoke to each of the
three mainstream party leaders – the NDP’s Dwain
Lingenfelter, Liberals’ Ryan Bater, and Saskatchewan
Party’s Brad Wall. In some manner or another, all sup-
port the creation of a sovereign wealth fund.
Lingenfelter spoke at length about his plan, one of
the key planks in the NDP’s policy platform. He thinks
a small amount of non-renewable resources revenue,
$100 million a year, should start going into a sovereign
wealth fund like Norway’s, the most successful fund of
its kind in the world. Debt repayment is key, but repay-
ment and savings could happen at the same time.
Bater pointed out that his fi rst speech as party
leader in 2008 declared support for such a fund. He’s
toying with the idea of half of those non-renewable
resource revenues going to the fund. But we must pay
down the debt fi rst, he said.
Wall’s support is more begrudging, likely because
it would be unwise for him politically to give too much
credence to the major policy point of his opponent. In-
deed, his response to the question of does Saskatchewan
need such a fund was quite brief, stating, “Th e idea is
one I’ve talked about some time ago. We even talked
about it in opposition. It’s a good idea for an economy
that has a lot of resource wealth. But we have to pay off
the debt fi rst.”
Here’s where the if ’s come in. If Bater or Lingen-
felter were to be elected, a sovereign wealth fund is
a sure thing. Th ere is no hope of Bater forming gov-
ernment, indeed, the Liberals will have a tough time
getting one or two seats. Lingenfelter is so far behind
Sovereign wealth fund is coming
in the polls, he’ll have a heck of a time maintaining the
seats he has, never mind causing an upset.
So will Wall do it? His attention seems to be almost
single-minded on paying down the debt, which is prob-
ably the smartest course of action. If we can survive
what is looking like a double-dip recession relatively
unscathed, and if we can pay off the $3 or so billion
remaining of provincial, non-Crown corporation debt
over the next four years, then we just may see such a
fund in place.
Wall argues that we essentially have a fund already
in place, the so-called rainy day fund, which was drawn
upon to deal with non-budgeted items like the fl oods of
2011, when it was indeed raining. However, the struc-
ture of the fund diff ers quite a bit from what Lingen-
felter subscribes to.
Th e Norwegian fund is interesting in that its invest-
ments are entirely outside of Norway, due to the infl a-
tionary nature of adding billions of dollars to the Nor-
wegian economy. Should Saskatchewan structure such
a fund to keep it from becoming a political football, i.e.
keeping the fund from investing in Saskatchewan proj-
ects that are questionable or political in nature? (Alberta
is the prime example here.) Lingenfelter seems to think
so, saying it should be apolitical. While he wouldn’t en-
tirely rule out Saskatchewan investment, he thinks that
should be left up to fund managers, not politicians.
Any way you look at it, a sovereign wealth fund for
Saskatchewan is an idea whose time has come. It’s really
hard to argue against saving for the future.
So yes, let’s pay down the debt. But after that’s done,
Saskatchewan should form its own sovereign wealth
fund, modelled on Norway’s success. It’s too good an
idea to ignore.
OpinionPIPELINE NEWS November 2011 A5
PIPELINE NEWS INVITES OPPOSING VIEW POINTS. EDITORIALS AND LETTERS TO THE EDITOR ARE WELCOME.
Email to: [email protected]
Brian Zinchuk
From the top of
the pile
Geoff Lee
Lee Side of Lloyd
It’s potpourri time again, so please enjoy the
mixed bag of subjects for commentary beginning
with the 18th Technical Heavy Oil Symposium held
in Lloydminster in September.
Symposium steeped in innovation talkMany of this year’s presentations served to make
the point that the heavy oil industry is driven by in-
novation and technology developed in Lloydminster
and other heavy oil centres in Western Canada.
A case in point is a new product by Noralta
Technologies Inc. called the nGauge that will allow
operators to accurately monitor and measure all of
the fl uid interfaces in a production tank or process
vessel with bottom line savings in fl uid hauling be-
ing just one benefi t.
Th e product is not on the market yet, but there
was no better place to introduce its near readiness
than to potential clients at the symposium.
Another innovative topic by Weatherford fo-
cused on the skyrocketing demand for steam injec-
tion control devices that distribute steam evenly in a
steam assisted gravity drainage (SAGD) reservoir.
Th e new devices allow for improved steam-oil
ratios and smaller carbon footprints from thermal
projects.
Other presentations by Champion Technologies
and Trican Well Service focused on new chemical
solutions to stimulating oil production from dam-
aged or underperforming wells.
All of the topics and speakers fi t into the innova-
tive and technical mould the symposium is intended
to address, so from that perspective the event was a
success.
Fracking on the front burnerTh e Canadian Association of Petroleum Pro-
ducers’ (CAPP) new guidelines for the hydraulic
fracturing of shale gas by are well timed given the
growing public debate and concern for fracking fl u-
ids on water quality and the environment.
When it comes to fresh supplies of drinking wa-
ter, there can be no compromises for human health
or the environment.
Quebec halted its fl edgling shale-gas industry
earlier this year following recommendations in an
environmental-assessment report that advised the
province to conduct more studies on the ecological
risks.
In August, Southwestern Resources Canada put
all seismic testing in New Brunswick on hold due to
ongoing protests over shale gas development where
fracking is used.
Fracking involves injecting a mixture of chemi-
cals, water and sand into the ground to help release
gas and oil.
CAPP’s new guidelines announced Sept. 10 in-
clude improved water and fl uids reporting practices
that apply to all CAPP natural gas producing mem-
bers operating in Canada.
CAPP president Dave Collyer said that protect-
ing Canada’s water resources is fundamental to the
industry’s social licence to operate and to grow.
He also said with the increase in natural gas pro-
duction from unconventional sources such as shale,
Canadians have told the industry they want more
information as to how industry uses and protects
water.
Th e CAPP principles address those concerns.
Th ey also articulate industry’s water management
objectives and water protection practices. CAPP
members will focus eff orts to improve water perfor-
mance by industry over time.
Th e new guidelines commit CAPP members to
support the disclosure of fracturing fl uid additives.
CAPP will also continue to advance, collaborate
on and communicate technologies and best practices
that reduce the potential environmental risks of hy-
draulic fracturing.
Th e guidelines include a commitment to safe-
guard the quality and quantity of regional surface
and groundwater resources, through sound wellbore
construction practices, sourcing fresh water alterna-
tives where appropriate, and recycling water for re-
use as much as practical.
Another guideline calls for CAPP to measure
and disclose water use with the goal of continuing to
reduce our eff ect on the environment.
CAPP also pledges to support the development
of fracturing fl uid additives with the least environ-
mental risks.
Th e guidelines show that the upstream industry
listens and respond to its critics along with a convic-
tion to promote its strong track record as a safe and
reliable producer of natural gas.
Two for one from Lee Side columnist
Th is month Pipeline News is focusing on cranes
and pickers. In preparing my list of possible stories,
one quickly rose to the top of the list.
By far, the most cranes in the province can be
found at the Regina Consumers Co-op Refi nery
Complex. I had been there a year ago, and lost count
of how many cranes there were on site. It was an
awful lot, working on an approximately $1.9 billion
revamp and expansion to the facility.
So on Oct. 3 I left a message for the facility
manager, and followed up with an e-mail. Not hear-
ing back, the next day I called. While he liked the
last piece I did, they were terribly busy, and simply
wouldn’t have time to have me come down right now.
Maybe a few months down the road, he off ered.
My initial plan had been to go to Regina on
Th ursday, Oct. 6. My wife was taking our son in for a
dental appointment, so it would have been a perfect
opportunity to kill two birds with one stone. My re-
quest was to do a brief interview with the manager,
followed by a tour of the cranes at work, and possibly
a short interview with the crane foreman. If it all had
gone according to plan, I would have done the initial
interview at 1 p.m., and been on the site, taking pic-
tures, around 2 p.m.
At about 2 p.m., a fi reball arose from one of the
older parts of the refi nery, followed by a fi re. Th ir-
teen people were treated medically. A subsequent 23
people reported injuries, but did not require medical
attention. Burns were the primary consideration.
If my best laid plans had gone forward, I would
have been within about a few hundred metres of the
explosion, maybe closer.
In my previous stories about the refi nery, one
thing that was impressed upon me was their strong
focus on safety. Indeed, we had talked about doing
a follow-on story about their safety program in the
spring of 2011, but I never followed up on it.
Now some may say, “Brian, they just had an ex-
plosion and fi re, and 36 people were injured. How
can you call that safe?”
Consider this: Including permanent staff and
contractors, there were just under 2,500 people on
site. A little over an hour after the explosion, I lis-
tened to the live news conference on CJME. By that
point, the fi re was under control, and all permanent
and contractor staff in the aff ected area were ac-
counted for. In just 75 minutes.
It’s hard enough to count heads with school kids
on a fi eld day, never mind account for thousands of
people on a site that covers the better part of a sec-
tion of land.
News video of the workers showed them gath-
ered in groups, mustered as expected. Every person I
saw on the TV had fl ame retardant coveralls.
It is precisely for this reason – a fl ash fi re – that
workers are required to wear such coveralls. You
can’t fi ght a fi re with them, but they can give you a
fi ghting chance in a situation like what happened. I
expect they would have made a diff erence for those
who were injured.
Th e company’s emergency responders were able
to put out the fi re without the assistance of Regina
Fire and Protective Services. City fi refi ghters were
staged, but not required in the end.
Th e area where the explosion took place was
part of the “revamp” project, and was an older area
of the plant. Th e initial indications were that a pipe
had leaked a mixture of diesel and hydrogen, and it
found an ignition source. Was that pipe part of the
planned revamp? Quite possibly. We don’t know. But
it might have been scheduled for maintenance, repair
or replacement in the coming months, as the project
reached its fi nal phases. It may simply have been a
situation of they were getting to it, but apparently
not quick enough.
For those who were injured, this incident will
be life altering, painful, and hard. But in the grand
scheme of things, it could have been much, much
worse. Th ere are dozens of massive storage tanks in
the vicinity. Th ousands of workers were on site. Th e
whole refi nery could have gone up.
Absolutely, something went terribly wrong. But
in the response, it appears, at least to this outsider, a
lot went right.
Brian Zinchuk is editor of Pipeline News. He can be reached at [email protected]
The close call that wasn’t
A6 PIPELINE NEWS November 2011
• 101 guests rooms • Meeting room facilities • Ample parking • Rusty’s Canadian Grille & Lounge • FREE high speed internet
For reservations call 1-888-700-2264 or visit www.bestcdn.com
Page A3“I’ve been in the industry for 15 years now. I kind
of fi gured we should go look at it,” he said. “So we
got there and knew they were going to need a crane
in order to do what they needed to do.
“We just happened to have a 500-ton crane.”
Th at crane is an all-terrain Liebherr LTM 1400
with a 197 foot main boom that has done previous
work in Lloydminster at the Husky upgrader, but
dealing with a collapsed rail girder is not routine.
“Th ese situations are always diff erent,” said Ty-
mofi chuk. “You never know what you are getting.
“Originally, I was told the bridge only weighed
60 tons, but after we hoisted on our loads, yesterday,
we lifted to 144,000 pounds which was already more
than what they said.
“Later, they told me it could weigh up to 100
tons, so I said ‘that’s quite a substantial diff erence
from the 60 tons.’
“When they couldn’t actually give me an actual
weight, I thought ‘I am not going to take the chance
of using one crane and having it too heavy.’
Page A7
Two 500-ton cranes lift bridge off semi
Above: MCR crane operator Tyson Seehagel, uti-lizing a 500-ton crane tested, the hoist weight of this collapsed CP rail girder at 144,000 pounds. After learning the girder could weigh up to 100 tons, the company called in Mammoet in Edmon-ton who sent their 500-ton crane to the scene the next morning. The two cranes worked together to lift and lower the wreckage within 24 hours. Both cranes needed 220,000 pounds of counter-weight.
MCR crane supervisor Jason Tymo chuk, left, gets briefed by a CP representative at the scene of a collapsed CP rail overpass in Lloydminster. MCR happened to have a 500-ton crane working at the ADM canola processing plant in town and got permission to respond the transportation emer-gency on Oct. 11.
PIPELINE NEWS November 2011 A7
www.exhaustmasters.ca
Complete Performance Exhaust for Gas, DPF and Diesel Vehicles Maximize Performance and Fuel Economy!
Specializing in Oilfield & Industrial ExhaustComponents and Systems
Specializing in Transport of Heavy and Oversized Equipment, Engineered Transport and Rigging Studies, SPMTs, Full Rail Services, Jacking Towers, Lift-N-Lock and Strand Jack Systems, State of the Art Rigging Equipment, Full Truckload and LTL Service - throughout North America. Hydraulic Cranes from 8 to 500 Ton Capacity, Crawler and Conventional Cranes
to 4000 Ton Capacity, Hydra-Slide Jacking and Skidding Systems, and Turnkey Transportation and Lifting Projects.
Mammoet strives to be the best full service provider, in the global market, for engineered lifting, and multi-modal transport
Worldwide specialists in heavy lifting and transport
www.mammoet.com
Over 80 Locations in over 40 Countries
WESTERN CANADA LOCATIONS
Bonnyville(780) 826-2253
Calgary(403) 252-0551
Edmonton(780) 449-0552
Fort McMurray(780) 791-5049
Pincher Creek(403) 627-4554
Vancouver, BC(778) 828-6516
Regina, SK(306) 523-4511
ALBERTA LOCATIONS
Page A6
“Your crane weighting is based on minimum
boom, right tight to you. Th e bigger radius you get
the less capacity you’re good for.”
Mammoet dispatched their own 500 ton LTM
1400 crane to the scene with MCR hoisting on end
of the fallen girder and Mammoet on the other to
get the job done safely.
“It’s not diffi cult to co-ordinate two cranes
working together,” said Tymofi chuk. “We picked it
up and swung it out of the way, clear of the hole.”
When the crushed semi with the excavator was
towed away, the two cranes got back to work and
swung the girder off to the far side of the road, set it
down then loaded it onto a truck.
Tymofi chuk said the job was a challenge, “be-
cause of the fact you don’t know what your factors
are – your weight and stuff ” including the tipping
angle.
“We were both running with 220,000 pounds of
counterweight.”
Lovecchio reports the bridge span was trans-
ported off site to the Edmonton area where will be
repaired and returned, but that date is yet to be de-
termined.
“Th e highway will have to be closed again so the
span can be reinstalled,” he said, noting CP owns the
bridge and the concrete piers.
“Th e full structure will be inspected prior to be-
ing brought back into service,” he added.
Tymofi chuk says the job was good PR for his
company and he hopes to come back and do the re-
installation crane work.
“Th at’s depending on how well they liked the
job we did. Th at’s all we can hope for. One or two
cranes will be used to put it back,” he said.
“Th ey say in two to three weeks it should be
ready to put back up. We should be able to do it our-
selves without Mammoet.
“We do have other cranes that can do what they
were doing too, and we get can a lot closer to the
bridge now that the hoe and everything is out of
there.”
Tymofi chuk says the MCR crane is equipped
with audible alarms when the lifting capacity is
reached, but he calls them more of an aid than a fail-
safe device.
“Th e number one thing that you deal with all
the time is your load charts. Th ey are printed off on
paper,” he said.
“Th e closer you get, the more lifting power you
have. Th e more boom that you sweep out, your charts
decrease as well because there is that much more
length.
“Th ere are certain attachments you can put on
this crane. We have a device called a super lift which
is a boom stiff ener, which increases your charts as
well.”
Th e LTM 1400 is one of the largest cranes in the
MCR fl eet that includes carry deck cranes, crawler
cranes, rough terrain hydraulic cranes and a variety
of picker trucks.
MCR also operates full crane services in Fort
McMurray, Red Deer and their newest location in
Bonnyville.
More power the closer you get
A8 PIPELINE NEWS November 2011
Monday to Friday
7:00 AM - 5:00 PM
4403 - 37th Ave.
Lloydminster, SK
(306) 825-2875
www.gforcediesel.com
M d F id h A
20 Service Bays
ALSO G FORCE DIESEL ESTEVAN!Best Performing
Pumps , Hoses & Accessories! T&E Pump Sales & Repair
306-636-5050221 - 4th Street
N!N!
!
O
m
ALSOALSO
PuPP m
LARGEST CANADIAN PDI CANADIAN PDI
DISTRIBUTORDISTRIBUTOR
LLLAAARRRGGG SSSLARGGESSTLLLAAARRRGGGEEESSSTT
Cat, Cummins & Detroit
DPF, EGR or VGTDPF, EGR or VGTSPECIALISTSSPECIALISTS
G Force Diesel Service Ltd.G Force Diesel Service Ltd.
Off road DPF, EGR
or VGT delete kits
available for your semi
By Geoff LeeEdmonton – Mammoet is no stranger to Lloydminster where the heavy lift-
ing and transport company regularly deploys a fl eet of carry decks, crawlers and
mobile cranes for Husky contract turnarounds and construction projects.
Th e international company gained public recognition and praise from of-
fi cials for its emergency work when they lifted and cleared a collapsed Canadian
Pacifi c overpass girder on Highway 16 in Lloydminster.
Th e company responded to the scene with a huge 500-ton LTM 1400 mo-
bile hydraulic crane.
Mammoet co-ordinated the 911 job with a similar LTM 1400 crane from
Myshak Crane & Rigging in Edmonton to help re-open the highway 24 hours
after a semi truck with an over height excavator struck and collapsed the bridge
on Oct. 11.
Th e crane work prompted a tour of Mammoet’s Western Canadian base in
Edmonton where Rick Patterson, director of hydraulic cranes, explained why
Rick Patterson, director of hydraulic cranes guided a tour of Mammoet’s base of operations in Edmonton where this massive 500-ton LTM mobile hydraulic crane was sent to Lloydminster to assist with an emergency lift of a collapsed CP overpass girder weighing up to 100 tons. Based on its lifting capacity, the LTM was the right crane for the job.
Mammoet responds to overpass collapse
the LTM 1400 was the right crane for that job.
“It’s got a great lifting capacity at a short radius,” he said, referring to the
LTM that was parked at the Mammoet complex with other cranes.
“Th at was part of the reason why it was chosen for that job.”
Th e LTM 1400 has a main boom of 197 feet and can be jibbed out to a reach
of 276 feet.
As for the challenge of co-ordinating the lift of the fallen CP steel girder
that weighed up to 100 tons, Patterson said good communication makes jobs
like that go off without a hitch.
“We were very successful working with the Myshak crane,” said Patterson,
who noted the lift was a big job for Mammoet.
“We do some emergency work with various rail companies when they have
train derailments. It’s a common type of work that we would do.”
Mammoet’s global lift and transport activities focus on the petrochemical
industry, civil engineering projects, power generation projects and off shore and
marine projects and include emergency situations.
Patterson says cranes are dispatched to job sites and emergencies from
whichever branch has equipment available including their growing crane and
transport operations in Regina and Saskatoon.
Mammoet’s transport fl eet in Saskatchewan includes everything from con-
ventional trailers right up to monster hydraulic platform trailers capable of car-
rying loads up to 100 feet long, 24 feet wide, and 20 feet high, weighing up to
200 tons.
“We transport just about anything oil and gas related – mining equipment,
oil and gas vessels, modules and any facility and plant pieces – pretty much any-
thing that will fi t on the trailer,” said Doug McCaskill, director of operations,
transport division.
“Length and dimensionally, we can pretty much move anything. Our trans-
port division covers everything from a small silo up to a big module.”
One of those monster 24 line hydraulic platform trailers is based at the
Edmonton yard where it is ready for duty hauling massive loads on public road-
ways.
“Its capacity depends on the area and the road confi guration,” said McCa-
skill.
“It’s typically used for hauling modular pieces for production plants and gas
plants and any large vessel that’s properly fi t on it.” Page A9
PIPELINE NEWS November 2011 A9
PICKER & OILFIELD HAULING SERVICE
• Boom & Knuckle Pickers• Boom & Knuckle Pickers•15-50 Ton/165’ Reach•15-50 Ton/165’ Reach
• Winch Tractor c/w Lo-Boys• Winch Tractor c/w Lo-Boys• Tandem & Tri-axle Trailers• Tandem & Tri-axle Trailers
• Tank Cradles c/w Hydraulic Arm• Tank Cradles c/w Hydraulic Arm• Pilot Trucks• Pilot Trucks
• Double Man Basket• Double Man Basket• ISN & Comply Works Member• ISN & Comply Works Member
• COR/IRP Certified• COR/IRP Certified
Lloydminster, SK/AB • Ph: 780-875-9250 • Fax: 780-875-4148
Proudly serving Lloydminster Area for over 20 Years
Mammoet has an array of mobile hydraulic cranes from 55 to 500 tons mobilized from its base of operations in Edmonton. In the background are the booms of 40, 60 and 80-ton rough terrain cranes.
Page A8Mammoet also manages a lot of heavy lifts and transport work from its
other Alberta bases in Calgary and Fort McMurray. McCaskill said the business
is picking up on all fronts.
“It’s very busy right now. Mammoet is progressively busy,” said McCaskill.
“We are roving billboards with all of the equipment we have. Obviously, we
are proud of our name because it’s all over everything in big white letters.”
McCaskill said when it comes to transporting huge loads on public high-
ways the job is neither easier nor harder in Saskatchewan than it is in Alberta.
“Every province has unique infrastructure challenges. Th e population den-
sity is one thing, but in this line of work you are careful no matter where you
are,” he said.
“Th ere are always restrictions and cautions to be taken. Saskatchewan has
challenges just like Alberta.”
Mammoet is also trying to keep pace with the demands for its lifting and
transport services in Saskatchewan with its strong mining, oil and gas, and pow-
er economy.
“We are fi nding that the workload is increasing year after year,” said Pat-
terson. “We are fi nding our branches in Regina and Saskatoon are getting an
increased market share every year.
“Oil and gas and mining are the drivers and some wind energy in southern
Saskatchewan. We are constantly going in and out of Saskatchewan and sup-
porting our group there.”
Th e largest cranes like the 500-ton LTM 1400 used to lift the collapsed
CP bridge in Lloydminster are mobilized from Edmonton, Calgary and Fort
McMurray.
At its Saskatchewan crane and transport operations, Mammoet uses smaller
cranes up to 200 tons for the local commercial, potash and oil and gas markets.
“Th ey would hoist compressor fl are stacks, components, coolers and boilers
that type of equipment. We also participate in turnarounds,” said Patterson.
“We work with Husky on a regular basis. We use similar cranes to the LTM
1400 and also cranes ranging from 9 ton carry decks up to 400-ton crawlers.”
Heavy lifter knows how to move mountains of metal
Mammoet is busy throughout Alberta too, with a wealth of construction
and oil and gas projects demanding their lifting and transport expertise and
services.
“We have been very fortunate,” said Patterson. “We’ve been relatively busy
throughout the downturn here. We see good things coming in the future. We are
involved in various projects all over Alberta. It defi nitely keeps us busy.
“We’ve got a strong presence in Fort McMurray with the various owners
up there with maintenance and new construction. We do a lot of heavy lifts and
transport in the Fort McMurray region.”
A10 PIPELINE NEWS November 2011
Millennium Oilflow Systems & Technology (MOST) is a manufacturing company making products for the oil field, specifically for production
of heavy oil by the artificial lift system (PCP application).
Products manufactured and sold are made to ISO 9001-2000, API and CSA standards.
Main Offi ce:4636 Eleniak RoadEdmonton, Alberta
Canada T6B 2S1TEL: 780.468.1058Fax: 780.468.9165
Lloydminster Offi ce:5103 62 Street
Lloydminster West, AlbertaCanada T9V 2B3
CELL: 780.808.0950CELL: 780.808.9852
We Are Environmentally FriendlyMOST products are some of the most environmentally friendly
solutions in the oil field services industry.
OUR POLICYTo manufacture precision, quality products that meets or exceeds industry standards and customer requirements while continually
striving for improvement.
Broker
Cell: (306) 460-7628Bus: (306) 463-1766 Fax: (306) 463-6631
[email protected]/kindersley
1 West Road, Kindersley, SK S0L 1S1
independently owned & operated
By Geoff LeeLloydminster – By practicing the golden rule in
business, Bry-Tan Trucking Ltd. has become a pick-
er and oilfi eld hauler of choice for many customers
in the Lloydminster area.
“We’ve got a lot of customers throughout the
years, and hopefully we treat them pretty good,” said
Bryan McGonigle, president.
“We treat them good, and hopefully they treat
us good too and keep on calling us back. I would
says about 95 per cent of our business is repeat busi-
ness.”
Bry-Tan’s work is performed with a core fl eet
of four stiff boom cranes, six knuckle pickers, three
winch trucks, and a highway tractor.
Th ey also have an assortment of low-boys, hi-
boys, tank cradles, pilot trucks, man baskets and re-
lated equipment ready to roll out of their four-acre
yard.
Bry-Tan counts contractors, equipment rental
Golden rule keeps Bry-Tan on a rollcompanies and utility operators among its loyal base
of customers requesting a variety of picker and haul-
ing services.
“We actually have one truck that works for
ATCO Electric,” said McGonigle. “It works for
them just about every day. Th ey are hauling poles
and transformers.
“Th e other ones are doing anything that’s related
to the oilfi eld. We haul everything from tubing and
rods to tanks.
“We’ve got fi ve tank cradles, so we do hauling of
tanks. We do a lot of spotting of tanks with the big-
ger pickers,” he said.
Bry-Tan also hauls and installs equipment such
as fi re tubes for Husky Energy and Canadian Natural
Resources during their spring battery turnarounds.
Th ey also handle day-to-day hauling of com-
pressors and buildings for new oilfi eld plants and
facilities in the area for a variety of clients.
“We’ve got diff erent types of trailers. We’ve got
hi-boys, low-boys, drop decks, and scissor necks,”
said McGonigle.
“We also haul equipment such as trackhoes and
loaders, and we haul a lot of rental equipment for
various companies.
Page A11
Bryan McGonigle, president of Bry-Tan Truck-ing, hangs onto the door railing of this 20-ton Manitex truck mounted stiff boom crane. The company has four Manitex stiff booms ranging from 20 to 50 tons.
PIPELINE NEWS November 2011 A11
Volvo Construction Equipment
dependable used parts from Strongco. Let’s Work.
1640 Enterprise RoadMississauga, ON L4W 4L4(905) 670-5100www.strongco.com
ALBERTACalgary (800) 342-6523
Edmonton (800) 252-9398
Grande Prairie (888) 513-9919
Red Deer (866) 950-3473
ATLANTICDartmouth (800) 565-1916
Moncton (800) 332-3338
Newfoundland (709) 747-4026
ONTARIOGrimsby (800) 668-9575
Kitchener (800) 265-2488
London (Lambeth) (800) 265-4762
Mississauga (800) 268-7004
Orillia (800) 268-7004
Ottawa (Stittsville) (800) 822-3308
Sudbury (Lively) (800) 267-9833
Thunder Bay (800) 465-5080
QUEBECBaie-Comeau (866) 996-3091
Boucherville (877) 674-8380
Chicoutimi (800) 323-1724
Laval (800) 363-6789
Ste-Foy (800) 463-2662
Val-d’Or (800) 561-4192
Strongco offers Used Parts and Rebuilt Components. Dependable solutions to help our Volvo and Champion Motor Grader customers continue to make the grade every day.
Tremendous Value Trusted Reliability• The same great quality and service that you • Carefully selected and thoroughly inspected have come to expect – but at a lower price. by Strongco service technicians.• Saves you money on repair costs. • 30-day used parts warranty.
Extended Machine Life What You Need, Now• Renewed strength, functionality and efficiency. • Fast access to a wide variety of used parts. • One of Canada’s largest used parts inventories for Champion Motor Graders.
We’re continuing to do our part to help you. Visit your nearest Strongco branch parts counter to speak to one of our specialists. Search our inventory online at www.tractor-part.com and at www.machinerytrader.com
Page A10“We do quite a bit on the residential side. We
do quite a few roof rafters and air conditioning
units and stuff like that. We have quite a bit of vari-
ance in the jobs that we do.”
Bry-Tan’s six knuckle-boom pickers have a lift-
ing capacity ranging from 18 to 42 tons. Th ey are
equipped with Palfi nger cranes that are operated by
remote control.
“We can get into a lot of buildings with them,”
said McGonigle.
“Th ey are basically good for a lot of diff erent
things. We haul a lot of pipe with them and build-
ings and stuff like that.
“Th e nice thing about the knuckle pickers is
that they are pretty easy to operate.”
All knuckle pickers are made overseas, but
Palfi nger has a distribution centre in Niagara Falls,
Ontario, when Bry-Tan can order parts over night.
“Th e biggest thing is parts availability. We don’t
put things together to sit on the front lawn to col-
lect dust,” said McGonigle.
“We want them out there working. You have to
be able to supply parts in order to get them opera-
tional. Everything breaks down.”
Bry-Tan’s four stiff boom pickers have lifting
capacities ranging from 20 to 50 tons with Mani-
tex cranes that can reach longer and higher than a
knuckle-boom.
“In various situations, the boom pickers are as
eff ective as the knuckle pickers are,” said McGoni-
gle.
“For a lot of people, it’s just a preference of
what they want to do.”
Th e 20 ton Manitex has about 68 feet of reach,
while the 30 ton has 156 feet of reach with a jib.
Th e 42 ton and the 50 ton can extend to 97 feet
and jibbed to 154 feet.
“Th ey are ideal for tank moving. Th at’s basically
what the two bigger ones are used for – hauling
tanks and setting tanks,” said McGonigle.
While 2011 has been one of Bry-Tan’s busiest
years, McGonigle says they were just as busy, if not
busier, that fi rst time oil hit $70 a barrel.
“When oil was at $140 we weren’t as busy as
when oil was at $70,” he said in reference to there
being a shortage of service workers in the oilfi eld.
“It was very hard to fi nd people to work. I don’t
know where everyone went to, but people kind of
vanished and it was hard to fi nd good employees.
“You can have all the equipment in the world,
Boom or knuckle-picker?
but if you don’t have good people to operate it, you
don’t have very much.”
Generating repeat business has been the driv-
ing philosophy behind the success of Bry-Tan since
McGonigle started the company in 1989 with a
truck and two employees.
“I started with Roy’s Trucking as a lease opera-
tor, and then I went on my own and we just kind of
grew from there,” he said.
“We have had a lot of people over the years that
we have worked for that I have been involved with
at some point in time,” said McGonigle.
“It’s not only the people that I’ve been involved
with, but the people that some of my guys have
been involved with. Page A12
There is never a dull moment for Bry-Tan Trucking, a company that gets the call each year to move this oatplane from the Lloydminster hangar to Sandy Beach, north of the city. The plane is lifted onto this lo-boy with the aid of a truck mount knuckle-boom Pal nger crane.
Photo submitted
A12 PIPELINE NEWS November 2011
would like to Welcome their new Dental TherapistLloydminster Paint& Supplies Ltd.
Daryl (780) 875-4454 or(780) 871-41095628 - 44 Street, Lloydminster, AB
ATV / SLED DECKS
Adjustable width decks also available
Re-usable and High Resale Value
• Our customers testify that we
have the best looking deck on the
market - and it is built to last
• If a customer decides to
purchase a different pickup the
deck can accommodate either
Short & Long Box trucks
• Easy to load & unload
• Reversible ramp for your
snowmobile & quad
• High quality brushed aluminum
requires no maintenance
• Rounded headache rack
• 4 side LED lamps
• Super Clamps Included
• Strongest (and longest) ramp
system on the market
v
NEW Shop Location 6303 63rd Ave (north of Kenworth)
Kevin - 780-871-8931Kevin - 780-871-8931Tyler - 780-872-3885Tyler - 780-872-3885
24 Hour Service 780-872-322524 Hour Service 780-872-3225
All RepairsAll Repairs• 1 ton to Class 1 to Service Rigs
• Safety Certified CVIP• Safety Certified CVIP• Preventative maintenance• Preventative maintenance
• Air Conditioning• Air Conditioning
3 Mobile Units3 Mobile UnitsAuthorized Repair Facility
••
Page A11“Some of my guys have worked with me for quite some time, so they bring
a lot of business into the realm of Bry-Tan Trucking.”
McGonigle’s right hand man is manager Mike Savoy who handles the dis-
patch and co-ordinates crews and equipment.
“Mike has been with me for approximately 12 years. He has run a lot of the
equipment. He ran a 17-ton and then he went to a 30-ton and a 42-ton,” said
McGonigle.
“Th ere is probably nobody who is more dedicated to what we do than Mike
is. He is very responsible and a good person to work with.”
Bry-Tan has grown to more than 30 employees today with McGonigle’s
wife Patrice managing the administration and the couple’s three sons Tanner,
Brayden and Riley working in operations.
Asked to recall a memorable business moment, McGonigle chose the day
they were called upon to pick a spray plane that crash-landed into a slough.
“We had to take that spray plane out of the slough and actually turn it in mid
air,” he said. “Th e plane wasn’t damaged hardly at all.
“It was pretty challenging to do that kind of thing with two pickers because
the plane was upside down. When we lifted it out of the water, we had to turn it
upright to put it back on its wheel.
“Th ere have been a few jobs throughout the years that have been pretty chal-
lenging.”
For McGonigle, every job Bry-Tan does is another opportunity to gain an-
other repeat customer.
“If you do a good job and people appreciate you, you usually go back again.
My theory is good news takes a long time to get around and bad new gets around
pretty fast.
“You don’t want the bad news to get around at all, but it’s the stuff that trav-
els the fastest,” McGonigle said.
Long-term workers bring in business
Bry-Tan Trucking, a picker and oil eld hauling service company, is owned and operated by Bryan McGonigle and his wife Patrice who have built their business based on satis ed repeat customers. Their three sons also work for the company in operations.
Bry-Tan Trucking has six truck mounted knuckle-boom cranes built by Pal nger including one 18-ton, two 22-ton, two 30-ton and one 42-ton crane for a variety of oil eld and related lifting and hauling work.
PIPELINE NEWS November 2011 A13
Meadow Lake – Th e
Meadow Lake Trib-
al Council (MLTC),
through its Resource
Developments Inc. busi-
ness entity, will develop
a 36 megawatt renew-
able power generation
facility at its 100 per
cent owned NorSask
sawmill.
Resource Develop-
ments will redirect the
mill’s fi bre waste prod-
ucts from a beehive
burner to a state-of-the-
art power generation
plant adjacent to the
mill to produce electri-
cal power for sale to the
province.
SaskPower and
MLTC signed a let-
ter of intent on Oct. 3
and are now working
on mutually agreeable
terms for the 25-year
power purchase agree-
ment, which is expected
to be completed by the
end of 2011.
Th e construction of
the biomass Meadow
Lake Bioenergy Cen-
tre next to the NorSask
mill will also generate
about 300 jobs includ-
ing 25 permanent jobs
at the facility.
Biomass is an in-
dustry term for using
renewable organic ma-
terial to generate en-
ergy.
Th e project is the
fi rst power development
project initiated by the
newly formed First Na-
tions Power Authority
in partnership with the
government of Sas-
katchewan and Sask-
Power.
“Th is is the fi rst
project to come about
through the support of
FNPA, which refl ects
the vision of the govern-
ment of Saskatchewan
to actively engage First
Nations in the prov-
ince’s growing econo-
my,” said Rob Norris,
minister responsible for
SaskPower.
“Th e project will
have a direct and posi-
tive impact on the local
community and sur-
rounding area, while
adding greener and
cleaner energy to Sas-
katchewan’s power
grid.”
Th e renewable pow-
er project is scheduled
to be in service in early
2014.
“Th e Meadow Lake
Bioenergy Centre is a
very signifi cant mile-
stone for the business
development vision of
Meadow Lake Tribal
Council,” said Chief
Eric Sylvestre.
Th ere are nine bands
in the MLTC including
fi ve Cree and four Dene
First Nations.
“We are excited
about the economic op-
portunities this project
will provide for our part-
nerships and our com-
munities, and it builds
upon more than 20
years of successful busi-
ness management. We
are proud to be leading
a major project in part-
nership with FNPA and
SaskPower.”
FNPA is a non-
profi t, membership-
based corporation
formed last spring to
set out a partnership
framework for a more
streamlined process to
help First Nations move
their generation projects
forward.
Each of the 74 Sas-
katchewan First Na-
tions is eligible to hold
membership.
“Congratulations to
MLTC on their hard
work and dedication to
make this project a real-
ity,” said FNPA execu-
tive director Jason Pol-
lock.
“Th eir vision and
leadership has not only
resulted in a much
needed renewable power
project for the province
of Saskatchewan, but
also the creation of this
organization (FNPA)
which will serve to as-
sist many other First
Nations in becoming
involved in the power
generation industry.
“SaskPower is to be
equally commended for
their commitment to
working with First Na-
tions, as demonstrated
by MLBC and their on-
going commitment to
the establishment of the
FNPA,” Pollock said.
First Nations togenerate green power
Call Brent or Darlene for all of your CCCCCCCCCaaaaaaaallllllllllllllll BBBBBBBBrrrrrrreeeeeeeennnnnnntttttttt oooooooorrrrrrr DDDDDDDDaaaaaaaarrrrrrrlllllllleeeeeeeennnnnnneeeeeeee ffffffffoooooooorrrrrrr aaaaaaaallllllllllllllll ooooooooffffffff yyyyyyyyoooooooouuuuuuuurrrrrrr equipment certi cation needs!eeeeeeeeqqqqqqqqquuuuuuuuiiiiiiiiipppppppppmmmmmmmmeeeeeeeennnnnnnnttttttttt cccccccceeeeeeeerrrrrrrrtttttttttiiiiiiiii ccccccccaaaaaaaatttttttttiiiiiiiiioooooooonnnnnnnn nnnnnnnneeeeeeeeeeeeeeeedddddddddssssssss!!!!!!!!!
BAR EngineeringBAR Engineeringis a is a multi-disciplinemulti-discipline engineering rm that engineering rm that
provides a wide array of solutions to the mostprovides a wide array of solutions to the mostdemanding industries across Western Canada.demanding industries across Western Canada.
Clients rely on BAR Engineering to deliverClients rely on BAR Engineering to deliverhigh-quality, cost effective, timelyhigh-quality, cost effective, timely and and
expert servicesexpert services to meet their project needs. to meet their project needs.
LLOYDMINSTER, ABLLOYDMINSTER, AB • • T: (780) 875-1683 T: (780) 875-1683 •• F: (780) 875-2728 F: (780) 875-2728WEYBURN, SK WEYBURN, SK •• T: (306) 842-4300 T: (306) 842-4300 •• F: (306) 842-4404 F: (306) 842-4404
W: BARENG.CA W: BARENG.CA •• E: [email protected] E: [email protected]
MUNICIPAL COMMERCIAL INDUSTRIALOIL & GAS UTILITY
A14 PIPELINE NEWS November 2011
One Call Will Get It AllOne Call Will Get It All
6401 63rd Avenue, Lloydminster (Northwest of Kenworth) Phone: (780) 875-6604 ∙ Fax: (780) 875-6634
- Power Swivels- Power Tongs- Drill Collars- Rod & Tubing Handling Equipment- Drill Bits- B.O.P's- Annulars- Flow Back Tanks- Accumulators- Cat Walks & Pipe Racks- Elevators- Flanges- Scapers - Downhole- Tanks - Rental- Tongs - Casing & Tubing
We are happy to coordinate pick up pick up and and deliveriesdeliveries for all your equipment needs.
FULL FLUSHBY & PRESSURE SERVICES
BODY VACS,STEAMER/PRESSURE WASHER SERVICES
SALTWATER DISPOSAL PUMPING SERVICES
Ken McConnellOwner/Operator
24 HR Dispatch: 780-205-9001Mike #: 403*11*29001
Fax: 306-397-2697Box 238 Edam, SK
24 HOUR SERVICE24 HOUR SERVICE
Racken Enterprises.indd 1 8/21/08 1:00:06 PM
New energy minister for Alberta's Redford cabinet
Edmonton – Out with the old and
in with the new.
Th at’s the prerogative of new Al-
berta Premier Alison Redford in nam-
ing a new cabinet team that includes
the appointment of Ted Morton as
energy minister, replacing Ron Liepert
who takes over as fi nance minster.
“Th is cabinet refl ects what change
looks like. It’s a team that’s committed
to listening to Albertans, and getting
to work right away on bringing the
change Albertans want and expect,”
said Redford about her cabinet shuffl e
that took eff ect on Oct. 12.
“As promised, there is a lot of new
talent around the table that will change
the way government works. Th ere are
also some familiar faces, including
Doug Horner, who, as previously an-
nounced, will stay on as deputy pre-
mier.”
Th e new cabinet will take the helm
of a renewed government structure, in-
cluding the creation of a Ministry of
Human Services that will bring to-
gether programming for children and
families in need.
Aboriginal relations and immigra-
tion will move to Intergovernmental,
International and Aboriginal Rela-
tions to better co-ordinate federal and
Aboriginal portfolios.
Th e function of economic devel-
opment for the province will move to
Treasury Board and Enterprise. Th e
Ministry of Environment and Wa-
ter will emphasize the importance of
protecting one of Alberta’s greatest re-
sources.
Redford also announced the ap-
pointment of nine parliamentary assis-
tants and membership in the govern-
ment’s renewed committee structure.
A new Operations Committee
will play a key role in the day-to-day
co-ordination of the government’s
agenda, including issues management,
legislation and house planning, and
communications.
Ted Morton was elected to his
second term as a Member of the
Legislative Assembly of Alberta
for the constituency of Foothills-
Rocky View on March 3, 2008.
Previously, Dr. Morton served as
Minister of Finance and Enter-
prise and Minister of Sustainable
Resource Development.
Other previous appoint-
ments include vice chair of the
Treasury Board and vice chair of
the Cabinet Policy Committee
on the Economy and member of
the Cabinet Policy Committee
on Agenda and Priorities. He was
fi rst elected in November 2004.
Dr. Morton obtained his
bachelor of arts in political science
from Colorado College (1971) and
his MA (1975) and PhD (1981)
in political economy from the
University of Toronto. From 1981
to 2004 he was a professor with
the University of Calgary and a
visiting professor at institutions in
Quebec, France, the United States
and Australia.
In 1998 Dr. Morton was
elected as a Senator-in-waiting
in Alberta´s second-ever Senate
election.
He served as director of policy
and research, offi ce of the Leader
of the Offi cial Opposition, Parlia-
ment of Canada in 2001.
Dr. Morton has received sev-
eral career awards and distinc-
tions, including Phi Beta Kappa
(1971); Best Nonfi ction Book
of 1992, Alberta Writers Guild;
Bora Laskin National Fellowship
in Human Rights (1995); and the
runner-up, Donner book prize
for best book on Canadian pub-
lic policy (2000). In 2001 he was
recognized in Macleans Guide to
Canadian Universities as one of
the 20 most popular professors at
the University of Calgary.
Dr. Morton has published
numerous scholarly articles and
six books.
He and his wife, Patricia, have
three children. In his spare time
Dr. Morton enjoys hunting, fi sh-
ing, gardening, cooking, and ski-
ing.
Courtesy Government of Al-berta website
Of cial biography of Ted Morton
PIPELINE NEWS November 2011 A15
Over a quarter-million small businesses in Canada rely on TELUS for wireless solutions and coverage.
Saskatchewan’s biggest* 4G Network is here.Make the switch to unrivalled support and coverage. Visit telus.com/builtforbusiness.
Business-friendly support, including device protection, dedicated 24/7 business
support and an account team trained to meet business needs
Business-focused solutions delivering data security and management of mobile
business, people and fleet
*Comparing the shared HSPA+ network available from TELUS to the public disclosure of HSPA+ network coverage of other provincial service providers for July 2011.
Make the switch to unrivalled support and coverage. Visit telus.com/builtforbusiness.
A16 PIPELINE NEWS November 2011
Lloydminster – MRC Midfi eld and a group
of their preferred vendors held a mini oil show at
the MRC shop in Lloydminster on Sept. 22 with
no danger of it challenging the heavy oil show that
comes to town next fall.
“It’s a customer appreciation mini oil show
event,” said Dean Sutherland, MRC’s sales and ser-
vice spokesman.
“Most of our clients already know what we mar-
ket, but it allows them to come in and ask questions
on certain products.
“I hope our customers come out and see these
products, ask questions and come away with some-
thing they haven’t been exposed to yet as far as new
technology and new equipment goes that could be
cost eff ective in their operations.”
MRC held a similar mini oil show two years ago
to celebrate the grand opening of their current loca-
tion.
“We just thought it was a good idea,” said
Sutherland. “It gets all of our customers together in
one place.
“It’s a good chance to see everybody and talk
with everybody, and give them a little appreciation
and some socializing on a more personal level.”
A pulled pork supper with DJ music and chari-
table donations to the Big Brothers Big Sisters of
Lloydminster and the local MS Society of Canada
added to the business social mix of the customer ap-
preciation event.
“We have a very good relationship with all of our
customers,” said Sutherland.
“Th is kind of serves two purposes – it’s a very
good informational forum for them, and also on the
social end of things, we get to visit with them away
from work. It helps build a relationship.”
MRC bills itself as the world’s largest distributor
of pipe, valves and fi ttings and related products for
the oil and gas industry with more than 60 locations
in Canada.
Th e Lloydminster shop carries a full line of pipe,
valves and fi ttings with a catalogue of over 100,000
available products, from completion and surface
completion products, to products pertaining to pro-
duction and production maintenance, and facilities.
“We also distribute wellhead drives, downhole
PC pumps and surface equipment,” said Sutherland,
who noted the demand is strong for just about every
product MRC carries.
“Business is good for us,” he said. “It’s been a
busy year, and I hope it continues that way.”
Sutherland is excited about the sales prospects
for some new vendor products brought to the event
including a new line of EuroMax PC pumps made
by Europump Systems Inc., located across the street
from MRC.
“Th at’s kind of a new product for us that we
are marketing for Europump,” said Sutherland. “It’s
going to change a lot of ways things are done. It’s
new on the market and it’s going to do some good
things.”
Th e new EuroMax PC pumps are designed with
a consistent elastomer thickness which minimizes
internal stator distortion, one of its many benefi ts.
“Th e elastomer thickness is constant from top
to bottom. It’s about eight millimeters thick, so you
get a better pressure rating,” explained Ted Harland,
Europump’s technical support expert.
Page A17
MRC hosts its own mini oil showGeoff Strong, an inside sales representative from Pro Tech Valve Sales Inc. in Edmonton, was ready to answer all questions about his company’s line of valves during the MRC Mid- eld mini oil show for customers and preferred
vendors Sept. 22.
PIPELINE NEWS November 2011 A17
Kenilworth Combustion Southeast SK to Northeast BCContact Heine Westergaard 1-780-744-3974
Nomad Electric in Northern AlbertaContact Clint Ferriss 1-780-624-2447
Pronghorn Controls in Southern and Central AlbertaContact Stan Neu 1-403-501-4895
CCR Combustion in East Central AlbertaContact Kevin Moan 1-780-872-0706
www.kenilworth.ca MAIN OFFICE 1-780-744-3974 FAX 1-780-744-2242
Eliminate odour from eld tanks and DEHY’s while using vapour as process fuel.
The rules are changing for red equipment in the oil and gas industry.
Are you ready for 2015?Are you ready for 2015?
Kenilworth has the solution!
Contact us TODAY to nd out
A non-destructive testing company in Estevan Saskatchewan & Virden, ManitobaX-ray, Gamma Ray, (pipeline crawlers), Ultrasonic (shear wave and corrosion surveys) Magnetic Particle, Liquid Penetrant,
Hardness Testing, API 510 and CWB Inspection.
All areas | 1.800.442.8721Virden | Phone or Fax: 204.855.3129 | Cell: 306.741.7265 Estevan | Phone: 306.421.3810
Brooks , AB | 403.362.5757North Battleford | 306.446.0242Shaunavon, SK |306.294.7077
Pumps, tubing drains, valves showcased Page A16
“Th ere is less torque and it’s easier
to pull the rotor out of the stator. Th ere
are a lot of advantages to it.”
“Th ere is better temperature dissi-
pation if you starve the pump and there
is a better pressure rating because the
pump is shorter than a conventional
pump,” he noted.
Th e product brochure lists the
full set of features and benefi ts of the
pumps that are designed primarily for
heavy oil with light oil applications up
to about 30 API oil as well.
“MRC distributes it for us. Th ey
do a good job,” said Harland.
Titus Tools Inc., a Lloydminster
company the designs and sells oil and
gas well production products, show-
cased the Titus safety torque tubing
hanger and the Titus safety toque tub-
ing drain that MRC distributes.
“Th ose are a couple of featured
products now that make it much easier
for the rig crews to handle putting in
a tubing drain in the tubing hanger
which is part of the production string
in an oil well,” said Titus president and
founder Tracy Klotz, at his company’s
booth.
“Midfi eld does a tremendous job
promoting other products in the area.
I am glad to be here.”
Stream Flo Industries Ltd. and
its subsidiary Master Flo from Ed-
monton, populated their display with
wellhead equipment, check valves and
chokes distributed at MRC locations
across Western Canada.
Page A19
Shane Tucker from Canadian Natural Resources Ltd., foreground, left, talks products with Tracy Klotz, president of Titus Tools in Lloydminster during a special customer appreciation oil show hosted by MRC Mid eld featuring displays from preferred vendors.
A18 PIPELINE NEWS November 2011
• Winch Tractor Available Step Deck Scissor Deck• B-Pressure• Steel Sales• Portable Rigs• Structural Steel• Shale Tanks• Flock Tanks• Silos• 400 BBL Tanks• Mud Tanks• 12’ Brake & Shear
• 200 Ton Iron Worker• Custom Sandblasting & Painting• Internal Tank Coating
Phone: 780.614.2113Phone: 780.614.2113Fax: 780.614.2115Fax: 780.614.2115
Luc Cell: 780.210.0635Luc Cell: 780.210.0635email: [email protected]: [email protected]
Box 1789, St. Paul, Alberta T0A 3A0
www.northernlightswelding.comwww.northernlightswelding.com
PIPELINE NEWS November 2011 A19
"We have been using these mats for roads and completions. We have not found a mat as heavy duty as these! We use them right up to the wellhead and the big 40 ton pickers have not broken one board. There is virtually no flex! If we do end up breaking one they let us pay for just the repairs, we don't have to buy a whole new mat! We rent them from March - November and will do it again next year. "
– Al Liknes Carduim Production integrated Team Penn West
Exploration - Drayton Valley
[email protected]@energyauctions.ca
403.815.2016
Our Mats are built for swamp use. These mats consist of over 1000’ Board Feet. They are 12(Twelve) 8” x 8” x 16’ held together by 1 ¼” Steel Rods. They are extremely easy to handle with little to no movement once in place! There is virtually no fl ex thus saving broken boards. When renting our mats once you have returned them as long as they are re-usable we will only charge you for repairs we will not charge you for the replacement of the entire mat.
Page A17“We were invited
by MRC Midfi eld as a
preferred vendor to rep-
resent our products and
display them and in-
troduce our products to
customers,” said Gordon
Lee, a technical sales
agent for Stream Flo
chokes.
“It’s a good time for
visibility and to meet
new customers and
some existing customers
as well.”
Stream Flo is a lead-
ing manufacturer of
wellheads, check valves
and safety systems for a
global oil and gas mar-
ket.
Master Flo, with
locations throughout
the world, is a leading
manufacturer of surface
chokes, control valves,
actuators and subsea
chokes.
“Business is great.
We are doing real well
throughout Western
Canada – business is re-
ally good in the industry
right now,” said Lee.
Pro Tech Valve
Sales Inc. in Edmonton
jumped at the chance
to display some of their
products distributed by
MRC to customers as
one of about 12 preferred
vendors on site.
“Th e event for our
company is more to
show off our products
like our ball valve name
and our gate and globe
valve name, and show
what Midfi eld supplies
to their end users and
answer any questions,”
said Geoff Strong, an in-
side sales representative
for Pro Tech.
“Pro Tech is all
about gate valves, globe
valves, check valves and
ball valves and high
pressure stainless carbon
steel, low temp – lots of
materials for diff erent
applications.”
“Th ese products
would be used more on
the production side of
things – not to get the oil
of the ground but once
it’s out of the ground –
to move it from pipe to
pipe and stuff like that.”
Strong said Pro Tech
does a lot business with
Suncor in Fort McMur-
ray as the company buys
a lot of their gate valves,
globe valves and check
valves.
Pro Tech designs,
manufactures and sells
valves and fi ttings for
power plants and pet-
rochemical and refi nery
companies worldwide.
A chance to show off
Right: Dean Sutherland, a sales agent with MRC Mid eld, was happy to wel-come visitors and customers to his company’s mini oil show held on Sept. 22 with participation from about a dozen preferred vendors.
Left: Gordon Lee, a tech-nical sales rep for Stream Flo Industries Inc. and its subsidiary, Master Flo, grips one of Master Flo’s chokes for oil and gas applications during the MRC Mid eld oil show on Sept. 22 at MRC’s shop in Lloydminster.
We offer 30 & 35 Ton Picker Services and We offer 30 & 35 Ton Picker Services and 3 Ton Picker Delivery Service3 Ton Picker Delivery Service
Professional and Experienced Operators Professional and Experienced Operators focusing on Safety & Customer Satisfactionfocusing on Safety & Customer Satisfaction
Dispatch 780-214-4345Of ce 780-874-9960
Email info@dekkeroil eld.comFax 780-874-9970
Box 12838 Lloydminster, AB T9V 1E9 B
Ask about our Financing and Leasing options
Regina 1507 Ross Ave. (306) 789-7383 1-800-667-7716 Saskatoon 303– 50th St. East (306) 242-3411 1-800-667-3098
WWW.FRONTIERPETERBILT.COM
24 Hour Emergency Parts & Service
BUY – SELL – TRADE
Estevan #1 Frontier Street (306) 636-6320 1-888-345-8070 Lloydminster 5201 - 40th Ave. (306)825-3553 1-800-667-6323
Monthly Specials Check out our
Online
A20 PIPELINE NEWS November 2011
• TUBING BAILERS • TUBING ROTATORS• JUNK BASKETS • GAS SEPARATORS• PUMP TO SURFACE EQUIPMENT • TUBING DRAINS• SWAB MANDRELS • ROD COUPLINGS• PERF WASH TOOLS • TUBING ANCHORS• CASING SCRAPERS • ROD SHEARS• TORQUE ANCHORS • PUMP OUT PLUGS• NO TURN TOOLS • SLOTTED SAFETY SUBS
QUALITY TOOLS & QUALITY SERVICE
Lloydminster 780.875.2151 • Provost 780.753.3132Brooks 403.794.0045 • Swift Current 306.773.5512
•••••• • ••• Quality Tools & Quality Service
CHECK OUT OUR WEBSITE: www.dashtoolsinc.com
Full Zip or Snap OffStarting at
$$79799999EACH
By Geoff Lee
Lloydminster – Rod Carroll can’t wait to take
delivery of a 2011 Kenworth T800 truck equipped
with a Manitex 35-ton crane. Th e unit is expected to
arrive this month.
Th at will be the third crane Carroll and his wife
Amie have purchased for their Dekker Oilfi eld Ser-
vices Ltd. business and will raise the bar on their lift-
ing capacity.
Dekker currently has a Kenworth C-500 tan-
dem tridem with a 30-ton National 1100 crane with
a 69-foot reach and a 40,000 pound deck mounted
winch.
Th ey also operate a 2011 GMC one-ton dually
that tows a 34-foot gooseneck trailer with a truck
mounted Fassi 3-ton knuckle-boom crane.
Th e new truck-mounted Manitex will feature a
77-foot boom to go with a 40,000 lb. deck winch.
“It will allow us to do pretty much the same as
the 30-ton; it’s just that we won’t have to run it as
much,” said Carroll who started his picker service in
February 2010.
“With the 30-ton you are running rig mats and
skids and some of the equipment seems to be getting
bigger. Th e 35-ton will give us the ability to handle it
without maxing out our weight charts and stuff .
“It’s not that the 30 is too small, it’s just that the
35 would be better.”
Th e new 35-ton picker truck will work out of
Dekker’s new location at the former Tanroc site in
Lloydminster where they have rented one and half
bays and space for a new offi ce.
“Once we get the fl ooring and walls up and
everything built the way we want it to be built, it
should be a lot nicer,” said Dekker with renovations
in full swing.
Ryder, a muscular 140 pound shop dog, is taking
everything is stride with his bowl full of food.
“He’s momma’s boy, that one,” said Dekker, who
doesn’t get much grunt work out of the pooch who
earns his keep as a watchdog.
Th e brunt of Dekker’s lifting is accomplished by
his 30-ton stiff boom crane used to haul everything
from skids, Class 3 shacks, pumps, tanks and tubing
to drill collars, power tools and drilling equipment.
“Whoever calls, we haul it,” said Carroll who fo-
cuses his picker services on deliveries to service rigs.
“We have steered toward the service side with
the odd drilling job. Our business is just picking stuff
and moving stuff , and hauling it out to rigs, and get
it out on time,” he said.
Carroll said the key to their success so far is be-
ing honest with customers and not taking on jobs
they can’t fulfi l.
“We try to do everything as professionally as we
can and as reliably as we can,” he said.
Page A21
Rod Carroll, with Ryder at his side, posed for a photo in front of this National 1100, a 30-ton truck mounted crane with a 69-foot boom at the Dekker Oil eld Services Ltd. yard. Dekker is anxious to take delivery of a new 35-ton Manitex picker with a 77-foot boom this month. Both truck mounted cranes come with a 40,000 pound deck winch.
Dekker relocates, new picker on order
PIPELINE NEWS November 2011 A21
FinancingFinancingOAC - Including USAOAC - Including USA
Limited Powertrain WarrantyLimited Powertrain WarrantyExport ServicesExport Services
Over 80 Trucks in StockOver 80 Trucks in StockAll Makes and ModelsAll Makes and Models
WWW. CUSTOMTRUCK.CAServing the prairies for over 45 years
2010 Kenworth T800
Cummins ISX, RTLO18918B,
14,600 lbs, 500 hp
Serial # J943811/12
2005 Peterbilt 379L
CAT C15, 18918B,
12,000 lbs, 475 HP
Serial #N881141
ReginaRegina 520 Park Street , S4N 0T6520 Park Street , S4N 0T61•800•463•93331•800•463•9333 306•569•9021 306•569•9021Bob WirtzBob Wirtz535-3869535-3869
Lenny JanzLenny Janz535-3572535-3572
Erin FoundErin Found520-2227520-2227
Chris BeatonChris Beaton541-8336541-8336
SaskatoonSaskatoon 2410 Northridge Drive, S7L 7L62410 Northridge Drive, S7L 7L61•800•268•42221•800•268•4222 306•-931•1911 306•-931•1911
Guy TatlowGuy Tatlow221-7254221-7254
Ian CopnerhurstIan Copnerhurst221-0274221-0274
Chad KempChad Kemp229-4423229-4423
Gord WoodGord Wood221-9597221-9597
Bert Downton - Saskatchewan Used Truck Sales Manager Bert Downton - Saskatchewan Used Truck Sales Manager 539-1128539-1128
The World’s BestThe World’s Best
2008 Kenworth T800
2009 Kenworth T660
2007 Kenworth T800
2008 Kenworth T800
CUM ISX, RTLO18918B, 12,000 lbs, 485/1850 HP,
D40-170P Serial #J934359
18 Manual, 13,200 lbs, 62” ACAD Sleeper, 485 HP,
46,000/lbs Serial #J941635
ISX, FRO16210C, 12,000 lbs, 72” ACFT Sleeper, 450ST HP Serial #J997998
C9 CAT, RTLO11908LL, 12,000 LB, 335 HP
Serial #J935170
2 Available
Staying with what you know Page A20
“If somebody phones and asks for a truck – if
we can’t supply it, we just don’t take the job. We
can’t ‘screw’ people around because they won’t phone
again.”
Dekker has four operational employees with
plans to hire three or four additional workers when
the new truck arrives as business orders continue to
pick up.
Currently, Carroll and Matt Lamberty run the
30-ton crane while Jamie Hayes and her co-worker
Kaitlyn Fraser operate the one-ton dually with the
Fassi knuckle-boom.
Like any new business start-up, Carroll and his
right hand man, Lamberty, initially relied on people
they knew for picker jobs even if it led them far from
Lloydminster where they do most of their work
now.
“Matt’s got 12 years of experience and I’ve got 12
to 13,” said Carroll. “We have worked in Fort Mc-
Murray, Grande Prairie, Manitoba, Estevan – we’ve
been all over.
“We spent a lot of years up in the Cold Lake
Weapons Range. We are still running into people we
have worked with in the past, and all of a sudden you
get another person phoning.
“We are striving to be Lloydminster based, but if
someone calls from anywhere, the truck’s got wheels
and we’ll go there.”
Carroll says starting a picker service company
was a no-brainer because that’s all he’s ever done
since he landed his fi rst job at age 18 at Classic Oil-
fi eld in Lloydminster where he and Lamberty earned
their journeyman picker tickets.
Carroll and a co-worker eventually left Classic
to start Spectra Oilfi eld Service Ltd., another lo-
cal picker company, before selling out to his partner
three years ago.
After bailing out of a brief wireline job that he
didn’t enjoy, Carroll landed a crane operator’s job in
Fort McMurray with SMS Equipment Inc.
“Th ey would assemble the huge 930 and 960
Komatsu haul trucks used by Suncor, so you were
lifting anything from 68 to 72 tons, depending on
the day,” said Carroll.
“I did that for a bit, and then I heard it started to
get busy at home again, so I came home and started
Dekker.
“I think I have a handle on the business. I
haven’t done anything else. I just came back to what
I know.”
Dekker Oil eld Services Ltd. is renovating their new shop and of ce in Lloydminster, but the ongoing construction work doesn’t stop owner Rod Carroll from working the phones to secure new picker customers. Carroll and his wife Amie launched the business in February 2010.
ree
Wo
A22 PIPELINE NEWS November 2011
401 Hwy #4, PO Box 879, Biggar SK, S0K 0M0Tel: (306) 948-5262Fax: (306) 948-5263
Over 17 Years Building Storage Tanks
Over 60 000 sq/ft of Production Space
• We build ULC, UL, Flameshield, API-650, 620, 12F, ASME• 7-3000 bbl• 2,273-200,000 L Horizontal Contained• Pressure Vessels
• 2,273-110,000 L Jacketed Underground• 2,273-120,000 L Vacuum Monitored• 1,250-5,000 L Rectangle• 5,000-200,000 L Single Wall Vertical
AGI’s innovative design, custom manufacturing process and comprehensive service combine to make AST’sone of the most cost eff ective, effi cient means of storage available today.
CALL US TO DISCUSS YOUR NEEDS:
1-800-746-6646
Website: www.envirotank.comEmail: info @envirotank.com
Tank Welding Unmatched in the IndustryUltra-sonically tested and X-Ray Quality
Flowsur ValveSaving Pumpsat Lower Prices
with Less Hassle
Automatic PumpAutomatic PumpShut DownShut Down
Ready For A Buyout??We advise Owner - Operators of Private Oil eld
Service Businesses on Liquidity Options
For more information please contact:
G. Trevor ConwayManaging Partner & Director
Tel: (403) 456-6473Email: [email protected]
Lloydminster –
More boom for your
buck. Th at’s the motto
of Dynamite Oilfi eld &
Picker Service Inc. that
celebrated its 10th year
of business in Lloyd-
minster in September.
Kris Bexson, who,
along with his wife and
bookkeeper, Hannah,
own and operates the
company that employs
four people. He attri-
butes the company’s
success to date to put-
ting that motto into
practice on a daily basis.
“We do supply very
well maintained equip-
ment,” said Bexson. “We
have an excellent record
for showing up on time
and doing exactly what
we say we are going to
do.
“Also my guys – I
have excellent man-
power. Th ey know the
business and they do it
safely. In 10 years, we
haven’t had one time-
lost accident and very
few reportable inci-
dents.”
Dynamite’s core
business activity is its
picker service with a
fl eet of three truck-
mounted Fassi knuckle-
boom cranes with a re-
spective lifting capacity
of 3.5, 5 and 7.5 tons.
Th e pickers can be
equipped with a reverse
knuckle-boom attach-
ment arm for lifting ob-
jects such as engines and
compressors through
small man doors.
Th ey also have three
fi fth-wheel trailers for
hauling equipment in-
cluding Pason oilfi eld
instrumentation and
data acquisition systems
to drilling rigs.
“All of our trucks are
medium duty trucks,”
said Bexson. “We stick
with medium duty and
we can do bigger jobs,
too, for less cost using
the same equipment.”
Market demand
has led the company
to diversify into hot
shot services, welding
and fabrication, oilfi eld
maintenance and man
lift work.
“We do any sort of
oilfi eld work that we can
handle,” said Bexson.
“We haul equipment
around – downhole tub-
ing, tools to service rigs.
We do quite a lot of man
basket work.
Dynamite recently
“tricked out” their man
baskets with a custom
fi breglass exterior fi nish
bearing the company
name and logo.
“Th e baskets attach
to our cranes so that’s
what we use for our man
lifts,” said Bexson.
Page A23
More boom for the buck at Dynamite
Dynamte completed this tandem lift of a pontoon boat at Boundary RV & Marine in Lloydminster with two cranes. The truck on the left (since sold) is a 1991 International equipped with a 4.5 ton Legend crane. On the right is a 2003 Freightliner with a 4.5 ton Fassi crane. Photo submitted
PIPELINE NEWS November 2011 A23
4 Flushby TrucksSteamer TrucksSlant Capable
Truck Cell: (306) 823-3512Cell: (306) 823-7111Res: (306) 823-4309Fax: (306) 823-4663
P.O. Box 331 Neilburg, SK S0M 2C04 Flushby TrucksSteamer TrucksSlant CapableVac Trucks
Page A22 “Th e baskets are for any kind of high work in plants and
facilities for piping that’s up in the air. It’s a little more economical than using
scaff olding. It’s a lot quicker.
“Mostly, we use them for steaming off tanks. We will meet a steam tech or
a fi eld consultant out on a site. Maybe they had some oil come up to the top of
their tank and run down the side of the tank; we will lift the steam guy up to
wash off the tank.”
Dynamite also provides a general picker service in town to move garden
sheds and boats and to lift roof rafters for new residential home construction,
but oilfi eld work is their bread and butter.
“At least 90 per cent of our business is oilfi eld,” said Bexson. “We pick up
small buildings and shacks and engines and motors. Most of our work is fi eld
work. We don’t do a lot of plant maintenance.”
Dynamite can also set up temporary cement containment rings to contain
leftover casing cement from newly drilled wells, and they also do wellsite setups
including some pipefi tting.
Variety is the spice of life for Bexson, who started a welding shop to main-
tain his own equipment and has branched out to making pipe racks, equipment
docks, ladders and stairs and custom oilfi eld work.
Bexson admits he thrives on diversity and challenges as a small business
owner.
“You are always on the move. You can have your day planned out, but you get
a few phone calls and guys need this or that done, and you have to be on the ball
and switch up your day and keep things moving and customers happy,” he said.
“I fi nd that very exciting. You are not doing the same thing every day.”
“You are really on your toes all the time, and of course, you are dealing with
equipment and you have to keep things maintained and make sure everything is
safe and organized properly.”
Bexson recently sold his very fi rst truck, a 1991 International with a 4.5 ton
Legend crane on it. Th e Fassi knuckle-boom is his crane of choice today.
“Th ey are easy to maintain. Th ey are an economical crane. Th ey have safety
features that I like,” he said.
“When it starts to drop down, that tells you the load is too heavy, so then
you boom back in, set it down, and get your equipment closer to the drop point.
Th at’s a safety feature. Th at’s the bypass valves that are built into all these hy-
draulic folding cranes.
“I really like that feature. If you are lifting and moving and doing everything
Most work in the eld
right, and you grease your picker all the time, and change the oil once a year, they
will last forever.”
Bexson said some of the keys to Dynamite’s survival in the past 10 years
were keeping their equipment in good shape with a regular maintenance plan,
and establishing a good relationship with their employees. Page A24
Kris Bexson, owner of Dynamite Oil eld & Picker Service Inc. expects all of his employees will graduate this month from an online Boom Truck Operator B (cranes up to 15.5 tons) course offered by Western Trade In-stitute in Saskatoon and endorsed by the Saskatchewan Apprenticeship and Trade Certi cation Commission.
dedicated to providing a light picker & hauling
service to the general public
as well as the oil and gas industry
in a safe and economic manner.
phone:phone:780.872.0033780.872.0033
Supplying 3.5 ton to 7.5 Supplying 3.5 ton to 7.5 ton truck mounted folding ton truck mounted folding
cranes for service incranes for service in AB and SK. AB and SK.
Over 10 Years of Service Over 10 Years of Service to the Lloydminster Area!to the Lloydminster Area!
A24 PIPELINE NEWS November 2011
BONDED TRUCKBED PROTECTION
· Spray-in Truck Bed Protection· Textured Non-Slip Surface
· Available in a Full Assortment of colors that will not fade
· Protection for Decks, Signs, Parts and Much More
Protec t Your Trailer!Protec t Your Trailer!S eaml ess, Easy To C l ean Fl oorS ea ml ess, Easy To C lean Floor
windshield & replacement· Prevent Chips & Cracks from Spreading
· Restores Safety & Structural integrity· Improves Clarity & Cosmetics 65 - 90 %
· Saves You Money Over Replacing
Rock Chips & LongRock Chips & LongCrack RepairsCrack Repairs
All Work GuaranteedAll Work GuaranteedFix that rock chip or crack before the snow fl ies!Fix that rock chip or crack before the snow fl ies!
· Interior Steam Cleaning
· All your Truck & SUV accessories
· Meguiar ’s Car Care Product Distribution· Over 20,000 Different Truck Accessories
BOND
Complete Auto Detailing Centre
3,5905 - 44 St. LloydminsterPh: (780) 808-2911
i d hi ld & lCRACKMASTERSCRACKMASTERS
Stable Foam Clean-outs | Hydro Vacs | Coiled Tubing Units | Power Tong Repair | Pressure Trucks | Vac Trucks
Page A23“You can have 10
vehicles, but if you don’t
have good employees,
you are not worth any-
thing,” he said.
Craig Salzl is the
lead picker operator and
assistant manager and
the senior hand at Dy-
namite with more than
six years on the payroll,
followed by Ethan Cart-
er who also operates a
picker.
Eugene Dufresne,
the maintenance crew
foreman, and Donald
Waskewitch, a labourer,
are the newer opera-
tional employees, but
everyone is trained to
troubleshoot mechanical
problems.
“We all kind of
pitch in,” said Bexson.
“We brought in a main-
tenance program about
fi ve years ago. We go
through these trucks ev-
ery 30 days with about
a fi ve page checklist we
developed ourselves.
“Since we imple-
mented that, I haven’t
ever had a breakdown in
the fi eld. I can’t remem-
ber the last time I had a
tow truck for one of my
trucks.
“If you are on your
way to a job, and you
have a breakdown, you
have an angry customer.
Th ere is a lot of money
waiting on lease and if
you are an hour late, the
people aren’t going to be
very happy.
“I’ve always tried to
learn as much as I can
about the equipment
that I am running. If you
can teach that to your
employees, that cuts
down you breakdowns
signifi cantly too.”
Bexson says the
company has been busy
the last two years and fu-
ture plans include build-
ing a bigger building be-
fore expanding with new
equipment.
“I am quite happy
with where we’re at right
now,” he said. “I think
I would like to build a
shop before buying any-
more equipment. We
have been here for eight
years and we are out-
growing the space.”
Good employees, maintenance key
Picker operators, Craig Salzl, left, and Ethan Carter ank Kris Bexson who is inside his company’s latest custom man basket with the company name on it.
PIPELINE NEWS November 2011 A25
Introducing The Next Generation Of Belt Drive
Ask Us About Our Other Products
• Adaptable to your torque requirements
• Compact. Just 2’ tall from bottom of stuf ng box to top of guard
• Easy to use
• Safe
• Affordable
• Wickedly Simple
• Stuf ng box design, repair & tracking
• Drivehead design, repair & tracking
• Field service & consultation by highly trained technicians
• Failure analysis & recommendationsfor improvements
Comes complete with our superior
FS style Stuf ng Box and a variety
of hydraulic motor and belt options.
Contact us to nd out more:Tel: 780.875.11096702-56th Street
Lloydminster, AB
Or nd us on the internet at:www.brightlingequipment.com
Lloydminster – No job is too big
for Action Towing & Recovery, except
when it doesn’t involve towing recovery
services, such as the collapse of the Ca-
nadian Pacifi c overpass on Highway 16
in Lloydminster on Oct. 11 that sent
cranes to the rescue.
“Th at stuff was out of our league. I
wasn’t about to start off ering my services
to stuff like a bridge,” said John Buhnai
at his Action Towing base located on
Highway 16 about 16 kilometres west
of the city.
“Most of our work is towing and
recovery work of trucks and heavy
equipment.”
Two 500-ton cranes were called in
to lift and clear the collapsed CP steel
girder that weighed up to 100 tons.
Action Towing however, is no
slouch when it comes to lifting heavy
wrecks or oilfi eld equipment in places
where most cranes and pickers fear to
tread.
Th eir NRC 40-ton sliding boom
recovery unit has a 35 foot boom height
and a 35 foot reach with enough muscle
at any angle to pick up wrecked service
rigs and heavy construction equipment
for towing or hauling. Page A27
Action Towing & Recovery owner, John Buhnai with his wife Ginette, has the bragging rights to the largest wrecker in the west with this 47 foot long Tow Mater with a 60-ton towing capacity. This photo was taken on a cold winter’s day in 2010 for a Pipeline News feature on working in cold weather – with the company gearing up for cold months of lifting and recovery work ahead.
Action towing can out lift most pickersAction towing can out lift most pickers
A26 PIPELINE NEWS November 2011
PIPELINE NEWS November 2011 A27
Lloydminster Citizens On Patrol
Check Us Out At www.lloydcops.com
Be A Part Of The Solution
For all our info and an Application
to download Requirements are
-Security check, training, and 5 hrs on
patrol a month.
Help with crime prevention
This ingenious design incorporates a set of centralizing drag blocks to the Multi Set Torque Anchor that helps reduce the vibrations and dampen the harmonics produced by higher RPM PC Pumps
If you have a specifi c problem on an application, we’ll help you design & develop novel production optimization equipment.
FEATURING, PREMIUM CENTRALIZED MULTI SET TORQUE ANCHOR
We offer 5 different models each with unique characteristics that will suit any specifi c PCP application.
At Premium We Know Torque Anchors!
Torque Anchors | Gas Separators | Horizontal Intake Sub | Tubing SwivelsTubing Centralizer | Fike Drain | Tubing Shear Joint | C-1 Tubing Anchors
Packers, Downhole Tools, Flow Control, Coating, Others#8, 10672 – 46th Street S.E.Calgary, Alberta, CanadaPhone: (403) 723-3008
Lloydminster, Alberta, Canada Phone: (780) 875-3050 Fax: (780) 875-3002
[email protected]: (780) 522-8296
The anchor is centralized in the casing providing a standard larger bypass area than most existing centralized anchors. It is available for all casing sizes with a variety of connection sizes and types.
Single Set Anchor - one anchor block coilable • Multi Set Anchor - Our Best Seller Cam Set Anchor - higher the torque, the better it will engage • Simple Set Anchor - our most economical option
Check out our website for our other 4 models of Torque Anchors
www.PremiumALS.com
Page A25 Unlike
picker trucks that lose
lifting capacity the fur-
ther their boom reaches,
the NRC maintains its
ability to lift its rated ca-
pacity.
“It will lift 40 tons
stretched right out,”
said Buhnai. “It’s diff er-
ent from a picker truck.
Picker trucks lose capac-
ity the further out you
reach.”
Asked why pickers
aren’t made the same
way as the NRC, Buh-
nai says it is just the way
they are engineered and
designed.
“Pickers would have
to be built too heavy.
Th ey wouldn’t be able
to haul anything down
the road with them,” he
said.
“We don’t haul
things on the back of it.
We just use it for recov-
ery work, and we might
tow the odd truck with
it. We are not trying to
haul a trailer and a pay-
load with it.”
Th e NRC also gets
the nod to lift heavy oil-
fi eld equipment in places
where picker trucks are
challenged by terrain, ac-
cessibility or soggy soil.
“We’ve done a num-
ber of lifts at diff erent
places – sometimes lift-
ing a heavy load that is
hard to get at with a big
unit. Our unit is small,
but it’s got heavy lifting
capacities,” said Buhnai.
“It’s kind of handy
to get into a tight area.
“Th ere are times
when we have to get
dragged in by farm trac-
tors because the roads
are so muddy we can’t
drive on them, so we just
get pulled.”
On the towing side
of the business, Ac-
tion Towing has six tow
trucks all equipped with
winches for recovery
work and pulling vehi-
cles out of ditches. Some
of the trucks have two
winches.
Th e fl eet ranges from
40 tons of towing capac-
ity up to the mother of
all wreckers, the 60 ton
Tow Mater – a 47 foot
yellow monstrosity.
“It’s the biggest and
the baddest,” said Buh-
nai. “It’s got fi ve axles
and four of them drive.
It can tow service rigs,
and big cranes. I haven’t
seen anything bigger out
there with more towing
capacity.
“We tow everything
from one-ton trucks to
road building equip-
ment, graders and front
end loaders to cranes
and service rigs as well
as big cranes that weigh
up 90,000 to 100,000
pounds.”
Action Towing’s
hauling fl eet includes
three lowboy trailers in-
cluding a tandem winch
tractor, a tri-axle scissor
neck and a 40-wheel
combo trailer with a re-
movable neck.
Th e combo unit has
a 60-ton capacity for
hauling service rigs and
heavy equipment to work
sites during road bans.
Th e company also
has an air cushion recov-
ery system for recovering
tipped trailers, tankers
and fi fth wheel trailers.
Buhnai has a staff
of seven employees sup-
ported by his wife Gi-
nette who works the
phones and books along
with doing some dis-
patching.
Action Towing has
a shop at their highway
yard where they main-
tain their own equip-
ment and sell new and
used trucks parts.
Asked to recall some
of the tougher towing
and recovery jobs at Ac-
tion Towing, Buhnai says
they have been doing
this long enough now
that no job is too tough.
“Some of them are
a little more challenging
than others, but it’s just a
matter of going out there
and looking it over and
doing our job,” he said.
Th ey base their de-
cision on what unit to
dispatch based by ask-
ing the customers a few
questions when they call
for help, with most of the
calls relating to highway
accidents and rollovers
that occur year round.
“Th ere’s rollovers on
nice days just as well as
there are on wet days or
stormy days,” said Buh-
nai.
“A lot of it is high-
ways where people are
driving on the blacktop
and get distracted for
whatever reason and roll
over on the straight and
narrow highways.
“We do a lot of oil-
fi eld work, but there’s a
lot of oilfi eld trucks out
there, so it stands to rea-
son there are going to be
some wrecks in the oil-
fi eld.”
Th e day the CP
overpass collapsed after
being struck by an over
height excavator on the
back of a semi, Action
responded to multiple
oilfi eld-related accidents
near the city.
Distractions cause numerous roll oversDistractions cause numerous roll overs
Action Towing’s 1994 Peterbilt NRC 40 ton sliding boom recovery unit was ideal for lifting and hauling this inoperable LeTourneau-Westinghouse earth mover on a lowboy from a site near Dewberry.
Photo submitted
COMPANYA
EQUIPMENT (2010) LTD.
NANANANANANANANAANANNANANNNNNNNNNNNNNNNNN TITTTTTTTTTT ONONONONONOOONNONONOONONONONNNNNNNONNNNNALALALAALALALALAAALAAAAAALALAALAAL NNNNNBBTBBTBTBBTBTBBTBTBBBBTTBBTBBBBBTTBTTT45444444445454454445444455 (((( 5454 TTTTTTTTTTONONONONONONONNONONONONONONONONOOONNONOONNNOONOONON))))))))))))))))))))))))))))))))))NANANANANANAANAANANANANANANANANANAAANANNAAANNANAAAAANAAAAAATITITITITITITTITTITIT ONONONONONONONONONONONOONONONONNONONONONONNNONONNNNNONONNNNNNONNNNNNNNONONNNNNOOOOOONNALALAAAALALALALALAALALAAAAALAALLAAAAAAAALAAAAAAAAAAAAAAA N N N N N N NNNNNNNBTBTBTBTBTBTBTBTBTBTBTBTBBTBTBTBTBTBTBTBTBTTTBTBTBTBTBTBTBBBTBTBTBTBTBTBTBTBTBTTBBTB 45454444454545454545454545454445454454544545454445544 ( ( ( ( ( ((( ( ((((((((((((((((((((( 454545454545454545454545454545454545454545454554545454545545454545454454445454544544444545 T T T T T T TT T TTT TT TT TT T T TTTT T TTTT TT T TTTT TTT TTTTTTTTONONOONONONONONONONONONONONONONNONONONONONONONONONONONONONONOOONONONONONONOOONONONOOOOONOOO ))))))))))))))))))))))))))))))))))))NANANANAANANANANANANNANANANANANAAAATITITITITTTT ONONONONONONONONONONNOONONNONONNNNNNNNNNNNNNNNALALAALAALAALAAALALAAAAAAAAAAA N N N N N NNNBTBTBTBTBTBTBTBTBTBTBTBTBTTBTBTBTBTBTBTBTBBTTBTBTTBTBTBTBBB 454544444454545454544545454544444 (( (((((((((454545454554545454454545454545454555544444545445 TTTTTTTTTTTTTTTTTONONONONONOONONONONONONONONNOONONONONONOONNNONNONNOO ))))))))))))))))))))))))NANANANANANANANANANANNNAANANNANANAANNNAANATITITITITITIIITT ONONONONONONONONONOOOOOO ALALALALALALAAA NNNN ((((NAAAAAAAATITTTTT OOOOOO ))))))))))))))))NATIONAL NBT45 [45 TON]
419 - 47TH STREET E.SASKATOON, SK S7K 5H4
(306) 955-4266
WE CREATE CUSTOMIZED TRUCK EQUIPMENT SOLUTIONS TO SUIT ANY NEED!
SALES - PARTS - SERVICE - CERTIFICATION
EXCALIBUREQUIPMENT.CA
Lloydminster –
Guest Control Systems
held a grand opening
of their new offi ce and
shop complex in Lloyd-
minster on Sept. 29 with
news the company hopes
to further expand to
Bonnyville or the Peace
Region of northern Al-
berta.
“Right now, we do
work all the way up to
Fort McMurray and we
have a small offi ce shop
in Kerrobert,” said Chad
Guest, company presi-
dent.
“We run about fi ve
guys steady down in that
area. Th ey work all the
way down to Kindersley
and do a lot of work in
the Hoosier and Denzil
area.”
Expansion in Lloyd-
minster and elsewhere is
driven by a demand for
Guest Control’s forced
air and natural draft
burner systems that they
manufacture and sell
from their new 20,000
sq.-ft. building.
Th e business volume
for burner sales, instal-
lations and service tops
that of their other elec-
trical, instrumentation,
pressure safety valve re-
pair and rental divisions
in that order.
“Th e biggest de-
mand right now is for
the heater systems that
we carry,” said Guest at
the grand opening.
“Th ere has been a
big push with that for
the last few years to get
systems certifi ed. It has
been driven by the CSA
B149.3 code for tank
heating systems. It’s a
burner system code that
applies to gas fi red heat-
ing systems.
“Th e government
doesn’t grandfather the
old systems that are out
there any longer, so they
have to be brought up to
code.
“As a result, there
has been a huge boom
in the burner heating
industry. We were for-
tunate enough to be in
a position to meet the
needs of customers.”
Guest has been on
a growth path during its
25 year history by adapt-
ing to the current needs
of the oil and gas indus-
try with new products
and services.
“When we started,
we did a lot of service
work and maintenance
work for instrumenta-
tion primarily in the
plants around the area,”
said Guest.
“We still do that,
but we have expanded
through the burner
heating systems – which
is more of our business
now than instrumenta-
tion is, but it’s just the
changing demands in
the oilfi eld.
“We still do instru-
mentation and electrical
work, but primarily, our
work right now is heat-
ing systems.”
Guest Control’s new
building includes 10,000
sq.-ft. of shop space that
allows the company to
design, engineer and
manufacture their own
line of forced air burners
and natural draft burn-
ers that meet the CSA
code.
A28 PIPELINE NEWS November 2011
One Call Will Supply It All
RIG PARTS SPECIALISTSwww.lamarreequipment.com
9419 - 27th Avenue, Edmonton, AB, CanadaPhone: (780) 438-3493 Fax: (780) 438-6655
Email: [email protected]
LAMARRE EQUIPMENT INC.
WPT Air Clutches Gummi Air Clutches
Burner sales drive Guest Control growth
Jordan Moss, a valve tech, left, works with burner tech John Leeson to hoist the housing for a Guest Control Firestorm burner onto a pickup with the aid of a ve-ton overhead crane.
Page A29
PIPELINE NEWS November 2011 A29
MOBILE UNITS MOBILE UNITS FORFOR
HireHireoror
PurchasePurchaseNO BOILER TICKETNO BOILER TICKET
REQUIRED TO OPERATEREQUIRED TO OPERATE
Grant Stegen 403 548-1231Syl Tateson 403 793-4616
NEW WATER HEATERNEW WATER HEATER
•• Completely Mobile fresh water heater Completely Mobile fresh water heater•• Capable of heating a 400 bbl. tank Capable of heating a 400 bbl. tank 0 - 40 degrees C in 40 min. 0 - 40 degrees C in 40 min.•• Variable heat output up to 15 million B.T.Us. Variable heat output up to 15 million B.T.Us.•• Diesel fired CSA approved burner Diesel fired CSA approved burner•• Extremely efficient fuel saving design Extremely efficient fuel saving design•• Patent pending Patent pending
THERMAL TEC LTD.
Overhead crane helpful in shop
Page A28Th ey also have room
to complete certifi ed re-
pairs to safety valves and
control instrumentation
and storage space for
sales of pressure safety
valves (PSV), back-up
generators and burner
systems.
“We do a lot of
manufacturing right
here in the shop,” said
Guest. “Th at’s one of
the reasons we built the
shop, to be able to do the
manufacturing in one
facility.
“It’s easier for qual-
ity control; it’s easier for
scheduling work, and
getting all the parts put
together for the next
jobs.”
One of the unique
features in the shop is a
fi ve-ton overhead crane
that can carry much
heavier loads if the need
arises.
“One of the rea-
sons we put our crane
is to make sure we have
enough capability for
any future growth,” said
Guest.
“A lot of the stuff
that we manoeuvre isn’t
really heavy, but it’s
over the weight to carry
around easily. Th e crane
makes it easier for that
type of stuff to be done.
“We went fi ve-ton
simply because the dif-
ference between a fi ve or
a two is future capabili-
ties. It’s there.
“We have a PSV
shop for rebuilding safe-
ty valves (pressure relief
valves) so we have some
of the valves coming off
the pipeline, and they’re
eight by 10 inches and
weigh about 500-600
pounds.
“For repairs of in-
strumentation valves,
the crane is fairly handy
as well.
“Most of the stuff
we deal with is probably
1,000 pounds or less.
Th ere is a separator out-
side right now that we
are rebuilding, and that
gives us the ability to
bring it inside and com-
pletely dismantle it. Th e
vessel itself will be sev-
eral thousand pounds.”
A crane demon-
stration was part of the
grand opening that in-
cluded generous serv-
ings of pulled pork with
all the fi xings for guests
and customers.
“We’ve got some
prize giveaways and we
are here talking to cus-
tomers if they come in
and enjoy some lunch
on us today,” said Guest
who said the new build-
ing will lead to improved
effi ciencies and better
service for customers.
“It’s a good base for
running our operations
out of. We are running
up to 100 guys now.
It was very diffi cult in
our old shop. It was too
small. Th is off ers us a lot
of opportunity that way
and for business growth
potential in the future.
“Traditionally we
were running around
17 to 25 people about
six years ago and we
have expanded steadily.
We’ve gone from the 25
to 40 range, and then we
went from 40 to 60, and
I think this summer we
peaked at 105.”
Guest Controls
opened its new shop to
employees on May 1
with staff making the
move into the two storey
offi ce wing on June 1.
Th e new building,
located at the north end
of the Hill Industrial
Park, sits on a two-acre
yard with enough park-
ing for more than 45
service vehicles.
“We keep busy,” said
Guest. “On safety meet-
ing days, it’s a very full
area. We do a lot of fi eld
installations with our
equipment, primarily in
burner systems.
“We also have elec-
tricians out there as well
as the instrument techs.
Th ey all require vehi-
cles.”
As for future growth,
Guest said, “it’s just a
matter of trying to get
the people in place to
make sure we can service
the customers well” be-
fore they take that step.
“We are looking at
possibly moving up to the
Peace or to Bonnyville.
“Th at’s where we
have actually been doing
quite a few systems – up
in Wabesca and Grande
Prairie and the Dawson
Creek area,” Guest said.
Brian Guest, who founded Guest Controls in 1978, poses with his son Chad, the company president, during the grand opening of the company’s new building in the Hill Industrial Park in Lloydminster.
A30 PIPELINE NEWS November 2011
ISO 9001:2008REGISTERED FIRM
NEW!
[email protected] www.marmit plastics.com
888.868.2658
Highway 43 West, Grande Prairie
PO Box 366 Station Main, AB T8V 3A5
“The Team You Can Trust”TT“T“T““
MPIMARMIT PLASTICS IN
C.
MARMIT PLASTICS INC
.
100 G allon Double Wall
Tank
Lloydminster – A lot
of heavy lifting goes on
under the shop roof of
Full Tilt Field Services
in Lloydminster, a com-
pany that specializes in
the manufacture of cus-
tom truck deck packages
and the installation of
articulating cranes.
Full Tilt is a dealer
for Fassi articulating
cranes and National
Cranes. Th eir prod-
ucts help to transform
all brands of customer
trucks into full service
picker trucks, mainte-
nance units, winch trucks
and small deck trucks.
“We take a cab and
chassis from a customer’s
truck – whatever brand
they bring in,” said shop
manager Lee Steinbring.
“We work with them
to make a full package of
what they require – cus-
tom built from front to
back – tool boxes and
decking and all that kind
of stuff .”
Full Tilt is also a
dealer of IMT truck
bodies that are fully as-
sembled in the shop.
Manual grunt work
is kept to a minimum
thanks to a set of power-
ful overhead cranes and
a 30,000 lb. truck lift, all
housed within a mas-
sive 54,000 sq.-ft. shop
shared with its parent
company, CE Franklin
Ltd.
“We have three over-
head cranes in here to
help assemble these new
trucks,” said Steinbring.
“We have two sev-
en-ton cranes and one
fi ve-ton. Th is way we can
grab any size of picker
or crane and put them
on the unit. We built the
space with a really high
roof so we can handle a
fairly high unit.”
Th e cranes are also
used to lift heavy manu-
factured deck parts that
are welded in the fabri-
cation shop where the
bulk of manufacturing
begins.
“We bring in the cab
and chassis and look at
the placement and how
we can build around the
fuel tanks that come with
the unit and design the
unit with the customer
to make it work for their
application,” said Stein-
bring.
“Th ere’s a lot of weld-
ing and a lot of steel. We
build the steel frame on
top of the chassis all the
way up. We custom make
all of our tool boxes. We
can build any size they
are looking for. We can
build our own aluminum
doors here.
“Th e sky is the limit
when you are coming up
with any new ideas to
build stuff .
“We do it all from
brand new trucks to
customers bringing in
older cabs and chassis
and making the modifi -
cations that they desire
– whether it’s modifying
their tool boxes or add-
ing new ones on.”
Custom features can
range from storage de-
vices such as pinch bar
holders and pipe rack ac-
cessories to side racks.
Page A31
Shop manager, Lee Steinbring, opens a garage door at the Full Tilt shop revealing a set of Fassi articulating cranes or knuckle booms as they are sometimes called. Full Tilt is a dealer for Fassi and National Crane equip-ment that is used on pickers for the oil and gas and construction indus-tries.
Full Tilt cranes make light of lifting
PIPELINE NEWS November 2011 A31
Knuckle booms more compact on truck Page A30
Picker trucks outfi tted with a Fassi
articulating boom, also known as a
knuckle boom, have a lifting capacity
from one ton to 50 tons.
“Th ey are fairly common on a lot of
maintenance units and fl ushbys,” said
Steinbring. “Th e Fassi is a little easier
to mount on some trucks, and it’s more
manoeuverable.
On a fl ushby, you don’t have the
room to mount a stiff boom. Th e articu-
lating crane folds up a little smaller and
it’s a little easier to work around.
“It is very popular. A lot of guys will
put them on the smaller trucks. Once
you get past an eight-ton in Saskatch-
ewan, you need a picker ticket to oper-
ate it.
“A lot of people stay with the
smaller ones for building maintenance
and miscellaneous stuff out there.”
National Crane equipment is pop-
ular for pipe handling due to its quick
speed and heavy lifting capability.
Steinbring says a picker truck could
be used for a wide variety of things
from lifting miscellaneous equipment
lying around a yard and pipe handling
to putting roofs on houses.
“Some of them will have man lifts
that go on the end so you can get up
to look at certain things,” added Stein-
bring.
“Th ere is such a wide variety. It’s
just about moving things that you can’t
move by hand,” he said.
Picker trucks are also used in build-
ing supply, construction, tire service,
public works, mining, railroad, and
rental markets.
“We do service the oilpatch, but we
also do a lot of stuff for construction,
roofi ng trucks and little deck trucks for
delivery – a little bit of everything,” said
Steinbring.
“Once the trucks are done, I’ve got
an engineer who goes through the crane
mount and ensures everything is secure
and sound and gives it a certifi cation for
the year.”
Full Tilt is the only crane dealer in
Lloydminster which means there is a
steady stream of vehicles in all makes
and models for custom deck work and
servicing of truck mounted equipment
that arrive at their shop.
“It’s been fairly consistent. It’s been
a steady incline here for the last six
months,” said Steinbring.
“It looks like the sky is the limit
again. It just keeps increasing as we
go.”
Full Tilt is also a go-to shop for
light and heavy duty mechanical repairs
and safety checks on all kinds of oilfi eld,
industrial and commercial vehicles for
service in Alberta and Saskatchewan
including service rigs and drilling rigs.
Full Tilt is well known as a manu-
facturer of hydraulic skid packages used
in the oilfi eld and is also a dealer of
VMAC compressors, and Crane Smart
Systems under the CE Franklin um-
brella.
CE Franklin distributes pipe, valves,
fl anges, fi ttings, production equipment,
tubular products and other general oil-
fi eld supplies to oil and gas producers
in Canada as well as to the oilsands, re-
fi ning, heavy oil, petrochemical, forestry
and mining industries.
Mechanic Ian Bialowas greases a ball joint on a Ford F-550 in Full Tilt’s automotive service and repair shop.
A32 PIPELINE NEWS November 2011
Lloydminster – Archer Daniels Midland Company (ADM) has donated
$25,680 to Lakeland College to help fund the curriculum of a new blended
program in second class power engineering.
Th e funding for second class power engineering studies is in keeping with
Lakeland’s plans to expand its training opportunities for careers in the oil and
gas industry under a new energy, entrepreneurship and Saskatchewan program
located at the Lloydminster campus.
“A new second class power engineering program will be part of program-
ming available from Lakeland College, a long-time training provider serving the
Alberta/Saskatchewan region, that would train an additional 80 students over
four intakes of students per year,” said Kara Johnston, energy program director.
“It will be an excellent addition to our current program off erings aimed to
serve several vital industries within our geographic area.”
Th e program funding cheque was presented to Johnston by Mike Deck,
ADM donates seed money to Lakeland
Lakeland heavy oil and operation technology students joined ADM’s Mike Deck (far left) and Lakeland’s Kara Johnston (far right) during a cheque presentation on Oct. 6 at the Lloydminster campus. ADM donated $25,680 to the college to go towards the creation and curriculum development of a blended program in second-class power engineering. Photo submitted
plant manager of ADM Agri-Industries, a wholly owned subsidiary of ADM
that operates a canola processing plant in Lloydminster.
“ADM strives to make a positive diff erence in the communities where we
live and work,” said Deck during the Oct. 6 presentation.
“We are proud to present this gift to Lakeland College and look forward
to helping develop a program to give power engineers an opportunity to up-
grade their skills, increase their personal safety and improve their operational
effi ciency.”
Currently, Lakeland off ers a one year certifi cate program in fourth class
power engineering with plans to off er a two year diploma in third class power
engineering in 2012.
Th e upgraded programming will be housed in a new $30 million heavy oil
operation technician (HOOT) lab with the fi rst phase construction expected to
begin in the spring of 2012.
Th e Alberta government kicked off the project fundraising in July with a
commitment of $4.9 million toward the fi rst $15 million phase of construction.
Th e new lab will include a new water testing room, an operations control
room, an operations lab and simulation and gas process labs.
Classrooms, lecture theatres, a student lounge, a computer lab and faculty
offi ces will be added in the second phase of the project.
A new power engineering lab and facility would enable the college to in-
crease seat numbers in its over-subscribed HOOT program and transition the
current one-year certifi cate HOOT program to a two-year program.
Th e facility will also enable Lakeland to off er more customized oil and gas
programming including petroleum management training and short-term, just-
in-time courses to address specifi c industry needs.
Th e existing HOOT program provides students with lab and classroom in-
struction in the operation and maintenance of boilers, turbines and combustion
engines leading to an industry practicum and a fourth class power engineering
exam in Alberta.
Th e donation is a part of the corporate ADM Cares program, a social in-
vestment program that directs funds to initiatives and organizations that drive
meaningful social, economic and environmental progress worldwide.
Th e program comprises three distinct focus areas: supporting the responsible
development of agriculture, improving the quality of life in ADM communities
and fostering employee giving and volunteer activities.
PIPELINE NEWS November 2011 A33
2009 FREIGHTLINER FLC11264SD stk #s picker unit,c/w Manitex 30102 picker,490 DD60, Allison Automatic
$325,000
1998 GMC TOPKICK C7500 ,Stk# J504146, 6
speed trans, single axle,
18 ft. deck, Hiab model
105 knuckle picker
$29,900
2005 FORD F550stk# A40565,C/w 1997 Cus-co vac unit,Refurbished in 2008, 500 fruitland blower, TC-350 crude spec
$95,000
2001 WESTERN STAR 4964SXstk# K970766, C/w 3x5, gardiner denver triplex pump, Hutchinson aluminum 11m3 single compartment
$185,000
Access Matting For Sale or Rent
Don’t Let The Weather Dictate Your Drilling Operations
Our Mats:* 8’ X 14’ Solid Oak (Hardwood) 3-Ply Laminated Mats
* Optional Interlocking Fingers Available Upon Request * A Beefy ‘187’ Carriage Bolt Pattern (Zinc Coated) * Green Painted Ends For Added Longevity To Cut Boards
Eric Ducharme 204.724.0592 or Chris Allison 204.851.1709
Call Today for Competitive PricesFor More Information visit us online @
4024
9211
•06/
25/1
0
By Brian ZinchukShaunavon – A little
south of Shaunavon, just
off the highway and nes-
tled in a bit of a valley, is
where you will fi nd one
answer to the accommo-
dations shortage in the
Shaunavon area.
Paladin Accomo-
dations Ltd. set up its
camp 22 kilometres
south of Shaunavon and
two kilometres east of
the highway. Th ey are
using land that is owned
by Audrey Matyka, of
Matyka Oilfi eld Service.
It’s far enough from
town to be quiet, and
peaceful. “Th e stars are
brighter,” noted Jona-
than Lupul, general
manager.
Clayton Greenlay is
the camp manager. Th e
operation is owned by
the Lupal family.
“We started offi -
cially January 4. We had
about a year and a half ’s
prep work before that,”
said Lupul.
“Th e trailers were
on the ground in August
2010,” Greenlay said.
Th ey had to run in gas,
power, their own septic
system and well in order
to get up and running.
Unlike camps running
off noisy and expensive
diesel generators, the
camp is tied into grid
power.
It wasn’t easy to
get that, however. Like
others in the oilpatch
have told Pipeline News, they’ve had to wait quite
a while for SaskPower to
get them them hooked
up. It took getting a gov-
ernment minister to in-
tercede to see action.
“We were told it
was going to take up to
16 weeks to get power,”
Lupul said. Th e interces-
sion got it done in two
weeks.
“We didn’t have a
customer base when we
started. We couldn’t wait
16 weeks. We had to
bulldoze through that,”
Lupul said.
Th e facility has two
primary components for
a total of 74 beds. A few
are used for staff .
“We have a 49-bed
Atco dorm,” Lupul said.
Th ey have individual
rooms, and common
washrooms.
He added, “We have
a fi ve unit Aramark com-
plex with 25 beds.
“We leased a two-
unit rec room. Th e
kitchen is in the Ara-
mark unit.
Greenlay has worked
on the service rigs and
grew up on a ranch 20
kilometres southeast of
Shaunavon, while Lupul
has been in the service
industry for years.
Greenlay noted one
of the interesting aspects
of running a camp is
pleasing varying tastes
for food. Page A34
Shaunavon camp in placePaladin Accommodations camp manager Clayton Greenlay, left, and general manager Jonathan Lupul, right, pose in front of their Shau-navon area camp.
Photos submitted
A34 PIPELINE NEWS November 2011
www.caltechsurveys.com
CALGARY403 |263 |8055
REGINA306 |775 |1814
UNITY306 |228 |4366
PROFESSIONAL LAND SURVEYORS Wel l S i tes P ipel ines Mapping As-Bui l ts Construct ion SurveysSubdiv is ion/Property Surveys
40242872•0
3/0
6/0
940
2428
72•0
6/25
/10
See our online inventory atwww.brutusbodies.com
4024
7758
•10/
23/0
9
5201
6700
•06/
25/1
0
Page A33 “We really try to step it up on the
food,” he said.
Th ey off er hearty, southwest Saskatchewan home
cooking, Lupul said. “What your grandma makes.”
Th ey aren’t aiming for fi ve star dining, but hearty
food.
“We use a local butcher for meats, local Hutter-
ite colonies for eggs and vegetables,” he said.Greenlay spends up to fi ve hours a day sourcing
food. He said, “We shop daily for fresh food. Some-
times we go to Swift Current, but mostly we get it
in Shaunavon.”
Th ey point out there’s a diff erence from daily
shopping and getting a food truck once a week.
Th e location is on a bus route, so it’s one of the
fi rst to get plowed when the snow falls, they pointed
out.
Th eir clientele has been a mix. “We’ve had drill-
ing crews, heavy haul truckers, helicopter pilots. We
do a lot for frac crews from Baker Hughes and Tri-
can.”
Sometimes the camp will fi ll to the max, then
it will be dead for weeks, then they’ll have 40 beds
fi lled. Cenovus’ activity over the summer kept them
busy.
“We’re putting in a bid for TransCanada’s Key-
stone XL,” Lupul said.
Th e company is also talking about a joint venture
with another housing provider to meet the needs of
that project.
As for early October, they didn’t yet have con-
tracts in place for the winter. But with many drilling
crews staying in campers, and Shaunavon, Eastend
and Gull Lake all full, they anticipate business will
be coming their way.
“Every hotel has been full for much of the past
two, three years,” Lupul said.
Greenlay added, “Calls are coming in all the
time. Th ere’s a lot of activity, we just have to market
more. We have a dogged pursuit of clients.”
74 bed camp in a tight market for places to stay
Clayton Greenlay is on the roof of the Paladin Accommodations camp. It has 74 beds.
PIPELINE NEWS November 2011 A35
A36 PIPELINE NEWS November 2011
www.metaltekmachining.com
ABSA RegisteredConforming to ISO and API Standards • 24hr Service
780 - 875 - 6535
TUBING DRAINS
FAVAFLOW SURE
VALVEC-VICES ROD BREAKER
WELLHEAD FLANGES
BAILER BITS
Drill Collar & Drill Pipe Recuts
Thread & Rethreadof Casing
REAMER SUBS
BOP TOPPLATES
Design - Engineering - ManufacturingDesign - Engineering - Manufacturing
· Wellhead Equipment Design,Manufacturing and Repair· Thread and Re-thread Casing, Tubing and Line Pipe· Drill Pipe and Collar Storage and Inspection· General and Custom Welding and Manufacturing· C.A.D Library of Parts· Complete Assemblies
· Product Development
· Rotary Connection Manufacture and Repair· Down Hole Production and Fishing Equipment Construction· Phosphate Coating Available For Finished Parts· MIG, TIG and B Pressure and Aluminum· Service and Drilling Rig Stocked Parts· Custom and Production Machining· Rapid Prototyping
PIPELINE NEWSSaskatchewan’s Petroleum Monthly
B-SectionNovember 2011
By Geoff LeeWainwright, Alta. – Davco Welding Ltd., based
in Wainwright and Lloydminster, has bulked up
its crane fl eet with the addition of a new 250-ton
Link-Belt crane for heavy duty facility construction
throughout east central Alberta and western Sas-
katchewan.
Th e company has also acquired a small, but nim-
ble, Spyder crane for inside facility work with the
ability to walk through a one-man door, turn into a
four-foot wide hallway and lift 6,380 pounds.
Davco specializes in oilfi eld construction, main-
tenance, and heavy lifting with a growing demand
for a variety of cranes and lifting capacity to move
facility equipment such as tanks, compressors, pipes,
valves and header inlet buildings.
“Th ings are getting heavier in the oilfi eld,” said
Faas, who co-owns the company with his wife Con-
nie.
“As they can haul bigger and heavier loads, big-
ger and heavier trailers are getting made, and loads
are getting heavier to lift and set in place when they
get to a facility.
“We started out with a 6-ton Broderson crane
that we worked around the yard and at some sites.
Th en we got a 12-ton we took out on smaller jobs.
“Now, we’ve got bigger jobs, and we are working
on bigger pipe and using bigger cranes.
“We go from a 14-ton to a 250-ton all terrain.
Th e 250-ton crane is used for a lot of long reach
heavier stuff such as heavy compressors.
“Right now, it’s on a river job that is reaching out
over 200 feet. We have rented cranes in the past to
fi ll the gap that we didn’t have. Finally, we decided
we should have one of our own.”
Th e Link-Belt ATC 3250 has a reach of 358 feet
which enabled Davco to put the crane to work in
September and early October hoisting pieces for a
coff er dam for a fresh water intake system on the
North Saskatchewan River east of Lloydminster.
Th e heavy crane work was part of a steam assist-
ed gravity drainage (SAGD) construction project.
Davco is the only company between Edmonton
and Saskatoon with a 250-ton crane that was imme-
diately put into action lifting a 67,000 pound valve
assembly near Strome, Alberta after it arrived at the
Wainwright yard in August.
It has also been used to hoist 40,000 pound sec-
tions of 30-inch pipe at the Strome job site east of
Camrose.
Th e versatile Spyder UNIC 295 crane is also
earning its keep inside plants and facilities with re-
stricted lifting requirements.
“Th e Spyder crane is to be able to get inside
buildings and able to work inside without having to
get a really large crane to tear the roof of a building
off and do a bunch of extra work,” said Faas.
Th e Spyder has a lifting height of 29 feet and a
boom length of 28 feet.
Page B2
Davco’s new 250-ton Link-Belt crane has a 358 foot reach that was ideal for hoisting pieces for a coffer dam for a fresh water intake system as part of a SAGD project on the North Saskatchewan River, east of Lloydminster. The project took place in September. Photo submitted
Cranes from a 'spyder' to 250 tons: Davco
B2 PIPELINE NEWS November 2011
Page B1
“It’s excellent for inside a facility or a tank farm.
It saves a lot of time and money,” said Faas.
“We can travel out to the site. It’s a lot quicker to
get it in there. We do not have to get extra crews just
to be able to get a bigger crane onto site.”
Davco has a total of nine cranes for lifting oil-
fi eld skid units, compressors, tanks, vessels and pip-
ing of any confi guration along with heavy military
equipment for CFB Wainwright.
“Th ey get loads out there – sometimes dead
equipment and stuff that needs to lifted,” said Faas.
“When they do an exercise, they haul a bunch
of equipment in and if they can’t unload it, they call
us to do it.
“We lift tanks, guns, helicopters, planes – all
kinds of cool stuff they have.”
Davco also assists emergency response person-
nel at accident scenes by utilizing long reach cranes
that have even been use to put derailed trains back
on track.
“Th ey are usually interesting jobs,” said Faas.
“Luckily, we have never been to an accident where
anyone has actually been killed.
Page B3
Tanks, guns, helicopters - all in a days work
Lifting this 67,000 pound valve assembly at an oil eld facility near Strome, Alberta was easy work for Davco’s new 250-ton Link-Belt crane.
Photo submitted
This new Spyder crane quickly earned its keep lifting a 2,000 pound valve inside a Pikes Peak SAGD facility in the Lloydminster area. The Spyder can work well in tight spaces.
Photo submitted
Dave Faas, president of Davco Welding based in Wainwright and Lloydminster, climbs the stairs of this fabricated steel platform made for a client to go over a pipeline rack at a facility.
Photo by Geoff Lee
www.davco.ccwww.davco.cc
Oil eld Facility Oil eld Facility Construction Construction
Services in Alberta Services in Alberta & Saskatchewan& Saskatchewan
• Welding
• Pipe tting
• Facility Construction
• Cranes & Heavy Lifting
• Skid Packages
• Painting & Sandblasting
• Torquing
• B Pressure Welder Testing
• Air Trailer
Wainwright - LloydminsterWainwright - LloydminsterPhone: (780) 842-5559 • Email: [email protected]: (780) 842-5559 • Email: [email protected]
PIPELINE NEWS November 2011 B3
89 Escana Street, Estevan Sk. • Phone: 637.2121 Toll Free: 1.866.332.2121
• Estevan • Saskatoon • Regina • Winnipeg
• SALES • SERVICE • PARTS • LEASING
Estevan Sk • Phone: 637 22112221111
Trucking Estevan Ltd.Trucking Estevan Ltd.
88 Devonian Street, Estevan, SK.88 Devonian Street, Estevan, SK.Ph: 634-4041 (24 hr) • Fax: 634-4040Ph: 634-4041 (24 hr) • Fax: 634-4040
www.samstrucking.ca
• Full Service Trucking Company• Top Quality Rig Moving Experience
A 90 ton crane was deployed by Davco Welding to lift this 2,000 barrel tank into place. Photo submitted
Jake Courtemanche guides a load of hollow structural steel at Davco’s fab-rication shop in Wainwright. The lift-ing was done using a 90-ton crane.
Photo by Geoff Lee
Page B3“Safety has really
changed things a lot in
how we, and everybody
else, operate. Safety is a
big thing.
“Your safety record
is really important when
you are awarded jobs.
Jobs are awarded be-
cause of your safety pro-
gram. We like to think
our safety record is one
of the best.”
Davco got its start
30 years ago as a small
mom and pop weld-
ing and quality control
company that eventually
purchased its nine acre
site as business grew.
Today, the com-
pany provides a range
of oilfi eld services from
cranes and heavy lifting
and facility construction
to welding, skid packag-
es, torquing, and paint-
ing and sandblasting in a
variety of buildings and
fabrication tents.
“Th ings just kind
of grew and grew,” said
Faas, who has a staff of
more than 100 employ-
ees including his twin
sons Kevin and Jamie
who perform a variety of
supervisory functions.
“We are kind of a
one-stop shop,” said Faas.
“We like to think we can
do just about everything.
We do it right from the
drawings to the painting
and installation.
“We are getting
more and more work for
everything – our fi eld
crews, our manufactur-
ing – everything to the
cranes. It’s getting busier
and busier.
“We are looking at
expanding some more.
We are looking at hir-
ing some more. I would
like to hire more guys. I
think we can handle up
to 125 pretty easily.”
Davco has been
awarded some of the
structural steel work to
support the proposed
Keystone XL pipeline by
TransCanada Corpora-
tion.
“Th at was defi nitely
a bonus,” said Faas. “Th at
gives us work to look for-
ward to. Th e work will be
structural for the pipe-
line for the compressor
stations as they go down
the line.”
Davco previously
landed a contract tying
in lines at Hardisty for
the main Keystone pipe-
line in 2009.
Crews also weld ev-
erything from two-inch
to 48-inch pipe at facili-
ties and compressor sta-
tions for pipelines from
Hardisty to Manitoba
with the assistance of
picker trucks.
“It’s mostly small
stuff that they lift or haul
out to site like small pip-
ing valves and assemble
them on site,” said Faas.
“Th ey use the pick-
ers to lift them – mostly
in the yard – it’s load-
ing them up and taking
them to site.”
Davco’s fl eet of
equipment includes
rollers, bevellers, line-
up clamps, hydraulic
torques and other es-
sential tools to com-
plete large scale facility
construction and facility
upgrades, routine turn-
arounds and shutdowns,
and spool replacements.
Davco signed on for Keystone XLstructural work
B4 PIPELINE NEWS November 2011
IInnssttrruummeennttaattiioonn SSaalleess && RReennttaallss
(Since 1985)
AAccuutteecc SSyysstteemmss LLttdd.. ((330066)) 448877 22553366 wwwwww..tthheeqquueessttggrroouupp..ccoo
(Since 1985)
LLEVEL-PRO Tank Gauging System
(Since 1985)
TM
LLEVEL-PRO Tank Gauging System
LEVEL-PRO “ PLUS“c/w Low Cost Simplex Satellite
Designed for Permanent & Portable tank applications.
TAANNKK LLEEVVEELL IINNVVEENNTTOORRYY &&SSPPIILLLL PPRREEVVEENNTTIIOONN OOn-site Displays
MMESSENGER1100 4X
((Since 1985)
RRemote siteCommunications
TMTAANNKK LLEEVVEELL IINNVVEENNTTOORRYY &&
SSPPIILLLL PPRREEVVEENNTTIIOONN(Since 1985)
ELECTRICAL • Gensets - 40 KW - 200 KW• Light Towers • Transformers
Mudvac's, Transfer Pumps c/w Manifolds & Hoses, Trash Pumps, Matting All Sizes,Bowen Power Swivels, 125 h.p. Boiler
GENERALOILFIELD HAULING
TANKS (All sizes)
• Mud • Shale • Premix • Processing • Polymer • Cone • Flare • Floc • 400 BBL
BORDER TANK RENTALS LTD.• LEADERS IN OILWELL DRILLING PRODUCTION RENTAL EQUIPMENT •
FAX: (306) 634-9963PHONE: (306) 634-7700P.O. Box 1238
ESTEVAN, SASKATCHEWAN S4A 2H8
Wainwright, Alta. – Steady as she goes. Th ose are
comforting words from ship captains and offi cers of
economic development such as Carley Herbert with
the Town of Wainwright.
Herbert sees smooth sailing ahead for the local
and regional economy including the oil and gas sec-
tor.
“We just talked to a few oil and gas companies
in the area, and they are all saying the same kind of
thing – it’s been a very steady year,” she said.
“Th ey are expecting it to get even busier by the
end of the year and into next year which is really
positive.”
Th e September newsletter of the Wainwright
Economic Development Board lists 16 new business
start-ups in town in 2011 including a Penn West
outlet.
Th ere is also a positive buzz about the acquisi-
tion of Carson Energy Services Ltd. by Flint Energy
Services Ltd. that aff ects approximately 100 Carson
employees in Wainwright.
“We are anticipating that will help us because
Flint is even larger than Carson,” said Herbert not-
ing the takeover went into eff ect on Oct. 1.
“I did talk to them after this announcement and
they all felt really positive about the acquisition. Th e
management is staying on.”
Wainwright is also benefi ting from a strong ag-
ricultural economy this year, and some new construc-
tion projects at CFB Wainwright despite Canada’s
pullback from Afghanistan.
Defence Construction Canada closed tenders on
Oct. 4 for the construction of a $30 million expan-
sion of its vehicle maintenance facility.
Th e military developer also plans to tender the
construction of a proposed $5.1 million community
centre at the base in the spring of 2012.
“With the military and agriculture having a
great year this year, and a steady oil sector, the busier
it is for us,” said Herbert.
“Th ere’s more money been spent here and more
businesses starting.”
Several commercial franchises including Hump-
ty’s Family Restaurants, Quiznos and Ricky’s All
Day Grill Restaurants and RONA hardware have
posted franchise investment opportunities on the
town’s website.
“We have a lot of people interested in Wain-
wright because we are kind of a growing commu-
nity,” said Herbert.
“We are kind of a regional hub and we have al-
ways had a very stable economy. It’s a good place to
start a business.
“A lot of franchises are looking here, so hopefully
if we can match them up, we can get them here.”
Proof the town is growing will come with the
results of the federal government’s 2011 census.
Page B5
Wainwright ring on all cylinders
Wainwright economic development of cer, Carley Herbert sees positive growth in this year’s re-gional oil and gas economy continuing into 2012. Wainwright is also bene ting from a strong agri-cultural economy in 2011 and new construction projects in the works for CFB Wainwright.
PIPELINE NEWS November 2011 B5
#1 Hwy 18, Oxbow, Saskatchewan306-483-5132 • www.ensignenergy.com
Big Sky Drilling, operating out of Oxbow, Saskatchewan, has the largest rig eet in Saskatchewan.
Big Sky Drilling specializes in oil and natural gas drilling in Southeast Saskatchewan and Southwest Manitoba.
FLOAT EQUIPMENT-REAMERS
Estevan, SKwww.gillisspowertongs.com
Tel: (306) 634-6768Fax: (306) 634-6738
Serving the Serving the southeast corner of southeast corner of Saskatchewan since Saskatchewan since
19931993
Sales & Safety:Sales & Safety:Ryan WallingtonRyan Wallington
421-7011421-7011
Manager:Manager:Dylan GillissDylan Gilliss421-8158421-8158
Sales:Sales:Logan GillissLogan Gilliss421-8481421-8481
Fax: 634-8298Email: [email protected]
EstevanSaskatchewan
Page B4Th at should put the
population near or over
the 6,000 mark, not in-
cluding the 600 or so
military personnel at
CFB Wainwright – with
many factors driving lo-
cal growth.
“We have a popu-
lation of 40,000 in our
trading area,” said Her-
bert.
More seniors are
also choosing to live in
Wainwright with the de-
velopment of retirement
homes by Points West
Living, an Alberta pro-
vider of supported living
options for retirees.
“We have retirees
coming here for better
health care and service,
and people for diff erent
industries – the oilfi eld
and the military obvi-
ously,” Herbert said.
A newer hospital to
replace the aging Wain-
wright Health Care
Complex tops the town’s
economic wish list with
land available in a con-
cept development.
“We are hoping we
have a spot for them if
the government comes
through with the fund-
ing,” said Herbert.
“We are hoping with
the military here, that
might help. Obviously,
if that were to happen,
then we would become a
bigger hub for people to
move to and retire to.
“It would be excel-
lent. Obviously, health
care is huge in any com-
munity. We have a lot
of doctors. We have 10
doctors here which really
helps us as well.
“People come here
from Viking and Lloy-
dminster for doctors.
When they are here, they
do other shopping too.”
While commercial
property along Highway
14 through Wainwright
is in short supply, the
town is forging ahead to
develop and service new
residential and industrial
lots to keep the economy
ball rolling.
“We plan to continue
to grow and try to work
with diff erent companies
to come here,” said Her-
bert. “We are developing
our own residential sub-
divisions to keep that go-
ing.”
Th e town plans to
develop up to 135 new
residential lots by next
fall in the fi rst phase of
its newest Enstrom sub-
division at the east end of
town.
An 190 additional
lots will come in Phase 2
where that new hospital
would be located.
Only 14 residential
lots are available in the
fi nal phases of the exist-
ing Baier residential sub-
division that the town
also serviced in keeping
with its plans to attract
newcomers.
Th e Baier subdivision
features a mix of single
houses and townhouses,
but rental housing re-
mains in short supply.
“We have had one
apartment go to a condo
so it limits the rentals.
Obviously, we have a
need for aff ordable hous-
ing,” said Herbert.
“Th at being said, we
do have Habitat for Hu-
manity planning a build
here for next year. Th ey
are going to build a du-
plex for a couple of fami-
lies.”
Only one indus-
trial lot remains in Tory
Heights Industrial Park,
but the town will prepare
plans to service fi ve new
lots over the winter.
“We are looking for
options for that for the
longer term as well,” said
Herbert.
Several franchises seeWainwright as an opportunity
The last available residential lots in the nal phases of the Baier subdivi-sion at the east end of Wainwright are lling up quickly as the town con-tinues to grow.
Lloydminster – Ques-
tions are a scientist’s best
friend when it comes to
research and discovery.
Th at is the case for
Jose Alvarez, a research
scientist with Alberta
Innovates Technology
Futures whose research
into the eff ectiveness of
waterfl ooding in heavy
oil applications began
with questions.
Th ose questions
were key to the clarity
of his presentation on
waterfl ooding at the 18th
annual Technical Heavy
Oil Symposium held in
Lloydminster Sept. 14-
15, and are worth re-
peating.
Why is heavy oil
waterfl ooding consid-
ered to be an unfavour-
able recovery method?
Can knowledge
gained from conven-
tional oil waterfl oods be
extended to heavy oil?
Why is published
data on fi eld studies lim-
ited, controversial and
contradictory?
Alvarez said these
questions have led him to
advocate more research
on the mechanisms of
how to get oil out of
pores in the reservoirs
utilizing waterfl ooding
with the goal of increas-
ing recovery rates.
Th e theory of wa-
terfl ooding is to restore
pressure to a reservoir by
“sweeping” the reservoir
with water via injector
wells placed through-
out the reservoir to dis-
place the remaining oil
towards the producing
well.
Alvarez noted exist-
ing research shows that
sweep effi ciency drops
off in heavy oil due to
the higher mobility of
viscous oil.
Higher mobility is
bad he said because in-
stead of pushing the oil
like a piston with water,
it pushes it like a fi nger.
“Th ese fi ngers are
not very effi cient in or-
der to push the oil from
the reservoir,” said Alva-
rez.
“Th e problem is we
don’t understand what
is happening in some re-
gimes with waterfl ood-
ing.
“We know that, for
example, with heavy oil
we are not getting as
high a recovery factor as
light oil; however, we are
getting recovery factors
that are not explained by
classical theory.”
“We need to un-
derstand what are the
mechanisms in order to
improve the recovery
factor in heavy oil,” he
said.
Alvarez believes re-
search needs to focus on
the recovery mechanisms
after what’s called break-
through – when the fi rst
drop of water from a
waterfl ood arrives at the
production well.
“I believe there are
two kinds of regimes.
One is before break-
through. Th at is pretty
well explained by clas-
sical theory. We know
about that,” he said.
“However after
breakthrough, what we
have found is that up
to 50-60 per cent of the
oil is produced at very
high water cuts, so what
the theory is explaining
there is not very clear
now.”
Alvarez says fi eld
scale experiments are
needed to evaluate the
real time importance of
the mechanisms.
He also said future
research needs to incor-
porate the mechanisms
into advanced simula-
tions.
“If we can under-
stand the mechanisms
better, we can increase
the recovery factor of
our heavy oil, and we
can push waterfl oods
into even higher oil res-
ervoirs which have a lot
of here in Canada.
“Some people will
tell you can’t use water-
fl oods for higher than
100 centipoise (viscous
heavy oil).
“However, here in
Canada, we are proving
those people are wrong.
We have been pushing
the envelope up to 1,000
cP, and we have recov-
ered up to 40 per cent
of the oil. We are try-
ing to push the envelope
higher.
“In Lloyd, there is a
huge tradition. Since the
’60s they have been us-
ing waterfl ooding. Th e
recovery factor can be
improved. We can write
new books about how
to extrapolate what we
know in Lloydminster
to the world.”
Alvarez expects ad-
vances in waterfl ooding
by the heavy oil indus-
try in the Lloydminster
area will be universally
accepted, the same way
that the local develop-
ment of heavy oil pro-
duction with sand or
CHOPS has gained
worldwide usage.
“What we know
here in Lloyd will be
used in other countries,
but what we need to do
is to better understand
the mechanisms, then
we can get more oil from
the ground,” he said.
B6 PIPELINE NEWS November 2011
FOR LEASE OR RENT20 ac. subdivided yardsite located in the center of the Waskada, Manitoba oil eld.
It includes 3 bedroom home with central air & electric heat suitable for living or of ce.
- 3,600 sq. ft. of cold storage sheds- property is fenced and has 2 large accesses on to main road
- treated water pipeline with multiple hook ups- MTS high speed phone service
- lots of room for parking of large equipment or heated shop- great location for oil eld based business
Looking for a long term tenant. For information contact Greg anytime
at 204-522-5044.
SVEIN BRYEIDE SVEIN BRYEIDE CONSTRUCTION Ltd.CONSTRUCTION Ltd.
HWY. 47 N. AT BENSON Fax: 634-9798 Cell: 421-0203
• Trackhoe and Backhoe• Lowbeds and More
Serving Sask for over 30 years.
• Earth moving and Oilfield Construction
• Lease Preparations and Restorations
• Pipeline Construction and Maintenance
• Road Building, Dugouts• Dozer Ripper and Winch Cats
• Motor Scrapers, Graders, Gravel Truck
634-6081
Water ood mechanisms need study
Jose Alvarez, a research scientist from Alberta Innovates Technology Futures, kicked off the 18th annual Technical Heavy Oil Symposium in Lloydminster in September with a talk on the state and direction of heavy oil water ooding.
PIPELINE NEWS November 2011 B7
Innovation Assured, Value DeliveredPrairie Petro-Chem, a Clariant Oil Services business, is a leader in the development and application of oil and gastreating compounds and industrial chemicals. Our expanded geographic position and talented and knowledgeableteam of experts are ready to help you improve your operations. Contact us today to learn more about our chemicaltechnologies and services.
Prairie Petro-Chem, A Clariant Oil Services Business: 738-6th Street, Estevan, SK S4A 1A4. Phone Orders: 306-634-5808. Fax Orders: 306-634-6150. Email Orders: [email protected]. General Inquiries: 306-634-7362. General Fax: 306-634-6694.Web: www.oil.clariant.com. Twitter: @ClariantOilSvcs What do you need?
By Brian Zinchuk
Weyburn – By add-
ing more services and
expanding existing ones,
Gibson Welding Ltd.
has been able to grow
substantially in recent
years. For instance, a
drive around the Stough-
ton area will often result
in fi nding a picker with
“Gibson Welding” on its
boom.
Th ere are a lot of
turns required to get into
Gibson Welding’s main
yard, about 12 miles
southwest of Weyburn.
Many roads and ap-
proaches in the area are
still cut due to the fl ood-
ing this past spring. “We
still can’t used our main
road. We’ve been trapped
here since last spring.
Th ere were three feet of
water on the road,” said
John Gibson.
Gibson sat down
with Pipeline News in a
brand new offi ce shack
that arrived just a few
days prior. Th e larger of-
fi ce is in keeping with
the company’s growth
trend.
Gibson started his
business as a small weld-
ing operation. “It started
out with me welding.
I had a little shop here,
and built things. I had
a truck and went out to
the drilling rigs,” he re-
called.
“It sort of mutated
into oilfi eld trucking
and rentals. Th at’s was
we primarily do now.
“I started build-
ing catwalks for service
rigs. We’ve got 22 sets.
Th ey’re just starting No.
23. We rent them out.”
“We keep three
welders, and that’s what
they do, build things and
fi x things,” he said.
When they’re not
making catwalks or other
items, they make tanks.
“We build our own
400-barrel tanks,” Gib-
son said, noting that
since they had so much
trouble in getting tanks
from other suppliers, the
company began building
its own fi ve years ago.
Prior to that, tanks were
coming from a northern
Alberta manufacturer.
“We don’t sell them.
We build them to rent.
We’ve got 80-some
tanks now.
Business really start-
ed to pick up around
2006 for Gibson Weld-
ing. He said, “It all start-
ed around fi ve years ago.
We were getting enough
to eat, but certainly noth-
ing like it is now.”
Th e Bakken play
made all the diff erence,
he explained.
Depending on the
season, the company’s
staff runs around 20 to
25. “We’re staffi ng up for
winter now. We get busy
in the winter. We’ve got
four steamer trucks we
fi re up.”
Pickers addedTh e pickers were
added to move rental
units. “Six years ago, we
were having trouble get-
ting trucks to move our
rental units. So why don’t
we buy a truck?” he said.
Page B8
This Gibson Welding picker was found near Stoughton on Sept. 27. Photo by Brian Zinchuk. The company estab-lished a shop at Stoughton just a few miles away.
Gibson Welding grows with Bakken play
FAX: 306-453-4476BOX 40, CARLYLE, SASK. S0C 0R0
www.evergreenenviro.ca
306-453-4475
* Environmental Protection Plans * Impact Assessments * Pre-Site Assessments * Environmental Audits & Assessments
* Well Site & Battery Abandonments * Drilling Waste Management * Pre/Post Water Well Testing * EM Surveying * GPS Mapping
* Formerly “Three Star Environmental”
B8 PIPELINE NEWS November 2011
NOW IN OUR
NEW LOCATION!413 Mississippian Drive
Estevan
Phone: 634-7892 • www.ipc-sk.ca
Proud to be an active part of the communityLocally Owned and Operated
Offering you Competitive PricesQuality Products
Great Service
WATER ENERGY RECOVERY
Location: Midale, SK 16-09-07-11 W2
A full oilfield waste management, custom treating and water disposal facility
306-458-2988306-458-2988
www.palko.com
New locations in Construction - Opening SoonOungre: Waste Water Processing Facility
Location: 01-16-002-14w2
Stoughton: Waste Water Processing FacilityLocation: 16-21-007-08w2
Page B7Initially, the fi rst one was a bit of
a letdown. He bought an old truck
whose clutch promptly dropped on
it. “We put a clutch in, and away we
went,” Gibson said.
It was a 17.5-ton unit. Th ey still
have it. It stays in the yard.
“I ran it myself seven days a week.
We couldn’t keep up,” he said.
A year or so later another picker
was purchased, then another. Each
was progressively bigger – 17.5, 23,
28, 30, 35 tons. Th e company now has
fi ve pickers in total, with a sixth being
built. It’s a 45-ton tri-drive, tandem
steer Kenworth equipped with a fi fth
wheel to pull its own trailer. Th e crane
is a Weldco unit with a swing cab.
With the mix of sizes, Gibson said,
“We hit each market,” adding that get-
ting bigger units meant getting “a little
braver each time.”
“Th ere’s incredible demand. It’s
very related to the type of work the
Bakken requires. Th ose fracs are very
picker intensive.”
Th ey also have three “Texas Bed”
trucks, one of which is a tri-drive. A
further winch tractor is being built in
Edmonton.
Rig matting has been in especially
high demand this past year, with Gib-
son saying, “We’re buying it buy the
truckload. It’s usually moved by pick-
er.”
Gibson Welding has grown to
become a very vertically-integrated
company, which is how Gibson likes
it. “I’m very much a believer in that. It
makes economic sense.”
If they need a new product or ser-
vice, they add it. For instance, a skid-
steer loader was recently added to deal
with the rig matting, in particular the
swamp matting. “It’s been running ev-
ery day since spring,” Gibson said.
Th e rental fl eet has grown to in-
clude approximately 80 tanks, 22 cat-
walks, 60 test separators, 30 fl are stacks,
and 300 pieces of rig matting.
Another addition has been renting
out work strings, pipe for service rig
work. For companies on a short term
job, it works out well.
“A lot has fallen on our lap because
it fi ts so well with what we’re already
doing,” Gibson said. As an example, he
noted a company will rent their mat-
ting, and then a catwalk. Th at leads
to a work string and tanks, plus light
towers and, if it’s winter, a steamer.
Th en you need the trucking to move
all of it.
Asked if he’s aiming at one-stop
shopping, Gibson replied, “To a cer-
tain point, it is. If we don’t have it, I
can help them get it.”
Gibson noted two local fi rms were
instrumental in getting the company
off the ground. He pointed to Norm
“Pierre” Mondor at Aldon Oils and
Ken Lee with Midale Petroleums.
“Th ey took a chance on me, helped
me get going,” he said. “I wouldn’t be
where I’m at without those two.”
Other supporting companies such
as Crescent Point have helped. Indeed,
when it came time to add a satellite lo-
cation, it landed right in the middle of
the Bakken fairway, at Stoughton.
“It made sense to have a presence
there. We like to keep our rental equip-
ment central. If we’re going to have a
yard, let’s have a shop.”
Th e result is a minimization of
commuting with the heavy trucks. In-
stead, workers can go to the Stoughton
shop in a pickup, and then take the big
truck out to the site. Page B9
Vertical integration keeps adding services
A tri-drive bed truck is a recent addition to the Gibson Weld-ing eet.
Specializing in • pumpjacks
• vessels • manbasket work
Travis Hutt - owner/operatorCell: (306) 487-8120 Bus: (306) 487-2608 • Fax: (306) 487-2296
Lampman, SK. Email: [email protected]
HUTT’STRUCKING LTD.
• 45 Ton Picker • Texas Bed/Winch Truck • Highway Tractor • Highboys • 45 Ton Picker • Texas Bed/Winch Truck • Highway Tractor • Highboys • Stepdecks • Double Drop Trailers • Pilot Trucks• Stepdecks • Double Drop Trailers • Pilot Trucks
“ ” Page B8
“We can reach quite a ways from
Stoughton,” Gibson said.
Construction of the shop started
a year ago in the spring. “Our timing
was terrible,” he said, noting the mud-
dy conditions.
In the last year, the company has
begun to pick up work with Cenovus,
whose primary fi eld is nearby. “Th ey’ve
been kind in giving us a chance,” Gib-
son said. “Th at’s been a pleasant sur-
prise.”
He noted the Bakken play is mov-
ing towards Oungre. One day south of
Torquay he counted 10 rigs, including
both sides of the Canada-U.S. border.
Family operation Gibson Welding is a family opera-
tion. “My wife Marg has been with me
since Day 1,” he said. “She’s the offi ce
trouble-shooter now, a person to go to
when you stumble. She’s been at my
side through it all.
Th eir son, Jason, 28, acts as fi eld
supervisor. “He’s been there ever since
he got out of school,” John said.
Th eir daughter, Michelle, 32, “went
out and saw the world, and decided
Saskatchewan is the place she ought to
be,” John said.
She has a bachelor’s degree of
management in accounting from the
University of Lethbridge, and is now
the offi ce manager.
Jackie, 22, is taking a petroleum
engineering degree in Butte, Montana.
She works with the fi rm as a summer
student. Smiling, John said, “We give
her every terrible job we could fi nd –
22 years of revenge!”
Daughter Morgan, 19, is taking
business admininistration at the Uni-
versity of Regina, and assists in the of-
fi ce.
Daughter-in-law Rena Good-
win, 28, is the safety co-ordinator. She
worked very hard over the past year,
and the company passed its Certifi cate
of Recognition audit with fl ying col-
ors, according to Gibson.
“We believe in safety, but we also
believe in safety with common sense.
We’re fortunate, we’re small enough
we can still have a lot of hands-on.
Pretty well every day, everyone who
works with us interacts with someone
who owns the company.”
Asked about the recent spat of ac-
quisitions in the southeast Saskatch-
ewan oilpatch, Gibson replied, “We’re
not for sale, ever. It’s not part of the
plan.”
“It will take over your life. A fam-
ily business is a great thing, but at the
supper table, it’s still there. We bought
a house in Phoenix just to get away
from the thing.”
“It’s the best of times, but also a
diffi cult time to fi nd labour. You’ve
got to have good people. It’s 30 below,
at 5:30 a.m., you’re putting a guy in a
half-million dollar truck. You’ve got to
have a pretty good guy.
“Saskatchewan’s about ready to
have its turn. We’re just about there.
We’ve got the natural resources, good
’ole farmboys that want to live here. I
think we can become quite a province
in the next few years.
“You have to maintain a favour-
able business environment. You need
to keep it to attract the capital. Th at’s
what we’re lacking. We need the rest
of the work to put money in here,” he
said.
As for their own company’s fu-
ture plans, Gibson said, “I think we’ll
do more of the same, and do it a little
better.”
PIPELINE NEWS November 2011 B9
LINELOCATING
GPSMapping
Box 235
Oxbow, SK S0C 2B0 Canada
Dispatch: 306-483-7897 Offi ce: 306-483-2194
Fax: 306-483-2292
Email: [email protected]
Serving Southeast Saskatchewan
and Southwest Manitoba.
www.absolutelocating.com
Whole family involved with rmMarg and John Gibson own and operate Gibson Welding of Weyburn.Saskatchewan’s about ready to have
its turn. We’re just about there.- John Gibson, Gibson Welding Ltd.
B10 PIPELINE NEWS November 2011
2010 Weybex Award Winner2010 Weybex Award Winner
The environmentally friendly The environmentally friendly alternative.alternative.
Red Deer, ABRed Deer, AB
Calgary, ABCalgary, AB
Frobisher, SKFrobisher, SK
www.dpsmicrobial.com
By Brian ZinchukCarnduff – It all
started out 25 years ago,
with two brothers-in-
law, one truck and one
trailer. Now C & N Oil-
fi eld Maintenance Ltd.
employs about 30 peo-
ple, operates a fl eet of 32
units, and launched its
own oilfi eld supply store
a year ago.
On Oct. 14, the
company celebrated its
25th anniversary with a
customer appreciation
day at its new shop in
Carnduff , the one they
moved into a year ago.
Company founders
Wayne Carley and Doug
Needham sat down with
Pipeline News in that
new shop on the com-
pany anniversary to dis-
cuss their origins. Doug
is married to Wayne’s
sister, Bev.
Carley bought out
Needham three years
ago, allowing him to
retire from the busi-
ness. And while Wayne
is still president of the
operation, his son Kris
runs much of the day-
to-day operations as op-
erations manager. Kris’s
wife Gayla is operations
manager. Doug’s son,
Ryder Needham, worked
with C&N as a summer
student, but has gone on
to a good job with a ma-
jor fi rm in Winnipeg.
Th eir fi rst employee,
Allan Hubbard, rounds
out the management
staff .
“I started with Bed-
ford Petroleums 28 or
29 years ago as an op-
erator,” Wayne said.
“When they sold, I ran
portable separators.”
He was working
under contract for a
successor company of
Bedford.
“I hired Doug to re-
lieve me on weekends.
Page B11
C&N Oil eld Maintenance Ltd. celebrated its 25th anniver-sary on Oct. 14. From left are Allan Hubbard, employee No. 1 and supervisor for circulating and pressure trucks; Doug Needham, co-founder, now retired; Wayne Carley, co-founder and president; Gayla Carley, of ce manager; and Kris Carley, operations manager.
Photo by Brian Zinchuk
25 years for C&N
PIPELINE NEWS November 2011 B11
• Vacuum Trucks• Vacuum Trucks• Steamers• Steamers• Water Trucks• Water Trucks• Tridem & Quad Pup • Tridem & Quad Pup Trailers Trailers
• Tractors/Vacuum Wagons• Tractors/Vacuum Wagons• Fire & Vapor Suppression • Fire & Vapor Suppression Unit Unit• Air Trailers/Safety • Air Trailers/Safety Supervisors Supervisors
CLASSICCLASSICVACUUM TRUCK LTD.VACUUM TRUCK LTD.
24 Hour 24 Hour ServiceService
ALIDA, SKALIDA, SK (306) 483-8697(306) 483-8697
Renting Soon - Call 634-6030 or 421-0252
This is the C&N eet and shop in the early days. Photo submitted
Page B10“As it started to peter
out, I said to Doug, ‘We
should buy out Charlie
Foster.’ He had one ser-
vice truck and trailer, and
did light maintenance.”
Th e pair bought
the truck and trailer for
$27,000 with the help
of a loan from Wayne’s
parents. It was paid off
in three years.
Asked who would
drive, Doug commented
on their diff ering driving
styles, with Wayne being
much more aggressive on
the pedal. “If it was a bid
job, Wayne would drive.
It if was by the hour, I
would drive.”
Th e work was initial-
ly general oilfi eld main-
tenance, doing pipefi t-
ting and changing belts.
Wayne had the benefi t
of four years as an oil-
fi eld operator before they
started, including having
worked for Valleyview
Oilfi eld Services in Ox-
bow. Doug had also put
in six months after high
school at Pembina Me-
ter in Edmonton. Both
farmed.
Doug and Bev
bought the family-
owned jewelry story
from Bev and Wayne’s
parents. Th ey sold it 12
years ago due to an in-
creased focus on the oil-
fi eld. However, during
the early years before the
days of cellphones, Bev
used to do dispatch from
the jewellery store. Cli-
ents would call the store,
and she would reach
them by way of two-way
radio. Bev also worked
on the administration
side of the business.
“When we bought
the store, gold was $35
an ounce. Oil was around
$20 a barrel,” Doug said.
“An ordinary ladies’ gold
band sold for $10 when
we bought it."
At the time of the
interview, oil was trad-
ing around $87 a barrel,
and gold was $1,680 an
ounce.
“In the summer I
farmed, and came back
to the store,” Doug said.
A lot of C&N’s work
was part-time, at fi rst.
Th ey could often wrap
up a job early in the day,
and then go farming.
“You’d wait for the
phone to ring,” Doug
said, noting it was a lot
slower pace than today.
A lot of those jobs only
took three hours.
“When we were
knocking on doors, we
were meeting people for
the fi rst time,” Wayne
said of their eff orts to
drum up business.
Th e previous owners
of that truck and trailer
had worked primarily
for Imperial Oil. “Th at’s
where we started,”
Wayne said.
Both strongly cred-
ited that initial work for
Imperial Oil for defi ning
how they did business.
“Th e changes in safety
haven’t been that big for
us, because Imperial Oil
was on the cutting edge,”
Wayne said. “I think
we’re a better company
today because Imperial
Oil was one of our fi rst
customers.”
Indeed, he said
they’ve seen other com-
panies over the years
that were nowhere near
where Imperial Oil was
back then.
Doug said, “Th eir
standards were high. If
you worked for them, you
could work for anyone.”
“Safety has come a
long way over the years,
but we hit the ground
running with Imperial
Oil,” Wayne said.
Imperial Oil also
helped launch a very im-
portant part of C&N’s
business, chemical deliv-
ery.
Doug said, “One day,
Imperial Oil asked us to
circulate some wells, 25
wells west of Carnduff .
Th ey would give us an-
other chunk, and another,
then boom!”
Wayne added, “A
lot of that was driven by
Bob Gibson with Esso
Chemicals, and Shane
Boyes with Nalco. Th ey,
through their chemical
sales, needed someone
to apply the product for
them. Th ose two chemi-
cal salesmen really ex-
panded our sales.”
Now C&N works
for over 50 companies,
according to Wayne, who
said, “We probably go
into at least 5,000 wells a
month now.”
Initially Doug would
handle the circulating,
then Allan Hubbard
started circulating as well.
He’s now the supervisor
in charge of all circulators
and pressure trucks.
“If you ever wanted
to clone someone, It
would be Al,” Wayne
said, speaking highly of
his work ethic. That,
combined with Doug
and Kris’s sales skill,
and Wayne’s manage-
ment, hasvebeen part
of the formula for their
success over the years.
Their initial growth
was on the maintenance
side. In five years, they
had grown to six units,
including a steamer,
a chemical delivery
truck, two crew trucks
and a pickup.
In the past, they
used to do hazardous
material work with
PCBs, but no longer.
The company has
seen substantial growth
in the last four or five
years. A portion of that
growth can be attribut-
ed to former C&N em-
ployees who have gone
onto bigger things, and
now hire their old em-
ployers to handle their
chemical needs.
“There are prob-
ably 20 guys in the
field who worked for
us who we now work
for,” Wayne said. Be-
fore he returned to the
fold, one of those was
his son Kris.
Page B12
Clients are best salespeople
B12 PIPELINE NEWS November 2011
FOR ALL YOUR VACUUM TRUCK NEEDSFOR ALL YOUR VACUUM TRUCK NEEDSTANDEM•TRI-AXLE•SEMI-VAC UNITS•COMBO UNITS•TANK TRUCKS
306•482•7897 OR 306•485•7833
100 Tonne Crane100 Tonne Crane100 Tonne CraneNEWNEWNEW
matting rentalsmatting rentals
bed trucksbed trucks
winch truckswinch trucks
pickerspickers
SERVING SASKATCHEWAN OIL & ENERGY INDUSTRY SINCE 1954SERVING SASKATCHEWAN OIL & ENERGY INDUSTRY SINCE 1954
Slick Drill Collar & Slick Drill Collar & Heavy Weight Pipe RentalHeavy Weight Pipe Rental
Weekly & monthly packages availableWeekly & monthly packages availableCall: 306-421-0235 or 306-421-6374Call: 306-421-0235 or 306-421-6374
46 – 13th Street NE • Weyburn, SK • S4H 1K8Phone: 306-842-5490 • Fax: 306-848-0275
Toll-free: 888-346-8260
www.hseintegrated.com
If You’re Serious About Safety
Occupational Health & SafetyAudiometric & Respiratory Equipment Fit Testing
••
Standby & Emergency Medical ServicesIndustrial Hygiene
•
•
Wireless Air Quality MonitoringPlume Dispersion Modeling
••
Gas Detection EquipmentGas Leak Detection and Analysis
••
Safety Project Management & ConsultingBreathing Air Equipment & ServicesOf ce/Air TrailersShower ServicesH2S Safety
•
•
•••
Emergency Fire ghtingCon ned Space & High Angle RescueWell Control and Blowout RecoveryHot Tap & FreezeSafety Training
••
•
••
Page B11 Over the years, numerous producing companies have
come and gone. “We’ve changed the same location sign seven times on some
wells,” Wayne said.
During slowdowns, wells still need servicing. “If the maintenance slows down,
circulating keeps going,” Doug said.
“When everyone saw a slowdown, we increased our business,” Wayne added.
“As far as I’m concerned, (former Alberta premier) Ed Stelmach was one of
the best things to happen to the Saskatchewan oilfi eld. Th at’s been a big thing for
this corner.”
Th ey bought their fi rst pressure truck four years ago. “Th at opened a lot of
doors for us,” Wayne said. “We’ve got three now.
“As they’re fi nding the Bakken to be corrosive, they needed a new system to
look after it. Th at’s where our pressure trucks come in.”
Of the 32 units that make up C&N’s fl eet, seven were added in the last year
alone, much of that on the chemical side.
“Th e majority of our business is chemical-related,” Wayne said.
Circulating keeps going even during slowdowns“Chemical is repetitive. It’s month in, month out, even with low oil prices.
Th at’s where we put most of our eff orts.
“Our best salespeople are the chemical companies in southeast Saskatchewan.
Th ey fi nd the work and customers, and then they call us.”
Having a comfort level with those companies is key, Wayne and Doug said,
with Wayne noting those chemical companies have confi dence the job will get
done. “We’re going to put it on our program and do it.”
Th eir employees are trained, and have proper documentation, Wayne said.
“Th e reason we’re here today is because of our staff . If you don’t have good
people working for you, then you’re in trouble. If you don’t treat them right, and
they go somewhere else and you have to work for them, they’re not going to give
you work.
“We have well over 10 million litres of chemical we’ve hauled over the 25
years. Boy, it’s been a lot,” he said.
In October, 2010, C&N Supply was launched, providing an independent local
oilfi eld supply store for Carnduff . “Th e amount of business we did in the fi rst year
was beyond my expectations,” Wayne said.
Regarding his retirement, Doug said, “I really do miss they guys in the dog-
houses and the fi eld.”
He does not, however miss the winter work, noting that now he spends time
down south in the winter.
PIPELINE NEWS November 2011 B13
24 Hour DispatchOxbow: 306-483-2848
Pipestone: 204-854-2231Waskada: 204-673-2284
Serving Southeast Saskatchewan, Southwest Manitoba & North Dakota since 1956.
• 16, 21 & 35 million BTU Super Heaters
• Propane Fired
• Horizontal 80 m3 frac tanks
• Triaxle Combo Units
16 21 & 35 illi BTU
• Tandem, tridem, quad sour sealed units
• Triaxle Combo Units
Stoughton – Secondary containment systems are
often modular – bolt together walls, and a poly liner
for the bottom. Th erein lies the problem, at least ac-
cording to Jayson King, who has come up with his
own solution for secondary containment – a one
piece, welded steel solution.
“It’s all in one piece. Th ey pick it off , put it on the
ground, put the tanks in it, and tied it in,” said King.
“Conventional containments are a steel wall
pinned together with a liner. Th ey take quite a bit
of manpower to set up – a three man crew and four
hours. Mine doesn’t have a liner. It’s all one piece,
welded steel.
“With labour shortages, mine can be set up with
two guys and a picker.”
Th e walls are formed with a rigid lip around the
top. Th e bottom corner is designed for rigidity. Th e
fi nal product looks like a very large tub.
Th e containment units are made in Weyburn by
Stewart Steel.
Now a consultant for lease building and recla-
mation, King said, “I used to do construction and
maintenance. I’ve set up conventional containments.
Th ey were quite labour-intensive. Th ere has to be
a better way to do this,” he said. “Driving around,
thinking, I came up with this design.”
Th ere are two sizes. Th e fi rst is 20 feet wide and
40 feet long, with a three-and-a-half foot wall. It
will hold two 400-barrel tanks. Th e second is 20 feet
wide and 52 feet long, with a four-and-a-have foot
wall. It can handle two 750-bbl. tanks, or three 400-
bbl. tanks.
Th e whole unit is made of 3/16-inch plate steel.
It has enough fl ex to form to the ground, but is rigid
enough to hold the weight, according to King. Th ere
are patents pending on the design.
Th e two sizes are 13,000 and 15,000 pounds re-
spectively, and are well within the capacity of most
pickers. Th ey sit fl at on the trailer, but are considered
an oversized load.
“It’s right to the limit. It needs pilot vehicles and
permits to move it,” King said. “Moving them hasn’t
been an issue.”
He added even with pilot trucks, it’s still cheaper
to move and install one of these one-piece contain-
ments than utilizing the conventional method.
Having a steel fl oor is tougher than a poly mem-
brane, which can be easily punctured. “It takes quite
a bit to puncture this,” he said.
While a poly liner can be slippery when wet, the
steel fl oor of these units has a slip-resistant surface.
Th e inside has a chemical-resistant coating.
Additionally, gravel is often placed inside poly
lined containments. Th ere is no need for that in these
units. Th e tanks are set on six 3 x 12 inch bridge
planks. Page B14
The blue secondary containment unit seen here west of Stoughton is essentially a very large tub of welded steel. That allows it to move in one piece, set up easily, and be a lot tougher than a poly liner. Photo by Brian Zinchuk
One-piece containment solution
The secondary containment unit is one piece
B14 PIPELINE NEWS November 2011
• Oilfield Graveling• Gravel Crushing & Screening• Sealed Trailers for Hauling
Contaminated Waste• Lease Preparation
& Reclamation• Grading
• Excavating• Heavy Equipment Hauling
• Car/Truck Wash• COR Certified
TOLL FREE 1-888-532-5526Creelman, Sask.
Dispatch Rod/Larry: (306) 421-9295Larry Cell: (306) 457-7712
Shop: 433-2059; Of ce phone/Fax: 433-2069
NEW - DRILLNEW - DRILLGENERATORSGENERATORS
24 hours a day • 8 kw - 350 kw
• Pumpjacks• Well Site Shacks• Service Rigs• Construction Sites• Drilling Rigs
Phone Toby: 577-1907Phone Toby: 577-1907
Jayson King designed a one-piece solution, seen over his shoulder, to simplify secondary containment.
Photo by Brian Zinchuk
Page B13Not having gravel
also makes reclamation
easier. If gravel becomes
contaminated from a
spill, it has to be sent to a
proper disposal site. Th e
one-piece units can be
cleaned with a steamer
and vac combination
unit.
“When reclaiming
it, it’s easier to move
around than a conven-
tional one,” King said,
noting poly liners often
have to be scrapped.
Flanges are included
on the side and end for
tie-in purposes. “Some
people have tied a load
line into it. Lots go over
the wall,” King said.
Each unit comes
with stairs. King has
recently switched to an
aluminum three-step
crossover with a plat-
form on top.
Units are rented out
on a monthly basis. Th e
most common usage is
for single well batter-
ies, however, there is a
potential to use them
for cleanups. Since they
are essentially large tubs,
contaminated snow can
be placed it them to melt
down. Th en a fl uid haul-
er can suck off the water
and oil, and treat it at the
producer’s own facilities,
like produced emulsion.
“My containments
are based out of Wey-
burn and Stoughton,”
said King, who hails
from Corning, north of
Stoughton.
King started plan-
ning this venture in the
summer of 2008, and
started producing them
in September 2009. Th at
year he produced be-
tween 10 and 15 units.
Th e following year took
off .
“Th ey really started
kicking in,” King said.
“Th ere were some weeks,
I moved 10 in a week.”
Th e fl ooding of 2011
slowed everything down,
but this winter looks
promising. “It’s starting
to pick up now,” he said.
“I see nowhere else but
up.”
To that end, King
has recently hired a con-
tainment co-ordinator.
Containment units can be used for snow cleanup
PIPELINE NEWS November 2011 B15
BERT BAXTER TRANSPORT LTD.
301 Kensington Ave.301 Kensington Ave.Estevan, SK.Estevan, SK.
Phone: (306) 634-3616(306) 634-3616
3902 - 75th Ave.3902 - 75th Ave.Leduc, AB.Leduc, AB.
Phone: (888) 835-0541(888) 835-0541
www.bbaxtertransport.ca
When your well site, lease or tankage requires containment,
call JK Containments for informationcall JK Containments for informationon how we will save you
time and money!
This product is patent pending
One piece portable containment designed
with quick set up, environmental security
and government regulations in mind.
Jayson King 306.736.9169Stoughton, SK
Jayson King 306 736 9169Jayson King 306 736 9169
www.jkcontainments.com
Genset / Light TowersGas Powered Pumps
Telescoping Fork & Scissor LiftsBackhoe / Trenchers / Trailers
Temporary Power Cable
Oil eld, Industrial, Commercial
Ph:(306) 634-9888 Ph:(306) 634-9888 ELECTRIC MOTOR DIV.
New/Used SalesComplete Rewinding & Repair
REPAIR SHOPTrash Pumps, Lights, Heaters,
Generators, Compressors, Converters
ESTEVANESTEVAN
Regina – Oil and gas
companies in Saskatch-
ewan may be too busy
drilling to acquire ad-
ditional petroleum and
natural gas rights while
the going is good.
Th at belief is shared
by Energy and Resourc-
es Minister Bill Boyd in
his reaction to the small
October sale of oil and
gas rights that brought
in just $13 million for
the province.
By contrast, the
combined lease and li-
cence sale of new rights
in Alberta topped $99
million in a two week
period ending Oct. 5.
“I consider this sale
to be a solid but smaller
sale,” said Boyd. “But I
believe what we’re see-
ing in this sale and the
one before it is compa-
nies focusing on assets in
hand and developing the
rich inventory of lands
they have accumulated
over the past two years.
“We see evidence of
that in demand for drill-
ing rigs and service rigs,
where the utilization
rates here are actually
higher than the rates in
Alberta and British Co-
lumbia.”
Th e August sale
generated $21.7 million
in sales revenue for the
province.
“Th ese last two sales
have seen smaller com-
panies establishing land
positions in our oil-
patch,” said Boyd.
“As well, this year is
tracking to be either the
third or fourth best on
record for land sale rev-
enues, with the top two
years occurring in the
last four years.
“Industry contin-
ues to send a message of
confi dence in our rich
oil resource and in our
strong business climate.”
Total land sale rev-
enues for the 2011 cal-
endar year now stand at
$228 million.
Th e October sale in-
cluded 142 lease parcels
that attracted $12.6 mil-
lion in bonus bids and six
petroleum and natural
gas exploration licences
that sold for $446,000.
Th e Swift Current
area led the pack with
most bids and the high-
est sales total of $4.3
million followed by the
Weyburn-Estevan area
at $3.3 million
Th e Lloydminster
area recorded sales of
$2.9 million with the
Kindersley-Kerrobert
area trailing the province
at $2.6 million.
Th e highest price for
a single parcel was $1
million. Federated Co-
operatives Limited ac-
quired this 259-hectare
lease parcel southwest of
Gull Lake.
Th e highest price
on a per-hectare ba-
sis was $9,468. Ranger
Land Services Ltd. bid
$153,285 for a 16-hect-
are lease parcel west of
Lashburn.
An oil shale spe-
cial exploratory permit
block on off er northeast
of Tisdale received a
work commitment bid
of $2.1 million from
Prairie Land & In-
vestment Services Ltd.
Th e next sale of
Crown petroleum and
natural gas and oil shale
dispositions will be held
on Dec. 5.
Swift Current area (numbers round off )
Th e total bonus re-
ceived in the area was
$4.2 million, an average
of $486 per hectare. Th is
compares to $2.8 mil-
lion, an average of $671
per hectare at the last
sale. Page B18
Drilling is hot but land sales are not
Contact your local Pipeline News Sales rep. to get you 28,000
Circulation on your career ad!
Speci c Targeting
B16 PIPELINE NEWS November 2011 PIPELINE NEWS November 2011 B17
Swayze Concrete Ltd.Swayze Concrete Ltd.Dennis • 861-1186Dennis • 861-11861531 Railway Ave., Weyburn, SK1531 Railway Ave., Weyburn, SKFax: 306-842-0414Fax: 306-842-0414Ph: 306-842-6558Ph: 306-842-6558
Swayze Concrete Ltd.Swayze Concrete Ltd.Randy • 482-7647Randy • 482-7647
Hwy 318 North, Carnduff , SKHwy 318 North, Carnduff , SKFax: 306-482-3350Fax: 306-482-3350Ph: 306-482-3617Ph: 306-482-3617
PRODUCTS WE CAN SLING:• Pipeline Sand• Road Gravel• Fill Gravel• 1/2 - 1 1/2 Rock• Mulch• Top Soil
SLINGING IS IDEAL FOR:• Bedding For Flow Lines• Tank Farm Bedding• Weeping Tile• Foundation Backfi ll• Excavation Backfi ll• Grade Fills• Landscaping
KENWORTH T800 MULTICAT STONE SLINGERKENWORTH T800 MULTICAT STONE SLINGEROur operators can sling prod-
ucts into the tightest spots,
saving you time and money.
With a radio remote control
and a 220º working pivot ra-
dius the conveyor can accu-
rately place material up to 80
feet from the end of the truck,
eliminating material handling,
reducing construction time
and improving bottom line.
The Stone Slinger has a 16 - 18
yard capacity depending on
the materials being hauled.
Contact us for Contact us for precise, labour free precise, labour free
placement of placement of materials on your materials on your
job site.job site.
Day Day Construction Ltd.Construction Ltd.
Lease ConstructionLease ConstructionLease Restoration • MulchingLease Restoration • Mulching
Carnduff, SK.Carnduff, SK.Phone: (306) 482-3244Phone: (306) 482-3244
- 24 hour service- 24 hour service
• New & Remanufactured Wellhead Equipment & Valves
• Wellhead & Frac Tree Installations
• Frac Trees, 3”, 4” & 5”, 10,000#• Gate Valves, 2”, 3”, 4”, 5” & 7”, 2,000# - 10,000#• Miscellaneous wellhead equipment
“MORE THAN JUST GRAVEL”Crushed AggregatesCrushed Aggregates
Top Soil, Gravel, SandTop Soil, Gravel, Sand& Crushed Rock& Crushed Rock
Municipal & Oil LeaseMunicipal & Oil LeaseRoad Gravelling & ContaminatedRoad Gravelling & Contaminated
Soil HaulingSoil HaulingAggregate ScreeningAggregate Screening
ExcavatingExcavatingGraders, Lowbeds & CatsGraders, Lowbeds & Cats
Sealed End DumpsSealed End Dumps24 Hour Service24 Hour Service
Cell: 577-7553Cell: 577-7553Fax: 455-2433 • ARCOLA Of ce:Fax: 455-2433 • ARCOLA Of ce: 455-2429455-2429
- Oil eld Maintenance - Service Crews- Pressure Welding - Pipeline Construction
- Battery Construction - Rent or SellNew & Used Equipment
Randy: 634-5405 - Cellular 421-1293Darcy: 634-5257 - Cellular 421-1425 • Fax: 634-4575
LOCALLY OWNED & OPERATEDBOX 843, ESTEVAN, SK.
24 Hour Service - 634-8737
When one looks at the riglocator.ca maps showing the activity around Stoughton, you quickly nd it is one of the highest concentrations in western Canada. A quick drive within a few miles of Stoughton on Sept. 27 revealed just how much is going on. Photos by Brian Zinchuk
A busy day around StoughtonEasy Rider Trucking
Aaron Well Servicing
Noble Well Services
Gee Bee Construction Matted wellhead
A good lease for ducks
CanElson Rig 26
Bert Baxter Transport
Allan Construction
B18 PIPELINE NEWS November 2011
RUNNING STEADY, ALWAYS READY
Hydro Vac Trucks
Straight Vacs
Water Hauling
Steam Trucks
24-7 Service
306-781-2296MOOSOMIN & REGINA
· Full Line Of Excavating Grading and Compaction Equipment
· Tri Axle Sealed End Dumps Tandems, Low Beds
· Sand, Gravel, Rock and Topsoil
· 24-7 Service
A Division of Boyd Excavating Ltd.
Page B15 Th e top purchaser of acreage in this area was Federated
Co-operatives Limited, who spent $1.9 million to acquire two lease parcels.
Th e top price paid for a single lease in this area was $1 million by Federated
Co-operatives Limited for a 259 hectare parcel situated partially within the Gar-
denhead South Upper Shaunavon Oil Pool, 23 km southwest of the Town of Gull
Lake.
Th e top price paid for a single licence was $53,022, by Eastend Energy Corp.
for a 1,036 hectare block situated partially within the Whitemud Second White
Specks Gas Pool, 10 km southwest of Eastend.
Th e highest dollar per hectare in this area was received from Scott Land &
Lease Ltd., who paid $4,190 per hectare for a 130 hectare parcel located adjacent
to the Chambery Upper Shaunavon Oil Pool, 14 km south of the town of Shau-
navon.
Weyburn-Estevan areaTh e total bonus received in the area was $3.3 million, an average of $489
hectare. Th is compares to $11 million, an average of $1,068 per hectare at the last
sale.
Th e top purchaser of acreage in this area was Windfall Resources Ltd., who
spent $914,198 to acquire six lease parcels.
Th e top price paid for a single lease in this area was $372,669 paid by Wyatt
Oil + Gas Inc. for a 65 hectare parcel situated adjacent to the Willmar Frobisher-
Alida Beds Pool, 21 km south of Carlyle.
Th e top price paid for a single licence was $53,520, paid by Plunkett Resources
Ltd. for a 1,036 hectare block situated 49 km southwest of the Roncott Bakken
Pool, 5 km southeast of Rockglen.
Th e highest dollar per hectare in this area was received from Torquay Oil
Corp., who paid $8,891 per hectare for a 32 hectare parcel located within the
Queensdale East Frobisher-Alida Beds Pool, 14 km south of Manor.
Lloydminster areaTh e total bonus received in the area was $2.9 million, an average of $202 per
hectare
Th is compares to $5.7 million, an average of $698 per hectare at the last sale.
Th e top purchaser of acreage was Prairie Land & Investment Services Ltd.,
who spent $1 million to acquire 12 lease parcels.
Th e top price paid for a single lease was $578,510, by Prairie Land & Invest-
ment Services Ltd. for a 259 hectare parcel situated two km south of the Soda
Lake Cummings Oil Pool, 15 km southwest of Maidstone.
Th e highest dollar per hectare in this area was received from Ranger Land
Services Ltd., who paid $9,467 per hectare for a 16 hectare parcel located within
the Lone Rock Sparky Sand Oil Pool, 20 km southwest of Lashburn.
Kindersley-Kerrobert areaTh e total bonus received in the area was $2.6 million, an average of $215 per
hectare. Th is compares to $2.2 million, an average of $256 per hectare at the last
sale.
Th e top purchaser of acreage in this area was Plunkett Resources Ltd., who
spent $561,351 to acquire one lease parcel. Th is was the top price paid for a lease
and the highest dollar per hectare in this area at $2,167per hectare.
Th is 259 hectare parcel is situated two km east of the Whiteside Ribstone
Creek Sand Gas Pool, 12 km northwest of Kindersley.
Th e top price paid for a single licence in this area was $130,535 by Allstar
Energy Limited for a 3,885 hectare block situated within the Bayhurst Viking Gas
Pool, 13 km north of Leader.
Oil shale permit issued near Tisdale
OXBOW
483-2826
ALIDA
443-2466
CARLYLE
453-2262
REDVERS
452-3216
ESTEVAN134 4th Street
637-4370
• Bulk Petroleum & Propane
Girard Bulk Service Ltd.Girard Bulk Service Ltd.PROPANE
• Cardlock• Propane Accessories
• Lubricants
PIPELINE NEWS November 2011 B19
* Bed Trucks* Winch Tractors
* Pickers
RIG MOVING Phone: 482-3244
G.W. TrenchingG.W. Trenching& Hauling Ltd.& Hauling Ltd.
Serving the Oil eld in S.E. Sask. for 36 years!
Lampman, Saskatchewan
Contact: Gordon WaughBus.: (306) 487-3178Cell: (306) 421-0566Fax: (306) 487-3253
• Oil eld Fiberglass Pipeline• Sand and Gravel• Backhoe Service• Bobcat Service• Environmental Services• Electrical Trenching• Grader Work• Flow Line Construction• Cat Work (6-way Dozer)• Sewer and Water
Steve Cole’s home town is Gainsborough. After building a company in Red Deer, he’s now set up a satellite operation in southeast Sas-katchewan. Photo by Brian Zinchuk
What’s that truck doing? He’s Haulin’ Acid
Estevan – Th e skull and crossbones on his hat are fi tting for Steven Cole. See, he’s
Haulin’ Acid.
More specifi cally, he owns and operates Haulin’ Acid, a Red Deer based acid-haul-
ing outfi t that’s in the process of establishing a southeast Saskatchewan presence.
In late September, Cole was looking for a shop for an Estevan-area truck. “Th ere’s
not a lot out there for a one-truck operation,” he said of the real estate situation.
“Th ere are new shops going up, but they want you to rent the whole shop. Until
something pops up, we’ll have to park outside.”
At 36 years old, he’s rediscovered his old stompin’ grounds.
“I never in a million years thought I would be coming back to this area. Years ago,
there wasn’t a lot of opportunity.
Sometimes, however, opportunity comes a-knockin’.
“When a frac has to shut down to wait for an acid truck for 24 hours, that
shouldn’t happen. From 12 hours away, I got a truck there quicker than what
they could get locally. When you’ve got a whole frac crew, the clock is
ticking.”
Th at fi rst call came in late 2010. Th e company has been work-
ing in southeast Saskatchewan for the better part of a year, ex-
cept “when the ocean arrived this past spring.
“We started thinking about this as soon as we got the
phone calls. Th ere was no work in the spring. Now, things
are rockin’ and rollin’. We’re here to stay.
“I wouldn’t attempt to set up here if I wasn’t from
this area,” he said, noting the importance of local con-
nections. He was born in Oxbow. “My home town is
Gainsborough. My grandma’s still in Carnduff . My
grandfather, Casey Anderson, worked for Dome.”
Haulin’ Acid’s driver in southeast Saskatchewan
is from Manitoba. Like many other people, fi nding
accommodations has proven to be tough. At the end
of September, he was still staying in a holiday trailer
in Lampman. He was eventually able to fi nd winter
accommodations in Carnduff .
“He sees the potential in this area. He was ex-
cited about working with us,” Cole said.
Safety is of utmost importance when your spe-
cialty is hauling highly corrosive material. “We’re 11
years accident-free. Zero lost-time accidents. Th e
safety thing is huge. It proves we’ve been doing it
right.”
Page B20
B20 PIPELINE NEWS November 2011
BADGERDAYLIGHTING™
• Tandem Tandem • Tri Axle • Tandem • 4 x 4
Regina ........................................ (306) 531-9487Saskatoon ................................. (306) 934-2964Swift Current ........................... (306) 773-0724Lloydminster ........................... (306) 875-1640Kindersley ................................ (306) 463-6006Carlyle ....................................... (306) 577-3400Weyburn ................................... (306) 848-0906Carnduff/Oxbow .................... (306) 482-5270
Toll Free: 1-800-465-4273www.badgerinc.com
Shoring Sales & Rentals
Full Service Hydrovac Fleet
Available To Saskatchewan
GENERAL OILFIELD HAULINGGENERAL OILFIELD HAULING
• 8 to 40 Ton Picker Service• 8 to 40 Ton Picker Service• Winch Trucks, Bed Trucks• Winch Trucks, Bed Trucks• Air-Ride Equipment • Tank Rentals• Air-Ride Equipment • Tank Rentals
634-8888634-8888 Estevan, SKEstevan, SK
Manitoba, Saskatchewan, AlbertaManitoba, Saskatchewan, Alberta
Opening in August 2011
Enquire as to lodging.
Phone: 1-204-325-7496 Ext 234or email
gm.cn923@choicehotels .com
Take advantage of Early Booking and Pre-sales!
Now Open
306•634•8332
404 Kensington Avenue ~ Estevan, Saskatchewan
Like Purolator for acidHaulin’ Acid now operates a truck based in the Estevan area.
Photo courtesy Haulin’ Acid
Page B19In times of labour
shortages, sometimes
standards slip. Not for
Cole. When it comes to
staffi ng, Cole said, “I’d
rather turn down work
than send out an incom-
petent driver. Our record
speaks for itself.
Th e company is
working on getting it’s
United States Depart-
ment of Transporta-
tion papers in order.
Southeast Saskatchewan
could serve as a potential
springboard to working
south of the 49th paral-
lel. He noted, “Th ere are
no acid haulers in North
Dakota. I got asked to
haul loads down there.”
However, there are
lots of regulatory road-
blocks to overcome be-
fore that can happen.
“I started out as an
owner-operator with
one truck for the fi rst
fi ve years. I realized if I
didn’t expand, I’d be 60
years old, driving this
acid truck,” Cole said.
And expand, he did.
“We have seven acid
trucks and one shower
truck. It’s a separate unit.
All of our acid trucks
have showers on them as
well. I could see as safety
gets more strict, they be-
come more in demand.”
Th e company just
hired a full-time admin-
istrator, relieving Cole’s
wife Darla of the duties.
“Acid is a funny
business. It’s not used on
every well. It’s a special-
ty thing. We have days
we could have used fi ve
more trucks. Th e next
day, you need two,” he
said. “We’re like Purola-
tor for acid.”
Acid is used in
maintenance work, fi x-
ing leaking wells, and
in abandonments. It’s
needed even when drill-
ing is slow.
Th e Cardium play
has rejuvenated Alberta’s
oilpatch, but Saskatch-
ewan has its own shine.
He noted, “Th ey don’t
use as much acid as in
the Bakken. Th is area is
great compared to work-
ing in Alberta. It’s all
fl at, there’s less chain-
ing up. It’s not hard on
equipment.”
Speaking of south-
east Saskatchewan, he
said, “Th e selling feature
is the size of this patch
for a guy who has a fam-
ily and is tired of be-
ing on the road. It’s all
within a two-and-a-half
hour drive. You can be
home, if you can fi nd a
home.”
• Repairs done on all models including: Sonolog, Echometer, DX, etc.
• Major parts and supplies in stock at all times
• Fluid Levels• Dynamometers• Pressure Surveys• Foam Depressions• Equiment Sales, Rentals & Repairs
Scott .........861-1001Anita .........861-7305Keith .........861-2243Dave .........452-8401
Ryan .........458-7790Chantal .....861-9796Brett ..........891-6303Spare ........891-6966
Box 4 • Midale, SK S0C 1S0Phone: (306) 458-2367 Fax: (306) 458-2373
email: [email protected]
PIPELINE NEWS November 2011 B21
TRUCKINGTRUCKING• Pickers• Pickers• Bed Trucks• Bed Trucks• Winch Tractors• Winch Tractors• Texas Beds• Texas Beds
RENTALSRENTALS• 400 BBL Tanks, Lined, • 400 BBL Tanks, Lined, Sloped, Steam Coiled, Sloped, Steam Coiled, Sumped & Sour Serviced, Sumped & Sour Serviced, • Enviro-Vac Units• Enviro-Vac Units• Rig Mats • Rig Mats • Invert Systems• Invert Systems• Surface Sump Tanks• Surface Sump Tanks• Caterpillar Loaders• Caterpillar Loaders• Vapor Tight Equipment• Vapor Tight Equipment
• Portable Flaring Equipment• Portable Flaring Equipment• Flow Back Separators• Flow Back Separators• Pre-Mix Systems• Pre-Mix Systems• Surface Tanks• Surface Tanks• Acid Tanks• Acid Tanks• Mixing Bins• Mixing Bins• Shale Bins• Shale Bins• Flare Tanks• Flare Tanks
(A Division of Total Energy Services Ltd.)
MIDALE Ph: 306•458•2811Fax: 306•458•2813
midale@totaloil eld.ca
CARLYLEPh: 306•453•4401Fax: 306•453•4402
carlyle@totaloil eld.ca
ESTEVAN MCLEAN TISDALEPh: (306) 634-5111 • Fax: (306) 634-8441 • 407 Kensington Avenue, Estevan
Hours: Mon. - Fri. 7:30 a.m. - 5:30 p.m.; Sat. 8 a.m. - 5 p.m.
VISIT US ON OUR WEBSITE: VISIT US ON OUR WEBSITE: www.wood-country.comwww.wood-country.com
WOOD COUNTRYWOOD COUNTRY
"Thinking windows? Shop and compare!"
Insist on CWD windows and doors.PVC Windows - Metal clad windows
Patio and garden doors - Insulated steel doorsCall for comparative pricing!
Metal CladdingNow stocking various lengths of Galvalume & white/white metal.
Farm and industrial, galvanized, galvalume and coloured. 26, 28, 29 & 30 gauge metal ordered to suit your size and needs.
Phone for pricing with your individual requirements!
Many types & pro les available.
We have the solution...COMMERCIAL BUILDING
60x76-16’ Stud Frame Buildingc/w: 20x14 R16 Overhead Door 2 - 36” Commercial Outswing Doors
$32,760.92
FARM BUILDING
50x100-18’ Post Frame Buildingc/w: 24x18 H.D. Steel Sliding Door
$28,377.01
Call today Call today for a FREE for a FREE building building
quote!quote!
3D MaintenanceCell numbers: 483-8024, 483-7024, 483-8148
Home: 486-2143 • Fax: 486-4855
Box 12 Frobisher, SK. S0C 0Y0
FOR SALEFOR SALE
40 acres for sale 1 mile west of Estevan. Two story house with single attached heated garage. Wrap around deck on 2 sides on upper level. Two bedroom country style with main living on the upper level with a gas fi replace in the living room. Lower level has a family room, bath-room and back entry to the garage. Large barn/shop with 3 stalls and two box stalls, tack room, shop in the back of the barn. Two sheds. Dugout and a well with unlimited water supply. This is a great place for horse lovers. Serious inquiries only.
Call 306-421-5042 or 306-471-8711.
Flint completes Carson Energy acquisition
Flint Energy Ser-
vices Ltd. has complet-
ed the previously an-
nounced agreement to
acquire all of the issued
shares of Carson Energy
Services Ltd., a privately
held energy services
company based in Sas-
katchewan.
Th e transaction
was subject to regula-
tory approvals that were
obtained at the end of
September, and closed
eff ective Oct. 1.
Th e purchase price
is comprised of $112
million in cash and 2.12
million Flint common
shares, plus up to an
additional $30 million
earn-out spread over the
next three years, subject
to closing adjustments.
Payment of the earn-out
portion of the purchase
price is dependent on
the Carson operations
meeting the EBITDA
target of $40 million per
year.
Carson, established
in 1974 and based in
Lampman, Saskatch-
ewan, is one of the prov-
ince’s largest private
companies engaged in
energy services, with
over 900 employees and
operations in 17 loca-
tions covering major
energy plays in Sas-
katchewan, Manitoba
and eastern Alberta. Th e
company off ers pipeline
construction, fabrica-
tion, civil and facility
construction, oilfi eld
maintenance, pipeline
integrity, horizontal dir-
ectional drilling, truck-
ing and tubular man-
agement, environmental
and safety sales and ser-
vices. Th e acquisition
also provides Flint with
a fi rm platform to ex-
pand its energy services
reach into Saskatchewan
and Manitoba.
Ron Carson,
president of Carson
Energy Services, will
continue as president
of Carson’s operations
within Flint. In addition,
Carson will continue to
operate under the Carson
Energy Services brand
while Flint and Carson
adopt the best practices
of each organization,
ensuring uninterrupted
and seamless services
to their customers. Th e
Carson operating results
will be consolidated in
the company’s produc-
tion services segment,
and will be reported in
the fourth quarter and
year end statements.
Shining brightThis high dynamic range photo, a combination of 7 exposures taken within a few seconds combined via software into one picture, shows the dramatic sky behind Lasso Drilling Rig 1 just east of Midale on Oct. 13. HDR
Photo by Brian Zinchuk
B22 PIPELINE NEWS November 2011
STRONGER BUILDINGSSTRONGER POSTS
Find out more about the strongest post framebuilding on the market.
Commercial buildings, machine sheds, shops, barns, hay sheds, arenas & more.
1-866-974-7678 IntegrityPostStructures.com
BOOK NOWBOOK NOW
Serving the SoutheastSaskatchewan oilfi eld industry since 1994.Newalta has provided waste management services for the
Southeast Saskatchewan oilfi eld industry for more than 17 years.
We’re proud of our strong local presence, our exemplary safety
record, solid environmental performance and our long track
record of excellent service.
Contact:Halbrite Location at 306-458-2419Lease 16-29-06-12W2OrAlida Location at 306-443-2146Lease 16-13-05-33W1
24 Hour Tank Truck Services(306) 421-5995
• 10m• 10m33 Compartment Pressure Truck 5000 PSI (steel line) Compartment Pressure Truck 5000 PSI (steel line)• 6m• 6m33, 2 Compartment Pressure Truck, 2 Compartment Pressure Truck• 2 - 15m• 2 - 15m33 Acid Trucks & 30m Acid Trucks & 30m33 Acid Wagon Acid Wagon• Sour Sealed 407 Crude Trailers• Sour Sealed 407 Crude Trailers • Fresh Water Trucks • Vac Trucks • Fresh Water Trucks • Vac Trucks • All Equipment is Modern & • All Equipment is Modern & G.P.S. Equip. G.P.S. Equip. • Fresh Water • Fresh Water Available Available
“Where Experience and Dependability “Where Experience and Dependability Are Just a Phone Call Away”Are Just a Phone Call Away”
#3 Breeze Street, Estevan, SK#3 Breeze Street, Estevan, SKOf ce: 306-634-0070 • Fax: 306-634-0071Of ce: 306-634-0070 • Fax: 306-634-0071
Estevan and Weyburn locationsEstevan and Weyburn locations
Weyburn – Th ese are busy times for
Bob Maurer Construction and Main-
tenance, a Weyburn-based oilfi eld ser-
vice company.
Bob Mauer started the business in
2002. His previous career in the oil-
fi eld was on the drilling side. He was
a toolpush on drilling rigs.
“I quit school to go on the rigs at
17,” he said, having started with Sim-
mons Drilling 28 years ago.
“I got tired of the rigs. I saw an
opportunity in oilfi eld construction,”
Maurer said.
He initially started with an end
dump truck and a backhoe. “We were
doing a lot of reclamation on old fl are
pits,” he said. “Th at created a lot of
work for a few years.
“Th en we went to dozers, building
leases for drilling.”
Excavators were the next addition,
leading into pipelining fi breglass fl ow-
lines.
Th e company now does lease-
building, pipelining, jack setting, builds
batteries, hauls gravel, operates pickers
and bed trucks, or, as Maurer puts it,
“A little bit of everything.”
Th e heavy equipment fl eet is com-
posed to eight dozers, four excavators,
two backhoes, a grader, a scraper, eight
semis including one bed truck, and
one 40-ton picker. Th ere are also vari-
ous tractors, mowers, snowblowers and
boiler units. Page B23
Alex Akerstrom hooks up the chains to the top of the tank.
Lots of work to be had
Bob Maurer would like to add a second picker, if he could nd people to run it.
PIPELINE NEWS November 2011 B23
WEYBURN, SK 306-842-8901
ESTEVAN, SK 306-634-8912
Essential Coil & Stimulation Services currently has a fleet of 25 coil units. These units are tan-dem tandem and tandem tridems. We have coil capabilities of up to 2500 meters of 2.00”, 3400 meters of 1.75”, 4500 meters of 1.5”, and 6700 meters of 1.25”. 7 sets of Class II blowout pre-
venters, including two remote accumulators and Class III capabilities.
We are actively working in Southern Saskatchewan. We have a shop in Weyburn at
#3 20th Ave. SE. Please call us for a list of all the services we provide.
If you are looking for a dynamic new career and live in the
area, fax your resume with a driver’s abstract to 403-580-8906
5 – 22nd Avenue S.E., Weyburn, Sask.
Tel: (306) 842-6100
For 24 hour emergency service call:
(306)861-2841Parts: (306) 842-6100
Tremcar West Inc. offers our customers a certified
repair shop with qualified workers specializing in:
www.tremcar.com
• Tank Trailer Repair
• PIVK B620 Inspections
• Auto Greasing
• SGI Inspections
• Trouble Shooting ABS Systems
• Stock and Sell Parts
• Leasing Available
Suzanna NostadtVice President
Bruce PalmerService Manager
Bob Maurer Construction and Maintenance running hard
Page B22“We can pretty much do everything,” Maurer he said, adding, “I’ve got fi ve
crew maintenance trucks running around.”
Two years ago he added a picker. “Th ere was demand for it. It leads you into
more work. A guy is turning down work every day. It is now much busier than
before.”
He’d like to add another picker, but manpower is an issue.
“We set pumpjacks, move tanks, matting, pipe, tubing and rods for the ser-
vice rigs.”
Th e picker has also seen a lot of days working with another fi rm, assisting
Fast Trucking with rig moves when they are short of pickers. Bob Maurer bed
trucks help out as well.
Th ere are 35 people working for Bob Maurer Construction and Mainte-
nance. Pretty much all their staff is local.
“A lot of my crew trucks run out of Estevan,” he said.
Th e company’s work is widely spread. “Everything’s as busy as it can be,”
Maurer said.
Th is winter is “pretty much booked up. We’re doing as much as we can do.”
Next summer looks promising as well, he said.
Now 45, Maurer was born and raised in the Weyburn area, and has lived
there all his life. He still lives on the family farm a few miles south of the city.
However, he’s rented out all his land. “Th ere’s not enough of me to go around,”
he said.
Th e current shop was built three years ago, one of the early entrants to the
Evanston Park on the south side of Weyburn, in the RM of Weyburn. “I’ve got
11 acres,” Maurer said, noting there is room to expand.
Bob Maurer Construc-tion and Maintenance's picker, operated by Rob Carlson (insert) moves a tank for Leg-acy Oil and Gas. Photo by Brian Zinchuk
B24 PIPELINE NEWS November 2011
* Gastric banding results in an average of 58% excess weight loss within the first three years and patients continue to maintain their weight loss even up to seven years later. (Niville E et al. A mid-term Experience with the Cousin Bioring - Adjustable Gastric Band. Obes Surg 2011; May 5. [EPub])
Serge D. - Fort McMurray, AB
Actual Slimband® Patient
I did, and thanks to Slimband® that’s now a reality for me.
If you’re like me, you don’t want to go on a diet where you
have to count calories, measure your portions or give up
the foods you love. It’s too easy to cheat and too much
effort to keep up!
For the last 10 years, Slimband® has helped over 6,000 men and women
discover a permanent solution to their weight problems, opening the door
to a healthier, happier life.
Aren’t you just about ready to consider something that works?
Call us at 1.800.700.7373 or visit us online at www.Slimband.com
to schedule a free consultation to help you decide whether Slimband®
is the right weight loss solution for you.
Obesity in the workplace
costs companies an alarm-
ing amount of money.
That’s a fact. One estimate
puts the costs associated
with employing obese peo-
ple at $285,000 per year
for a company with 1,000
employees. As a nation,
obesity is costing Canada
roughly $4.3 billion dollars
in healthcare expenses ac-
cording to the most recent
2001 survey. South of the
border obesity is costing
American companies $45
billion each year in medi-
cal coverage and employee
absenteeism. Obesity as
a health and productiv-
ity issue costs companies
more than tobacco use
or alcoholism.
Given this context, men
and women who suffer
from being overweight or
obese often face the ad-
ditional struggle of so-
cial stigma and bias in the
workplace. Obese adults
are often confronted with
negative prejudices and
stereotypes when applying
for a new position. Or, they
experience the “glass ceil-
ing” effect when trying to
advance within a company.
A leading employment
concern for any worker is
discrimination and unfortu-
Weight Bias in the WorkplaceImagine having your skills overlooked because you are overweight. Weight bias in employment situations happens more often than you think.
Do you wish you could get back into shape?
nately, obese or overweight
employees face over-
whelming discrimination
from their colleagues and
superiors in the workplace.
According to one study,
93% of human resource
professionals would prefer
to hire a “normal weight”
person over an obese per-
son who was equally quali-
fied for the job. If the posi-
tion involved face-to-face
interaction with clients,
12% of those who made
staffing decisions said they
felt an obese person would
not be fit for the job.
When it came to job ad-
vancement, 15% of human
resource personnel said
they would be less likely to
promote an obese employee
even if they had the skills
and knowledge that would
make them successful in
the position. Shockingly,
11% of those surveyed felt
it was appropriate
to terminate an em-
ployee strictly because of
their excess body weight.
Despite these negative
results, the researchers
found that no action was
being taken to correct the
unfair treatment of over-
weight employees. Con-
trary to the popular belief
that social pressure will
motivate overweight people
to “shape up”, research has
shown that 79% of over-
weight people react by re-
fusing to diet in an attempt
to affirm that the bias is un-
deserved. Rather than in-
spiring weight loss, weight
bias in the workplace has
detrimental effect on the
overweight employee.
Ideally, employers would
show genuine concern for
the health of their over-
weight employees by cre-
ating healthier work en-
vironments that support a
healthy lifestyle. Instead of
adding the stress and disap-
pointment of being treated
unfairly at work, co-work-
ers and management staff
should be sensitive and sup-
portive of colleagues who
have a weight issue.
Many companies have
found that covering the cost
of permanent solutions like
weight loss surgery is more
cost-effective than pay-
ing for disability insurance
or on-going prescription
weight loss medications
that may result in more sick
days due to side effects.
Addressing obesity in the
workplace with effective
long-term solutions like
gastric banding surgery can
also lower the cost of work-
er’s compensations for inju-
ries or accidents that occur
at the office.
For more information or to book a free consultation call Slimband at
1-800-700-7373
Slimband® Gets Results! The Slimband® is a fully reversible 20-minute procedure that’s clinically
proven* as an effective way to lose weight and keep it off for good.
A D V E R T I S I N G F E AT U R E
Start weight 321 lbs
Now weighs 214 lbs*Results may vary.
PIPELINE NEWS November 2011 B25
Call our Saskatchewan & other locations Toll Free:
Canalta - RamadaWeyburn........1.877.726.2320
Canalta - HotelsHumboldt .....1.888.831.1331Melfort ............1.855.680.4242 Moosomin .....1.877.342.7422Tisdale ...........1.877-771-6235Weyburn........1.877.809.1888
You can consolidate your corporate accommodation needs with Canalta Hotels.
Take a break
Bunkfrom your
Proud sponsors of:
canaltahotels.comPlease visit our web site
for the amenities in each hotel.
Working and traveling is stressful, whether it’s on the rigs or for business. Recharge yourself in your own space with warm hospitality, comfortable rooms, Comfortable Canalta Dream Bed, free continental breakfast, high speed internet, hot tubs, pool, gym and exercise facilities and other wonderful amenities.
Let our friendly staff at a Canalta Hotels take care of your accommodations.
R E DV E R SGENERATORS LTD.
#3 Railway Avenue
24hr 306-452-8200
RENTALS & MAINTENANCEDIESEL ENGINES - PUMPS - COMPRESSORS
Phone: 443-2424 Fax: 443-2433
Box 160, Alida, Sask. S0C 0B0
24 Hour Service • Canada and United States Oilfield Tank Trucks •
• Hot Oil Trucks & Super Heaters • • Pressure Trucks • Bobcat & Gravel Trucks • Backhoe •
• Frac Water Heater & Frac Tanks •
Certificate of Recognition & IRP 16
Ken Boettcher 483-7462 Tim Boettcher 483-8121 Wayne Odgers Salesman 485-9221 Edgar Bendtsen Dispatcher 483-8185 Mike Crawford Dispatcher 485-7970 Grant Anderson Manager 483-7405 Marvin Ferriss Manager 483-8937 Terry Torgunrud Safety & Compliance 483-8952 Carl Boettcher Supervisor 485-8372
(Nickle’s Daily Oil Bulletin) Emerge Oil & Gas Inc. reports that based on
production results to date in 2011, capital plans for the remainder of 2011 and
recent Viking well production performance, it anticipates production to aver-
age 5,600-5,700 boepd for 2011, representing a 14 to 16 per cent increase from
2010.
Th e reduction from previous guidance is the result of various factors in-
cluding: weather-related production downtime; slightly higher than budgeted
decline rates in certain heavy oil fi elds; and most notably, the mid-year realloca-
tion of capital toward evaluating the Viking potential on its owned and farm-in
lands, resulting in the drilling of fewer heavy oil wells than originally budgeted.
Emerge now expects to drill 40 to 43 heavy oil wells during 2011 as com-
pared to a planned 65 to 70 wells per original production guidance and prior to
the reallocation of capital toward Viking prospects.
While disappointed with the lack of production growth over the last two
quarters, the company has grown its average production during each quarter in
2009 and 2010 and year over year in 2009, 2010 and 2011.
Th e company is anticipating a return to production growth in 2012 through
its inventory of heavy and light oil drilling opportunities, particularly in the
greater Lloydminster, Primate and Coronation core areas, with upside potential
as it continues to evaluate its lands at Kirkpatrick Lake.
Emerge will be developing its 2012 capital budget later in the fourth quar-
ter.
It estimates third quarter production to average between 5,400 and 5,500
boepd and current fi eld production is approximately 5,700 boepd. Th e company
continues to guide toward total capital expenditures of $70-75 million for 2011
and expects to exit the year producing between 5,800 and 6,000 boepd.
In an update on operations, Emerge announced a successful heavy oil de-
velopment drilling program at Primate, Saskatchewan, where six (6.0 net) wells,
including one (1.0 net) service well, have been drilled as part of the fall program,
which began in mid-September.
Oil production now exceeds 800 bpd (based on fi eld estimates) from the
Primate fi eld from a total of six wells, with two additional wells awaiting com-
pletion.
Individual wells at Primate are producing at rates of 100 to 160 bpd, which
is two to four times the typical 40 to 50 barrels per day, vertical heavy oil pro-
ducer in the Lloydminster area.
Th e wells produce from the McLaren sandstone, which averages fi ve to six
metres of oil pay.
Emerge shot a 72-kilometre 2D seismic program in the third quarter and
has identifi ed 15 to 20 additional locations on 8.25 sections of 100 per cent
owned land.
Th e company plans to drill an additional six to eight heavy oil wells during
the remainder of 2011 in the Primate and Freemont areas. Emerge continues to
shoot additional seismic and evaluate land in the area of the Primate develop-
ment.
Meanwhile, in the company’s Viking light oil drilling program, pursuant to
a farm-in agreement entered into in January 2011, Emerge initiated its drilling
program in late June 2011 for the fi ve (3.5 net) horizontal commitment wells
targeting the formation in the Kirkpatrick Lake area, along the Halkirk/Coro-
nation Viking trend.
Under the terms of the farm-in agreement, Emerge incurs 100 per cent of
the capital costs (through to equipping) during the earning phase and will earn
a 70 per cent working interest in the wells.
All fi ve wells were drilled by mid-August, with average horizontal lengths
of 1,050 metres each with the completions beginning thereafter. All of the hori-
zontal sections encountered up to two per cent free oil returns in the mud tanks
during drilling.
Four of the fi ve wells have been fracture stimulated and currently three of
the wells have been tied-in and placed on initial production. Th e fourth well was
expected to be tied-in and on production by the end of October and the fi fth
well was awaiting completion.
Emerge focuses on Viking prospect
B26 PIPELINE NEWS November 2011
DISTRIBUTION INC.315A Kensington Ave., Estevan, SK
(306) 634-2835Fax (306) 634-2797
40B 18th Street, N. E., WeyburnPh: (306) 842-5081 Fax: (306) 842-5309
www.apexdistribution.com
Complete Oilfi eld & Industrial Service & Distribution
24 HOURS A DAY!
Sucker Rods & AccessoriesPipe, Valves & FittingsDrilling & Service Rig SuppliesAuthorized Kimray DistributorSecondary Containment SystemsGuiberson Well Service ProductsOil Country Tubular GoodsViking PumpsMeter & Instrumentation RepairProgressive Cavity Pumps
Toll Free: 1-888-638-6433 or 1-306-634-6400Plant: 1-306-388-2344 Fax: 1-306-634-7828
email: [email protected] website: www.estevanplastics.ca
Also Manufacturers of:• Fibreglass Belt Guards • Internal Fibreglass of Steel Tanks • Tank Skimmers • Insulated Wellhead Shelters
ESTEVAN PLASTIC PRODUCTS LTD.ESTEVAN PLASTIC PRODUCTS LTD.Your One Stop Shop For Fibreglass TanksYour One Stop Shop For Fibreglass Tanks
780 barrel tank pressures from 4 oz. PSI to 1616 oz. PSI.oz. PSI.
100 Barrel FRPPoptank 10’ diameter x 7.6’ high
400 Barrel
12’ diameter x 20’ high
500 Barrel1 piece fibreglass Tank
15’ diameter x 16’ high
or 12’ diameter x x25’ high
650 Barrel1 piece fibreglass Tank
15’ diameter x 20’ high
780 Barrel1 piece fibreglass Tank
15’ diameter x 25’ high
Land For Sale4 - 5 acre
industrial lots for sale - Shand District
Pongo Holdings Ltd.421-9576 or 421-2244
3 1/2 miles South of Estevan on Hwy 47( 35 of 1 of 8, West of 2nd )
Only 3 left
Regina – Saskatchewan has gained the equivalent population of 10 new cit-
ies in the past three and a half years to reach a record population of 1,057,888 in
the latest head count.
Statistics Canada reports the provincial population has grown by over 50,000
people from Jan. 1 2008 to July 1, 2011.
Th at’s 10 times the number of people required for any town of 5,000 people
in the province to seek city status and there is no letting up.
Between April 1, 2011 and July 1, 2011, Saskatchewan grew by 5,444 people,
the largest quarterly population jump since Statistics Canada starting keeping
quarterly population estimates.
Th e record quarterly growth consisted of a natural increase (births minus
deaths) of 1,524, net inter-provincial migration of 1,239 and net international
migration of 2,681.
Saskatchewan saw net in-migration from most other provinces including
Ontario (641 people), Alberta (423 people) and Manitoba (147 people).
Premier Brad Wall said the new population numbers show the continued
strength of the Saskatchewan’s economy.
“People move where the opportunities are and right now, there are a lot
more people moving into Saskatchewan than moving out,” Wall said.
“It wasn’t too long ago that the situation was completely reversed and more
people were moving away. Today, Saskatchewan is on the right track and our
government is working hard to make sure it stays that way.
“Th ere were those who said it would be impossible for Saskatchewan to
grow by 100,000 people in 10 years, which is really only growing at the national
average,” Wall said.
“Th e fact is – Saskatchewan has been growing by far more than the national
average for several years now. We’re up 50,000 people in just three and a half
years, so hitting 1.1 million people by 2015 is well within reach.”
Th e province’s population is also bucking the national trend by getting
younger with a median age of just 37.3 years – the second-lowest among the 10
provinces.
Saskatchewan is one of only two provinces to see its median age get younger
in the past year. In fact, since 2007, Saskatchewan’s median age has dropped
from 38.0 to 37.3.
Wall said this refl ects the fact that more young people and young families are
choosing to stay in Saskatchewan or are moving back to Saskatchewan.
“Th at means good things for our province’s future,” Wall said.
“A growing population and economy provides a growing tax base which
allows government to lower taxes and fund important government services like
health care, highways and education.”
Saskatchewan grows by 10 citiesSaskatchewan grows by 10 cities
This red service rig was working along Highway 13 between Grif- n and Stoughton on Oct. 13.
Photo by Brian Zinchuk
Working hard
PIPELINE NEWS November 2011 B27
IT’S ABOUT TIMEIT’S ABOUT TIMEJACK!JACK!
www.annugas.comToll Free 1.866.ANNUGAS
ANNUGAS PRODUCTION ENHANCERANNUGAS PRODUCTION ENHANCER
PAYS FOR ITSELF– 4 WEEKSThe increase in oil/gas
production isimmediately
measureable not only in time, but
real dollars.
INSTALLATION – 1 DAY
It only takes a few hours to have your compressor
up and running, practically eliminating production downtime.
YOUR TIME – ZERO
Our safety qualified installers willperform maintenance checks when required,onsite, saving you the
trip in.
®
Jack knows time is moneyJack knows time is moneyJack knows time is money
COMPRESSION CONSULTING LTD.
Please visit us at www.crescentpointenergy.com to learn more.
erggy.com yy
Thank you, Saskatchewan, for
10 great years.
We’re proud to be a part of your community.
PERCY H. DAVIS LTD.
CUSTOMS BROKERSForwarders & ConsultantsCustom Clearance Specialists
EDI Networking
Check out our International Small Package Service
DAILY DELIVERIES INTO DAILY DELIVERIES INTO ESTEVANESTEVANHEAD OFFICE
North Portal (306) 927-2165Estevan (306) 634-5454
Regina ................................(306) 352-2662Saskatoon...........................(306) 244-4847Regway...............................(306) 969-2126Moose Jaw .........................(306) 694-4322
Nationwide Serviceswww.percydavis.com
E-mail Address: [email protected]
(Nickle’s Daily Oil Bulletin) With a return to drier weather in Saskatch-
ewan, PetroBakken Energy Ltd. production has exceeded 43,000 boepd (87
per cent light oil and natural gas liquids), based on field estimates – up 22
per cent from the second quarter the company has reported.
Bakken business unit production is again over 20,000 boepd while
output from the Cardium business unit exceeds 14,000 boepd, with the
remainder of the production generated by the company’s southeast Sas-
katchewan conventional and Alberta/British Columbia business units.
PetroBakken, a 59 per cent-owned subsidiary of Petrobank Energy and
Resources Ltd., estimated that approximately 3,000 boepd of additional
productive capacity is currently down as of the first week of October due
to well maintenance, site access constraints (primarily related to flooding
originating in the second quarter) and facility maintenance.
Drilling activity in the third quarter resulted in 96 (69.9 net) wells,
a decrease of 19 (5.1 net) wells over the same period last year. Of the to-
tal, 32 (25.2 net) wells were drilled in the Bakken, 44 (31.3 net) wells in
the Cardium, 19 (12.4 net) wells drilled in PetroBakken’s Saskatchewan
conventional business unit and one (one net) well in its Alberta/British
Columbia business unit.
At the end of the quarter, there was an inventory of 47.7 net wells ei-
ther waiting to be completed or to be placed on production. Of these wells,
13.7 net wells were in the Bakken (6.8 net of which are on production but
not stimulated) and 24.5 net wells were in the Cardium.
PetroBakken said it continues to execute on its business plan and as
of early October had 18 drilling rigs operating: eight within the Cardium
fairway of Alberta, six within the Bakken fairway in southeast Saskatch-
ewan, two drilling conventional prospects in southeast Saskatchewan and
two drilling exploration wells in central Alberta.
The company anticipates that an additional 48 net wells will be drilled
and a total of 75 net wells will be brought on-
stream by the end of the year. This would leave an
anticipated inventory of 21 net wells which would
be expected to be brought onstream in the first
quarter of 2012.
PetroBakken running 18 rigs
What do you call a group of dozers? A herd? A gaggle? A ock? Maybe a eet? A crew? This crew of dozers was resting west of Stoughton on Oct.
13. Photo by Brian Zinchuk
What are they?
B28 PIPELINE NEWS November 2011
PIPELINE NEWS November 2011 B29
ENVIROTRAP SYSTEMS 1-306-483-7330Sales Contact: CHEYENNE OILFIELD SERVICES 1-306-483-7924
E-mail: [email protected] www.envirotrap.com
THE PROBLEM
All Your Wellhead Containment NeedsAll Your Wellhead Containment NeedsIncluding Hydraulic Pumping UnitsIncluding Hydraulic Pumping Units
MISSION STATEMENT“We Work In Harmony With Both The Oil Industry & Landowners To Protect
Our Environment”
ENVIROTRAPENVIROTRAPSYSTEMSSYSTEMS
THE SOLUTION
• Unit cost is less than clean-up cost from one packing failure
Responsible Product From a Responsible
Company
Chemical Barrel Containment
Stand
WellheadContainment Unit
Hydraulic PumpContainment Unit
Estevan Office: Estevan Office: Phone:Phone:
(306) 634-2681 (306) 634-2681Fax: Fax:
(306) 636-7227(306) 636-7227
Calgary – Oilsands
Quest Inc. may have
enough cash in its pock-
et at the end of October
to continue to advance
the development of its
oilsands pilot project at
Axe Lake, Saskatchewan
toward commercial pro-
duction of bitumen.
Th e Calgary-based
company is hoping to
convert a non-binding
letter of intent by a
third party to purchase
the company’s Wallace
Creek bitumen assets in
Alberta for $60 million
into a signed deal by the
end of the month.
Earlier in Septem-
ber, the company re-
ported it could run out
of fi nancing at the end
of October without ad-
ditional funding to con-
tinue its core steam as-
sisted gravity drainage
(SAGD) pilot project at
Axe Lake.
Th e pending trans-
action for Wallace
Creek, announced on
Sept. 27, includes $40
million in cash and a
$20 million contingent
payment subject to “cer-
tain events” according to
a news release.
“Th is prospec-
tive transaction is good
news for Oilsands Quest
shareholders,” said chief
executive offi cer Garth
Wong.
“It will provide us
much of the capital we
need to complete the Axe
Lake pilot and prove the
commercial recoverabili-
ty of our highest priority
core asset.
“While Wallace
Creek has shown con-
siderable potential, it
is not yet as well delin-
eated as Axe Lake and
is therefore considerably
further away from com-
mercial development,”
said Wong
Th e prospective pur-
chase off er follows the
cancellation of a $60
million rights off ering
on Sept. 12 with news
the company had re-
ceived a letter of intent
for the possible sale of
Wallace Creek.
“Our decision to
cancel the rights off er-
ing considered that the
negotiation of a material
transaction had reached
an advanced stage – a
transaction that would
signifi cantly change our
use of proceeds described
in the rights off ering
prospectus,” explained
Wong.
“As well, it had be-
come apparent that we
would not achieve a full
$60 million subscription
through the rights of-
fering, perhaps at least
partially due to the weak
markets of recent weeks.
“We are striving to
return the company to a
solid fi nancial footing so
that we can move ahead
on unlocking the value
of the barrels of bitumen
we have in the ground.
We appreciate the pa-
tience of our sharehold-
ers through this chal-
lenging period.”
Oilsands Quest is
also evaluating fi nancing
alternatives including
a private placement of
equity or a new, smaller
rights off ering that will
continue to explore stra-
tegic partnerships or
further asset sales.
Completion of the
Wallace Creek trans-
action is subject to a
number of terms and
conditions, including
negotiation of a defi ni-
tive agreement, board
approvals, due diligence,
fi nancing and approv-
al by Oilsands Quest
shareholders.
Oilsands Quest an-
ticipates that a defi ni-
tive sale agreement will
be concluded by the end
of October and that the
transaction will close by
the end of December
2011.
A further announce-
ment will be made upon
the execution of a defi ni-
tive sale agreement.
Th e company has
held Wallace Creek in
its portfolio since Janu-
ary 2008, when it pur-
chased the 45,545-acre
permit.
Th e area is prospec-
tive for SAGD oilsands
recovery, subject to fur-
ther seismic and drilling
investment to delineate
the bitumen reservoir
more fully.
Th e company says
the exploration program
conducted over the past
three years has added
substantially to the
geological understand-
ing and potential of the
Wallace Creek reservoir,
as refl ected in the trans-
action price.
Oilsands Quest re-
ceived approval from Al-
berta Energy in June to
extend its Wallace Creek
permits for an additional
67 days to March 31,
2013 to allow for two
full seasons of winter ex-
ploration programs.
Th e company also
relinquished its licences
in Saskatchewan and its
southernmost contigu-
ous permits at Raven
Ridge in Alberta this
year to focus all of its ac-
tivities in Saskatchewan
on Axe Lake.
In addition, Oilsands
Quest received approval
from the government of
Saskatchewan to convert
portions of its Axe Lake
permits to 15-year leases
– the fi rst oilsands leases
in the province.
Th e proceeds from
the sale of the Wallace
Creek asset, if concluded,
will reduce the amount
of capital the company
requires to advance the
Axe Lake pilot project.
Th e proposed pilot
will consist of one pair of
100 metre long horizon-
tal wells, with the upper
well placed fi ve metres
below the glacial till cap,
or overburden, and is de-
signed to make use of the
existing surface facilities.
Oilsands Quest expects Wallace Creek sale
Serving S.E. Saskatchewan & Serving S.E. Saskatchewan &
Western ManitobaWestern Manitoba (Secor, Comply Works, and WCB compliant)(Secor, Comply Works, and WCB compliant)
Running Bear Rentals Ltd.
Box 395, Wawota Sask S0G 5A0306-575-8209
Light Towers 8kw 20kw
B30 PIPELINE NEWS November 2011
Dave: 306-461-4322Pat: 306-861-9986
• BEST trained most experienced staff
• BEST and newest equipment
• BEST engineering support
• BEST quality and service
• BEST choice for oilwell optimization
Calgary, Alta. – TransCanada Corporation’s
proposed Keystone XL pipeline is expected to gen-
erate more than 5,100 person years of employment
for Americans in South Dakota.
A new independent U.S. economic study says
the construction of the pipeline through the state
will stimulate the creation of those jobs from a com-
bination of construction work and spin-off jobs.
Th e report from the Perryman Group could
help the U.S. Department of State to determine if
the proposed pipeline is in the U.S. national interest
during its ongoing 90-day consultation period with
regulatory approval at stake.
If construction of the pipeline begins early in
2012, Keystone XL is expected be operational in
2013.
“Th is $7 billion pipeline project is shovel ready
and will put South Dakotans and thousands more
Americans back to work once construction begins,”
said Russ Girling, TransCanada president and chief
executive offi cer in a Sept. 29 news release.
“We will invest a total of $13 billion into the
entire Keystone pipeline system – all private money
with no government stimulus – to deliver Canadian
and American crude oil to the U.S Gulf Coast to
address the energy needs of Americans.”
Th e Perryman Group estimates that during con-
struction the project would lead to $470 million in
new spending for the South Dakota economy; in-
crease personal income by $319 million and boost
state and local tax revenues by more than $10 mil-
lion.
Th e study further concluded that once the pipe-
line is operational, South Dakota could see nearly
$685 million in property taxes to county and other
local governments during the operating life of the
pipeline, money that could be used to build new
roads, schools and hospitals.
Construction in South Dakota would consist of
seven new pump stations and over 314 miles of new
pipeline that would cross nine counties and is ex-
pected to employ over 3,050 construction workers.
Th e study notes the benefi ts of Keystone are not
limited to the states where it would be located.
From pipe manufactured in Arkansas, pump
motors made in Ohio and transformers built in
Pennsylvania, workers in almost every state in the
U.S. would benefi t from the project and the ongoing
development of Canada’s oil sands.
TransCanada says that within days of receiving
regulatory approval for Keystone XL, the project
would begin to put 20,000 Americans directly to
work during the construction phase.
Th is includes welders, pipefi tters, heavy equip-
ment operators and engineers to construct the proj-
ect that is expected to create an additional 118,000
total spin-off jobs (in person-years).
Th e Perryman study conservatively estimates the
permanent increase in stable oil supplies from the
Keystone XL pipeline will add more than 250,000
permanent jobs for U.S. workers and add more than
$100 billion in annual total expenditures to the U.S.
economy.
TransCanada and its supporters believe the
Keystone XL would also have a signifi cant ongoing
benefi t to the U.S. economy by providing a more sta-
ble, consistent and reliable supply of crude oil from
Canada versus importing crude oil from volatile, un-
stable regimes overseas that do not share the inter-
ests and values of Americans.
Th e proposed 2,673 kilometre pipeline to trans-
port crude oil from Hardisty, Alberta to delivery
points in Oklahoma and Texas received an environ-
mental clearance on Aug. 26 with the release of the
Final Environmental Impact Statement by the U.S.
Department of State.
TransCanada has voluntarily agreed with the
federal pipeline regulator to an additional 57 special
conditions that provide an even greater confi dence
in the operation and monitoring of the pipeline,
including: a higher number of remotely controlled
shut-off valves, increased pipeline inspections and
pipe that is buried deeper in the ground.
Keystone XL to pump jobs into South Dakota
Calgary, Alta. – Th e Energy Resources Conser-
vation Board (ERCB) has made four amendments
to its well-spacing framework for conventional and
unconventional oil and gas reservoirs.
Th e changes allow for enhanced conservation of
Alberta’s oil and gas resources by enabling compa-
nies to optimize resource recovery, in a safe, effi cient,
and responsible manner that maximizes the benefi t
of the resources for all Albertans.
Eff ective immediately, subsurface well-density
controls for coalbed methane and shale gas have been
removed across Alberta, and in certain gas zones in
southeastern Alberta.
In addition, baseline well densities have been
increased from one well to two wells per pool per
standard drilling spacing unit province-wide for
conventional gas reservoirs.
Centralized target areas for drilling spacing
units will now be standard throughout Alberta, with
the exception of a specifi c area in southeast Alberta
where corner target areas will be standard for gas
reservoirs only.
Regulation amendments have also been imple-
mented which decrease the complexity of the cur-
rent spacing framework.
Well spacing relates primarily to the subsurface
aspects of reservoir development and does not im-
pact the rights of landowners with respect to surface
development.
ERCB requirements for development of all
surface facilities, such as wells and pipelines, which
include public notifi cation requirements and allows
landowners to participate in ERCB processes, re-
main unchanged.
Well spacing relates primarily to the subsur-
face aspects of reservoir development and does
not impact the rights of landowners with respect
to surface development.
ERCB requirements for development of
all surface facilities, such as wells and pipelines,
which include public notifi cation requirements
and allows landowners to participate in ERCB
processes, remain unchanged.
ERCB adjusts well spacing framework
PIPELINE NEWS November 2011 B31
Supplementing both the Drilling and Production sectors of the Oilfield Industry. Tanker Units, Pressure Batch Trucks, and a Fully Equipped Pressure Batch Trucks, and a Fully Equipped
Service Truck are available. Service Truck are available.
We specialize in transporting Salt Water, Crude Oil, We specialize in transporting Salt Water, Crude Oil, Completions, Completions, Contaminated Mud & Fresh Water!Contaminated Mud & Fresh Water!
Office 1-306-453-4470Office 1-306-453-4470Fax 1-306-453-4404Fax 1-306-453-4404
Manager 1-306-577-9960Manager 1-306-577-9960Dispatcher 1-306-577-9801Dispatcher 1-306-577-9801
“Serving The Oil and Gas Industry “Serving The Oil and Gas Industry with 24 Hour Drilling Fluid Service”
Specializing in Non DamagingSpecializing in Non DamagingBiodegradable Drilling FluidsBiodegradable Drilling Fluids
Designed for Horizontal DrillingDesigned for Horizontal DrillingPO Box 1089, Carlyle, Saskatchewan S0C 0R0PO Box 1089, Carlyle, Saskatchewan S0C 0R0Phone: Phone: (306) 453-4411 (306) 453-4411 Fax: Fax: (306) 453-4404 (306) 453-4404
Division PresidentDivision President306-577-9900 (Carlyle)306-577-9900 (Carlyle)
Field Supervisor Field Supervisor306-421-0344 (Estevan)306-421-0344 (Estevan)
Field SupervisorField Supervisor306-452-8182 (Redvers)306-452-8182 (Redvers)
Warehouse ManagerWarehouse Manager306-577-3347(Carlyle)306-577-3347(Carlyle)
gg
Designing & Implementing Designing & Implementing Production Chemicals Production Chemicals
for Western Canadafor Western Canada
Cell: 306-575-7521Cell: 306-575-7521Of ce: 306-453-4414Of ce: 306-453-4414Fax: 306-453-4415Fax: 306-453-4415
mm g gg gf th Oilfi ld I d t T k U itf th Oilfi ld I d t T k U it
menting both the Drilling and Production menting both the Drilling and Production
B32 PIPELINE NEWS November 2011
Calgary Lloydminster Provost Redcliff Drayton Valley Kindersley Medicine Hat
Calgary Sales 403.264.6688
PPRODUCTION EQUIP. TANKS PUMPJACKS
The Oilfield Equipment People!TM
1.888.745.46471.888.745.4647Toll Free
Separators Treaters Free Water Knockouts
Pumpjacks Tanks Lineheaters Flare KO’s Compressors
NGL Bullets Primemovers Pumpskids Flarestacks
Gas Sweeteners Flowmizers Meterskids Dehydrators
Separators Treaters Free Water Knockouts
Pumpjacks Tanks Lineheaters Flare KO’s Compressors
NGL Bullets Primemovers Pumpskids Flarestacks
Gas Sweeteners Flowmizers Meterskids Dehydrators
PLATINUMPLATINUMEnergy GroupEnergy Group
www.platinumenergycanada.com
PUMPING UNITS
PIPELINE NEWSSaskatchewan’s Petroleum Monthly
C-SectionNovember 2011
Crane operator gets a lift from oilpatch
By Brian ZinchukEstevan – A love of lifting things has kept Dwight Packer in fi re-retardant coveralls while at the
controls of his cranes for 29 years.
Packer is the owner of Skylift Services Inc. of Estevan, the largest lifting operation in southeast
Saskatchewan.
“I got my fi rst boom truck in 1982, and have been expanding ever since,” Packer told Pipeline News.
Th e fi rst shop was built in 1983, a tiny 32 x 45 foot Quonset. “I wondered what I would do
with all the extra space,” he recalled.
Ever since, space has been at a premium. Th e old yard had numerous shop expansions
over the years, and fi nally, a new facility was built in the Frontier Peterbilt Industrial Park
east of Estevan. It was built in the summer of 2008, but they weren’t able to get into it
until the summer of 2009.
“We outgrew this shop before we moved,” he said, noting they use both yards.
In the early years, he started with a small portion of the old yard, then rented a
bit more yard space with each expansion.
“When I fi rst got into the business, I ran under L&C Trucking’s authority.
Walter Christenson helped me get started.”
Packer has been operating on his own since 1989.
“I bought my fi rst crane, a 35-ton, in 1987,” he said. “I bought a couple of
rough terrain [cranes] in 1989, a 15-ton and a 35-ton. In 1994, I built my
second shop, and had about four staff .”
Packer personally started out running cranes. He said, “It is a specifi c
skill, no doubt about it. I have had people tell me they can run anything
but fi nd that a crane is diff erent. One guy said he could run anything.
He got in the crane for one minute, and got out frustrated.
“You’re not moving the hook, you’re sort of chasing it, but you
know where it’s going,” he said.
As example, he noted that when a load is swinging into
position, positioning the boom over it causes it to stop.
“We have to make sure we know where everyone is, and
is out of the way.”
It’s apparent in his voice Packer has a love of cranes.
“I don’t just run cranes because I have to. I enjoy run-
ning cranes more than being in the offi ce.”
Page C2
Call Mike or Sean for more Call Mike or Sean for more information on all of the new and information on all of the new and used trucks and trailers we have used trucks and trailers we have
available for sale atavailable for sale at1-800-667-19301-800-667-1930 OR OR
check out our inventory online atcheck out our inventory online atwww.warnerindustries.cawww.warnerindustries.ca
• SALES• SALES• LEASING• LEASING• PARTS• PARTS• SERVICE• SERVICE• TRANSPORTATION• TRANSPORTATION
Regina Regina 330 4th Ave. E.330 4th Ave. E.
Moose JawMoose JawJct. N. Service Rd. Jct. N. Service Rd. & Hwy. 2 N.& Hwy. 2 N.
We have a great We have a great selection of new Doepker trailers selection of new Doepker trailers
available and on order.available and on order.Check online or give us a call Check online or give us a call
for a complete list!for a complete list!
Skylift's 120-ton crane lifts a tank into secondary containment. Photo submitted
Page C1Indeed, he’s often found running equipment,
even though his company is at a size where man-
agers tend to stay in the offi ce. His offi ce has a
direct entry from the shop area for easier acces-
sibility.
“I still get a big thrill out of lifting things,”
Packer said.
Varied fl eetTh e company’s fl eet covers a broad spectrum.
Th e smallest is a “Spyder crane.” It’s a tiny track-
mounted unit with outrigger legs that spread out
to look very much like a spider. When folded up,
it’s narrow enough to fi t through doorways and
into buildings. Th at unit was acquired about three
years ago.
“It goes in streaks. Lately, it’s been very busy,
or we’ll go a month without using it.”
Moving up in size is a 15-ton carry deck crane
on which the cab does not rotate with the boom.
Four rough-terrain cranes – a 15-ton, 35-ton
50 and 55-ton are next. Th e 50-ton was seen at
the Boundary Dam Power Station on the day of
the interview.
On the picker side, also known as boom
trucks, Skylift has 27, 30, 42 and 45-ton units. All
are equipped with fi fth wheels. Indeed, Packer ex-
plained. “We were the fi rst in the area to use fi fth-
wheel mount QMC pickers. Now everybody’s got
’em.”
For mobile cranes there are units in the 35, 60,
75 (two units), 90 and 120-ton sizes. Mobile cranes
can be identifi ed by their separate driving cab.
“We will have a brand new 110-ton Grove in the
yard,” Packer said, anticipating its delivery before the
publication of this paper.
With such a broad spectrum of lifting capacity,
Packer noted “Th ey all see their streaks. Right now,
my 75-ton Terex is the busiest. We do a lot of coiled
tubing at well sites. Th ey have to remove the coil be-
fore moving down the road. [Th e truck] would be
too heavy. [Th e coil] will go on a transport to the
location.
“In many cases, we’ll do the hauling as well,
transporting from one location to the next.”
Th ey have fi ve semi tractors and “a pile of trail-
ers.”
Other than coiled tubing, Packer said the com-
pany does a wide variety of work.
“We do a lot of facil-
ity work,” he said, not-
ing they were setting a
treater and header build-
ing at an NAL site that
day. Th e aforementioned
rough terrain crane was
at the power station, and
another crane was work-
ing on a coal-mining
dragline the day before.
“We do a lot of
pumpjacks – setting
them, maintaining them,
setting new ones. We
move and reset old ones.
Sometime’s they’ll settle, so we pick them up and
reset them.”
In addition to conventional lifting, they also do
some dropping – pile drivers, that is. “We do
driven piles. We have two pile rigs,” Packer said.
Th e drop hammer rigs are used with a pick-
er.
“A boom truck goes in, sets up quickly, and
tears down quickly,” he described. “It’s cost eff ec-
tive for smaller jobs.”
Skylift got into pile driving a dozen years
ago.
“We can do up to 16-inch piles and up to
about 51-feet long,” he said.
Recent growth“Most of our expansion has taken place in
the last six years. Oil has been a huge factor. Sas-
katchewan is the centre of the economic universe
right now. Th ere are power projects and oil,”
Packer said. “Th e coal mines give us lots of work
as well.”
“It’s an exciting time to be in the crane busi-
ness.”
Asked whether he would be looking at sub-
stantially larger cranes, Packer said those typical-
ly end up on project work, much further afi eld.
Th at’s contrary to his preference to remain rela-
tively close to home, within 200 miles. “It’s im-
portant to me to have everyone home at night, as
much as possible,” Packer said. “You can’t run a
business like this without people, and you
need to keep them happy.”
Skylift employs 28 people, but could
stand to add a perhaps one more crane
operator and one more picker operator.
“We try to grow from the inside, and
promote from within,” he said. “Th ey
grow up with the company, and don’t de-
velop habits we don’t like.”
“I’m very fortunate to have very ex-
traordinary people. I have the best peo-
ple. I know I do,” he said, adding that
included fi eld and offi ce staff .
“If everyone walked out tomorrow, I’d
shut the doors. You can’t do this without
them and I wouldn’t want to start over.
“Oil has been the mainstay over the
years. Power projects come and go. Th ey
[oil] are our bread and butter and have always been
at least 50 per cent of what we’ve done,” he conclud-
ed. “However, we do feel fortunate to have such a
diversifi ed customer base,” Packer said.
C2 PIPELINE NEWS November 2011
T. K. Trailer SalesManor, Sask. Ph: 1-306-448-2260; Cell: 1-306-575-7116
www.pjtrailers.com
DumpsDumps96” x 14’96” x 14’
60” x 8/10’60” x 8/10’ 78” x 10/12/14’78” x 10/12/14’
TiltsTiltsMakes Loading Makes Loading
Easy!Easy!
UtilitiesUtilitiesA variety to A variety to choose fromchoose from
Car Car HaulersHaulers
• COMMERCIAL • COMMERCIAL • FARM • FARM • OILFIELD • OILFIELD • PERSONAL• PERSONAL
2 & 3 Axle 2 & 3 Axle (various weights)(various weights)
8” I-Beam Frame8” I-Beam Frame
GoosenecksGoosenecks DeckoversDeckovers
We Now Sell LWe Now Sell LIGHTNINGIGHTNING CARGO TRAILERS! CARGO TRAILERS!
All AluminumAll Aluminum
Dan O’ConnorOperations Manager
204-748-5088
Office - Kola, MB.Office - Kola, MB.204-556-2464204-556-2464
Daylighting, Oilfield Hauling, Steaming & Mobile Pressure Washing, Winch, Water & Vac-uum & Computerized Certified Pressure Truck Services
Exciting times for crane operatorsDwight Packer lifts coiled tubing with a crane while Ryan Floden (below) coun-ters the wind with his tag line
PIPELINE NEWS November 2011 C3
Scott (Scooter) Boyes: 306-482-8886 Scott (Scooter) Boyes: 306-482-8886 Jason (Jake) Boyes: 306-482-8883 • Shawn (Gump) Boyes: 306-482-8313Jason (Jake) Boyes: 306-482-8883 • Shawn (Gump) Boyes: 306-482-8313
C
General Oil eld Hauling General Oil eld Hauling Serving Alberta, Saskatchewan and ManitobaServing Alberta, Saskatchewan and Manitoba
· Winch Trucks· Winch Trucks· Texas Bed Tri Drive· Texas Bed Tri Drive· Air Ride Equipment· Air Ride Equipment· 50 Ton Hiboys · 50 Ton Hiboys
· 50 and 60 Ton Scissorneck · 50 and 60 Ton Scissorneck Lowboys Lowboys· Tandem Axle Jeeps· Tandem Axle Jeeps· 30 Foot Gooseneck Hotshot Trailers· 30 Foot Gooseneck Hotshot Trailers
CLIFF NANKIVELLTRUCKING LTD.
Kalvin NankivellPresident
Claudia MullisVice-President
Of ce: (306) 462-2130Fax: (306) 462-2188
Box 123Kisbey, SK S0C 1L0
Phone: 634-5519 or 634-734124 Hwy. 39 E. Estevan
• GENERAL OILFIELD HAULING • TANK & TREATER MOVING • 24 HOUR PERSONALIZED SERVICE • PIPE CUSTODIAN • PUMP JACK HAULING
L & C Trucking
Estevan – While some might consider constantly
lifting heavy loads might be hard on the stress level,
that’s not how Kerry Goudy sees it.
Th e long-time picker operator is now a dis-
patcher with L&C Trucking in Estevan, a position
he has held for nearly two years. But prior to that, he
spent many years in the fi eld, mostly moving pipe.
“When I came into this, I didn’t know anything
about the oilfi eld,” Goudy said. “I worked at the
brickyard for 16 years.”
Goudy found himself working at Estevan Brick-
yard right out of high school, but when that job dried
up, it was time to turn to the oilpatch.
Goudy had a truck driver’s licence when he
started at L&C, as well as a rigging certifi cate, but
not a picker ticket.
“I took a fi ve month course when the brickyard
closed,” he said. “I needed something to do because
the brickyard was closing down. I needed somewhere
to go.”
He didn’t fi nd the course, which is heavy on load
charts and math, diffi cult. “I’m into that stuff . I didn’t
fi nd it hard. I never had a problem with math.”
“Anyone you talk to who has trouble, it’s the
math. Th eir main problem is the load charts area.
“You learn quick as a picker operator. You’ve
got to grab anything and everything. To be effi cient,
you’ve got to pay attention.
Page C4
Kerry Goudy has moved into the dispatch role after several years running pickers like the one be-hind him. Photo by Brian Zinchuk
Running picker? Not stressful. Dispatching? That’s stress
C4 PIPELINE NEWS November 2011
$190,000$190,000Rent to own
option available!!
ONLY 2 LEFT!SRI MODULAR HOMES FOR SALE
Right in Macoun (15 min. west of Estevan).
1,265 SQFT, 3 bedroom, 2 bath home
located on 80’ x 120’ lots.
1,000 SQFT pressure treated sun deck.
Call 421-3749
2011 Rental Price & Size Chart for 400bbl Tanks: 4 Panels X 4 Panels = 31’ X 31’ Good for One (1) OR Two (2) 400bbl Tanks. 4 Panels X 6 Panels = 31’ X 46’4” Good for Three (3) OR Four (4) 400bbl Tanks. 5 Panels X 6 Panels = 38’8” X 46’4” Good for Five (5) OR Six (6) 400bbl Tanks.
Rent: 400bbl Tanks, Mats, Secondary Containment, Self Powered Wireless Tank Gauges & Remote Tank Communication
Canada & USA Patent Pending
Containment Design
Lee (306) 487-7411 John (306) 487-7756 Keith (403) 909-3885
SSoutheast Rentals Ltd. Secondary Containment System Rentals
$375 / month
$440 / month
$500 / month
Crossover Stairs $ 85 / month
Save Time & Money with Fully Assembled Modular Walls Transportable & Expandable - Drop, Place and Pin Corners
36”
When hiring Scott Land, YOU hire the Advantage...• Surface Acquisitions, Freehold Mineral Leasing, Administration Projects• No project is too small or too large• Most active Land Company in Saskatchewan & Manitoba, with a proven 25 year track record• Experienced Field Agents• Competitive Rates, Including an Emerging Company Plan (ECP) package to all Junior Start-up Companies
1460 - 2002 Victoria AvenueRegina, SK S4P 0R7
Toll Free: 1-888-939-0000Fax# 306-359-9015
www.scottland.ca
Shaun Kozak, Mineral Manager 306-790-4352Chad Morris, Surface Manager 306-790-4363Celeste Farrow, Surface Coordinator 306-790-4378Laurie Bielka, Assistant Branch Manager 306-790-4360Crown Sale Inquiries 403-261-6580Main Line: 306-359-9000
Scott Land & Lease Ltd.
Page C3“You’ve got to be on
the ball. If it’s going to
go sour, it’ll go fast.”
Preplanning your
lifts is key, according to
Goudy, who said, “To
be a good picker opera-
tor, you’ve got to see the
end, and work your way
to the start. Th ere are
so many steps involved.
You make it so much
easier if you see the job
before you start it.”
Th ere’s also less
chance of missing some-
thing when you think
ahead, he added.
Most of his lifts
have been pipe and rods,
he explained, as L&C is
a pipe custodian, a com-
pany that takes care of
and transports pipe for
oil companies. “We haul
a lot of pipe.”
“In the fi eld, a lot
of times they don’t have
loaders. Drilling rigs
have loaders, but service
rigs don’t.
“In the beginning,
a lot was put on the
ground, on timbers.
Most guys just picked it
off the ground.”
He has also set a lot
of pumpjacks over the
years. Jacks have a lot of
things to tie down and
it needs to be done in a
certain manner so as to
not be overweight.
Goudy has also
had a lot of swampers.
Asked what makes a
good swamper, he said,
“One that pays attention
and basically does what
needs to be done. One
that knows where he
should be at all time.”
Th ey also have to
be willing to learn, he
added. A few of his
swampers have gone
on to become operators
themselves.
“Th e biggest thing
for a good swamper is
to be one that shows
up!” he said. “It’s nice to
have the same swamper
all the time, but that’s
not always a luxury.”
“It can be long
hours, but now with
complying with hours
of service [regulations],
you’re not out as much
as you used to be.”
One of his more
unique lifts was to lift a
roof off the foundation
where it was assembled
and over to the side.
Another operator in-
stalled it on the house
later. “Th at was pretty
interesting,” he said.
As for how he
ended up being one of
L&C’s three dispatch-
ers, Goudy said, “Th ey
asked me. Th ey needed
somebody to fi ll the
spot; I’d still be in the
picker.”
“Th e thing about
being in the picker is
there was no stress.
Any job they’d give you,
you’ve done a hundred
times.
Goudy describes
himself as laid back, but
said he still likes to get
the job done, and get it
done effi ciently.
Blair Hunter, whose
management duties
include looking after
L&C’s pickers, inter-
jected. “He’s not for
hire,” he said with a
smile. “Pickers are a hot
commodity right now.”
Coming to the dis-
patch side of things
from a picker opera-
tor experience makes it
“way easier to be a dis-
patcher,” Goudy said.
“Dispatching is high
stress. You’re not just
dealing with your job,
but everyone else’s jobs,
and their personalities.
You have to be neutral,
take it in, be a mediator,
and move one.”
“I’m a perfectionist.
I always have been. It’s
a trait of a good picker
operator. You have to
take pride in what you
are doing,” Goudy con-
cluded.
An L&C Trucking picker rolls down the street, leaving their principle yard on the east side of Estevan.
You've got to see the end, and work your way to the start
PIPELINE NEWS November 2011 C5
Estevan, SK
Arti cial Lift Systems 306.637.6055
Completion Systems 306.634.9339
Drilling Services 306.634.2924
Fishing & Re-Entry Services 306.634.2924
Rental Services 306.634.2924
Wellhead Systems 306.634.7600
Thru-Tubing Services 306.634.2924
Wireline 306.634.4726
Weyburn, SK
Testing and Production Services 306.842.2699
Secure Drilling Services 306.842.2699
(Nickle’s Daily Oil Bulletin) - Gibson Energy
Inc. and Palko Environmental Ltd. have entered
into an agreement providing for the acquisition by
Gibson of all of the issued and outstanding com-
mon shares of Palko not already owned, directly or
indirectly, by Gibson.
Under the terms of the transaction, sharehold-
ers of Palko may elect to receive either: (i) 0.1717
of a common share of Gibson for each Palko share;
or (ii) $3.05 cash for each Palko share; or (iii) a
combination thereof.
Th e total cost to Gibson is approximately
$62.7 million, including the assumption of esti-
mated net debt of approximately $15.95 million.
When combined with the company’s invest-
ments in Palko to date, pursuant to which Gibson
has acquired approximately 39 per cent of the out-
standing Palko shares, Gibson is paying an eff ec-
tive price of approximately $2.26 per Palko share
in order to acquire 100 per cent of Palko.
Th e transaction will expand Gibson’s Cana-
dian custom terminal operations to include water
disposal services and oilfi eld waste management.
“Th e acquisition of the remaining interest of
Palko is a key step in forming this platform to
meet the ever-increasing water disposal services
and oilfi eld waste management needs of the oil
and gas industry in North America,” Stew Han-
lon, president and chief executive offi cer of Gib-
son, said in a prepared release. “Palko represents a
strategic acquisition for Gibson. Combined with
our recent investment in the Plato pipeline, treat-
ing and disposal facility and development plans
for our Rimbey custom terminal, it creates a ser-
vice off ering in Western Canada that will make
Gibson a signifi cant player in this space.”
Th e combined platform, including Palko (100
per cent interest), Plato and Rimbey, represents an
investment by Gibson of $82 million for a total
estimated earnings before interest, taxes, deprecia-
tion, and amortization (EBITDA) contribution of
$16 million per year when fully operational.
“Th is expansion of Gibson’s custom terminal
service off ering across Western Canada will create
additional benefi ts in our trucking and market-
ing businesses due to the integrated nature of our
business model,” Hanlon said.
Th e transaction is to be completed through an
arrangement pursuant to the Business Corpora-
tions Act (Alberta) and is expected to be complet-
ed by the middle of December.
Completion of the transaction is subject to ap-
proval by Palko shareholders, court approval and
regulatory approvals.
Th e board of directors of Palko has unani-
mously determined, with the nominees of Gibson
abstaining, to recommend that Palko shareholders
vote their Palko shares in favour of the transaction.
Certain shareholders of Palko, collectively hold-
ing or controlling approximately 42.9 per cent of
the Palko shares (81.8 per cent of the Palko shares
when combined with the Palko shares already
owned by Gibson), have entered into agreements
with Gibson whereby they have irrevocably agreed
to vote their Palko shares in favour of the transac-
tion.
Th e terms of the transaction prohibit Palko
from soliciting or initiating any discussion re-
garding any other business combination or sale of
material assets, includes provisions for Gibson to
match competing, unsolicited proposals and, sub-
ject to certain conditions, provides for a $3 million
break fee payable by Palko to Gibson.
FirstEnergy Capital Corp. is acting as fi nan-
cial adviser to Palko. Scotia Capital Inc. is acting
as fi nancial adviser to Gibson with respect to the
transaction.
Gibson Energy to acquire Palko Environmental
C6 PIPELINE NEWS November 2011
2012 MAXEY 30’X102” FLATDECK GOOSENECK
2x11, 200 lb. dual wheel axles, 16” wheels,
flip-up ramps, 5’ pop-up rear center,
led lights, front spring loaded
drop-leg jacks, D-rings, full width
diamond plate toolboxSUPER PRICE AT $ 10,995.00!SUPER PRICE AT $ 10,995.00!
Carlyle R.V. & Leisure 306-453-6773 www.carlylerv.com
4wd Tractor /4wd Tractor /Vacuum Wagon Uni tsVacuum Wagon Uni ts
•Daily or Hourly Rates •Daily or Hourly Rates
•SECOR Certi ed •SECOR Certi ed
Call 306.421.6374 Call 306.421.6374 or 306.486.2110or 306.486.2110
www.harleydavidsonofyorkton.comwebs i te spec ia l s –
2012 HARLEY-DAVIDSON’S®®Now AvailableNow Available
Ask About Service Shop SpecialsHARLEY-DAVIDSON® of Yorkton, SK
Since 1984306-783-1999
NEWNEW
Early deposits or lay-away
terms recommended
Stoughton, Oungre, gain disposal facilities
Mike Irvine of Endurance Oil eld Supervision and Construction sets elevations for the new Palko fa-cility at Stoughton. Photo by Brian Zinchuk
Oungre, Stoughton – Waste management
company Palko Envi-
ronmental Ltd. is in the
process of adding two
new facilities in south-
east Saskatchewan, one
near Oungre, and a sec-
ond near Stoughton.
“Business has been
steady with activity in
the area,” said Kyle Pe-
terson, Palko area man-
ager.
Th e company start-
ed with a disposal well
north of Midale. Con-
struction at that facility
started in 2007. A waste-
processing facility was
added in 2009 to pro-
cess other oilfi eld waste
streams. In the mean-
time, the company grew
to include four locations
in Alberta. Th e Oungre
and Stoughton facilities
are the fi rst expansions
in Saskatchewan, but
not likely the last.
“We plan to con-
tinue to grow,” Peterson
said.
Th e Oungre facil-
ity is located two miles
south of Oungre along
Highway 35 at 1-16-
2-14-W2. It is licensed
to accept water-based
oilfi eld waste streams.
Some examples include
service rig completion
fl uids, spill fl uids, pro-
duction fl uids and frac
fl uids.
Th e Stoughton facil-
ity is six miles south of
the town at 16-21-7-8-
W2. It will essentially be
a mirror image of Oun-
gre’s he noted.
Peterson said the
two new facilities will
accept tank trucks only
at this time. Vac trucks
will continue to be re-
ceived at Midale.
Both new facilities
will have six 1,000-bbl.
tanks for receiving fl uids
and pumping, plus ad-
ditional 400-bbl. utility
tanks.
Both Oungre and
Stoughton will have
drive-through unloading
risers, meaning no back-
ing up for truckers. Four
unloading spots will be
set up at each facility, with
the ability to add more
as required. Stoughton
has an entrance and exit,
while Oungre has one
entrance/exit and a turn-
around loop.
Each of the new fa-
cilities is located adjacent
to a highway, for easy ac-
cess. “It is a benefi t, to be
right off the highway,”
Peterson said.
Five people will be
employed at each of
the new facilities – one
manager and four op-
erators per facility. Lead
operators from Midale
were promoted to man-
agement positions at the
new plants. Jim Weber
will look after Stough-
ton, while Glenn Claybo
will take care of Oungre.
In addition to the
new disposal wells, Pe-
terson said the company
has had other projects
on the go. “We’re on
the move here. We built
a dedicated tank farm,
8-17-6-13, for Cenovus
that opened mid-Octo-
ber. It’s a facility to man-
age service rig work over
and completion fl uids.”
Dallas Birnie will be su-
pervising this operation.
Good product goes
back to Cenovus, and
the waste stream is sent
to the Palko Midale
plant.
Th e tank farm is near
the Cenovus Goodwater
plant.
Palko has also con-
solidated its Saskatch-
ewan administration
functions in a new offi ce
on Railway Avenue in
Weyburn. “We moved
our administration from
Midale to Weyburn,”
Peterson said.
“We’re excited to
better secure our current
customer base,” Peterson
said. “Th e two locations
were a good fi t for us.”
PIPELINE NEWS November 2011 C7
Foord Trucking Ltd.Foord Trucking Ltd.
Phone: 306.421.1049Phone: 306.421.1049
Sand & Sand & GravelGravel
1305 - 9th Street Estevan • 634-64561305 - 9th Street Estevan • 634-6456
Indulge your craving...Indulge your craving...
Granby’s on 9th
succulent lobster, succulent lobster, fresh shrimp & fresh shrimp &
crab legs. crab legs. Our chef is serving Our chef is serving up fine cuisine sure up fine cuisine sure
to satisfy any to satisfy any Seafood lover.Seafood lover.
I love work! In fact, I love it so much that I could
watch it all day!
Th is love began early in my life. Growing up in
the new area of Pleasantdale in Estevan, watching
work was an alternative to play. Houses were be-
ing built all around us, and my young friends and I
would watch from the sidelines the fascinating world
of work. From the pouring of cement foundations
to the framing and fi nishing, there was always some-
thing interesting to see.
We also watched the milk delivery men, news-
paper and letter carriers, and the garbage collectors
do their work on our street.
At home, my siblings and I watched my mother,
a nurse, work at healing our minor scrapes and cuts.
My father contributed to my love aff air with work.
He often took my brother, sister and me to his law
offi ce on weekends when he went back to do work or
to meet clients after hours. While he did his work, we
also “worked,” answering the phones as receptionists,
taking shorthand and typing memos as secretaries,
and sitting behind the big desks as lawyers, dispens-
ing wisdom and advice.
I know that I am not the only person fascinated
with the watching of work. Th ere is a whole genre of
reality TV devoted to the fascinating world of work
Ice Road Truckers, Dirty Jobs, and How It’s Made to
name just a few.
One of the benefi ts of my work now is watching
others do their work, up close and personal. From
watching the rig crew run sucker rods off the trailer
into the hole to re-assembling the pump jack after
servicing, there is always something interesting to
see.
“Wow! Did you see that?” I exclaimed to Lyle,
the new part-time guy I was training. We were at
Frontier Inspections outside of Estevan, loosening
the straps on the trailer holding down the sucker
rods that we were returning.
Th e loader operator, Alan, had approached in
his loader with the forks spread wide. But before he
got to the trailer, he slowed right down and paused.
In one of the smoothest moves I have ever seen, he
dipped the forks of the loader down to ground level
and with the left side he used the huge pincher grip
to pick up a small piece of wood about four-inches
square. Th is wood had a big nail protruding out of
the centre of it, a potential problem for anyone driv-
ing on the grounds. He then reversed the loader,
turned, and deposited the off ending small scrap of
wood in an open dumpster.
I was amazed. Alan had used the huge loader to
pick up the small piece of wood as easily as I could
have if I had simply bent over and used my fi ngers.
I was nearly speechless. I didn’t think anyone other
than Dwight at Guardian had that level of skill with
a big loader.
I had long been impressed with Dwight’s skill.
Watching him in his loader scoot back and forth
around Guardian’s yard with a load of pipe was like
watching a dancer, fl uid yet disciplined. His knowl-
edge of his loader’s abilities and his own skill from
years of practice made it seem almost eff ortless to
the casual observer. I knew diff erent though. I had
seen others badly operate loaders at shops and drill-
ing rigs often enough to recognize real skill. Alan
had that skill as well, it would seem.
A few days passed. Th en a call came. I was be-
ing dispatched to pick up wash pipe from Guardian
and take it to location, where a picker was waiting to
unload it. I would be backhauling used sucker rods
to Frontier. “Got that?” the boss asked.
“Got it,” I replied. “I should pick up popcorn.”
“What?” the boss asked.
I had spoken out loud by mistake. Smiling, I
said “Nothing.” I was missing an afternoon movie at
home but I would get to watch something far more
interesting that day. Men at work!
Nadine lives in Estevan with her husband and family, and works as a hot shot driver in the oilpatch regularly delivering goods in and around Estevan and Shaunavon, and Sinclair and Waskada. Her mission, beyond delivering the goods quickly, is to have every in-teraction be a positive one. She can be reached at [email protected]
One Woman’s Perspective on Life, Liberty and the Pursuit of
Land Locations By Nadine Elson
Shifting Shifting GearsGears
Watching men at work
• Pressure Vessels & Well Testers
• Sour Well & Sweet Well Production Testing
• Frac Flowback Tesing
• Coil Clean Out Rig Ins and Returns Monitoring
• Supply Blowback and 400 bbl tanks
• Complete Trucking Services
Call Dale 306-861-3635Serving Weyburn,
Estevan, Stougton & Redvers
EMERGENCY RESPONSE EXERCISE
C8 PIPELINE NEWS November 2011
customizable • durable • mobile
Call:Rick Edmundson • 1- 403-348-1671
or Toll Free • 1-877-842-3288
www.officestogo.ca
Offi ces to Go are built with superior
construction to withstand the harsh-
est climates.
They are not only extremely durable
but also have a high end interior.
The v-nose construction allows for
better fuel economy and ease of
towing.Standard Features! • microwave
• fridge
• air conditioners
• dual pane thermal windows
• leather sofa bed
• electric heaters
• mud room fl oor
• R38 Insulation
• 15,000 LB Hitches
• tow hooks
• one piece walk on rubber roof
with 12 year warranty
By Brian Zinchuk
Goodwater – A small
plane had the misfor-
tune of not only com-
ing in for hard landing,
but also smashing into
an above ground carbon
dioxide facility used in
enhanced oil recovery.
Th e gas fl owing through
it was sour. What do to?
Th at was the sce-
nario for a mock disaster
training exercise held by
Cenovus Energy near
their Goodwater plant in
the south Weyburn fi eld.
Th e event took place on
Oct. 17.
“Today was a full
scale emergency re-
sponse exercise,” said
Twila Walkeden, com-
munity relations adviser
for Cenovus.
Describing what she
stressed was an exercise,
not a real-life emergen-
cy, Walkeden said, “We
had a plane crash into
one of our production
facilities near our central
receiving terminal where
we receive CO2 from
North Dakota. It was
just northeast of the vil-
lage of Goodwater.”
Th e simulation
was of a small airplane.
“Th ere were three people
in the plane, one casualty
and two walking wound-
ed,” she said.
“It crashed right
into one of our produc-
tion fi eld facilities. Part
of the wing damaged
one of our CO2 lines.
“Our CO2 does con-
tain H2S. Th ere was a
danger of an H2S leak
both from the crash to
the facility and damage
to the CO2 pipe.
“We activated our
emergency response
plan. We did everything
we could to contain the
incident and ensure the
safety of our employ-
ees, contractors, general
public and the environ-
ment,” Walkeden said.
“We engaged the lo-
cal fi re department and
EMS (emergency medi-
cal services) to be part of
this simulation.
Th e exercise was
something of an open
secret, due to the fact a
panic could have been
caused without ample
warning. Local residents
within a two-mile radius
received hand-delivered
letters informing them
of the impending exer-
cise, lest someone think
there was a real emer-
gency.
“A big part was not
interrupting people’s
lives and not causing
unnecessary alarm,” she
said.
Cenovus staff also
knew something was
coming up, but not when,
or what it might be.
Th e call went out
at 8 a.m. on a Monday.
Within 10 or 15 min-
utes, responders were on
the site, Walkeden said.
To amplify the
simulated reality of the
training scenario, there
was a smoke machine
and roadblocks set up.
Upwards of 25 re-
sponders from Ceno-
vus took part in vari-
ous capacities. Some
responded to the fi eld,
while others were in the
command centre, co-
ordinating calls from a
boardroom at the Good-
water plant. Th ere they
had fl owcharts to follow
for emergency response.
Participants were
given inputs they had to
react to, like wind direc-
tion and H2S level. Th ey
initially assessed the area
was safe to go into sour
gas-wise, allowing them
to triage and assist the
injured parties. Other
responders pretended
to isolate the facility by
engaging various valves
and controls.
An evacuation plan
was developed, and, for
exercise purposes, put
into play.
Page C9
Cenovus runs emergency response exercise
Emergency medical technicians Jason Schmidt (standing left) and Marvin Fox (standing right) aid Cenovus rst responder Rick Anderson (kneeling) in the assessment of injuries to one of the casualty of the mock plane crash. The role of the injured was played by Jerrod Bartlett of Industrial Electric in Weyburn.
Photo by Randy Schiller/Cenovus
Weyburn Fire Department rescuers Owen Skjonsby (standing left) and Joe Cayan (kneeling right) assessed the simulated injuries of Industrial Elec-tric’s Doug Reddaway. Reddaway was a casualty in a mock plane crash. Kevin Cooke (standing with vest) Cenovus emergency respons plan co-ordinator observed.
Photo by Randy Schiller/Cenovus
PIPELINE NEWS November 2011 C9
2– 2008 CASE IH 535HD 2010 NEW HOLLAND T9060HD 2– 2008 CHALLENGER MT965B
2002 CAT 966G CAT GP30K
1976 INTERNATIONAL FLEETSTAR
2010 JINMA 504
1976 INTERNATIONAL FLEETSTAR
2004 FORD F3502007 PETERBILT 389-131
2010 DEGELMAN 7000 70 FT QTY OF CONTAINERS2009 UTILITY 53FT
AUCTION SITE: Hwy 12 & Cory Rd. Sale Starts 8 AM
Auction Company License #309645
CURRENT INVENTORY INCLUDES: 13 – Ag Tractors
55 – Combines
51 – Headers
8 – Swathers
15 – Trucks
29 – Trailers
4 – Wheel Loaders
7 – Sprayers
10 – Air Drills
5 – Harrows
2 – Lake Lots
� Motor Scraper
� Grain Carts
� Skid Steer Att.
� Grain Vacs
� Snowmobiles & Quads
� Containers
For complete and up-to-date equipment listings visit
» rbauction.com
UNRESERVED PUBLIC AUCTION
Saskatoon, SaskatchewanNovember 30, 2011
DON’T MISS OUT.We are still accepting consignments for this auction. Don’t miss out: call & take the hassle out of selling your equipment or trucks.
Flexible contract options – straight commission, cash guarantee or outright purchase
Full-service auctions at our auction sites – or on your own property
Worldwide marketing of your assets
Convenient on-site and online bidding options
CALL TO CONSIGN: 306.933.9333
This plane fuselage that was staged in the mock incident. A smoke ma-chine was used to make the scene realistic. The simulated injured passen-ger on the ground was played by Doug Reddaway of Industrial Electric in Weyburn and the victim inside the plane was a mannequin.
Photo by Randy Schiller/Cenovus
Effective communication methods learned
Page C8 Walkeden said, “We
mock evacuated some residents due to
a [simulated] building collapse and H2S
leak. Th at resulted in a plume of gas
travelling towards two residences. Th e
reception centre was McKenna Hall [in
Weyburn].”
By 11:30 a.m., everything had
calmed down and was back to normal.
“We strive to create an incident-
free environment. We practice emer-
gency response processes in tabletop,
communication and full scale exercises
like the one we’re doing today. Th is is
just one of the things we do to protect
the health and safety of the public, our
workers, contractors and the environ-
ment,” Walkeden said.
All told, she said, “It went over very
well. You always learn things about the
process.”
Some of the pointers picked up in-
clude the use of eff ective communica-
tion. Th ere are times when using two-
way radio, which broadcasts to all with
a radio, is appropriate, and other times
when a more private cellphone is advis-
able, she noted.
Th e last time a similar exercise was
done was a few years ago. Th is exercise
was probably three months in the mak-
ing, she said.
C10 PIPELINE NEWS November 2011
Got Pain?Do you have BACK, SHOULDER, KNEE pain
or discomfort anywhere...
Call us TODAY for a FREE CONSULTATION!Do
How it works:
When applying RF energy to the
body where pain occurs, any
resistance encountered by the energy
ow will cause heat to be produced
at the site of maximum resistance.
The heat then breaks down scarred
or inactive tissue, replacing it with
new cellular function. It also re-
stimulates the circulation, adding
more oxygen to the injured area.
New collagen is stimulated to
rebuild itself in the deeper dermis
and subcutaneous layers, causing
improvement to the underlying
tissues, muscles or inner scar tissue
areas
See how this and many of our
other treatments can help
you achieve your professional
approach to personal beauty!
Testimonials coming soon at www.bellmedicalaesthetics.com
This new non-invasive radio frequency treatment can be effective to
manage pain on a range of body areas. Using our latest non-invasive RF
machines it is now possible to apply radio frequency waves directly to pain
related areas without cutting or damaging the skin.
(A process that is not detrimental or harmful to the outer or inner layers of
the skin)
Gone are the days when taking pain killers was the only way to address
annoying and acute pain. Modern pain management techniques have been
developed to ght pain caused due to illnesses, injuries or post-operative
procedures.
•Safe •No Risk •Non-Invasive
iii i i
3-419 Kensington, 3-419 Kensington,
Estevan, SK S4A 2H8 Estevan, SK S4A 2H8
(Strip Mall by Wal-Mart)(Strip Mall by Wal-Mart)
Ph: 306.634.6789 Fax: 306.634.6793
Ph: 306.634.6789 Fax: 306.634.6793
PAIN FREE
HAIR FREE
Get rid of unwanted hair
anywhere on your body
www.courageoil eld.com306-483-2130, Oxbow, Sk
Downhole | Steaming | washing | digging | daylightingWe have a unique, always expanding list of services:
• Portable Catwalks• Winch Truck
• Belly Dump Gravel Trailer
HydrovacHydrovac•Enviromental End Dump Trailer• Portable Washrooms• Dry Steamer•Free Standing Rod Rigs
Combo VacCombo Vac
Canadian Owned & Operated
Your SolutionsOur Commitment
SMS Equipment holds a unique position in the industry as a one-stop supplier of the most complete range of equipment. We offer only world-renowned brand names that meet your standards of reliability and productivity. With over 40 locations to serve you across Canada, SMS Equipment is your local equipment and solutions provider.
Saskatoon Branch:
1.306.931.00442907 Millar Ave
Saskatoon, SK S7K 6P6
Regina Branch:
1.306.359.31212351 Albert St. N
Regina, SK S4P 3C6
www.smsequip.com
By Brian ZinchukWeyburn – Cenovus Energy and
Apache teamed up with the Petroleum
Technology Research Centre and City
of Weyburn to create a new visitor in-
formation centre explaining, the pur-
pose of which is to explain their op-
erations in the area.
Th e two companies are the lead
players in the Weyburn-Midale proj-
ect, which uses carbon dioxide pumped
from North Dakota in a miscible
fl ood for enhanced oil recovery. For
the last ten years, the project has been
monitored by the International En-
ergy Agency’s Greenhouse Gas CO2
measuring, monitoring and verifi ca-
tion initiative. Th at monitoring project
is wrapping up, but the everyday work
in the Weyburn and Midale units is
ongoing.
Th e new Weyburn Energy Inno-
vation Centre was launched on Sept.
28.
Weyburn Mayor Deb Button not-
ed, “For 60 years. Weyburn has been
synonymous with oil and gas. Th e in-
dustry is part of the fi bre of Weyburn.
Th e industry’s future is our future.”
It’s no small wonder then that the
host of the new centre is none other
than Weyburn City Hall itself. A por-
tion of the upstairs of City Hall has
been dedicated to the display, which
includes several multimedia kiosks,
newspaper clippings about the project
from around the world, and even core
samples of rock from the oilfi elds in
question.
Cenovous Energy operates the
larger Weyburn fi eld, while Apache
operates the Midale fi eld.
“Companies like Apache and
Cenovus have played a huge role in
developing the Midale and Weyburn
fi elds. We are thrilled to host the new
centre in Weyburn City Hall,” Button
said.
Jeff Richards of the Weyburn
Chamber of Commerce and master
of ceremonies noted, “Weyburn is the
hub of energy innovation. Our goal is
to educate and promote.”
He noted it’s not like the old days,
where workers could easily take their
children out in the fi eld and show
them what they do. Th is facility allows
young people to get a glimpse of what
goes on in the patch.
Th e total cost of the centre is ap-
proximately $50,000, paid for jointly
by Cenovus, Apache, the public out-
reach mandate of the IEA-GHG
project, and the City of Weyburn.
Norm Sacuta, communications
manager with the PTRC, said, “It’s
a visitor information centre primarily
about the Weyburn-Midale oilfi elds
and the greenhouse gas project. We
wanted to show how long this has been
a producing fi eld, since the 1950s.”
Th e displays also show the City of
Weyburn’s ties to the oilpatch, and the
importance of those ties in the growth
of the city.
Th ere’s been a number of re-
quests by the general public to learn
more about the fi eld, Sacuta explained.
While the Cenovus Goodwater site
has something rare in the oilpatch – a
sign that says “Visitors” on the outside,
those visitors are generally government
offi cials and researchers. Th e City Hall
location allows for an outreach to the
general public.
Page C11
Weyburn Energy Innovation Centre launched
Information panels explaining the surrounding oil eld are part of the dis-play.
PIPELINE NEWS November 2011 C11
Gibson Welding Ltd.Oilfield Trucking & Rentals
John 861-1280Fax 842-1707
[email protected]. BOX 926, WEYBURN, SK S4H 2L2
• 35, 30 & 23 Ton Pickers• Bed Truck• Pipe Custodian• Pipe Racks• Rig Matts• Flarestack Sales & Rentals• Tubing Trailers• 400 BBL Test Tank Sales & Rental• Wellhead Sales & Installation• Backhoe & Skid Steer• Steamer• Crew Truck• Test Separators• Work Strings• Light Towers• COR CertifiedSECOR Certi ed
SURFACE BIT RENTALQUALITY RERUN & RETIP
24 HR SERVICECELL: 306-421-3726RES: 306-634-7538
CHAD FROESE OFFICE: 306-388-2941
Weyburn City Hall hosts information centre
A core sample of the Vuggy formation can be seen on display.
Page C10
“It’s an expensive process, and City Hall was
kind enough to donate the space for free,” Sacuta
said. “Th e City was really interested to use this as a
beginning of an oil and gas centre for the city.”
“Cenovus thought it was important to partner
with the PTRC and Apache to showcase the tech-
nology in this project. We’re hoping these shows the
attention to innovation,” said Twila Walkeden, rep-
resenting Cenovus at the ribbon cutting ceremony.
“Th e oilfi eld’s future is dependent on innovation
to get more oil out of the ground. Th e ‘low-hanging
fruit’ has been picked. Th e ‘high fruit’ will be tougher
to get to, and more expensive.”
She noted the Weyburn unit has 1.4 billion bar-
rels of initial oil in place.
“We’ve recovered about 25 per cent with pri-
mary and secondary recovery. Using enhanced oil
recovery, we estimate we can recover another 18 to
20 per cent. Th at’s still not even half. Th e other half
of the volume will be recovered by other means.”
Regarding the new information centre, Walkeden
said, “It is important to note these four organization
found it is really important to educate people about
the project. We’re extending the life of this fi eld, and
storing CO2.”
Apache senior reservoir engineer Bob McKish-
nie said, “We’re doing CO2 to enhance recovery and
extend the life of the fi eld. Part of the project is to
ensure the CO2 stays in the ground for future gen-
erations. Th e display educates future stakeholders.”
Th e research component of the IEA-GHG
project came to a close on March 31, Sacuta said.
“Th ere’s still some analysis of well integrity and some
soil sampling which we have done four diff erent
times in the past.”
Th at sampling was disrupted by the wet con-
ditions last spring, so it was moved to the last two
weeks of October.
Th e British Geological Survey is doing the
work. It will test 600 points, plus the Cameron and
Jane Kerr family land which is outside the injection
zone.
Th e Kerrs made national headlines in early 2011
when they expressed concerns that injected CO2
might be leaking onto their land.
Th e British Geological Survey study is separate
from the independent study being done on the Kerr
land by the International Performance Assessment
Centre for Geologic Storage of CO2 (IPAC-CO
2).
IPAC-CO2 performed studies on the land in Sep-
tember.
Th e IEA-GHG research project players are now
putting together a best practices manual, due in the
spring of 2012. Knowledge from this project will
fl ow towards four Alberta CO2 projects, according
to Sacuta.
Four multimedia kiosks are the heart of the Wey-burn Energy Innovation Centre, located in Wey-burn City Hall.
C12 PIPELINE NEWS November 2011
BRENT GEDAK WELDINGBRENT GEDAK WELDING126 Lamoro St.126 Lamoro St.
just off Hwy 39 W. of Estevanjust off Hwy 39 W. of Estevan
Of ce: (306) 634-5150Of ce: (306) 634-5150Fax: (306) 634-5148Fax: (306) 634-5148
• Water Disposal/Injection Skid • Water Disposal/Injection Skid Packages • Truck Unloading Packages Packages • Truck Unloading Packages • MCC/Lact Units • Header Packages • MCC/Lact Units • Header Packages • Vessel Packages • Pressure Piping • Vessel Packages • Pressure Piping Systems • Industrial Insulators • Rig Systems • Industrial Insulators • Rig
Repairs • Rig Matting • Utilidor Repairs • Rig Matting • Utilidor Buildings • 3-D Drafting Services Buildings • 3-D Drafting Services
• Self Framing Buildings• Self Framing Buildings
www.brentgedakwelding.comwww.brentgedakwelding.com
COR Certi edCOR Certi ed
SaskatoonSaskatoon – It’s a busy time for – It’s a busy time for crane operators in Saskatchewan, crane operators in Saskatchewan, according to Cory Cowley.according to Cory Cowley.
Cowley is the business man-Cowley is the business man-ager for International Union of ager for International Union of Operating Engineers Local 870, Operating Engineers Local 870, the provincial local based in Sas-the provincial local based in Sas-katoon. It’s the trade union that katoon. It’s the trade union that represents the crane operator trade represents the crane operator trade in Saskatchewan.in Saskatchewan.
“We’re sending out apprentices “We’re sending out apprentices left and right,” said Cowley, noting left and right,” said Cowley, noting they had three crane dispatches on they had three crane dispatches on the day the day Pipeline NewsPipeline News called. Th at’s called. Th at’s a pretty regular occurrence. a pretty regular occurrence.
Apprentices are dispatched at Apprentices are dispatched at a ratio of one apprentice for every a ratio of one apprentice for every three cranes on a site, allowing the three cranes on a site, allowing the apprentice to work with several apprentice to work with several cranes and gain experience. Op-cranes and gain experience. Op-erators can obtain their Red Seal erators can obtain their Red Seal journeyperson papers through the journeyperson papers through the national apprenticeship board.national apprenticeship board.
Th e in-class portion of train-Th e in-class portion of train-ing can be done through schools ing can be done through schools like SIAST. Cowley noted, “You like SIAST. Cowley noted, “You still have to go in the fi eld and do still have to go in the fi eld and do the work.”the work.”
OE crane operators are cur-OE crane operators are cur-rently seeing a lot of work in Re-rently seeing a lot of work in Re-gina, Saskatoon, North Battleford, gina, Saskatoon, North Battleford, Colonsay, Nipawin and Estevan. Colonsay, Nipawin and Estevan. Alberta is also booming. Crane Alberta is also booming. Crane
operators are in high demand, ac-operators are in high demand, ac-cording to Cowley. cording to Cowley.
During slow times, being a During slow times, being a member of a union can lead to work member of a union can lead to work elsewhere in the country. One pro-elsewhere in the country. One pro-vincial local might phone another vincial local might phone another and ask for a number of operators and ask for a number of operators to come to work on a project, he to come to work on a project, he explained. “It’s a foot in the door explained. “It’s a foot in the door to run a crane around Canada,” he to run a crane around Canada,” he said.said.
Most Local 870 hands are cur-Most Local 870 hands are cur-rently working in the province, he rently working in the province, he said.said.
Cowley would like to see the Cowley would like to see the pace of activity somewhat lower, pace of activity somewhat lower, noting the government is doing noting the government is doing “Fifty years of work in three days.“Fifty years of work in three days.
“Th e pace is ridiculous. We “Th e pace is ridiculous. We don’t need to do all the province’s don’t need to do all the province’s work in a short time. You want to work in a short time. You want to ensure there’s something to do in ensure there’s something to do in the future.”the future.”
However, he added, “We’ll However, he added, “We’ll take it when it’s here.”take it when it’s here.”
Indeed, there are large number Indeed, there are large number of Alberta hands working in Sas-of Alberta hands working in Sas-katchewan under the union’s aus-katchewan under the union’s aus-pices. But it’s not just Albertans. pices. But it’s not just Albertans. “We’ve got people from all over “We’ve got people from all over Canada working right now.”Canada working right now.”
Keystone XLKeystone XLOperating Engineers is also Operating Engineers is also
one of the four unions that pro-one of the four unions that pro-vides unionized labour for big-vides unionized labour for big-inch pipelines like the planned inch pipelines like the planned TransCanada Keystone XL TransCanada Keystone XL which has been held up by envi-which has been held up by envi-ronmental concerns. ronmental concerns.
“It’s a normal pipeline to me. “It’s a normal pipeline to me. With the technology in place, it With the technology in place, it should never be a problem,” said should never be a problem,” said Cowley, who is a pipeliner him-Cowley, who is a pipeliner him-self. He noted there are concerns self. He noted there are concerns with a truck running down the with a truck running down the road, too.road, too.
If, and when, Keystone XL If, and when, Keystone XL does get the go-ahead, there are does get the go-ahead, there are two spreads, or crews, expected two spreads, or crews, expected to work on the Saskatchewan to work on the Saskatchewan portion. Th at would entail sever-portion. Th at would entail sever-al hundred operating engineers al hundred operating engineers members, from dozer hands, ex-members, from dozer hands, ex-cavator operators, sideboom op-cavator operators, sideboom op-erators to picker operators and erators to picker operators and boring hands.boring hands.
“We have no idea when that “We have no idea when that pipeline will go,” Cowley said. pipeline will go,” Cowley said.
The International Union of Operating Engineers has several crane operators working at the Boundary Dam Power Station clean coal pro-ject. Photo by Brian Zinchuk
Crane operators in high demand
PIPELINE NEWS November 2011 C13
ELECTRICAL CONSTRUCTION, MAINTENANCE & SERVICE
PLC’S, VFD’SBATTERY CONSTRUCTION
TRENCHINGMOTOR SALES & REPAIRS
24 HOUR SERVICE62 DEVONIAN ST. ESTEVAN, SK.
PH: 637-2180 FAX: 637-2181LOCALLY OWNED & OPERATED
Enform COR Certi ed
OFFICE and DISPATCHOFFICE and DISPATCH306-457-3774306-457-3774
FORGET, SK.FORGET, SK.
Greg Cutler - 577-1950577-1950Ralph French - 577-8553Ralph French - 577-8553
• Clean Fresh Water Tankers Tankers
• Oil & Salt Water • Oil & Salt Water Transfers Transfers
• Service Work• Service Work
[email protected]@yourlink.ca
24 HR. EMERGENCY24 HR. EMERGENCY306-457- 3774306-457- 3774
NOW PROVIDINGNOW PROVIDINGHeater & HeatedHeater & Heated
Frac Water!Frac Water!
SPECIALIZING IN:SPECIALIZING IN:
Estevan - Less than
a year after moving into
its own facility in Este-
van, Fiberspar has ex-
panded its yardspace.
Th e company,
which makes spoolable
pipeline, is increasingly
busy, according to Der-
ek Daku, general man-
ager for their Canadian
operations.
“We rented all the
land to the road,” Daku
said, pointing to the
area to the west of their
building. “We have a
full fi ve acres now.”
Fiberspar’s yard is
on the east side of Es-
tevan, in the RM of Es-
tevan, about a half mile
north of Highway 39.
Th e additional land was
added in September.
Th e yard is fi lled
with spools of pipe, and
it’s all spoken for, ac-
cording to Daku. “We
have about 90 spools
right now. All that pipe
is sold already. I’ve got
six or seven semis com-
ing in today to replen-
ish it.”
Th e pipe comes
from their manufactur-
ing facility in Texas by
road and rail. Th e com-
pany is still considering
a southeast Saskatch-
ewan manufacturing fa-
cility. “I’m guessing next
year,” Daku said of the
timing.
Th e addition of
their own brand new
45-ton picker in March
has been a great boon to
customer service. Daku
said, “If someone calls
at 5 p.m., I can have it
loaded and ready in the
morning.”
Th ey also added
a new Peterbilt truck
for deliveries, bringing
the total to three – two
semis and a two-ton.
“We can haul out six
spools of pipe at any
given time, to diff erent
customers,” Daku said.
Th ey also now have
the ability to respool
smaller orders. A typi-
cal reel of pipe will have
1,700 metres of pipe.
Now they can do short
spools, 400 metres for
example, for less than
full reel orders.
As it stands now,
they are adding staff and
running hard. “Th ey’re
not slowing down for
the winter,” Daku said
of their customers.
“We’re growing so
fast, it’s overwhelming.
But we’re keeping up.
Th e Lloydminster loca-
tion is picking up. Th e
other one that’s picking
up is Shaunavon.”
Indeed, Fibespar
has leased land adjacent
to the railway tracks in
Shaunavon from the
local shortline railway.
When Pipeline News visited Shaunavon in
July, several of the large
distinctive green spools
of pipe could be found
in the railyard.
Cenovus, one of the
most active drillers in
the Shaunavon area, is
the big driver. “We have
approximately 60 miles
of pipeline to go in
there right now,” Daku
said.
Fiberspar has added more yard space, and lled much of it with spools of pipe. All of this pipe has been sold. Photo by Brian Zinchuk
Fiberspar adds yard space
This new 45-ton National Crane unit has been a great bene t to Fiberspar in Estevan.
Photo by Brian Zinchuk
G. T. & H Holdings Inc.Chad: 421-1896 (cell)Chad: 421-1896 (cell)Chad: 421-1896 (cell)Chad: 421-1896 (cell)Chad: 421-1896 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)Garry: 421-0529 (cell)
Estevan, Sk
SHOP FOR RENT• 60’ x 120’• 60’ x 120’• 60’ x 120’• 60’ x 120’• 60’ x 120’• 5 Overhead Doors• 5 Overhead Doors• 5 Overhead Doors• 5 Overhead Doors• 5 Overhead Doors• 16’ Ceiling• 16’ Ceiling• 16’ Ceiling• 16’ Ceiling• 16’ Ceiling
Estevan – Doug
Curtis spends a lot of
time with his eyes on gi-
ant spools of green pipe.
He’s the picker operator
for Fiberspar in Estevan.
December will mark
a year for Curtis at Fi-
berspar, after eight years
with L&C Trucking.
At L&C, he started out
as a swamper for three
months, drove truck for
a few more months, then
operated an eight-ton
knuckle boom.
From there he
graduated to crane-style
pickers.
Asked about the dif-
ference between the two,
he noted if a knuckle
boom can’t pick up a
load, it simply won’t. But
a crane style can pick up
a load, and then go over.
Not that that has hap-
pened to him, but that’s
the diff erence in opera-
tion.
He took a crane
course through Southeast
Regional College, and
has a Boom “A” ticket.
“Th e crane course is
tough. We did it in Es-
tevan. It was a week-long
course.”
Much of his work in
his previous job involved
hauling straight pipe.
Now it’s spooled pipe,
which can way around
17,000 pound for a 16-
foot spool, or 20,000
pounds for a 14-foot
spool.
Th e new National
Crane tri-drive 45-tonne
picker is equipped with
load sensors and a real-
time computerized read-
out of the load and the
crane’s capabilities at its
given boom length and
the angle of the boom.
“As you boom out, it
tells you how much your
load [capability] decreas-
es,” Curtis said.
Having an enclosed
cab that rotates 360 de-
grees with the boom is
an added bonus, espe-
cially in cold weather.
Curtis is a local boy.
“I grew up in Bienfait,
and I’ve never left,” the
29-year-old said. He
started in the patch at
age 21, after a few years
working at a local lumber
yard.
C14 PIPELINE NEWS November 2011
For Sale or LeaseBuilding, large wood frame building, steel clad roof, approx.
27,000 sq ft under roof, plus 4500 - 5000 sq ft offi ce area, sales area, bathrooms, conference room, offi ces. Excellent water supply. Suitable for oil fi eld services, construction, trucking location. Situ-
ated adjacent to Pipestone, MB within one half mile of Jct. 2&83 Hwy.
For more information call Gene Parks, 204-729-7118
Doug Curtis runs this new crane for Fiberspar in Estevan.
Photo by Brian Zinchuk
First a swamper, now a picker operator
PIPELINE NEWS November 2011 C15
Mechanical, Electrical & Instrumentation1-306-634-6877
Proudly serving our customers.Contact us today about your Construction, Fabrication & Maintenance requirements.
1-306-634-6877 www. intenergy.com
Flint is a market leader providing products and services for the energy industry from over 60 operating locations across North America. We’re your trusted partner for:
• Pipeline Construction• Facility Construction• Electrical and Instrumentation Services• Process equipment design and manufacturing• Fabrication and specialized transportation• Infrastructure construction management
Flint also offers Mechanical and Electrical services for:Compressor stations • Pumping stations • Meter stations
• Substations • Gas Plants • Oil batteries • Well Sites • Drill and service rigs • and more
If y
ou can dream it...
...WE CAN BUILD IT!We can design any custom trailer you can imagine!
CPS Belly/Side DumpsCPS Belly/Side Dumps
Any ConfigurationAny Configuration
Load Trail GoosenecksLoad Trail Goosenecks
Any size, spec, many in stockAny size, spec, many in stock
We alsoWe alsoofferoffer
• Open & Enclosed Trailers• Bathroom - Shower Trailers• Complete line of Pickups & SUV’s• Semis• Complete line of heavy duty trailers• Specialty TrailersAuto & Trailer SalesAuto & Trailer Sales
Kenmare, NDKenmare, ND. .
Nore’sNore’sTake advantage of the Canadian exchange rate and save thousands! We are only 30 miles south of the border!701-848-6572 or 701-848-6571701-848-6572 or 701-848-6571
View our complete inventory at www.noresauto.comView our complete inventory at www.noresauto.com
Call 421-3749 for info.
400 - 2000 sq. ft. of
office/retail space
• all utilities included• available now
Lowest price in town per square foot.
Estevan – Dayman Trucking Company Ltd. of
Estevan took delivery of a new, larger crane in mid-
October which will help the company handle ever-
growing loads.
Th e new Linkbelt 86100 hydraulic boom mo-
bile crane becomes the largest in their fl eet of lifting
equipment. Th e 100-ton crane replaces a similar 75-
ton crane acquired three years ago.
Th e “86” in the nomenclature stands for eight-
foot, six-inches wide, the maximum width allowable
on roads without being considered a wide load. It’s
capable of highway speeds, and was driven from the
factory in Lexington, Kentucky.
Equipped with a fi fth outrigger in the front, the
crane has a 360 degree load chart.
A mechanic from Edmonton spent a week with
Dayman Trucking, going through the new machine
with the operators, Bill Dayman and Todd Folkerts.
Dayman operates three pickers as well, ranging
from 30 to 42 tons. Th ey are a mix of QMC, DFI
and Weldco units.
“We could use two more, but you can’t fi nd op-
erators,” said Kip Dayman, who dispatches, drives,
and runs picker for the family company.
“Th e older one was only three year old,” he said,
explaining the purpose of the new unit, to handle
larger coiled tubing reels. “Th ey’re getting to be big-
ger reels for deepers zones. Some of these coils were
58,000 pounds, and we were fi ne with a 75-ton crane.
Now they are up to 75,000 to 80,000 pounds.”
Dayman projects even larger coils are on the
horizon. “In two years, it might not be big enough.
We’re hoping it is, but who knows?”
Th e crane will probably see about 20 per cent
of its usage in moving coiled tubing. Th e remainder
of the work is moving things like tanks and treater
packages.
“Everything is getting bigger. You just have to
keep up with it,” Dayman said. “We started with a
used 50-ton out of New Brunswick in ’92.”
Patriach passesLorne Dayman, who founded Dayman Truck-
ing with his wife Iris in 1956, passed away Oct. 8. He
was predeceased by Iris 12 years ago.
Crane upgrade for larger loads
Dayman Trucking's brand-new 100-ton Link-belt cranes hoists a coil of pipe, loading it into a Technicoil coiled tubing unit. This was one of the rst lifts for the newly delivered machine. Bill Dayman is at the controls.
Photo by Brian Zinchuk
C16 PIPELINE NEWS November 2011
KEEP THE THIRST TO BUILD, CREATE AND MAKE.
THE WAY CAM WORKS:
CAM MARSHALLPresident and CEO, Global Flow Inc.
BUSINESS BANKING IS ABOUT A SHARED PERSPECTIVE.At Canadian Western Bank, we see the world the same way as our customers. As a result, we take the time to understand your industry and provide banking solutions suited to your business needs. Discover insights and learn more at theworkingbank.ca.
PIPELINE NEWS November 2011 C17
Curly’s Picker Service Ltd.Curly’s Picker Service Ltd.Mark T. (Curly) Hirsch
1595 Dieppe Cres.Estevan, Sask.S4A 1W8
Secor Certi edCell: (306) 461-5898Fax: (306) 634-6690
GOUDY TRANSPORT INCGOUDY TRANSPORT INCStoughton, SK
Offi ce (306) 457-2785Email: [email protected]
Cell (306) 457-7692www.goudytransport.sasktelwebhosting.com
Rock, Gravel, Sand Clay Supply & DeliveryOil and Salt Water TransferContaminate Hauling & Service WorkEnd and Belly Dump TrucksSteamer/Vac Truck
COR Cer tif iedCOR Cer tif iedIRP 16IRP 16
Registered withRegistered withISNET WorldISNET World
COMPLY WORKSCOMPLY WORKS
HAULIN’ ACID INC.INC.
- 11 years accident free- COR Certi ed
Estevan, SK • 306-461-4000 Red Deer, AB • 403-304-6643
Member of:
• acid trucks• pressure pump
• shower truck• uid hauling
REDRIVER LUMBER LTD.REDRIVER LUMBER LTD.481 Devonian St. • Ph: 634-2114 or 634-2143
IN STOCK 3” x 12”3” x 12”10’ • 12’ 10’ • 12’
& 16’ long& 16’ long
We Deliver
To The
Rigsite
Weekdays 7:00 a.m. - 5:30 p.m.; Sat. 7:30 a.m. - 5:00 p.m. • After Hours Call CHAD 634-0195 or cell 421-1896
FOIL FACE INSULATION
Estevan – A little
over a year ago, Border
Insulators Inc. of Este-
van moved into a new,
much larger home. It’s
allowed the company to
spread out and grow.
Th e company got its
start in 1983, when com-
pany founder and presi-
dent Robert Saxon saw
an opportunity at home.
He was tired of working
all over the place, and
had been working at the
Key Lake uranium mine
when the new company
came together.
“I was an insulator
by trade. I saw an op-
portunity to start my
own operation,” he said.
“I got tired of trav-
elling.”
Around the same
time, Robert’s wife Car-
oline started a hair salon
in Estevan, which is still
in operation.
Border Insulators
work is in the oilfi eld,
industrial and commer-
cial work. “My fi rst job
was for Dome Petro-
leum, at the Steelman
Gas Plant,” Robert re-
called. Th at project was
miscellaneous repair
work, bringing it up to
standards.
Much of the ini-
tial work was wrapping
pipe, insulating and
metal-cladding vessels.
Raymond Lukye
was employee No. 1,
and is still with the fi rm,
looking after buildings.
After a year or so,
Saxon added a few more
employees. By 2010,
that number had grown
to 20 to 30 people, de-
pending on the time of
year. With that many
people, however, things
were getting cramped at
their old location in the
centre of Estevan.
“It was congested,
but we all fi t in,” Saxon
said.
Th ere’s a lot more
room in the new loca-
tion, going from a quar-
ter of an acre to fi ve
acres. But remarkably,
much of that space has
found usage. Along the
north fence, there’s a
row of completed pre-
fabricated buildings, al-
ready bought and paid
for. Th e main building
is on the east end, and
a second shop, added
recently, is on the west
end.
All of the Saxon
children are currently
involved with the com-
pany. Ryan works in
management; Robin
works in administra-
tion; Devin insulates
and constructs build-
ings; Mellissa builds
prefab buildings. How-
ever, their father notes,
they are treated like ev-
ery other employee.
Pre-fab buildings
“We started putting
up pre-fab buildings 20
years ago,” Saxon said. It
has been a growing part
of the business.
Prior to the use of
“sandwich board,” foam
insulation between alu-
minum sheets, compa-
nies would use wood
and clad it in metal.
Page C18
Dwayne Ludlow takes the door off a 400-bbl. tank.
Border Insulators spreads out
C18 PIPELINE NEWS November 2011
2008 D8T
1,200 hours MS RipperAngle Blade SU & Full U Blades
AvailableADTs • COMPACTION • CRAWLERS • EXCAVATORS • MOTOR GRADERS ADTs • COMPACTION • CRAWLERS • EXCAVATORS • MOTOR GRADERS
MOTOR SCRAPERS • TOOL CARRIERS • WHEEL LOADERS MOTOR SCRAPERS • TOOL CARRIERS • WHEEL LOADERS
CAT • KOMATSU • HITACHI • FIAT ALLISCAT • KOMATSU • HITACHI • FIAT ALLISKOBELCO • BELL • TEREX • SAMSUNGKOBELCO • BELL • TEREX • SAMSUNG #306 Wicklow Centre - 1133-4th Street, Estevan, SK#306 Wicklow Centre - 1133-4th Street, Estevan, SK
SUN VALLEY LAND LTD.
306-634-6684
www.sunvalleyland.ca • [email protected]
Estevan, SK 634-7276Estevan, SK 634-7276
Located off Located off Hwy 39 West, Hwy 39 West,
Lamoro St.Lamoro St.
Engineered Quality
Control
• CSA Approved Concrete • CSA Approved Concrete • Demolitions • Excavations • Demolitions • Excavations
• Sand and Gravel • Site Preparations • Sand and Gravel • Site Preparations • Water & Sewer• Water & Sewer
FULL CONSTRUCTION SERVICES FULL CONSTRUCTION SERVICES
INCLUDING:INCLUDING:
Page C17
“We were introduced to these
panels by a supplier. We said we’d give
it a whirl,” Saxon said.
During the rough patches, he
said they managed to pull through by
watching spending and hoping for the
best. Th e second rough period, in the
1990s, meant selling off some equip-
ment at 50 cents on the dollar.
Th e last 10 years have been in-
creasingly busy. Even in 2009, when
much of the oilpatch slowed down,
they didn’t, because infrastructure still
had to be completed.
Ryan Saxon explained they usually
operate in the fi eld with crews of three.
“You’re insulating lines to keep them
from freezing up.
“It is a must. If they don’t insulate
the lines, they’re out there with the
steamer.”
Typical locations include wellsites,
batteries and gas plants. Th ey have
eight service trucks for fi eld work.
It’s common now for electricians
to precede the insulators, applying heat
tracing (wire heaters) to piping before
the insulation is applied.
Insulating vessels keeps the heat in,
resulting in better separation of emul-
sion into its component parts. Th is is
often done by surrounding the vessel
in a pre-fabricated building.
About half of their work is piping,
the other half is buildings.
“To do a proper job, you have to
have both ends of the business,” Ryan
said.
Th e company also builds master
control centres, doghouses, site trailers
and offi ce trailers.
Border Insulators is in the fi nal
stages of receiving its Certifi cate of
Recognition, or COR.
A recent addition to Border Insulators work has been tank and equipment
rentals. Th e side venture is called R&R Tank and Equipment Rentals.
Ryan Saxon said, “We saw the opportunity with the shortage of tanks. We
started manufacturing our own tanks and got into the sales end, too.”
Th ey can build tanks with capacities varying from 100-bbl. to 2,000-bbl.
About 70 per cent are the common 400-bbl. test/production tanks, the majority
of which are equipped with an L-skid.
“Th ey can be used for frac tanks to production tanks,” he said. “We’ve got 36
rental tanks now.”
Th e company will soon be receiving a new roller and break sheer to assist in
the manufacturing of the tanks. Before they were using pre-rolled sheets.
Th e company also rents out telehandlers, manlifts and light towers.
R&R was another impetus for building a new, larger shop.
“We’re talking about expanding this shop already,” Saxon said. An addition
would have an overhead crane, allowing for easier assembly.
R&R Tank and Equipment Rentals
Several types of buildings offered
Mellissa Sax-on contructs a pre-fab build-ing. She most recently was working on CO2 capture research at International Test Centre at the University of Regina.
Right: R&R Tank and Equipment Rentals is a new side business for Border Insulators. They now build, rent and sell tanks, as well as provide other equip-ment rentals.
Resources Resources GuideGuide
PIPELINE NEWS November 2011 C19
JUSTIN WAPPEL - Division Manager
401 Hwy. #4 S. Biggar, SaskatchewanPO Box 879 S0K 0M0Ph (306) 948-5262 Fax (306) 948-5263Cell (306) 441-4402 Toll Free 1-800-746-6646Email: [email protected]
a l t u s g e o m a t i c s . c o m
Specializing in well site and pipeline surveys
Yorkton
306.783.4100
Weyburn
306.842.6060
Regina
800.667.3546
Swift Current
306.773.7733
Lloydminster
780.875.6130
Medicine Hat
403.528.4215
Edmonton
800.465.6233
Calgary
866.234.7599
Grande Prairie
780.532.6793
Lloyd Lavigne • Kirk ClarksonOwners/Managers
6506 - 50th AvenueLloydminster, AB
Phone: (780) 875-6880
5315 - 37th StreetProvost, AB T0B 3S0
Phone: (780) 753-6449
Fax: (780) 875-7076
24 Hour ServiceSpecializing in Industrial & Oilfield Motors
Aspen Custom Trailers
6017-84th Street S.E.
Calgary, AB T2C 4S1
[T] 403 236 2244[F] 403 236 8829[C] 403 813 6319[Toll Free] 877 236 2244
Lance WotherspoonRegional Sales Manager
LECLAIRTRANSPORT
Lyle LeclairCell: 306-421-7060
General Oilfi eld Hauling
Box 208 Estevan, SK S4A 2A3
461-8471 • 461-8472 • 461-8473
Call: Clinton Gibbons
Cordell JanssenCordell JanssenDistrict ManagerDistrict Manager
DownholeDownhole
93 Panteluk Street, Kensington Avenue N93 Panteluk Street, Kensington Avenue NEstevan, SaskatchewanEstevan, Saskatchewan
PHONE:PHONE: 306-634-8828 • 306-634-8828 • FAX:FAX: 306-634-7747 [email protected] • www.nov.com
NorseStar Ventures Inc.
Light Oil eld Hot ShotSteam Truck Services
(306) 621-7621(306) 457-8283
YOUR WORK BOOT HEADQUARTERS
1210 4TH STESTEVAN634-8232
202 MAINCARLYLE453-6167
112 2ND ST.WEYBURN842-3006
THE WORK WEAR STORE LTD.THE WORK WEAR STORE LTD.RON'SRON'S
RICK CORMIERManager
Box 609 Bus: (306) 634-8084Carlyle, SK Cell: (306) 577-8833S0C 0R0 Fax: (306) 453-6075www.truetorq.ca [email protected]
Ironhorse focuses on Pembina, Leon LakeIronhorse Oil & Gas
Inc. has entered into an
agreement to sell its 50
per cent working inter-
est in its gas property at
Shackleton, Saskatch-
ewan, for cash consid-
eration of $10.2 million
eff ective Aug. 1, 2011.
Th e anticipated closing
date was Oct. 26.
Pursuant to the
terms of the agreement,
the purchaser has placed
a cash deposit, equal to
10 per cent of the pur-
chase price, in trust with
their legal advisers.
“Th e sale of our nat-
ural gas property gives
us running room to pur-
sue our opportunity-rich
oil prospects,” said Larry
Parks, Ironhorse’s presi-
dent & CEO.
“Th is disposition al-
lows us to complete the
transition to an oil-based
production and reserves
growth platform.”
Ironhorse estimates
its daily production rate
after closing the sale of
Shackleton property will
be 75 boepd.
Net proceeds from
the sale of the Shackle-
ton property will be used
to pay down the com-
pany’s outstanding bank
debt, which is approxi-
mately $14.5 million.
Subsequent to the
sale of the Shackleton
property, the company’s
lender has agreed to a
$10.2 million credit fa-
cility comprised of a
$6.1 million primary
revolving facility and a
$4.1 million bridge fa-
cility.
Ironhorse intends
on further development
of the company’s proven
oil reserves at Pembina,
Alberta, as well as the
drilling of new oil op-
portunities at Leon
Lake, Saskatchewan.
At Leon Lake, the
company continued to
develop its oil resource
play with the drilling of
two (1.5 net) oil wells
in September. Th e two
wells were cased for Up-
per and Lower Shau-
navon oil and will be
completed later this fall.
Ironhorse worked
on a 3D seismic pro-
gram over the balance of
its lands at Leon Lake.
Results from the seismic
program are expected to
be interpreted by De-
cember.
C20 PIPELINE NEWS November 2011
Do you want to work for a progressive company that takes safety seriously and uses today’s newest technologically advanced equipment? If your answer is “yes”, we are interested in talking to you!We are currently seeking to fi ll the following positions in the Provost, Consort and Lloydminster areas.
Well Servicing Division
All applicants must have a valid driver’s license, as well as all of the required industry training for the position they are applying for. We offer higher than industry standard wages, an exceptional employee benefi ts package, several employee incentive programs and unlimited opportunity for advancement.
If you want to grow with a company where you are known by your name and not your employee number, please forward your resume to:
is an industry leader in Safety Services and is currently seeking
Safety Personnelto keep up with increasing customer demands.
If you are interested in becoming part of the TargetTeam and enjoying our growth with us, let us know!
Employment Opportunity
Please forward resume with copies of tickets to:
[email protected] or fax to780-870-5359
Experienced Oilfi eld Picker Operators
in Northern Alberta
• excellent hourly wages
• guaranteed monthly wage
• December, January, February, March
• camp supplied
• 3 weeks in, 1 week out
Call: 780-986-6235
OpportunitiesOpportunities
CareerCareer
Platinum Pumpjack Services Corp. has grown to be the largest Pumpjack sales and service company in Canada with operations in Lloydminster, Provost, Drayton Valley, Medicine Hat, and Kindersley. We are currently recruiting a motivated individual to work as:
FIELD FOREMAN FIELD FOREMAN (Lloydminster Facility)
Duties would include: Direct supervision of eld personnel. Scheduling, organizing and dispatching trucks to meet customer requests. Generating repair quotes for customers, and performing site visits to our large customer base. The successful candidate must be capable of working in a high paced environment, while keeping a well-organized work load. They should work well with people, be capable of organizing multiple customer orders at once, and have a good understanding of Microsoft Excel, and Word. We offer competitive salaries with bene ts package. Only the selected applicants will be contacted for an interview.
Résumés, including references, can be sent to:
Platinum Energy Services Corp.PO Box 10207Lloydminster, AB T9V 3A3
Fax: (780) 875-7149Email: aoracheski @platinumenergy.net
PUMPING UNITS
Invicta Energy Corp. has drilled, completed and
placed on production eight gross (4.4 net) horizontal
wells over the past couple of months at Kindersley,
Saskatchewan.
Of the eight wells drilled, six wells are still fl ow-
ing and two wells are pumping. Initial 30 day aver-
age gross production rates ranged from 20 barrels of
oil per day to 80 bpd with an average of 40 bpd.
Th e peak gross production rates from several in-
dividual wells exceeded 100 bpd during the fi rst 30
to 45 days. Th e best well reached a gross peak rate
of 150 bpd during a 48 hour production test. Th ese
rates do not include the solution gas which is cur-
rently being tied in and which should add another
100 boepd to 120 boepd of gross production. Peak
gross oil production from the property exceeded 350
bpd without the solution gas during August.
Invicta said it is confi dent that the Kindersley
property will provide drilling opportunities for the
next several years based on this past summer's drill-
ing results which have established over 100 drilling
locations. Of these, 15 locations at Kindersley are
being surveyed to be licensed and ready to drill in
the next few quarters.
Invicta's current net production is 245 boepd
(90 per cent light oil). Net production is expected to
increase to over 300 boepd in October with the tie-
in of the Kindersley solution gas.
Th e company's credit facility has doubled to $6
million from $3 million, based primarily on a review
of the production results from the recently com-
pleted drilling program at Kindersley. “We are very
pleased that our lender is supportive of our vision of
developing our Viking resource play in Kindersley,
Sask.,” Gordon Reese, Invicta president and chief
executive offi cer, said in a news release.
Th e company plans to spend approximately $4.8
million of capital in the fourth quarter to drill six
gross (3.75 net) wells at Kindersley, shoot two seis-
mic programs and participate in Crown land sales.
Total capital spending for 2011 is forecast to be $11
million to $12 million with exit production ranging
from 350 boepd to 400 boepd compared to a 2010
exit of 150.
Invicta drills at Kindersley
Heavy loadBetts Drilling Rig 1 is coming together. Here the derrick arrived in Estevan on Oct. 4.
Photo by Brian Zinchuk
OpportunitiesOpportunities
CareerCareer
PIPELINE NEWS November 2011 C21
sanjel.com
Sanjel has current openings for experienced Driver/Operators, Supervisors and Coordinators in ALL of our Districts! ALL Class 1 & 3 Drivers with a mechanical aptitude and a keen interest in the Oil & Gas Services industry are encouraged to apply!
What’s in it for you??
Rotations that fit your lifestyle, comprehensive benefits, competitive total compensation packages… and that’s just the start! Enjoy continued personal and professional growth in a highly sought after working environment… all here at Sanjel.
Call us today, to speak to our Recruiters and see how YOU can be a part of the Sanjel team. Or for full position descriptions please visit our careers page at www.sanjel.com/careers/can.cfm
Be a part of the NEW ENERGY here at Sanjel!
** APPLY TODAY ** Build your career with Sanjel – Canada's largest privately-owned global oilfield services company. With the right people and the right solutions approach to maximizing our clients' well production, Sanjel is committed to: empowering our employees to be innovators; proactively providing a safe working environment that exceeds industry standards.
Please forward your resume to Sanjel: E: [email protected] F: 403.716.0333 Career Line: 1.800.9SANJEL
Looking to Put a New Energy into Your Career?
There’s a New Energy Here.
Acidizing Cementing Coiled Tubing Fracturing Nitrogen
Canada USA International
Lynco Construction LtdMidale, SK
Positions Include:• Maintenance Foreman
• Backhoe/Trackhoe Operators• Labourers
• Must have valid drivers licence• Must have safety tickets
(H2S and rst aid)
CAREER OPPORTUNITIESCAREER OPPORTUNITIES
Benefit package &
Benefit package &
Competitive wages
Competitive wages
EMAIL RESUME TO:EMAIL RESUME TO:
edwin. [email protected]. [email protected] fax to (306) 458•2297or fax to (306) 458•2297
REQUIRESREQUIRES
• Farm Laborers• Tractor Operators
• Back-hoe Operators• Mulcher Operators
• Class 1 Drivers• Journeyman Mechanic
Fax: 780-875-6334Fax: 780-875-6334email: [email protected]: [email protected]
Two Skylift Services cranes lifted the cover over a new cold storage facility for TS&M in Estevan on Sept. 29. Photos by Brian Zinchuk
The cover goes up and overThe cover goes up and over
CareerCareerOpportunities
C22 PIPELINE NEWS November 2011
Baker Hughes serves the worldwide oil and natural gas industry with reservoir consulting and products and services for drilling, formation evaluation, completion and production. We are leading provider for high-performance technology that creates value from oil and gas reservoirs. Virtually every product and service we provide is designed to lower costs, reduce risk or improve productivity during activities directly related to hydrocarbon extraction, advancing reservoir performance. Baker Hughes operates in over 90 countries serving independent, international and national oil companies. Our service network is organized into 23 Geomarkets operating in 9 regions and 2 hemispheres. Region and Geomarket management teams work to understand customer needs and coordinate delivery of individual products and comprehensive service solutions that include the right Baker Hughes technologies for the project.Baker Hughes offers opportunities for quali ed people who want to grow in our high performance organization. We are currently recruiting for an experienced Equipment Specialist to join the Baker Hughes team in Estevan, Saskatchewan.
The responsibilities of the position include, but are not limited to:Under direct supervision, develops and applies basic knowledge of standardized procedures, performs routine maintenance on tools, units, guns, and support equipment.Replaces expendable part, gaskets, seals, lines, ttings, explosives, radio-active supplies, etc.May pick up equipment at the rig site, test or re t equipment off the shelf. Conduct all business activities in accordance with Baker Hughes Health Safety and Environmental policies, Legal Compliance requirements and Baker Hughes Core Values.
Successful applicants will possess the following:Skill/KnowledgeMechanical aptitudeGood verbal and written communication skills
Education/Experience/TrainingHigh School Diploma or equivalentEntry level
At Baker Hughes we make a commitment to the success of each individual team member. We offer bene ts to chart your career path such as training, specialty assignments, cross-functional team projects, and much more. Additionally, Baker Hughes offers you the exibility - and opportunities - you need to achieve your career goals.Interested applicants are encouraged to please visit our website at www.bakerhughes.com/careers and explore one of the many other opportunities that we have to offer in other locations that you may be eligible for.
EQUIPMENT SPECIALIST
Fax or Email ResumeAttention Jerry or JoshFax: 306•636•[email protected] Devonian St. ~ Estevan, SK
Lloydminster Estevan
Apply online today at: www.frontierpeterbilt.com
While Frontier Peterbilt appreciates all applications received, we advise that only candidates under consideration will be contacted. Thank you for your interest for employment with Frontier Peterbilt Sales.
Frontier Peterbilt Sales Ltd. is an enterprising truck dealership with operations in Saskatoon, Regina Lloydminster and Estevan. Our ongoing development and phenomenal growth in the Truck Sales industry are evidence of the company's commitment to offering customers a comprehensive range of products which perform at optimum efficiency and provide valuable benefits.
We have built a high level of customer trust and satisfaction through our new and used truck inventory and parts availability and reliability, strong geographic presence, premium service, and unparalleled value. We have a strong mandate to continue to grow in the marketplace and to provide quality service for sales, repairs, and maintenance.
Frontier Peterbilt Sales Ltd. continually offer opportunities for our employees' career development, we have created an organization and a working environment aimed to attract, empower, reward, and retain the most dedicated, talented, and passionate individuals.
These positions offer a competitive and comprehensive compensation package.
Estevan •Heavy Duty/Truck & Transport
Technician •Used Truck Representative
•Service Manager •New Truck Sales Representative
•Lot Attendant
Lloydminster •Heavy Duty Technician
ConstructionSupervisors!!!
Jerry Mainil Ltd is an oil eld construction company that services Southeast Saskatchewan, and is currently
looking for aCONSTRUCTION SUPERVISOR
We are looking for a team oriented employee who has a clear understanding of facility construction and/or pipelining.This employee would be responsible for:- Leading a team of crews, operators, and labourers- Liaising with customers to determine their needs and requirements- Ensuring our employees adhere to company and customer rules, policies, and procedures- Ensure all work is performed safely and Regulations are being adhered toThe successful candidate would have:- Experience in pipeline construction and/or facility construction/maintenance- Strong organizational skills to align manpower, tools, equipment, and project resources- The ability to multi-task.- Understanding of the Saskatchewan Boiler Branch regulations and Z662 would be an asset.
We will offer a wage based upon experience and ability, a charge out bonus, as well as a group bene ts package and pension plan. You will also be home every night, along with a rotating weekend schedule.
If you’re interested in applying for this position, please email your resume to [email protected], or fax (306) 842-6560.
You can check out our website at www.jerrymainilltd.com
OPERATIONS MANAGERTurnbull Excavating requires the services of an Operations Manager. Turnbull Excavating requires the services of an Operations Manager. Reporting to the President, the Operations Manager will work with Reporting to the President, the Operations Manager will work with senior management overseeing and managing the corporate affairs of senior management overseeing and managing the corporate affairs of the construction and concrete divisions of the company.the construction and concrete divisions of the company.
Persons interested in this position must be capable of managing growth Persons interested in this position must be capable of managing growth and be a key component in developing, promoting, and planning for and be a key component in developing, promoting, and planning for future expansion.future expansion.
In addition the operations manager will work with managers andIn addition the operations manager will work with managers and employees on day to day functions plus direct human resources, employees on day to day functions plus direct human resources, recruiting, and Safety activities.recruiting, and Safety activities.
Candidates should have a broad base of education and training in Candidates should have a broad base of education and training in nance, marketing and administration duties. Sales and purchasing nance, marketing and administration duties. Sales and purchasing
experience would also be a de nite asset.experience would also be a de nite asset.
A relevant combination of experience and training will also be seriouslyA relevant combination of experience and training will also be seriously considered.considered.
Compensation package to commensurate with experience.Compensation package to commensurate with experience.
Turnbull Excavating Ltd. is a privately owned Estevan company Turnbull Excavating Ltd. is a privately owned Estevan company operating since 1984 and currently employs 50 plus people in various operating since 1984 and currently employs 50 plus people in various construction activities construction activities
Please forward resume to:Please forward resume to: Turnbull Excavating Ltd. Turnbull Excavating Ltd. Attention: Patrick Boyle Attention: Patrick Boyle Box 788, Estevan, SK, S4A 2A6 Box 788, Estevan, SK, S4A 2A6
or email to or email to [email protected]@sasktel.net
CareerCareer OpportunitiesOpportunities
PIPELINE NEWS November 2011 C23
Hydrovac Operators and Swampers
• Offering excellent wages• Excellent bene t package available
• Willing to train if necessary• Safety tickets an asset
• Operators must possess class 3A driver’s license• Living accommodation available
For more information call: Trevor at: 306-483-7777 or Kim at: 306-483-7722 Email resumes to: [email protected] or fax to: 306-483-2082
Labourers Required• Class 5 drivers licensed and safety
tickets preferred.
Tubular Repair Operator• Class 1A drivers a must
• Competitive wages and excellence bene t package available.
Interested individuals can fax resume to (306) 634-8025
Oil eld Labourers Required
To assist with oil eld tubular inspection in plant and on location.
Applicants must possess a valid class 5 drivers licence.
Oil eld experience preferred but not necessary. Training will be provided to
successful applicants. Please mail, email, fax or drop off resume to:
341 Imperial AvenueEstevan, Saskatchewan S4A 2H8Fax: 306-634-2606Email: [email protected]
No phone calls please.
L & C Trucking“Serving the Oil Patch for 54 Years”
DRIVERS
SWAMPERSCompetitive wages, health plan,
safety tickets an asset, but will
train. You will be home every night.
Over time paid after eight hours
Apply with resume in person, fax, mail or email to:24 Hwy 39 E., EstevanAttention: Norm MackBox 73 Estevan, SK S4A 2A2Email: [email protected]: 634-8699APPLICATIONS HELD IN STRICT CONFIDENCE
Journeymen Electriciansand Apprentices
PowerTech Industries Ltd. in Estevan is seeking
Journeymen Electricians and Apprentices for work
in the Southeast Saskatchewan Oil & Gas Industry.
Experience: 1 year (preferred) Safety Certifi cates
are needed. 1st Aid/CPR, H2S, WHMIS. Applicants
must have a valid driver’s license. Oilfi eld
background preferred. Full benefi ts packages and
RSP plan.
Duties: Day to day electrical construction and
maintenance in the oilfi eld.
Wage/Salary Info: Depending on experience &
qualifi cations.
To Apply: Fax: (306) 637-2181, e-mail
sschoff [email protected] or drop off resume to
62 Devonian Street, Estevan, SK.
Precision Well ServicingAs Canada’s largest well servicing contractor with 199 service rigs, Precision Well Servicing (PWS) provides customers with quality staff and equipment to provide a full slate of services including; completions, workovers, abandonments, well maintenance, high-pressure and
critical sour-well work and re-entry preparation.In Estevan we are looking for the following positions:
Shipper/ReceiverHeavy Duty Mechanic
Precision offers competitive wages, plus a comprehensive bene ts package. If you are interested in further information about Precision and the above opportunities please apply by:
Sending your resume to [email protected], by fax to
306-634-6053 or call 306-634-8886 or in person to 421 Mississippian Drive in Estevan.
Precision appreciates you interest in these career opportunities and thanks all applicants. Future correspondence will be limited to candidates selected
for interviews only.TSX: PD NYSE:PDS
Call John or Ginette 1-888-875-8111
orSend Resume to
Fax: 780-846-0005Email:
Location: Middle EastFor the following positions:
Field Supervisors, TMX Operators, & Flushby Operators
Minimum Quali cationsField Supervisor:• 10 Years Well-Servicing Experience• 5 Years Coiled Rod Experience• Strong computer skills – MS Of ce
Flush-By Operators:• 5 Years experience of hands on PCP and reciprocating arti cial lift systems• 2 years in a supervisory or lead role• Good mechanical aptitude• Strong computer Skills – MS Of ce
TMX Operators:• 2 years coiled rod experience • 5years Oil eld Service experience
All positions: • Require & possess a valid passport• Willing to work rotation in a isolated environment• Able to adapt in a multi-cultural environment
Rotation: 28 days in/ 28 days outSalary: Dependant on experience
Contact: [email protected]
Only those contacted for an interview will be considered
International Employment
Is hiring for the following positions at our Weyburn SK location:
Coil OperatorsCoil Helpers
Essential Coil & Stimulation Services is a company recog-nized for safety and excellence within the oil & gas industry. We currently provide services throughout Alberta & South-ern Saskatchewan. Class 1 driver’s license is preferred, but all class of drivers are welcome to apply. Previous oil eld
experience & valid tickets are an asset.
Essential offers above average wages, job bonuses, em-ployee savings plan, group bene t plan, scheduled days off
& training will be provided for the right candidates.
Great employees are Essential…come see what we have to offer!
Fax, email or drop off your resume & current drivers abstract
[email protected]: 403-580-8906
A vibrant & growing company
C24 PIPELINE NEWS November 2011
Calfrac has grown from a small oilfield services company to an international leader in fracturing and coiled tubing well services.
Rotational OpportunitiesWe’re hiring rotational employees for our Western Canada operations.
3-weeks-in, 2-weeks-out field positions:
2-weeks-in, 2-weeks-out maintenance positions:
Call us: Fax us: Apply online:
NOW HIRINGNOW HIRINGALL POSITIONSALL POSITIONS
Apply by email to:[email protected]
or fax: 780.955.2008est. 1980
780.955.5537Offering 2 Range III Top Drive Single Rigs and 5 Conventional Range II Single Rigs
OpportunitiesOpportunities
CareerCareerPIPELINE NEWS November 2011 C25
We have been awarded the opportunity to supply a number of Inspectors to upcoming Main
Line Pipeline Projects.
We are looking for all levels of Facility and Pipeline Inspectors. Please email your resume to: [email protected] We are currently looking for
Construction Management Inspection
Safety
Office: 403.263.3929 Fax: 403.258.0444 Email: [email protected]
TIR Canada Inc. Suite 501 - 5920 Macleod Trail SW Calgary , AB T2H 0K2
INSPECTORS NEEDED
- Chief Inspectors - Senior Inspectors - Coating Inspectors - Utility Inspectors
- Welding Inspector - Civil Inspectors - Electrical and Instrumentation Inspectors
OVER 50 YEARS STRONG IN OILFIELD CONSTRUCTIONARNETT & BURGESS Oilfield Construction LimitedOiOiOiOilflflfieieieieldldldld CCCCononononststststrururuructctctctioioioion nn LiLiLimimimiteteteteddddddRRNENETTTT && BBURURGEGESSSS OiOiO lflfieieldld CCononststruructctioionn LiLimimitetedd
NOWNOW HiringCOME JOIN OUR TEAM! We’re hiring for various Pipeline construction
projects in the Regina area.Over 50 years strong, Arnett & Burgess Oilfi eld Construction Limited safely provides quality pipeline construction, facility installation, pipeline integrity, custom fabrication, maintenance and related contruction
services to the energy industry.
All positions require previous experience in Pipeline Construction. Previous experience on Pipeline Integrity projects is an asset.
• PIPELINE LABOURERS • PIPELINE FOREMAN• SUPERINTENDENTS
• HEAVY EQUIPMENT OPERATORS• WELDERS HELPERS
• WELDERS WITH B PRESSURE• PIPE FITTERS
Compensation:Highly Competitive wages
Overtime Daily Subsistence
Preferred Certifi cationsH2S Alive
Standard First Aid & CPR
Required Certifi cations Driver’s License
Ground Disturbance – Heavy Equipment Operators only
For more details and other career opportunities please visit:www.abpipeliners.com
For Inquiries please call: 403.290.7800
Please submit your resume to :[email protected]
CONSTRUCTION LTD.EXCAVATING, SAND AND GRAVEL • REDI-MIX CONCRETE
Glen Peterson Construction Ltd.314 - 6th Street, Estevan, SK S4A-2V7
Ph: 306•634•2741 Fax: 306•634•4643
Glen Peterson Construction, SK leader in aggregate, trucking concrete construction and sewer and water in-stallations, is growing. Immediate openings for:
Safety Coordinator:Must have COR safety program and all safety quali cations for Sewer and Water, Concrete construction and aggregate operations. Full time position. Fax resume to 634-4643 or phone Tyler at 421-3474
Technical Engineer:2 years experience. Must be able to run lieca survey equip-ment. Full time. Wages depend on experience. Fax resume to 634-4643 or phone Tyler at 421-3474
Of ce Dispatcher:Must be able to coordinate trucks, maintenance program of equipment, etc. Full time position. Fax resume to 634-4643 or phone Tyler at 421-3474
Sewer & Water Labourers, 4 Openings:$15 -$17/hour depending on experience. Phone Tyler at 421-3474
Equipment Operator:Experience in operating loaders, hoes, dozers, and crusher a de nite plus. Must be dependable. Full time position. Wage depending on experience. Fax resume to 634-4643 or phone Tyler at 421-3474
Diesel Mechanic:50-80K depending on experience. Must have tools. Experi-ence in diesel, hydraulics, electrical systems. Welding ability preferred. Fax resume to Tyler 634-4643 or phone 421-3474
Concrete Foreman, 2 Openings:2 years experience in all phases of concrete work. Wage depending on experience. Fax resume to 634-4643 or phone Sam at 421-1168
Concrete Labourers, 3 Openings:Must have reliable transportation, Wage $15 - $17/hour de-pending on experience. Fax resume to 634-4643 or phone Sam at 421-1168
Driver, 2 positions:Experience with tandems, belly dumps, loaders, A-Train, and B-Train. 1- licence required. Looking for a long term oppor-tunity? Fax resume to 634-4643 or phone Sam at 421-1168
Concrete Truck Driver, 2 Openings:Must have 3-A Licence, Wage $22 - $24/hour depending on experience. Fax resume to 634-4643 or phone Ken at 421-7119
Glen Peterson Construction Ltd. is an equal opportunity employer dedicated to a safe, drug-free workplace. We offer excellent wages and bene ts, plus overtime, incen-tives and bonus.
Fax: (780) 872-5239
Brady Oilfield Services LP.
1A, 3A Drivers/Owner Operators
Weyburn, Halbrite and surrounding area.Oil eld Safety Certi cates an asset but not
necessary. Bene ts package available.
Forward Resume and Drivers Abstract P.O. Box 271 Midale, Sask. S0C 1S0
Fax: (306) [email protected] [email protected]
(A Division of Total Energy Services Ltd.)
Total Oil eld Rentals in Midale and Carlyle is now hiring
-Picker Operators -Bed Truck Drivers
• Top wages offered, bene ts availableInterested individuals can fax resume to:
MidalePhone: 458-2811
Fax: 458-2813
CarlylePhone: 453-4401
Fax: 453-4402
Career Career OpportunitiesOpportunitiesC26 PIPELINE NEWS November 2011
Choose a CAREERwith us in the
vibrant oil industry! • Accepting applications.
• Always focused on safe work.
• Wages well above industry standard.
• Health benefi t plan (paid for by IWS).
• Steady work with scheduled days off .
• Room for advancement.
TO JOIN OUR TEAMEmail your resume to [email protected]
Fax (306) 634-2607 - Ph (306) 634-2336
Box 490 (477 Devonian St.) Estevan, SK S4A 2A5
www.independentwellservicing.com
•
•
• •
• • •
We thank all applicants for their interest; however, only those considered for an
interview will be contacted.
HEATER OPERATORSHEATER OPERATORSNeeded for high volume frac uid heating company.
Competitive base salary, job bonus and living allowance.
Clean driver’s abstact, H2S and First Aid required
Class 1A or 3A License required
Please phone John (306) 861-6065or Fax resume to (306) 842-1251
We are First Choice Energy Services, part of the First Choice Business Group, one of thefastest growing companies in Western Canada o ering oil eld services, wastemanagement and equipment rentals in Alberta and North Dakota. We are opening ano ce in Southeast Saskatchewan and we are looking for 2 key managers:
Produc on Tes ng Manager You will be responsible for hiring & training tes ng sta . You have the contacts todevelop business for mul ple tanks as well as related equipment and services.
Vacuum & Water Truck Manager & Dispatcher You will be responsible for business development, hiring & training and ensuring themaintenance of the eet.
We o er great salaries, bene ts and pro t sharing. Please forward your resume [email protected] or fax to 780-665-7108
Some of the many benefi ts to consider when applying for
a position at Bert Baxter Transport in Estevan:
• Full time, permanent employment • Full benefi ts packages available • Clean, safe work environment
Interested applicants can fax to: 306-634-4258 or email: [email protected]
JOURNEYMAN WELDERExperience in mig, tig and air arc welding preferred.
PIPELINE NEWS November 2011 C27
Over Over 28,00028,000 circulation circulationtargeting the Oil and Gas Sector!targeting the Oil and Gas Sector! YOUR ADVERTISING TEAMYOUR ADVERTISING TEAM
SW Sask - for all of your advertising needs contact:
Ph: 306.773.8260Fax: 306.773.0504
Doug EvjenSales Manager
Stacey [email protected]
NW Sask - for all of your advertising needs contact: Ph: 780.875.6685 Fax: 780.875.6682
Email: [email protected] ToblerSales Manager
SE Sask and SW Manitoba - for all of your advertising needs contact:Ph: 306.634.2654 Fax: 306.634.3934
Email: [email protected]
SEISMICSEISMICDecember 2011 Focus Contact your Sales Rep to be a part of the focus edition
Cindy BeaulieuSales Manager
Glenys [email protected]
Deanna [email protected]
Kristen O’[email protected]
Teresa [email protected]
PIPELINE NEWSNEWSSaskatchewan’s Petroleum Monthly
C28 PIPELINE NEWS November 2011
Sales & Service we provide:
• Industrial & Hydraulic Hose
and Fittings • Pumps & Motors
• Valves • Cylinders
• Pneumatic Controls • Winches
• Pipe Handling Equipment
o Kelly Spinner o Pipe Spinner
o Rod Tongs o Tubing Tongs
“Your Drilling Rig Hydraulic Specialists”“Your Drilling Rig Hydraulic Specialists”
Website: www.wil-tech.ca
EstevanPhone: (306)634-6743
Address: 69 Escana Street, Estevan, Sask. S4A 2H7
Contact Information:
ReginaPhone: (306)721-1559
Address: 259 McDonald St. N., Regina, Sask. S4N 5W2
Services we provide:• Parker Store
• Full Machine Shop and
Fabrication
• 24 Hour Mobile Repairs and
Testing
• Complete System Design
• Hydraulic Crane Repairs
• Preventative Maintenance
• Power Unit Fabrication