Zoologica Scripta

Phylogenetic relationships of Western Mediterranean

subterranean Trechini groundbeetles (Coleoptera: Carabidae)ARNAUD FAILLE, ACHILLE CASALE & IGNACIO RIBERA

Submitted: 26 October 2010Accepted: 29 November 2010doi:10.1111/j.1463-6409.2010.00467.x

282 ª

Faille, A., Casale, A. & Ribera, I. (2010). Phylogenetic relationships of Western Mediterra-

nean subterranean Trechini groundbeetles (Coleoptera: Carabidae). — Zoologica Scripta, 40,

282–295.

Carabid beetles of tribe Trechini (Coleoptera) are one of the main groups of insects that

colonized the subterranean environment. Many species of this group have developed simi-

lar morphological modifications related to the subterranean life, resulting in a characteris-

tic Aphaenops-like phenotype that obscures their phylogenetic relationships (depigmented,

blind, elongated body and appendages, narrow head and pronotum). We present here the

result of a molecular study using a combination of nuclear (small ribosomal unit, large

ribosomal unit) and mitochondrial (cox1, cyb, rrnL, trnL, nad1) genes to investigate the phy-

logenetic placement of the highly modified subterranean genera of the tribe Trechini from

the west Mediterranean area (France, Spain, Morocco and Sardinia). Our results confirm

the multiple independent origin of troglomorphism among these genera, and reveal a pat-

tern largely determined by geographical proximity. We discuss the validity of some groups

proposed on the base of morphological features, and provide estimates of divergence

between subterranean genera and other groups of Trechini, including epigean species of

the same area. We compare the estimated age for the origin of the main groups resulting

from two different calibrations, using one the standard mitochondrial mutation rate (2.3%

divergence per Myr) and the other the separation between Sardinia and mainland 33 Ma.

Under the first scenario, the main groups of genera would have a late Miocene origin, with

a subsequent colonization of north Africa at the Pliocene–Pleistocene boundary. The

assumption that the main groups originated through vicariance due to the separation of

the Sardinian plate in the Oligocene results in a Messinian origin of the north African sub-

terranean taxa, and a global mitochondrial rate reduced to 1% divergence per Myr.

Corresponding author: Arnaud Faille, Institut de Biologia Evolutiva (CSIC-UPF), Passeig

Marıtim de la Barceloneta 37-49, 08003 Barcelona, Spain and Museum National d’Histoire

Naturelle, Departement Systematique et Evolution, Entomologie, C.P.50, UMR 7205 du CNRS

/USM 601, 45 rue Buffon, F-75005 Paris, France. E-mail: faille@mnhn.fr

Present address for Arnaud Faille, Zoologische Staatssammlung Munchen, Munchhausenstraße 21,

81247 Munchen, Germany

Achille Casale, Dipartimento di Zoologia e Genetica Evoluzionistica, Universita di Sassari, Via

Muroni 25, 07100 Sassari, Italy. E-mails: casale@uniss.it, a_casale@libero.it

Ignacio Ribera, Institut de Biologia Evolutiva (CSIC-UPF), Passeig Marıtim de la Barceloneta

37-49, 08003 Barcelona, Spain. E-mail: ignacio.ribera@ibe.upf-csic.es

IntroductionThere are many groups of insects in which some isolated

species have subterranean habits, but only some of them

seem to have a marked tendency for repeated colonisations

of the underground, with the possibility of extensive radia-

tions in this environment. This is the case of some groups

of Coleoptera like the Leiodidae Leptodirini, the Dytiscidae

2010 The Authors d Zoologica Sc

Hydroporinae and the Carabidae Trechini (Casale et al.

1998; Giachino et al. 1998; Leys et al. 2003). Subterranean

species of Coleoptera usually show similar morphological

and physiological modifications interpreted as convergent

adaptations, which give them a typical appearance: depig-

mented, blind, apterous, and either small size and short

and robust appendages in the endogean species, or larger

ripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295

A. Faille et al. d Phylogeny of Mediterranean hypogean Trechini

size, slender shape (in particular a narrow and elongate

pronotum and head) and elongate appendages in species

typical of caves or less open interstitial spaces (Racovitza

1907; Jeannel 1943; Barr & Holsinger 1985; Culver et al.

1990). The later facies has often been defined as ‘aphae-

nopsian’, in reference to one of the earliest described gen-

era of subterranean Coleoptera, Aphaenops Bonvouloir,

1861, which includes some species endemic to the Pyre-

nees sharing these modifications.

In the west Mediterranean area (south-western France,

the Iberian Peninsula, Morocco and Sardinia), there are

several troglobitic genera of Trechini, of which the most

prominent is the Pyrenean radiation of the genera Aphaen-

ops, Hydraphaenops Jeannel 1926 and Geotrechus Jeannel,

1919 with about 80 species (Jeannel 1941; Lorenz 2005;

Faille et al. 2010a). A recent molecular phylogeny demon-

strated that all the highly modified subterranean species of

the Pyrenees share a single origin, but even at this reduced

geographical scale convergent evolution is common,

resulting in the polyphyly of the subterranean genera as

established on morphological characters (Faille et al.

2010a). In addition to this Pyrenean radiation, in the

western Mediterranean there are several genera of subter-

ranean Trechini with more or less highly modified,

steno-endemic species that have often been hypothesized

to be related to the Pyrenean radiation due to their

‘aphaenopsian’ facies. They also share some internal mor-

phological characters, such as the lateral position of the

copulatory piece in their endophallus (‘anisotopic’ genitalia

in the terminology of Jeannel 1943). These include Speo-

trechus Jeannel, 1922 in southern France, Hydrotrechus Car-

abajal et al. 1999 and Apoduvalius Jeannel 1953 in the

Cantabrian mountains, Sardaphaenops Cerruti & Henrot

1956 in Sardinia, Paraphaenops Jeannel 1916 in the Medi-

terranean coast of Spain, and Antoinella Jeannel 1937 and

Subilsia Espanol 1967 in Morocco. The aim of this work is

to place these subterranean genera in a general phyloge-

netic framework including a representative sample of the

western Mediterranean Trechini, and provide a temporal

framework for studying their origin and biogeography.

Material and MethodsTaxon sampling

We included in the study species of all subterranean gen-

era of west Mediterranean Trechini with only two excep-

tions, Subilsia and Hydrotrechus. We also include some

subterranean species of genera with more eastern distribu-

tions, included in the Duvalius phyletic lineage (Jeannel

1928a; Casale & Laneyrie 1982): Duvalius Delarouzee,

1859, Agostinia Jeannel 1928a,b and Trichaphaenops Jeannel

1916. Among the epigean taxa we include a representation

of the western European and Moroccan species of Trechus

ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters,

Clairville, 1806 plus some genera of Trechini of uncertain

relationships: Iberotrechus Jeannel 1920 (Ortuno & Toribio

2006) and Doderotrechus Vigna Taglianti, 1968, plus repre-

sentatives of other subtribes of Trechini: Perileptus

Schaum, 1860, Aepopsis Jeannel, 1922 and Thalassophilus

Wollaston, 1854 (Jeannel 1926; Casale & Laneyrie 1982)

(Table S1). As outgroups we used species of the Trechinae

tribes Bembidiini and Patrobini. Trees were rooted in

Penetretus Motschoulsky, 1850 (Patrobini), likely to be the

sister group of Trechini plus Bembidiini (e.g. Ribera et al.

2005; Maddison et al. 2009).

Background on the taxonomy and the systematic placement

of west Mediterranean subterranean Trechini

Sardaphaenops Cerruti & Henrot 1956This genus includes three highly modified troglobitic taxa

endemic to Sardinia, Sardaphaenops supramontanus supra-

montanus Cerruti & Henrot 1956; S. supramontanus grafittii

Casale & Giachino 1988; and Sardaphaenops adelphus Casale

2004. When this aphaenopsian genus was described, it was

considered to be related to Duvalius (Cerruti & Henrot

1956; followed by Jeannel 1956 and Juberthie & Massoud

1980). Duvalius is highly diversified from the Alps to China

and includes hundreds of species described so far, but is rep-

resented in the western Mediterranean region by only a few

taxa: two species in Spain, two species in Mallorca (one of

them attributed to the subgenus Trechopsis Peyerimhoff,

1908), one species in Sardinia and four in Algeria (three of

them attributed to the subgenus Trechopsis) (Casale &

Laneyrie 1982; Moravec et al. 2003). Subsequently, Casale

& Laneyrie (1982) included Sardaphaenops in the Aphaenops

phyletic lineage (see also Vigna Taglianti 1982; Casale &

Giachino 1988; Casale 2004). Although the detailed rela-

tionships of this genus seem difficult to be establish based

on morphological characters, as it is the case for most of the

species considered to be ‘palaeoendemic’ (Vigna Taglianti

1982; Ortuno et al. 2004), Casale & Giachino (1988), Casale

& Vigna Taglianti (1996), Casale (2004) and Casale & Mar-

cia (2007) suggested that it could present affinities with the

genus Paraphaenops from Catalonia (see below).

Paraphaenops Jeannel 1916Paraphaenops, containing only Paraphaenops breuilianus was

described by Jeannel (1916) as a subgenus of the mostly

epigean Trechus. It is known only from some caves in the

north of the Iberian system in Tarragona, an area with

several hypogean species of various zoological groups con-

sidered to be ‘palaeoendemic’ (see Ortuno et al. 2004 for a

review). It is geographically very isolated from all

the other aphaenopsian species of Trechini. Jeannel

(1928a) considered that it was closely related to the genus

40, 3, May 2011, pp 282–295 283

Phylogeny of Mediterranean hypogean Trechini d A. Faille et al.

Speotrechus from the French Cevennes (see below), an

opinion followed by Espanol (1950, 1965). Subsequent

authors placed this species closer to Sardaphaenops and the

Pyrenean troglobitic genera Aphaenops, Geotrechus and Hy-

draphaenops (Casale & Laneyrie 1982).

Apoduvalius Jeannel 1953Apoduvalius are small blind and depigmented cave beetles

known by 14 species located along the Cantabrian chain,

in north-west Spain (Serrano 2003). The two first species,

Apoduvalius negrei and A. drescoi, were described by Jeannel

(1953), who named the genus to underline the strong simi-

larities with the Duvalius group of genera. This group is

extremely diversified in the Alps and in central Europe,

but represented in Spain by two species only, the first

endemic to Catalonia, Duvalius berthae (Jeannel, 1910), the

second only known from Sierra de Alcaraz, Duvalius lenci-nai Mateu & Ortuno, 2006. The Duvalius phyletic lineage

(Jeannel 1928a) is morphologically well characterized by

the dorsal (isotopic) position of the copulatory piece, a

part of the endophallus that is usually well sclerified. The

point of view of Jeannel (1953) was shared by subsequent

authors (Espanol 1965; Casale & Laneyrie 1982), but in a

revision of the genus Apoduvalius Vives i Noguera (1980)

noted that all species of this genus have a lateral copula-

tory piece (‘position anisotope’, Jeannel 1955) (see also

Deuve 1991; Dupre 1995; Salgado & Pelaez 2004). There-

fore, these authors concluded that the species of Apoduva-

lius were close to the endemic Pyrenean genus Geotrechus,

with 22 described species mainly located on the foothills

of the French Pyrenees (Casale & Laneyrie 1982; Moravec

et al. 2003). The presence of pubescent protibiae is

another character shared by these two genera, although

this is also shared with Duvalius.

Antoinella Jeannel 1937The genus Antoinella was created by Jeannel for a single

troglobitic species of Morocco, Antoinella groubei (Antoine

1935), originally attributed to the genus Duvalius by

Antoine (1935). From the features of male genitalia, Jean-

nel (1937) suggested that Antoinella is close to Trechus,more especially to the Trechus fulvus Dejean, 1831 species

group, a point of view followed by Casale (1982) but not

by Mateu & Escola (2006), who assumed a relationship

with Duvalius. It currently includes eight species, all ende-

mic to Morocco (Comas & Mateu 2008).

Speotrechus Jeannel, 1922The monospecific genus Speotrechus was erected by Jeannel

for a species of the French Alps and the Cevennes. It was

attributed to the Aphaenops phyletic lineage, close to

Paraphaenops (Jeannel 1928a).

284 ª 2010 The Authors d Zoologica Sc

The Pyrenean radiation: Aphaenops Bonvouloir,1861, Hydraphaenops Jeannel 1926 and GeotrechusJeannel, 1919All highly modified subterranean species of Trechini in

the Pyrenean area were shown to form a monophyletic

group by Faille et al. (2010a). The three genera were

found to be para- or polyphyletic, showing extensive mor-

phological convergence presumably as a result of similar

ecological requirements.

Hydrotrechus Carabajal et al. 1999 and SubilsiaEspanol 1967The genus Hydrotrechus was described for a species (Hydro-

trechus cantabricus Carabajal et al. 1999) found in loose soil

saturated with water in the Cantabrian mountains in north-

west Spain. According to the authors, it seems related to the

genus Trechus, differing mainly by the presence of pubes-

cence in the elytra and the absence of eyes (Carabajal et al.

1999). This genus should be considered as synonym of Tre-

chus (Ortuno and Jimenez-Valverde in press).

The morphologically peculiar genus Subilsia was origi-

nally described from a female, and considered to be close

to Duvalius (Espanol 1967). The subsequent discovery of

the male (Espanol 1970) showed that the copulatory piece

of the endophallus was of ‘anisotopic’ type; therefore, this

peculiar genus from the Middle Atlas in Morocco seems

to be more likely related to Trechus and Antoinella (Casale

& Laneyrie 1982). We could not obtain fresh specimens

for a molecular study of these two species.

DNA extraction, PCR amplification and sequencing

Specimens were collected in the field and directly preserved

in 96% ethanol. DNA was obtained from whole specimens

by a standard non-destructive extraction (Rowley et al.

2007) using commercial kits. Voucher specimens are kept in

the MNHN (Paris), DNA aliquots are kept in the tissue col-

lections of the MNHN and IBE (CSIC-UPF, Barcelona).

We sequenced three mitochondrial genome fragments

including five genes (3¢ end of cytochrome c oxidase sub-

unit 1, cox1; an internal fragment of the cytochrome b, cyb;

and a continuous fragment including the 3¢ end of the

large ribosomal unit plus the Leucine transfer plus the 5¢end of NADH dehydrogenase subunit 1, rrnl+trnL+nad1)

and two nuclear genes (5¢ end of the small ribosomal unit,

SSU and an internal fragment of the large ribosomal unit,

LSU) (see Table 1 for the primers used). Sequences were

assembled and edited with BIOEDIT v. 7.00 (Hall 1999) or

SEQUENCHER 4.6 (Gene Codes, Inc., Ann Arbor, MI, USA).

New sequences have been deposited in EMBL database

with Accession Numbers (Table S1). Protein-coding genes

were not length variable, and the ribosomal genes were

aligned with the online version of MAFFT v.6 using the

ripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295

Table 1 Primers used in the study.

Marker Primer Sequence References

cox1 RON 5¢ GGATCACCTGATATAGCATTCCC 3¢ Simon et al. (1994)

HOBBES 5¢ AAATGTTNGGRAAAAATGTTA 3¢ Monteiro & Pierce (2001)

TOM AC(A ⁄ G)TAATGAAA(A ⁄ G)TGGGCTAC(T ⁄ A)A Ribera et al. (2010)

TONYA 5¢ GAAGTTTATATTTTAATTTTACCGG 3¢ Monteiro & Pierce (2001)

NANCY 5¢ CCCGGTAAAATTAAAATATAAACTTC 3¢ Simon et al. (1994)

JERRY 5¢ CAACATTTATTTTGATTTTTTGG 3¢ Simon et al. (1994)

PAT 5¢ TCCAATGCACTAATCTGCCATATTA 3¢ Simon et al. (1994)

cyb CB1 5¢ TATGTACTACCATGAGGACAAATATC 3¢ Simon et al. (1994)

CP1 5¢ GATGATGAAATTTTGGATC 3¢ G. Kergoat, personal

communication (2004)

CB2 5¢ ATTACACCTCCTAATTTATTAGGAAT 3¢ Simon et al. (1994)

TSERco 5¢ TATTTCTTTATTATGTTTTCAAAAC 3¢ Simon et al. (1994)

rrnl+tRNA-Leu+nad1 NDIA 5¢ GGTCCCTTACGAATTTGAATATATCCT 3¢ Simon et al. (1994)

16SaR 5¢ CGCCTGTTTATCAAAAACAT 3¢ Simon et al. (1994)

LSU D3 5¢ GCATAGTTCACCATCTTTC 3¢ Ober (2002)

D1 5¢ GGGAGGAAAAGAAACTAAC 3¢ Ober (2002)

SSU 18S-5¢ 5¢ GACAACCTGGTTGATCCTGCCAGT 3¢ Shull et al. (2001)

18S-b5.0 5¢ TAACCGCAACAACTTTAAT 3¢ Shull et al. (2001)

SSU, small ribosomal unit; LSU, large ribosomal unit.

A. Faille et al. d Phylogeny of Mediterranean hypogean Trechini

GINS-i algorithm and default parameters (Katoh et al.

2002; Katoh & Toh 2008).

Part of the sequences were obtained from Faille et al.

(2010a,b). We added 14 new specimens and a total of 230 new

sequences to the dataset (Table S1), including 151 sequences

for the specimens already in Faille et al. (2010a), thus avoiding

the use of chimerical sequences for eight of the taxa.

Phylogenetic analyses

Bayesian analyses were conducted on a combined data

matrix with MrBayes 3.1.2 (Huelsenbeck & Ronquist

2001), using six partitions corresponding to the six

sequenced genes (the small trnL was included in the same

partition as the rrnL gene). Evolutionary models were esti-

mated prior to the analysis with Model-Test 3.7 (Posada

& Crandall 1998). MrBayes ran for 107 generations using

default values, saving trees each 1000. ‘Burn-in’ values

were established after visual examination of a plot of the

standard deviation of the split frequencies between two

simultaneous runs. We also used Maximum Likelihood as

implemented in the on-line version of RAxML (which

includes an estimation of bootstrap node support, Sta-

matakis et al. 2008), using GTR+G as the evolutionary

model and the same six partitions used in MrBayes. A Par-

simony topology was obtained using PAUP v4.b10 (Swof-

ford 2002), with 1000 bootstrap searches of 10 random

replicates each, not saving multiple trees.

Estimation of divergence times

To estimate the relative age of divergence of the lineages we

used the Bayesian relaxed phylogenetic approach imple-

ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters,

mented in BEAST v1.4.7 (Drummond & Rambaut 2007),

which allows variation in substitution rates among branches

(Drummond et al. 2006). We implemented a GTR+I+G

model of DNA substitution with four rate categories using

the mitochondrial data set only and pruning specimens with

missing gene fragments, with an uncorrelated lognormal

relaxed molecular clock model to estimate substitution rates

and the Yule process of speciation as the tree prior. The

main nodes of the topology were constrained to match that

of the tree obtained with the whole dataset (mitochondrial

plus nuclear) in MrBayes. We ran two independent analyses

for each group sampling each 1000 generations, and used

TRACER version 1.4 (Drummond & Rambaut 2007) to

determine convergence, measure the effective sample size of

each parameter, and calculate the mean and 95% highest

posterior density interval for divergence times. Results of

the two runs were combined with LogCombiner v1.4.7 and

the consensus tree compiled with TreeAnnotator v1.4.7

(Drummond & Rambaut 2007). The analyses were run for

20 · 106 generations, with the initial 10% discarded as

burn-in. We calibrated the trees in two different forms:

1. It has been hypothesized that the genus Sardaphaenops

originated through vicariance with SW mainland Eur-

ope due to the tectonic separation of Sardinia during

the Oligocene and Early Miocene (Casale & Vigna

Taglianti 1996; Casale 2004). This calibration point has

been used for the estimation of divergence rates among

west-Palaearctic lineages of Leptodirini subterranean

beetles (Caccone & Sbordoni 2001; Ribera et al. 2010).

The prior of the age of the node separating Sardaphaenops

from its sister group was defined as a normal distribution

40, 3, May 2011, pp 282–295 285

Phylogeny of Mediterranean hypogean Trechini d A. Faille et al.

with average 33 Myr (following Schettino & Turco

2006; see Ribera et al. 2010 for a detailed justification)

and a standard deviation of 2.0 Myr.

2. We used a standard mitochondrial mutation rate for

insects of 2.3% divergence per Myr, equivalent to a

per-branch rate of 0.0115 substitutions ⁄ site ⁄ Myr

(Brower 1994). Despite the obvious limitations of the

use of an a priori universal standard rate, recent works

have shown that for Coleoptera the rate of a combina-

tion of ribosomal and protein-coding mitochondrial

genes is remarkably consistent and close to this figure

(e.g. Papadopoulou et al. 2010; Ribera et al. 2010). We

used as prior for the rate a normal distribution with

average 0.0115 substitutions ⁄ site ⁄ Myr and a standard

deviation of 0.0001.

ResultsThe two runs of the Bayesian analyses converged at approxi-

mately 6.5 · 106 generations (taken as burn-in), with a stan-

dard deviation of the split frequencies lower than 0.01. The

two runs were combined to produce a single consensus phy-

logram based on 7000 trees. The convergence of the param-

eters was good, as measured both with the estimated

effective population size and the convergence diagnostic

parameter in MrBayes (Huelsenbeck & Ronquist 2001).

The topologies obtained with Maximum Likelihood in

RAxML and parsimony in PAUP were very similar to that

obtained with MrBayes, with only some poorly supported

nodes showing incongruence (Fig. 1).

The monophyly of Trechini was strongly supported

(Bayesian posterior probability, Bpp = 1; MP ⁄ ML boot-

strap, BT = 67 ⁄ 100, Fig. 1), but Bembidiini appeared as

paraphyletic, with one well-supported node excluding Phi-lochthus from the rest of Bembidiini plus Trechini. Within

Trechini the two genera Perileptus and Thalassophilus (sub-

tribes Perileptina and Trechodina respectively) were sister

to a large clade including subtribes Trechina and Aepina

in a series of well-supported lineages with poorly resolved

relationships among them (Fig. 1).

These well-supported lineages included three highly

diversified groups: (i) all the Pyrenean subterranean taxa,

i.e. the Aphaenops group of genera, Aphaenops, Hydraphaen-

ops and Geotrechus (in agreement with Faille et al. 2010a);

(ii) the Duvalius group of genera, including Duvalius, Ag-

Fig. 1 Phylogram of Western Mediterranean subterranean Trechini o

nodes, parsimony bootstrap ⁄ Bayesian posterior probability, obtained i

Methods for details). In red, troglobitic genera (outside the Pyrenean

species of the two genera Trechus and Duvalius; in blue, epigean sp

Putzeys, 1870) species and species with some populations located in ca

(see Table S1). -: unresolved or poorly supported node (bt < 70%,

mentioned in this figure the reader is referred to the web version of the

286 ª 2010 The Authors d Zoologica Sc

ostinia and Trichaphaenops in a well-supported clade, plus

the genera Doderotrechus, Aepopsis (subtribe Aepina) and

Iberotrechus with poorly resolved relationships within this

group; and (iii) the Trechus group of genera, a clade

including all epigean species of Trechus with the only

exception of two Iberian species (Trechus comasi Hernando

2002 and Trechus schaufussi complex) plus the subterranean

genera Apoduvalius, Antoinella and Speotrechus.

In addition to these three major lineages there were a

number of less diversified genera with poorly supported

relationships: Sardaphaenops, Paraphaenops and the two Ibe-

rian species of Trechus not included with the rest of the

genus. In both the Bayesian and the Maximum likelihood

trees, the Aphaenops and the Duvalius lineages were sisters,

and the Trechus group was included in a clade with Sardap-

haenops, Paraphaenops and the Iberian Trechus, although

with low support in both cases (Bpp = 0.76, BT = 62 and

74 respectively; Fig. 1). The genera Sardaphaenops and

Paraphaenops never appeared directly related to the Pyre-

nean Aphaenops group.

Of the three main lineages within Trechini, only the

Aphaenops group in the Pyrenees included exclusively sub-

terranean species. The internal phylogeny of this group

was in agreement with the results of Faille et al. (2010a),

with the effect of the new sequences being mostly reflected

in the increased support of some nodes. The hypogean

genus Geotrechus formed a paraphyletic series at the base

of the lineage, within which there were two independent

origins of first an intermediate Hydraphaenops and then the

Aphaenops morphological types, forming two radiations in

the East and West of the chain (Fig. 1; see Faille et al.

2010a).

The west Mediterranean species of Duvalius included in

the analyses (D. berthae from Catalonia) formed a well-

supported clade with the Alpine species of the genus, with

two subterranean genera with an ‘aphaenopsian’ facies (Ag-

ostinia and Trichaphaenops) nested within it.

The single species of Antoinella included in the analyses

formed a well-supported clade with two epigean species of

Trechus, Trechus martinezi Jeannel 1927 from the south-

east of the Iberian peninsula and T. fulvus, widely spread

in the western Palaearctic region. The Cantabrian genus

Apoduvalius appears as polyphyletic and again nested

within a lineage of epigean Trechus (Fig. 1), with the spe-

btained in MrBayes, using the combined data matrix. Number in

n MrBayes ⁄ ML bootstrap obtained in RAxML (see Material and

radiation); in orange, hypogean depigmented and eye-regressed

ecies, including intertidal (Aepopsis) or cryophilic (Trechus saxicola

ves (Iberotrechus, Trechus uhagoni, Trechus barnevillei Pandelle, 1867)

Bpp < 50); x: contradictory node (for interpretation of colours

article).

ripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295

Phylogeny of Mediterranean hypogean Trechini d A. Faille et al.

6 ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters

Phylogeny of Mediterranean hypogean Trechini d A. Faille et al.

cies Apoduvalius alberichae Espanol, 1971 (included in the

subgenus Trichapoduvalius Vives 1976) related to some epi-

gean Trechus from the same geographical area, and the

species of Apoduvalius sensu stricto sister to them. The

genus Speotrechus from Cevennes and Causses appears as

sister to the complex formed by the epigean Trechus and

the subterranean genera nested within it, i.e. Antoinella

and Apoduvalius.

Estimation of divergence dates

The two independent runs of Beast for each of the analy-

ses reached convergence in less than the 10% of the gen-

erations used as ‘burnin’ by default, as measured with the

effective sample size estimated in TRACER. For each analy-

sis, the two independent runs were combined to produce a

single ultrametric tree. The relationship between the esti-

mated age of the nodes when using an a priori standard

rate of 2.3% divergence ⁄ Myr and when the age of the

node including the Trechus group of genera, Sardaphaenops,

Paraphaenops and T. aff. schaufussi plus T. comasi was set to

33 Myr followed a perfect linear relationship, with slope

2.33 and an intercept of 0.065 (Table S2; Figs S1 and S2).

When the tectonic separation of Sardinia was used as a

calibration point, the estimated average rate for the com-

bined mitochondrial sequence decreased by a factor of 2.3,

to a value of 0.005 substitutions ⁄ site ⁄ Myr (Table S2).

Under this scenario, the origin of Trechina dated back to

mid Eocene, and that of the main lineages to late Oligo-

cene or early Miocene (Fig. 2A). The separation between

the Moroccan Antoinella and the SE Iberian T. martinezi

was 5.66 Myr, in good agreement with a vicariance pro-

duced by the end of the Messinian salinity crisis at

5.3 Myr (Chalouan et al. 2008).

On the contrary, using a standard rate of 2.3% diver-

gence per Myr, the origin of Trechina was estimated to be

in early Miocene, and the origin of the main lineages in

late Miocene (Fig. 2B). The separation between Sardap-

haenops, Paraphaenops and the species of Trechus was esti-

mated to have occurred in middle Miocene, during the

Tortonian, and the separation between Antoinella and T.

martinezi in the Pliocene–Pleistocene transition.

DiscussionPhylogeny of Trechini

We found strong support for the monophyly of the sub-

tribe Trechina, one of the most diverse lineages of ground

beetles (Lorenz 2005), but only with the inclusion of Aep-

opsis, a genus including one only intertidal species of the

Atlantic coast from Britain to Morocco. This result is in

accordance with recent work based on larval morphology

(Grebennikov & Maddison 2005). Aepopsis has been

grouped with other intertidal species from both Europe

288 ª 2010 The Authors d Zoologica Sc

(Aepus) and sub-Antarctic territories (Chile, Patagonia,

Falkland islands and New Zealand) in the tribe Aepini

(Jeannel 1926; Casale & Laneyrie 1982). Our results sug-

gest that the peculiar morphology of Aepopsis and the likely

closely related genus Aepus could be the consequence of a

highly specialized, derived combination of characters

within the subtribe Trechina, of uncertain phylogenetical

affinities with the southern taxa.

Within Trechina, the genera included in our study

grouped largely according to their geographical distribu-

tion, with three strongly supported clades including the

Pyrenean subterranean taxa (Aphaenops group), some gen-

era mostly distributed in the Alps and central Europe (Du-

valius group), and a series of species of Trechus with a

western Mediterranean distribution (Trechus group). These

three groups largely agree with the traditional phyletic lin-

eages of Aphaenops, Duvalius and (part of) Trechus (Jeannel

1927, 1928a; Casale & Laneyrie 1982; Casale et al. 1998),

although their composition is not exactly the same (in par-

ticular for the troglobitic genera studied here) and the

morphological characters used to define them are highly

homoplasic (pubescence of the protibiae and presence of

eyes). Preliminary results suggest that the widespread

genus Duvalius could be polyphyletic, as observed for Tre-

chus.

The position of Sardaphaenops, Paraphaenops and two

Iberian species of Trechus was not well supported,

although all analyses grouped them with the Trechus

group, in agreement with their geographic distribution

(Fig. 3) and with morphology, especially the structure of

the endophallus (anisotopic position of copulatory piece).

In any case, both Paraphaenops and Sardaphaenops (and the

two species of Trechus) are isolated lineages within the

western Mediterranean Trechini, not closely related to the

Pyrenean radiation. These two Iberian species of Trechus,

T. comasi and a species of the T. schaufussi complex, were

not grouped with the rest of the species of the genus. Tre-

chus comasi has been said to be close to Trechus brucki

Fairmaire, 1862 (Hernando 2002), a member of the ‘Tre-

chus uhagoni group’ (Jeannel 1941). However, T. uhagoni

Crotch, 1869 was included in the analyses and unambigu-

ously placed inside the Trechus clade, in accordance with

morphology (Ortuno 2010). In this last work, T. comasi is

considered by the author as a subspecies of T. schaufussi

Putzeys, 1870. The specimen considered as T. schaufussi in

Faille et al. (2010a), from Ciudad Real, should better be

considered as a member of a complex of species under the

name T. schaufussi, which has seven recognized subspecies

(Serrano 2003) and is in need of a taxonomic revision.

Within the exclusively subterranean Pyrenean Aphaenops

group our results basically agree with Faille et al. (2010a),

although the addition of new species reinforced the

ripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295

Fig. 2 (A–B) Ultrametric tree of the Phylogeny of Western Mediterranean subterranean Trechini obtained with Beast, using (A) the

separation of the Sardinian species with a prior age of 33 Myr; (B) a standard mitochondrial rate (0.0115 substitutions ⁄ site ⁄ Myr) (see

Material and Methods for details). Number in nodes, estimated age (in Myr); grey band, 95% confidence intervals.

A. Faille et al. d Phylogeny of Mediterranean hypogean Trechini

ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295 289

Fig. 2 (Continued)

Phylogeny of Mediterranean hypogean Trechini d A. Faille et al.

290 ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295

Fig. 3 Distribution map of the troglobitic genera of Western Mediterranean Trechini. (1) Sardaphaenops, (2) Paraphaenops, (3)

Doderotrechus, (4) Trichaphaenops, (5) Agostinia, (6) Speotrechus, (7) Pyrenean clade, (8) Apoduvalius and (9) Antoinella.

A. Faille et al. d Phylogeny of Mediterranean hypogean Trechini

evidence of the para- or polyphyly of the recognized gen-

era. This implies the transition from an ‘anophthalmous’

habit (Geotrechus) to a subterranean life strongly linked to

the presence of high humidity and a film of water (Hydrap-

haenops) and finally, twice independently, to the typical

Aphaenops morphology. The appearance of the Aphaenops

morphology in the Pyrenean clade was apparently accom-

panied by an increase in the diversification rate and a

range expansion, once in the eastern and a second time in

the western part of the Pyrenees (Faille et al. 2010a). The

same ‘Aphaenopsian’ morphological type developed inde-

pendently in other lineages of Trechini, but in these cases

without diversification or range expansions (Paraphaenops,

Sardaphaenops), even if, according to our estimations, these

taxa are of more ancient origin (see below). A possible rea-

son could be the lack of suitable habitat for their geo-

graphical expansion, either for being confined to an island

(Sardaphaenops) or for the higher aridity of the area (Parap-

haenops).

The inclusion of Iberotrechus in the Duvalius group is

surprising, and had never been suggested before. Origi-

nally described within Trechus, Jeannel (1920) finally

erected a new genus and subsequently postulated its affini-

ties with the American Homaloderini (Jeannel 1927).

However Moore (1972), followed by Casale & Laneyrie

(1982), synonymised Homaloderini with Trechini, but the

affinities of the highly distinctive genus Iberotrechus

remained obscure (e.g. Ortuno & Toribio 2006). Iberotre-

chus bolivari (Jeannel 1913) was considered to be exclusive

of a single cave in Cantabria, but has recently been found

to be a typical inhabitant of shaded and very moist decidu-

ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters,

ous forest, usually close to streams or springs (Ortuno &

Toribio 2006).

The Trechus group of genera as considered here

includes two subterranean genera nested within it, one of

them (Apoduvalius) polyphyletic, and a third subterranean

genus (Speotrechus) as sister to the remaining species. The

most incomplete sampling of the large and widespread

genus Trechus prevents the introduction from any formal

taxonomic change, but from our results it is clear that a

deep taxonomic rearrangement will be necessary, with the

separation of what is currently known as Trechus in sev-

eral genera. The inclusion of Antoinella within the T. ful-

vus group is in agreement with morphological

expectations (Jeannel 1937; Casale 1982), in particular its

proximity to species distributed in the Baetic cordilleras

(T. martinezi). Hypogean lifestyles are common in this

group of species, and several of them are subterranean in

Spain and North Africa (Jeannel 1927; Antoine 1955; Re-

boleira et al. 2010).

The inclusion of Apoduvalius as part of a group of NW

Iberian species of Trechus, although coherent from a geo-

graphical perspective, was more unexpected. The subgenus

Trichapoduvalius seems to be distinct from the rest of the

species, and of more recent origin. The relationships of

Apoduvalius with Trechus but not with the Pyrenean Ap-

haenops group (and in particular Geotrechus) is supported by

two additional morphological characters: the disposition of

the humeral setae of the elytra, aggregated on the external

edge of elytra (not aligned in any species of the Aphaenops

group, Jeannel 1926), and the presence of complete frontal

furrows (incomplete in the Aphaenops group, Jeannel 1926).

40, 3, May 2011, pp 282–295 291

Phylogeny of Mediterranean hypogean Trechini d A. Faille et al.

Estimations of divergence times within Trechini

The two alternative calibrations, assuming a vicariant ori-

gin of Sardaphaenops due to the tectonic isolation of Sardi-

nia or assuming a standard mitochondrial rate, resulted in

two very different scenarios for the origin and evolution of

the subterranean west Mediterranean Trechini. Under the

classic hypothesis of a tectonic origin for Sardaphaenops, its

origin – and thus the origin of the Trechus group plus

Paraphaenops and the two Iberian Trechus – was set to be

early Oligocene. The divergence between the Moroccan

Antoinella and its Iberian relatives was accordingly esti-

mated to have occurred at the end of the Messinian per-

iod, in agreement with many examples of vicariance

produced by the last opening of the Strait of Gibraltar

5.3 Ma (e.g. Martınez-Solano et al. 2004; Carranza &

Amat 2005; Agustı et al.2006). The origin of the Aphaenops

group would be in early Miocene, a period of global

warming that could be associated with the colonization of

the subterranean medium by hygrophilous species (Zachos

et al. 2001; Uriarte 2003). With this calibration, the Tre-

chini radiation would still be younger than the origin of

the Pyrenean radiation of the other main lineage of sub-

terranean beetles (Leptodirini), as estimated using the

same vicariant event (Ribera et al. 2010).

The estimated average rate when the tree is calibrated

using the tectonic separation of the Sardinian plate (0.005

substitutions ⁄ site ⁄ Myr) (Fig. 2A) was ca. 3 times lower than

the standard mitochondrial rate of 2.3% of divergence per

Myr (Fig. 2B) (Brower 1994). The standard rate has shown

to be surprisingly accurate for different groups of beetles

when using a mixture of protein-coding and ribosomal

mitochondrial genes, as it was the case here. Thus, as noted

above, using Leptodirini beetles and the same calibration

point the estimation of Ribera et al. (2010) for a very similar

set of genes was 2%, and Papadopoulou et al. (2010) using

Tenebrionidae and the age of the Aegean trench obtained

an estimate of 2.7%. Using only protein-coding genes gives

higher estimates, e.g. 3% for cox1-cox2 for the Canarian

Trechus (Contreras-Dıaz et al. 2007), or 2.6% for the com-

plete combined protein-coding mitochondrial set and for

deep divergences (which tend to underestimate the rates)

(Pons et al. 2010). In the later work it is shown that the

branches for the protein-coding genes of suborders Polyph-

aga and Myxophaga were about double the length of those

of Archostemata and Adephaga, with the rate for the later

estimated to be ca. 2%. However, even assuming a slower

rate for Adephaga, the estimated rate of 0.005 substitu-

tions ⁄ position ⁄ Myr for the combination of protein-coding

and ribosomal mitochondrial genes seems to be exceedingly

low in comparison to published results. There does not

seem to be any obvious difference in the estimated branch

lengths of the subterranean vs. the epigean species of

292 ª 2010 The Authors d Zoologica Sc

Trechini that could justify a lower rate as a consequence of

the subterranean adaptations (longer life cycles, cold adap-

tation, e.g. Culver 1982).

The assumption of a standard rate of 2.3% divergence

per Myr resulted in a linear increase of all estimated dates

(Fig. 2B; Fig. S1), with the origin of Sardaphaenops, Parap-

haenops, the Iberian Trechus and the Trechus group of gen-

era in the Tortonian. During this period, the SW

Mediterranean experienced a complex geological setting,

with multiple events of isolation of terrains in the Baetic

ranges and the Rif Area (Braga et al. 2002; Jolivet et al.

2006), in agreement with an almost simultaneous split of

taxa in mainland Iberia and Europe (Trechus group), the

Baetic ranges (the two isolated Iberian Trechus), some

Mediterranean coastal ranges (Paraphaenops) and Sardinia

(Sardaphaenops). This would require the subsequent expan-

sion of the distribution of some species of the Trechus

group, including the colonization of north Africa by Antoi-

nella at the Pliocene–Pleistocene boundary, and the recent

expansion of T. fulvus and other species of the genus (i.e.

Trechus obtusus Erichson, 1837, see Jeannel 1927, 1928b).

The study of another genus of Trechini in the same

area, such as Duvalius, with the troglobitic species Duva-

lius sardous (Dodero, 1917) in Sardinia, considered to be

close to the Catalan D. berthae (Vigna Taglianti 1982),

or the Mallorcan Duvalius balearicus Henrot, 1964, appar-

ently close to the Algerian D. jurjurae Peyerimhoff, 1909

could shed further light on the diversification of the west

Mediterranean subterranean Trechini and the origin of

some of the most emblematic subterranean species of this

area.

AcknowledgementsWe thank Charles Bourdeau, Javier Fresneda, Jose Maria

Salgado, the members of Associacio catalana de bioespe-

leologia, our colleagues and friends speleologists working

in the Alps and Sardinia (in particular, Giuseppe Grafitti,

Enrico Lana, Paolo Marcia and Carlo Onnis) and all the

collectors mentioned in the Table S1 for their help dur-

ing field work, and Vicente Ortuno for information on

the taxonomic position of Hydrotrechus. Philippe Deliot

made the picture of aphaenopsian Trechini (Aphaenops ca-

talonicus Escola & Cancio) illustrating Fig. 1. This work

was partly funded by projects CGL2007-61665 to IR and

CGL2007-61943 to A. Cieslak (MNCN, Madrid). AF

was supported by a postdoctoral Research Fellowship

from the Alexander von Humboldt Foundation.

Researches in Sardinia by A. Casale were in part sup-

ported by the P.R.I.N. ‘L’endemismo in Italia’, coordi-

nated by Prof. M. Bologna, University of Rome and

the UE program Interreg Sardinia-Corsica-Tuscany on

Biodiversity.

ripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295

A. Faille et al. d Phylogeny of Mediterranean hypogean Trechini

ReferencesAgustı, J., Garces, M. & Krijgsman, W. (2006). Evidence for

African–Iberian exchanges during the Messinian in the Spanish

mammalian record. Palaeogeography, Palaeoclimatology,

Palaeoecology, 238, 5–14.

Antoine, M. (1935). Notes d’Entomologie Marocaine. XXI.

Description d’un Duvalius cavernicole microphthalme de la

grotte de daya Chiker (Coleoptere Carabidae). Bulletin de la

Societe des Sciences Naturelles du Maroc, 15, 234–237.

Antoine, M. (1955). Coleopteres carabiques du Maroc (Premiere

partie). Memoires de la Societe des Sciences Naturelles et Physiquesdu Maroc. Zoologie, Nouvelle Serie, No 1. Paris-Rabat: Editions

Larose.

Barr, T. C. & Holsinger, J. R. (1985). Speciation in cave faunas.

Annual Review of Ecology and Systematics, 16, 313–337.

Braga, J. C., Martın, J. M. & Quesada, C. (2002). Patterns and

average rates of late Neogene-recent uplift of the Betic

cordillera, SE Spain. Geomorphology, 50, 3–26.

Brower, A. V. Z. (1994). Rapid morphological radiation and

convergence among races of the butterfly Heliconius erato

inferred from patterns of mitochondrial DNA evolution.

Proceedings of the National Academy of Sciences of the United States

of America, 91, 6491–6495.

Caccone, A. & Sbordoni, V. (2001). Molecular biogeography of

cave life: a study using mitochondrial DNA from Bathysciine

beetles. Evolution, 55, 122–130.

Carabajal, E., Garcıa, J. & Rodrıguez, F. (1999). Descripcion de

un nuevo genero y una nueva especie de Trechini (Coleoptera:

Caraboidea: Trechidae) de la cordillera Cantabrica. Elytron, 13,

123–131.

Carranza, S. & Amat, F. (2005). Taxonomy, biogeography and

evolution of Euproctus (Amphibia: Salamandridae), with the

resurrection of the genus Calotriton and the description of a

new endemic species from the Iberian Peninsula. Zoological

Journal of the Linnean Society, 145, 555–582.

Casale, A. (1982). Nuovi Carabidi del Marocco, di Grecia e di

Papua-Nuova Guinea (Coleoptera). Revue Suisse de Zoologie, 89,

229–244.

Casale, A. (2004). Due nuovi Coleotteri ipogei di Sardegna,

Sardaphaenops adelphus n. sp. (Coleoptera Carabidae) e Patriziellamuceddai n. sp. (Coleoptera Cholevidae), e loro significato

biogeografico. Bollettino della Societa Entomologica Italiana, 136,

3–31.

Casale, A. & Giachino, P. M. (1988). Note su Sardaphaenopssupramontanus Cerruti & Henrot, 1956 (Col. Carabidae), e

descrizione di S. supramontanus grafittii n. subsp. Bollettino delMuseo Regionale di Scienze Naturali, Torino, 6, 585–601.

Casale, A. & Laneyrie, R. (1982). Trechodinae et Trechinae du

monde. Tableau des sous-familles, tribus, series phyletiques,

genres, et catalogue general des especes. Memoires deBiospeologie, 9, 1–226.

Casale, A. & Marcia, P. (2007). Larval morphology of

Sardaphaenops adelphus Casale, 2004, a highly specialized

troglobitic beetle endemic to Sardinia (Coleoptera, Carabidae).

Subterranean Biology, 5, 35–42.

Casale, A. & Vigna Taglianti, A. (1996). Coleotteri Carabidi di

Sardegna e delle piccole isole circumsarde, e loro significato

biogeografico (Coleoptera, Carabidae). Biogeographia, Lavoridella Societa Italiana di Biogeografia (n.s.), 18, 391–427.

ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters,

Casale, A., Vigna Taglianti, A. & Juberthie, C. (1998). Coleoptera

Carabidae. In C. Juberthie & V. Decu (Eds) Encyclopaedia

Biospeologica. 2 (pp. 1047–1081). Moulis-Bucarest: Societe

Internationale de Biospeologie.

Cerruti, M. & Henrot, H. (1956). Nuovo genere e nuova specie

di Trechidae troglobio della Sardegna centroorientale

(Coleoptera). Fragmenta Entomologica, 2, 121–128.

Chalouan, A., Michard, A., El Kadiri, K., Negro, F., Frizon de

Lamotte, D., Soto, J. I. & Saddiqi, O. (2008). Chapter 5: The

Rif belt. In A. Michard, O. Saddiqi, A. Chalouan & D. Frizon

de Lamotte (Eds) Continental Evolution: The Geology of Morocco.Structure, Stratigraphy, and Tectonics of the Africa-Atlantic-

Mediterranean Triple Junction (pp. 203–302). Berlin: Springer.

Comas, J. & Mateu, J. (2008). Dos nuevas especies del genero

Antoinella Jeannel, 1937 de Marruecos (Coleoptera: Carabidae:

Trechinae). Heteropterus, 8, 35–41.

Contreras-Dıaz, H. G., Moya, O., Oromı, P. & Juan, C. (2007).

Evolution and diversification of the forest and hypogean

ground-beetle genus Trechus in the Canary Islands. MolecularPhylogenetics and Evolution, 42, 687–699.

Culver, D. C. (1982). Cave Life: Evolution and Ecology. Cambridge,

MA: Harvard University Press.

Culver, D. C., Kane, T. C., Fong, D. W., Jones, R., Taylor, M.

A. & Sauereisen, S. C. (1990). Morphology of cave organisms –

is it adaptative? Memoires de Biospeologie, 17, 13–26.

Deuve, T. (1991). Un nouvel Apoduvalius, nivicole, des Picos de

Europa (Col. Trechidae). Entomologica Gallica, 2, 187–188.

Drummond, A. J. & Rambaut, A. (2007). BEAST: Bayesian

evolutionary analysis by sampling trees. BMC Evolutionary

Biology, 7, 214.

Drummond, A. J., Ho, S. Y. W., Phillips, M. J. & Rambaut, A.

(2006). Relaxed phylogenetics and dating with confidence. PLoSBiology, 4, e88.

Dupre, E. (1995). Le genre Aphaenops des massifs pyreneens dans

la systematique des Trechini (Coleoptera, Carabidae).

Ikartzaleak, 19, 9–18.

Espanol, F. (1950). Coleopteros cavernicolas (Troglobios) de la

provincia de Tarragona. Speleon, 1, 41–58.

Espanol, F. (1965). Los trequidos cavernıcolas de la Penınsula

Iberica e islas Baleares (Col. Caraboidea). Publicaciones delInstituto de Biologıa Aplicada, 38, 123–151.

Espanol, F. (1967). Resultados de una campana biospeleologica en

el Gran Atlas Central. Coleopteros. Miscelanea Zoologica, 2, 47–

51.

Espanol, F. (1970). Algunos coleopteros cavernıcolas del Gran

Atlas Central, Marruecos. Annales de Speleologie, 25, 369–375.

Faille, A., Ribera, I., Deharveng, L., Bourdeau, C., Garnery, L.,

Queinnec, E. & Deuve, T. (2010a). A molecular phylogeny

shows the single origin of the Pyrenean subterranean Trechini

ground beetles (Coleoptera: Carabidae). Molecular Phylogeneticsand Evolution, 54, 67–106.

Faille, A., Bourdeau, C. & Fresneda, J. (2010b). A new species of

blind Trechinae from the Pyrenees of Huesca, and its position

within Aphaenops (sensu stricto) (Coleoptera: Carabidae:

Trechini). Zootaxa, 2566, 49–56.

Giachino, P. M., Decu, V. & Juberthie, C. (1998). Coleoptera

Cholevidae. In C. Juberthie & V. Decu (Eds) Encyclopaedia

Biospeologica. 2 (pp. 1083–1122). Moulis-Bucarest: Societe

Internationale de Biospeologie.

40, 3, May 2011, pp 282–295 293

Phylogeny of Mediterranean hypogean Trechini d A. Faille et al.

Grebennikov, V. V. & Maddison, D. R. (2005). Phylogenetic

analysis of Trechitae (Coleoptera: Carabidae) based on larval

morphology, with a description of first-instar Phrypeus and a

key to genera. Systematic Entomology, 30, 38–59.

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence

alignment editor and analysis program for Windows

95 ⁄ 98 ⁄ NT. Nucleic Acids Symposium Series, 41, 95–98.

Hernando, C. (2002). A new cave-dwelling Trechus Clairville,

1806 from the north of the Iberian Peninsula (Coleoptera:

Carabidae: Trechinae). Heteropterus, 1, 7–11.

Huelsenbeck, J. P. & Ronquist, F. (2001). MRBAYES: Bayesian

inference of phylogenetic trees. Bioinformatics, 17, 754–755.

Jeannel, R. (1916). Deux nouveaux Trechus cavernicoles de France

et d’Espagne [Col. Carabidae]. Bulletin de la Societe

Entomologique de France, 280–283.

Jeannel, R. (1920). Notes sur les Trechini (Col. Carabidae).

Bulletin de la Societe Entomologique de France, 150–155.

Jeannel, R. (1926). Monographie des Trechinae. Morphologie

comparee et distribution geographique d’un groupe de

Coleopteres. Premiere Livraison. L’Abeille, 32, 221–550.

Jeannel, R. (1927). Monographie des Trechinae. Morphologie

comparee et distribution geographique d’un groupe de

Coleopteres. Deuxieme Livraison. L’Abeille, 33, 1–592.

Jeannel, R. (1928a). Monographie des Trechinae. Morphologie

comparee et distribution d’un groupe de Coleopteres.

Troisieme Livraison: les Trechini cavernicoles. L’Abeille, 35, 1–

808.

Jeannel, R. (1928b). Les Trechus des hautes montagnes, leur

origine et leur histoire. Contribution a L’etude du Peuplement des

Hautes Montagnes (pp. 1–13). Paris: Lechevalier Editeur.

Jeannel, R. (1937). Nouveaux Trechinae palearctiques. Bulletin de

la Societe Entomologique de France, 42, 82–88.

Jeannel, R. (1941). Faune de France. Vol. 39: Coleopteres Carabiques

I. Paris: Lechevalier.

Jeannel, R. (1943). Les Fossiles Vivants des Cavernes. Paris:

Gallimard.

Jeannel, R. (1953). Un genre nouveau de Trechini cavernicoles

des monts Cantabriques. Notes Biospeologiques, 8, 121–125.

Jeannel, R. (1955). L’Edeage. Paris: Publications du Museum

d’Histoire Naturelle No 16.

Jeannel, R. (1956). Sur un Bathysciite cavernicole nouveau de la

Sardaigne (Coleoptera Catopidae). Fragmenta Entomologica, 2,

105–114.

Jolivet, L., Augier, R., Robin, C., Suc, J. P. & Rouchy, J. M.

(2006). Lithospheric-scale geodynamic context of the Messinian

salinity crisis. Sedimentary Geology, 188, 9–33.

Juberthie, C. & Massoud, Z. (1980). Sur differents types

d’organisation sensorielle antennaire chez les coleopteres

Trechinae troglobies et description d’un type original de

recepteur chez Rakantrechus etoi. Memoires de Biospeologie, 7,

353–364.

Katoh, K. & Toh, H. (2008). Recent developments in the

MAFFT multiple sequence alignment program. Briefings in

Bioinformatics, 9, 286–298.

Katoh, K., Misawa, K., Kuma, K. & Miyata, T. (2002). MAFFT:

a novel method for rapid multiple sequence alignment based on

fast Fourier transform. Nucleic Acids Research, 30, 3059–3066.

Leys, R., Watts, C. H. S., Cooper, S. J. B. & Humphreys, W. F.

(2003). Evolution of subterranean diving beetles (Coleoptera:

294 ª 2010 The Authors d Zoologica Sc

Dytiscidae: Hydroporini, Bidessini) in the arid zone of

Australia. Evolution, 57, 2819–2834.

Lorenz, W. (2005). A Systematic List of Extant Ground Beetles

of the World (Coleoptera ‘Geadephaga’: Trachypachidae and

Carabidae incl. Paussinae, Cicindelinae, Rhysodinae), 2nd edn.

Tutzing, Germany: Lorenz Educational Pub.

Maddison, D. R., Moore, W., Baker, M. D., Ellis, T. M., Ober,

K. A., Cannone, J. J. & Gutell, R. R. (2009). Monophyly of

terrestrial adephagan beetles as indicated by three nuclear genes

(Coleoptera: Carabidae and Trachypachidae). Zoologica Scripta,

38, 43–62.

Martınez-Solano, I., Goncalves, H. A., Arntzen, J. W. & Garcıa-

Parıs, M. (2004). Phylogenetic relationships and biogeography

of midwife toads (Discoglossidae: Alytes). Journal of

Biogeography, 31, 603–618.

Mateu, J. & Escola, O. (2006). El genero Antoinella Jeannel, 1937

(Coleoptera, Carabidae, Trechinae) tres especies nuevas

de Marruecos: A. espanyoli sp. n., A. iblanensis sp. n. y A.

fadriquei sp. n. Animal Biodiversity and Conservation, 29, 117–

121.

Monteiro, A. & Pierce, N. E. (2001). Phylogeny of Bicyclus(Lepidoptera: Nymphalidae) inferred from COI, COII, and Ef-

1a gene sequences. Molecular Phylogenetics and Evolution, 18,

264–281.

Moore, B. P. (1972). A revision of the Australian Trechinae

(Coleoptera: Carabidae). Australian Journal of Zoology

Supplementary Series, 20, 1–61.

Moravec, P., Ueno, S.-I. & Belousov, I. A. (2003). Tribe

Trechini. In I. Lobl & A. Smetana (Eds) Catalogue of Palaearctic

Coleoptera, Vol. 1, Archostemata, Myxophaga, Adephaga (pp. 288–

346). Stenstrup: Apollo Books.

Ober, K. A. (2002). Phylogenetic relationships of the carabid

subfamily Harpalinae (Coleoptera) based on molecular sequence

data. Molecular Phylogenetics and Evolution, 24, 228–248.

Ortuno, V. M. (2010). Clarification of the status of Trechus comasi

Hernando (Coleoptera: Carabidae: Trechini) from the Iberian

Peninsula and its taxonomic position. The Coleopterists Bulletin,

64, 73–74.

Ortuno, V. M. & Jimenez-Valverde, A. (in press). Taxonomic

notes on Trechini and description of a new hypogean species

from the Iberian Peninsula (Coleoptera: Carabidae: Trechinae).

Annales de la Societe Entomologique de France (n.s.).Ortuno, V. M. & Toribio, M. (2006). Ecological relocation of the

palaeoendemic Iberotrechus bolivari (Jeannel): from troglobiont

to epigean (Coleoptera: Carabidae: Trechini). The Coleopterists

Bulletin, 60, 23–30.

Ortuno, V. M., Sendra, A., Montagud, S. & Teruel, S. (2004).

Systematique et biologie d’une espece paleoendemique hypogee

de la peninsule Iberique: Ildobates neboti Espanol 1966

(Coleoptera: Carabidae: Dryptinae). Annales de la SocieteEntomologique de France (n.s.), 40, 459–475.

Papadopoulou, A., Anastasiou, I. & Vogler, A. P. (2010).

Revisiting the insect mitochondrial molecular clock: the mid-

Aegean trench calibration. Molecular Biology and Evolution, 27,

1659–1672.

Pons, J., Ribera, I., Bertranpetit, J. & Balke, M. (2010).

Nucleotide substitution rates for the full set of mitochondrial

protein-coding genes in Coleoptera. Molecular Phylogenetics andEvolution, 56, 796–807.

ripta ª 2010 The Norwegian Academy of Science and Letters, 40, 3, May 2011, pp 282–295

A. Faille et al. d Phylogeny of Mediterranean hypogean Trechini

Posada, D. & Crandall, K. A. (1998). Modeltest: testing the

model of DNA substitution. Bioinformatics, 14, 817–818.

Racovitza, E. G. (1907). Essai sur les problemes biospeologiques.

Archives de Zoologie Experimentale et Generale. 6 (4eme ser.),

371–488.

Reboleira, A. S. P. S., Ortuno, V. M., Goncalves, F. & Oromı, P.

(2010). A hypogean new species of Trechus Clairville, 1806

(Coleoptera, Carabidae) from Portugal and considerations

about the T. fulvus species group. Zootaxa, 2689, 15–26.

Ribera, I., Mateu, J. & Belles, X. (2005). Phylogenetic

relationships of Dalyat mirabilis Mateu, 2002, with a revised

molecular phylogeny of ground beetles (Coleoptera, Carabidae).

Journal of Zoological Systematics and Evolutionary Research, 43,

284–296.

Ribera, I., Fresneda, J., Bucur, R., Izquierdo, A., Vogler, A. P.,

Salgado, J. M. & Cieslak, A. (2010). Ancient origin of a

Western Mediterranean radiation of subterranean beetles. BMCEvolutionary Biology, 10, 29.

Rowley, D. L., Coddington, J. A., Gates, M. W., Norrbom, A. L.,

Ochoa, R. A., Vandenberg, N. J. & Greenstone, M. H. (2007).

Vouchering DNA-barcoded specimens: test of a nondestructive

extraction protocol for terrestrial arthropods. Molecular Ecology

Notes, 7, 915–925.

Salgado, J. M. & Pelaez, C. (2004). Un nuevo Trequido

cavernıcola del carst Asturiano, Apoduvalius (Apoduvalius)anseriformis n.sp. Fragmenta Entomologica, 36, 33–41.

Schettino, A. & Turco, E. (2006). Plate kinematics of the

Western Mediterranean region during the Oligocene and Early

Miocene. Geophysical Journal International, 166, 1398–1423.

Serrano, J. (2003). Catalogo de los Carabidae (Coleoptera) de la

Penınsula Iberica. Monografıas S.E.A., 9, 1–130.

Shull, V. L., Vogler, A. P., Baker, M. D., Maddison, D. R. &

Hammond, P. M. (2001). Sequence alignment of 18S

Ribosomal RNA and the basal relationships of Adephagan

beetles: evidence for monophyly of aquatic families and the

placement of Trachypachidae. Systematic Biology, 50, 945–969.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook,

P. (1994). Evolution, weighting and phylogenetic utility of

mitochondrial gene sequences and a compilation of conserved

polymerase chain reaction primers. Annals of the EntomologicalSociety of America, 87, 651–701.

ª 2010 The Authors d Zoologica Scripta ª 2010 The Norwegian Academy of Science and Letters,

Stamatakis, A., Hoover, P. & Rougemont, J. (2008). A rapid

bootstrap algorithm for the RAxML web servers. Systematic

Biology, 57, 758–771.

Swofford, D. L. (2002) PAUP*: Phylogenetic Analysis Using

Parsimony (and Other Methods) Version 4. Sunderland, MA:

Sinauer Associates.

Uriarte, A. (2003). Historia del Clima de la Tierra. Vitoria-Gasteiz:

Servicio Central de Publicaciones del Gobierno Vasco.

Vigna Taglianti, A. (1982). Le attuali conoscenze sui Coleotteri

Carabidi cavernicoli italiani. Lavori della Societa Italiana di

Biogeografia (n.s.), 7, 339–430.

Vives i Noguera, E. (1980). Revision del genero Apoduvalius

Jeannel (Col. Trechinae). Speleon, 25, 15–21.

Zachos, J., Pagani, M., Sloan, L., Thomas, E. & Billups, K.

(2001). Trends, rhythms, and aberrations in global climate

65 Ma to present. Science, 292, 686–693.

Supporting InformationAdditional Supporting Information may be found in the

online version of this article:

Fig. S1 Relationships between the estimated age of the

nodes according to the two calibration strategies A and B

(see Table S2 and Text).

Fig. S2 Representation of the confidence intervals of

the estimation of the age of the nodes according to the

two calibration strategies (see Table S2 and Text).

Table S1 Sequenced specimens, with locality, collec-

tors, sequence accession numbers and ecology (H, hypo-

gean; E, endogean; Ep, epigean).

Table S2 Estimated parameters in the Beast run for the

two hypothesis of calibration.

Please note: Wiley-Blackwell are not responsible for the

content or functionality of any supporting materials sup-

plied by the authors. Any queries (other than missing

material) should be directed to the corresponding author

for the article.

40, 3, May 2011, pp 282–295 295

sp locality collector biology code SSU LSU cox1 rrnL tRNA-Leu nad1 cyb

Trechini

Aphaenops Bonvouloir, 1862Aphaenops Bonvouloir, 1862 (sensu stricto)Aphaenops leschenaulti Bonvouloir, 1861

Grotte de Castelmouly - Bagnères-de-Bigorre (France-65)

C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF1 FR733945 GQ293593 GQ293629 GQ293739 GQ293757 GQ293822 GQ293886

Aphaenops catalonicus Escolà & Canció, 1983

Cova des Toscllosses - Bonansa (Spain-Huesca) C. Bourdeau, P. Déliot, J. Fresneda

H MNHN-AF2 GQ293508 HM921082 GQ293674 GQ293699 GQ293756 GQ293821

Aphaenops loubensi Jeannel, 1953 Salle de la Verna - Sainte-Engrâce (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF3 FR733946 HM921083 GQ293660 GQ293863

Aphaenops cabidochei Coiffait, 1959 Salle de la Verna - Sainte-Engrâce (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF5 GQ293556 GQ293667 GQ293890

Villanueva de Aezkoa - Sierra de Abodi - P70 (Spain-Navarra)

C. Bourdeau, A. Faille, E. Quéinnec

H MNHN-AF6 GQ293520 FR733893 GQ293741 GQ293778 GQ293831

Aphaenops ochsi Gaudin, 1925 Grotte d’Ayssaguer - Larrau (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF7 HM921084 GQ293666 FR729559 FR729559 FR729559 GQ293892

Sima de Garralda - P10 (Spain-Navarra) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF8 GQ293521 GQ293601 FR733894 GQ293740 GQ293777 GQ293830

Aphaenops jeanneli (Abeille de Perrin, 1905)

Aven d’Istaurdy - Aussurucq (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF11 GQ293594 GQ293661 FR729560 FR729560 FR729560 GQ293891

Aphaenops orionis Fagniez, 1913 Mine de Larrey - Montory (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF10 FR733990 GQ293664 FR729561 FR729561 FR729561 GQ293885

Gouffre EL71 - Château-Pignon (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF9 GQ293507 GQ293592 HM921077 FR733930

Geaphaenops Cabidoche, 1966Aphaenops rhadamanthus (Linder, 1860)

Doline de la Sablère - Castet (France-64) C. Bourdeau E MNHN-AF14 GQ293677 GQ293717 GQ293776 GQ293827 GQ293895

Aven de Nabails - Arthez d'Asson (France-64) C. Bourdeau, P. Déliot, A. Faille

E MNHN-AF13 GQ293506 HM921080 FR729562 FR729562 FR729562

Aphaenops ludovici Colas & Gaudin, 1935

Grotte d’Ambielle - Arette (France-64) C. Bourdeau, P. Déliot, A. Faille

E MNHN-AF15 FR733947 GQ293550 GQ293676 GQ293716 GQ293775 GQ293828 GQ293896

Cerbaphaenops Coiffait, 1962

Aphaenops cerberus (Dieck, 1869) Grotte du Sendé - Moulis (France-09) P. Déliot, A. Faille H MNHN-AF30 FR733948 GQ293589 GQ293646 GQ293718 GQ293779 GQ293835 GQ293871

Grotte de L'Estelas - Cazavet (France-09) P. Déliot, A. Faille H MNHN-AF20 GQ293526 FR733991 FR733895 FR729563 FR729563 FR729563

Aphaenops jauzioni Faille, Déliot & Quéinnec, 2007

Grotte d’Artigouli - Estadens (France-31) P. Déliot, A. Faille H MNHN-AF33 GQ293581 GQ293640 FR729564 FR729564 FR729564 GQ293877

Aphaenops carrerei Coiffait, 1953 Gouffre du Trapech d’en Haut - Bordes-sur-Lez (France-09)

C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF34 GQ293512 GQ293572 GQ293641

Aphaenops michaeli Fourès, 1954 Grotte de Noël - Seix (France-09) A. Faille H MNHN-AF35 GQ293515 GQ293585 FR733896 GQ293722 GQ293768 GQ293815

Aphaenops delbreili Genest, 1983 Gouffre du Petit Mirabat - Ercé (France-09) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF37 GQ293513 GQ293570 GQ293638 GQ293720 GQ293773 GQ293804 FR733931

Aphaenops bonneti Fourès, 1948 Trou du Rantou - Suc-et-Sentenac (France-09) P. Déliot, A. Faille H MNHN-AF38 GQ293571 FR733897 GQ293721 GQ293774 GQ293805

Aphaenops hustachei Jeannel, 1916 Grotte de l'Eglise - Nistos (France-65) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF39 GQ293514 GQ293573 GQ293636 GQ293711 GQ293751 GQ293844

Aphaenops sp. Grotte de Frechet-Aure - Frechet-Aure (France-65) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF134 FR733992 GQ293643 FR729565 FR729565 FR729565

Aphaenops sp. Grotte de la Cascade - Sarrancolin (France-65) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF135 FR733949 GQ293576 GQ293635 GQ293710 GQ293749 GQ293842 GQ293883

Aphaenops sp. Tuto de la Cigalero - Ferrère (France-65) P. Déliot, A. Faille H MNHN-AF42 FR733950 GQ293583 GQ293637 GQ293696 GQ293752 GQ293843 GQ293884

Aphaenops vandeli Fourès, 1954 Grotte de Payssa - Salsein (France-09) P. Déliot, A. Faille H MNHN-AF44 FR733951 GQ293584 GQ293657 GQ293706 GQ293762 GQ293808 GQ293869

Aphaenops vandeli bouiganensis Fourès, 1954

Grotte de L'Ournas - Saint-Lary (France-09) P. Déliot, A. Faille H MNHN-AF46 GQ293510 GQ293590 GQ293654 FR729566 FR729566 FR729566

Aphaenops crypticola (Linder, 1859) Gouffre de Peyreigne - Tibiran-Jaunac (France-65) P. Déliot, A. Faille H MNHN-AF51 GQ293580 GQ293642

Grotte d’Aron - Portet d’Aspet (France-31) P. Déliot, A. Faille H MNHN-AF52 GQ293591 GQ293651 FR729567 FR729567 FR729567 GQ293855

Grotte de Gouillou - Aspet (France-31) P. Déliot, A. Faille H MNHN-AF47 FR733952 GQ293577 GQ293671 GQ293709 GQ293765 GQ293812 GQ293866

Grotte de Terreblanque - Aspet (France-31) P. Déliot, A. Faille H MNHN-AF50 GQ293579 GQ293650 GQ293858

Grotte de l’Haiouat de Pelou - Nistos (France-65) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF48 GQ293578 GQ293655 GQ293859

Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) P. Déliot, A. Faille H MNHN-AF49 FR733993 GQ293653 GQ293708 GQ293764 GQ293811 GQ293868

Aphaenops parallelus Coiffait, 1954 Grotte de la Buhadère - Coulédoux (France-31) P. Déliot, A. Faille H MNHN-AF53 GQ293582 GQ293652 GQ293707 GQ293763 GQ293810 GQ293865

Aphaenops sioberae Fourès, 1954 Grotte de Payssa - Salsein (France-09) P. Déliot, A. Faille H MNHN-AF54 GQ293516 GQ293587 GQ293639 FR729568 FR729568 FR729568

Aphaenops bouilloni Coiffait, 1955 Grotte de Pétillac - Bordes-sur-Lez (France-09) P. Déliot, A. Faille H MNHN-AF56 GQ293575 GQ293644 GQ293870

Aphaenops sp. Grotte d'Aulignac - Bordes-sur-Lez (France-09) A. Faille H MNHN-AF133 GQ293509 GQ293586 GQ293645 GQ293694 GQ293758 GQ293806 GQ293888

Aphaenops mariaerosae Genest, 1983 Gouffre du Trapech d’en Haut - Bordes-sur-Lez (France-09)

C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF57 FR733953 GQ293568 GQ293649 GQ293704 GQ293760 GQ293809 GQ293860

Aphaenops chappuisi Coiffait, 1955 Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) P. Déliot, A. Faille H MNHN-AF61 GQ293525 GQ293563 GQ293684 FR729569 FR729569 FR729569

Arachnaphaenops Jeanne, 1967

Aphaenops pluto (Dieck, 1869) Grotte du Sendé - Moulis (France-09) P. Déliot, A. Faille H MNHN-AF58 FR733954 GQ293567 GQ293647 GQ293864

Aphaenops tiresias (Piochard de La Brûlerie, 1872)

Gouffre de la Peyrère - Balaguères (France-09) A. Faille H MNHN-AF59 GQ293527 GQ293596 GQ293658 GQ293713 GQ293748 GQ293800

Grotte du Goueil-di-Her - Arbas (France-31) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF60 FR733994 FR733898 FR729570 FR729570 FR729570 GQ293889

Aphaenops alberti Jeannel, 1939 Aven prox. Istaurdy - Aussurucq (France-64) C. Bourdeau H MNHN-AF12 FR733955 GQ293595 GQ293662 GQ293700 GQ293782 GQ293829 GQ293853

Cephalaphaenops Coiffait, 1962

Aphaenops bucephalus (Dieck, 1869) Gouffre de la Peyrère - Balaguères (France-09) A. Faille H MNHN-AF62 GQ293511 GQ293588 GQ293675 GQ293693 GQ293747 GQ293814 GQ293876

Pubaphaenops Genest, 1983

Aphaenops laurenti Genest, 1983 Grotte de Bordes de Crues - Seix (France-09) A. Faille H MNHN-AF63 FR733956 GQ293569 GQ293634 GQ293719 GQ293767 GQ293813 GQ293873

Hydraphaenops Jeannel, 1926Hydraphaenops ehlersi (Abeille de Perrin, 1872)

Goueil-di-Her - Arbas (France-31) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF64 FR733957 GQ293565 GQ293683 FR729571 FR729571 FR729571 GQ293875

Hydraphaenops vasconicus (Jeannel, 1913)

Aven d’Istaurdy - Aussurucq (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF65 GQ293530 GQ293622 GQ293628 GQ293698 GQ293759 GQ293803 FR733932

Hydraphaenops vasconicus delicatulus Coiffait, 1962

Salle de la Verna - Sainte-Engrâce (France-64) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF66 FR733958 GQ293600 GQ293663 GQ293695 GQ293753 GQ293818 GQ293872

Hydraphaenops galani Español, 1968 Guardetxe Koleccia - Usurbil (Spain-Guipuzcoa) C. Bourdeau H MNHN-AF67 GQ293524 GQ293602 FR733899 GQ293697 GQ293746 GQ293817

Hydraphaenops bourgoini (Jeannel, 1945)

Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) P. Déliot, A. Faille H MNHN-AF69 FR733959 GQ293553 GQ293672 GQ293734 GQ293755 GQ293824 GQ293894

Grotte de l'Eglise - Nistos (France-65) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF68 FR733960 GQ293552 GQ293659 GQ293733 GQ293772 GQ293826 GQ293851

Hydraphaenops pandellei (Linder, 1859) Grotte d’Arréglade - Rébénacq (France-64) C. Bourdeau H MNHN-AF70 FR733961 GQ293545 GQ293681 GQ293880

Grotte d' Ambielle - Arette (France-64) C. Bourdeau, A. Faille H MNHN-AF71 FR733962 GQ293546

Hydraphaenops pecoudi (Gaudin, 1938)

Gouffre du Barroti - Lacourt (France-09) A. Faille H MNHN-AF72 FR733963 GQ293566 GQ293673 GQ293738 GQ293878

Hydraphaenops elegans Gaudin, 1945 Subterranean river of Artigaléou-Arodets - Esparros (France-65)

C. Bourdeau, E. Ollivier, E. Quéinnec

H MNHN-AF120 FR733964 GQ293562 FR733900 GQ293703 GQ293754 GQ293816

Hydraphaenops penacollaradensis Dupré, 1991

Aven El Sinistro, Villanúa (Spain-Huesca) C. Bourdeau, E. Ollivier H MNHN-AF121 FR733965 GQ293564 GQ293702 GQ293771 GQ293823

Geotrechus Jeannel, 1919Geotrechus Jeannel, 1919 (sensu stricto)Geotrechus discontignyi (Fairmaire, 1863)

Grotte du Tuco - Bagnères-de-Bigorre (France-65) C. Bourdeau, P. Déliot, A. Faille

E/H MNHN-AF92 FR733966 GQ293560 FR733901 FR729572 FR729572 FR729572 GQ293893

Geotrechus orcinus (Linder, 1859) Gouffre de Peyreigne - Tibiran (France-65) C. Bourdeau, P. Déliot, A. Faille

E/H MNHN-AF85 GQ293519 GQ293559 FR733902 GQ293744 GQ293789 GQ293802

Geotrechus orpheus (Dieck, 1869) Grotte de la Quère - Mérigon (France-09) P. Déliot, A. Faille E/H MNHN-AF81 GQ293528 GQ293597 GQ293665 FR729573 FR729573 FR729573 GQ293874

Grotte de Montespan - Ganties (France-31) P. Déliot, A. Faille E/H MNHN-AF79 FR733967 FR733995 FR733903 GQ293723 GQ293780 GQ293834

Geotrechus trophonius (Abeille de Perrin, 1872)

Grotte de Tuto Heredo - Merigon (France-09) A. Faille E/H MNHN-AF83 FR733968 GQ293561 GQ293631 GQ293715 GQ293766 GQ293825 GQ293852

Geotrechidius Jeannel, 1947

Geotrechus gallicus (Delarouzee, 1857) Aven de Nabails - Arthez d'Asson (France-64) C. Bourdeau, P. Déliot, A. Faille

E MNHN-AF76 GQ293518 GQ293557 GQ293670 GQ293724 GQ293769 GQ293798 FR733933

Geotrechus jeanneli Gaudin, 1938 Grotte de la Bouhadère - Saint-Pé-de-Bigorre (France-65)

C. Bourdeau, P. Déliot, A. Faille

E MNHN-AF77 GQ293517 GQ293558 FR733904 GQ293725 GQ293770 GQ293799

Geotrechus saulcyi (Argod-Vallon, 1913)

Gouffre du Barroti - Lacourt (France-09) A. Faille E/H MNHN-AF86 FR733969 GQ293668 FR729574 FR729574 FR729574 GQ293887

Geotrechus seijasi Español, 1969 Cova d'en Manent - Isòvol (Spain-Girona) P. Déliot, A. Faille E/H MNHN-AF89 GQ293529 GQ293598 FR733905 GQ293854

Geotrechus vandeli Coiffait, 1959 Aven d'Anglade - Couflens (France-09) P. Déliot, A. Faille E MNHN-AF88 GQ293523 GQ293549 FR733906 GQ293714 GQ293784 GQ293833

Geotrechus vulcanus (Abeille de Perrin, 1904)

Perte du Fustié - Saint-Martin-de-Caralp (France-09)

C. Bourdeau, A. Faille E/H MNHN-AF91 FR733970 GQ293599 FR733907 GQ293701 GQ293786 GQ293832

Trechus Clairville, 1806

Trechus distigma Kiesenwetter, 1851 Aven de Nabails - Arthez d'Asson (France-64) C. Bourdeau, P. Déliot, A. Faille

Ep MNHN-AF94 FR733971 GQ293611 GQ293678 FR729575 FR729575 FR729575 GQ293879

Trechus quadristriatus (Schrank, 1781) Collau de la Plana del Turbón - Egea (Spain-Huesca)

P. Déliot, A. Faille, J. Fresneda

Ep MNHN-AF96 GQ293534 GQ293619 FR733908 GQ293743 GQ293745 GQ293841

Trechus barnevillei Pandellé, 1867 Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria)

C. Bourdeau, P. Déliot, A. Faille

Ep/H MNHN-AF97 GQ293533 GQ293607 GQ293680 GQ293727 GQ293783 GQ293848

Trechus fulvus Dejean, 1831 Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria)

C. Bourdeau, P. Déliot, A. Faille

Ep/H MNHN-AF98 FR733972 GQ293613 FR733909 GQ293729

Trechus martinezi Jeannel, 1927 Cova de les Meravelles - Cocentaina (Spain-Alicante)

C. Andújar, P. Arribas, A. Faille

H IBE-AF1 FR733973 FR733996 FR729576 FR729576 FR729576

Trechus saxicola Putzeys, 1870 Braña Caballo - Piedrafita (Spain-León) C. Bourdeau, P. Déliot, A. Faille

Ep MNHN-AF100 FR733974 GQ293614 GQ293682 FR729577 FR729577 FR729577 GQ293882

Trechus aff. schaufussi Putzeys, 1870 Ciudad Real-Navas de Estena-"El Boqueron" (Spain-Toledo)

A. Faille E/H MNHN-AF101 GQ293532 GQ293620 FR733910 GQ293737 GQ293788 GQ293820 FR733934

Trechus grenieri uhagoni Crotch, 1869 Cueva de Orobe - Alsasúa (Spain-Navarra) C. Bourdeau H MNHN-AF102 GQ293540 GQ293616 FR733911 GQ293730

Trechus navaricus (Vuillefroy, 1869) Grotte de Sare - Sare (France-64) C. Bourdeau H MNHN-AF103 GQ293539 GQ293603 GQ293687 FR729578 FR729578 FR729578 FR733935

Trechus escalerae Abeille de Perrin, 1903

Cueva de Porro Covañona - Covadonga (Spain-Asturias)

J.M. Salgado H MNHN-AF104 GQ293538 GQ293612 FR733912 GQ293731 GQ293793 GQ293839

Trechus obtusus Erichson, 1837 Saint-Pé-de-Bigorre (France-65) C. Bourdeau, A. Faille Ep MNHN-AF126 FR733975 GQ293608 GQ293726 GQ293795 GQ293847

Trechus obtusus Erichson, 1837 Estrada de Nicho (Portugal-Madeira) A. Arraiol Ep IBE-AF2 FR733976 FR733997 FR733913 FR729579 FR729579 FR729579

Trechus comasi Hernando, 2002 Cueva Basaura - Barindano (Spain-Navarra) J. Fresneda H MNHN-AF127 FR733977 GQ293617 FR729580 FR729580 FR729580 FR733936

Trechus ceballosi Mateu, 1953 Aven de Licie Etsaut - Lanne-en Barétous (France-64)

C. Bourdeau, A. Faille Ep MNHN-AF128 FR733978 GQ293610 FR733914 GQ293728 GQ293791 GQ293850

Apoduvalius Jeannel, 1953

Apoduvalius alberichae Español, 1971 Cueva de Agudir - Cardano de abajo - Palencia (Spain-Asturias)

J.M. Salgado H MNHN-AF105 GQ293536 GQ293618 GQ293632 GQ293732 GQ293794 GQ293840

Apoduvalius anseriformis Salgado et Peláez, 2004

Cueva de Entrecuevas - Caravia Alta (Spain-Palencia)

A. Cieslak, A. Faille, J. Fresneda, I. Ribera, J.M. Salgado

H MNCN-AF1 FR733998 FR733915 FR729581 FR729581 FR729581 FR733937

Apoduvalius anseriformis Salgado et Peláez, 2004

Cueva del Perro - Ludeña (Infiesto) (Spain-Asturias)

A. Cieslak, A. Faille, J. Fresneda, I. Ribera, J.M. Salgado

H MNCN-AF2 FR733979 FR733999 FR733916 FR729582 FR729582 FR729582 FR733938

Apoduvalius sp. Cueva Requexada - Piloñeta (Spain-Asturias) J.M. Salgado H MNHN-AF106 GQ293537 GQ293609 GQ293736 GQ293796 GQ293846

Antoinella Jeannel, 1937

Antoinella gigoni Casale, 1982 Trou de la piste - Tahla (Morocco) H. Mansouri, F. Fadrique, J. Comas & F. Alfambra

H IBE-AF3 FR733980 FR734000 FR733917 FR729583 FR729583 FR729583 FR733939

Speotrechus Jeannel, 1922Speotrechus mayeti (Abeille de Perrin, 1875)

Perte du Rimouren - Saint-Montant (France-07) J-Y. Bigot H MNHN-AF107 GQ293535 GQ293547 FR733918 FR729584 FR729584 FR729584 GQ293881

Sardaphaenops Cerruti & Henrot, 1956Sardaphaenops supramontanus supramontanus Cerruti & Henrot, 1956

Sa. (NU) Mandara E`Suru Manna - Urzulei P. Marcia H MNCN-AF3 FR733981 FR734001 FR733919 FR729585 FR729585 FR729585

Sardaphaenops supramontanus grafittii Casale & Giachino, 1988

Sa. (NU) Baunei g. Voragine Tesulali P. Marcia, C. Onnis H MNCN-AF4 FR733982 FR734002 FR733920 FR729586 FR729586 FR729586 FR733940

Sardaphaenops adelphus Casale, 2004 Sa. (NU) Baunei g. Voragine Tesulali P. Marcia, C. Onnis H MNCN-AF5 FR733983 FR734003 FR733921 FR733941

Paraphaenops Jeannel, 1916Paraphaenops breuilianus (Jeannel, 1916)

Cova Cambra - Tortosa (Spain-Tarragona) C. Bourdeau, P. Déliot, A. Faille

H MNHN-AF108 GQ293541 GQ293551 GQ293685 FR729587 FR729587 FR729587 FR733942

Iberotrechus Jeannel, 1920

Iberotrechus bolivari (Jeannel, 1913) Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria)

C. Bourdeau, P. Déliot, A. Faille

Ep/H MNHN-AF111 FR733984 GQ293615 GQ293679 GQ293735 GQ293781 GQ293819 GQ293861

Duvalius Delarouzée, 1859

Duvalius berthae (Jeannel, 1910) Cova d’en Xoles - Pratdip (Spain-Tarragona) C. Bourdeau, P. Déliot, F. Fadrique, A. Faille

H MNHN-AF115 GQ293606 GQ293626 FR729588 FR729588 FR729588 GQ293857

Cova Massega - Llaberia (Spain-Tarragona) C. Bourdeau, P. Déliot, F. Fadrique, A. Faille

H MNHN-AF114 GQ293531 FR734004 FR733922

Duvalius convexicollis Peyerimhoff, 1904

Faille du Pensier - Saint-Auban (France-06) J.M. Lemaire E/H IBE-AF4 FR734005 FR733923 FR729589 FR729589 FR729589

Trichaphaenops Jeannel, 1916

Trichaphaenops gounellei (Bedel, 1879) Baume Cervière - Vassieux-en-Vercors (France-26)

A. Faille H MNCN-AF6 FR733985 FR734006 FR733924 FR729590 FR729590 FR729590

Agostinia Jeannel, 1928

Agostinia gaudini (Jeannel, 1952) Puits des Bauges - Dévoluy (France-05) J-Y. Bigot H MNHN-AF116 GQ293543 GQ293604 FR733925 GQ293692 GQ293787 GQ293838

Doderotrechus Vigna Taglianti, 1968Doderotrechus crissolensis Dodero, 1924

Miniera Gianfranco - Prali (Italy-Piemonte) A. Casale H IBE-AF5 FR733986 FR733926 FR729591 FR729591 FR729591

Doderotrechus ghilianii Fairmaire, 1859 Miniera Gianna - Prali (Italy-Piemonte) A. Casale H IBE-AF6 FR733987 FR734007 FR733927 FR729592 FR729592 FR729592 FR733943

Aepopsis Jeannel, 1922

Aepopsis robini (Laboulbène, 1849) Plage du Toëno - Trébeurden (France-22) A. Faille Ep MNHN-AF112 GQ293504 GQ293623 FR733928 GQ293689 GQ293792 GQ293836

Perileptus Schaum, 1860

Perileptus areolatus (Creutzer, 1799) Immouzer des Ida Outanane (Maroc) P. Aguilera, C. Hernando, I. Ribera

Ep MNHN-AF113 GQ293503 GQ293625 GQ293688 FR729593 FR729593 FR729593 FR733944

Thalassophilus Wollaston, 1854Thalassophilus longicornis (Sturm, 1825)

Beost (France-64) C. Bourdeau, A. Faille, J. Fresneda

Ep IBE-AF7 FR734008 FR733929

Bembidiini

Philochthus Stephens, 1828

Philochthus lunulatus (Fourcroy, 1795) Guadalajara - El Pobo de Dueñas (Spain-Guadalajara)

A. Cieslak, I. Ribera Ep MNHN-AF118 GQ293505 FR734009 GQ293686 GQ293690 GQ293797 GQ293801

Typhlocharis Dieck, 1869

Typhlocharis sp. Santa Almagrera (Spain-Almería) C. Andujar E MNHN-AF119 GQ293502 GQ293624 GQ293633 FR729594 FR729594 FR729594

Porotachys Netolitzky, 1914

Porotachys bisulcatus (Nicolaï, 1822) Grotte des Fées - Saint-Cricq-du-Gave (France-40)

C. Bourdeau, A. Faille Ep/H MNHN-AF131 FR733988 GQ293544 GQ293742 GQ293790 GQ293849

Patrobini

Penetretus Motschoulsky, 1850

Penetretus temporalis Bedel, 1909 Ifri Ouled-Ayach - Taza (Morocco) F. Alfambra, H. Mansouri Ep IBE-AF8 FR733989 FR734010 FR729595 FR729595 FR729595

Phylogenetic relationships of Western Mediterranean subterranean Trechini groundbeetles (Coleoptera: Carabidae)Arnaud Faille*, Achille Casale & Ignacio Ribera

Supplementary material

Table S2Parametres of the Beast run using two calibration strategies: A) fixing an a-priori rate of 0.0115 substitutions/MYdating the separation between Sardaphaenops and the mainland sister taxa (node "Trechus s.l.") at 33 MY and B) dating the separation between Sardaphaenops and the mainland sister taxa (node "Trechus s.l.") at 33 MY (see Text)

A: 2.3% /MY B: 33MY A: 2.3% /MY B: 33MY A: 2.3% /MY B: 33MY A: 2.3% /MY B: 33MY A: 2.3% /MY B: 33MYSummary Statistic mean mean 95% HPD lower95% HPD lower95% HPD upper95% HPD uppermedian median effective sample size (ESS)effective sample size (ESS)posterior -1.56E+04 -1.57E+04 -1.56E+04 -1.57E+04 -1.56E+04 -1.57E+04 -1.56E+04 -1.57E+04 5742.859 764.835prior -190.626 -265.611 -200.056 -277.432 -181.195 -254.232 -190.585 -265.557 1421.321 280.103likelihood -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 8970.426 4746.276meanRate 1.15E-02 5.01E-03 1.13E-02 4.07E-03 1.17E-02 6.01E-03 1.15E-02 4.98E-03 3.52E+04 403.88treeModel.rootHeight 16.287 37.91 13.483 32.733 19.225 43.964 16.213 37.421 1640.001 572.098pyr-duva 14.59 34.061 11.771 26.76 17.458 41.938 14.529 33.768 1447.101 472.714trechus s.l. 14.208 32.982 11.46 32.046 17.025 34.003 14.141 32.98 1494.119 1.78E+04duvalius s.l. 13.797 32.24 10.922 25.097 16.735 40.632 13.741 31.915 1371.082 490.548trechus 11.88 27.629 9.528 23.321 14.441 31.395 11.815 27.826 1747.76 1167.154trechus s.str. 10.643 24.829 8.436 20.529 12.866 29.055 10.59 24.897 1626.898 847.929pyr 9.812 22.71 8.138 17.953 11.62 27.921 9.759 22.563 992.785 284.418pyr1 9.131 21.144 7.621 16.754 10.721 25.798 9.085 20.988 924.447 257.095pyr2 8.722 20.208 7.36 16.134 10.196 24.59 8.682 20.075 830.06 237.823pyrE 8.3 19.233 6.865 15.124 9.762 23.656 8.261 19.108 957.059 255.028pyrW 8.262 19.147 6.913 15.049 9.675 23.202 8.225 19.034 860.604 233.2764striat 8.231 19.281 6.092 14.384 10.404 23.945 8.173 19.254 1801.785 898.02aphaW 7.772 17.993 6.443 14.145 9.139 22.068 7.738 17.885 945.336 243.767apod 7.271 16.894 5.014 11.748 9.598 22.574 7.198 16.739 2465.534 848.789geo 7.244 16.797 5.6 12.391 8.867 21.15 7.237 16.742 1670.572 350.656aphaE_H 7.174 16.607 5.81 12.695 8.596 20.517 7.14 16.509 1289.117 309.144aphaW_R 6.73 15.579 5.464 11.963 8.034 19.236 6.71 15.496 1209.556 245.601aphaE 5.418 12.521 4.204 9.082 6.628 15.815 5.376 12.436 1743.5 398.841apo2 5.082 11.801 3.508 7.845 6.751 15.915 5.022 11.667 1557.576 522.706fulvus 4.43 10.307 2.776 6.363 6.216 14.567 4.359 10.142 3841.759 1410.038duvalius 4.122 9.638 2.523 5.744 5.807 13.801 4.056 9.425 2596.27 923.936apo2alb 3.832 8.894 2.435 5.485 5.318 12.509 3.779 8.752 1960.078 653.899agost 1.909 4.447 0.833 1.93 3.122 7.566 1.824 4.243 4477.702 1408.163yule.birthRate 0.202 8.73E-02 0.153 6.50E-02 0.254 0.111 0.201 8.67E-02 5436.734 797.448gtr.ac 7.77E-02 7.79E-02 4.70E-02 4.81E-02 0.109 0.11 7.69E-02 7.71E-02 1.72E+04 8252.105gtr.ag 1.002 0.988 0.699 0.675 1.355 1.337 0.985 0.967 1712.905 1003.794gtr.at 0.137 0.135 9.87E-02 9.63E-02 0.18 0.179 0.135 0.132 1225.821 735.373gtr.cg 0.275 0.274 0.132 0.134 0.425 0.423 0.268 0.268 1.11E+04 5122.294gtr.gt 7.95E-02 7.84E-02 4.66E-02 4.56E-02 0.118 0.117 7.77E-02 7.63E-02 3279.329 1812.593siteModel.alpha 0.621 0.62 0.527 0.528 0.717 0.714 0.622 0.621 9778.217 5819.451siteModel.pInv 0.549 0.549 0.512 0.513 0.584 0.585 0.55 0.549 5346.974 5320.876ucld.mean 1.17E-02 5.09E-03 1.11E-02 4.04E-03 1.23E-02 6.15E-03 1.17E-02 5.06E-03 2853.047 367.252ucld.stdev 0.366 0.362 0.268 0.264 0.469 0.466 0.364 0.359 2109.936 1563.749coefficientOfVariation 0.36 0.357 0.26 0.258 0.463 0.463 0.358 0.353 2094.378 1560.981covariance 1.96E-02 1.75E-02 -0.136 -0.142 0.172 0.166 1.90E-02 1.60E-02 1.15E+04 5836.173treeLikelihood -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 -1.54E+04 8970.426 4746.276speciation -206.898 -273.414 -216.061 -284.819 -196.924 -261.843 -206.858 -273.377 1378.172 276.097

Figure S1Relationships between the estimated age of the nodes according to the two calibration strategies A and B (see Table S2 and Text)

Figure S2Representation of the confidence intervals of the estimation of the age of the nodes according to the two calibration strategies (see Table S2 and Text)

0  

5  

10  

15  

20  

25  

30  

35  

40  

45  

50  

treeModel.rootH

eight  

pyr-­‐duva  

trechus  s.l.  

duvalius  s.l.  

trechus  

trechus  s.str.  

pyr  

pyr1  

pyr2  

pyrE  

pyrW  

4striat  

aphaW  

apod  

geo  

aphaE_H  

aphaW_R  

aphaE  

apo2  

fulvus  

duvalius  

apo2alb  

agost  

R²  =  0.9999  

0  

5  

10  

15  

20  

25  

30  

35  

40  

0   2   4   6   8   10   12   14   16