Upload
lydang
View
219
Download
0
Embed Size (px)
Citation preview
Transcriptional Regulation of Mortalin and the Hexosamine Biosynthetic
Pathway by the Orphan Nuclear Receptor ERRα
Guillaume Sylvain‐Drolet
Department of Biochemistry
McGill University
Montréal, Québec, Canada
August 2010
A thesis submitted to the Faculty of Graduate Studies and Research in partial
fulfilment of the requirements for the degree Master of Science
@ Guillaume SylvainDrolet, 2010
2
ABSTRACT
The orphan nuclear receptor estrogen‐related receptor α (ERRα, NR3B1) plays a
major role in transcription regulation of metabolic genes. Its role in glycolysis
regulation is well known. However, we ignore yet if it could be implicated in a
signaling pathway connected to glycolysis, the Hexosamine Biosynthetic Pathway
(HBP). The HBP is an important energy and nutrient‐sensing pathway, which
modulates O‐linked N‐acetylglucosamine (O‐GlcNAc) post‐translational
modification. We demonstrate here that ERRα is involved in transcriptional
regulation of HBP genes. ERRα can be localized to promoters of several HBP genes,
such as Ogt and Oga. Both encode two enzymes that directly modulate the O‐GlcNAc
cycling. Moreover, ERRα activates HBP genes transcription in collaboration with its
coactivator PGC‐1α. In ERRα‐null mice, the HBP genes expression is downregulated.
However, we can observe more O‐GlcNAcylated proteins in absence of ERRα. This
was demonstrated more specifically on the mitochondrial chaperone Mortalin.
Mortalin is encoded by Hspa9, and we show that this gene is an ERRα target.
Moreover, Mortalin is much more O‐GlcNAcylated in absence of the ERRα. This
suggests that in addition to Mortalin transcriptional regulation, ERRα is involved in
Mortalin post‐translational modification through regulation of the HBP.
3
RÉSUMÉ
Le récepteur nucléaire orphelin relié à l’estrogène (ERRα, NR3Β1) joue un rôle
majeur dans la régulation de gènes métaboliques. Son rôle dans la régulation de la
glycolyse est très bien connu. Cependant, nous ignorons encore s’il pourrait être
impliqué dans la régulation d’une voie de signalisation directement liée à la
glycolyse, la voie de signalisation des hexosamines (HBP). La HBP est une
importante voie de signalisation servant de détecteur d’énergie et de nutriments et
régulant la modification post‐traductionelle O‐lié N‐acétylglucosamine (O‐GlcNAc).
Nous démontrons qu’ERRα est impliqué dans la régulation des gènes de HBP. ERRα
se lie aux promoteurs de plusieurs gènes de HBP, comme Ogt et Oga, codant pour
deux enzymes qui régulent directement le cycle des O‐GlcNAc. De plus, ERRα active
la transcription des gènes de HBP en collaboration avec son coactivateur PGC‐1α.
Dans les souris déficientes pour le gène ERRα, l’expression des gènes de HBP se
trouve réduite. Cependant, nous pouvons observer plus de protéines O‐GlcNAcylées
en absence d’ERRα. Ceci a été démontré plus spécifiquement sur la chaperone
mitochondriale Mortalin. Mortalin est codée par le gène Hspa9 et nous démontrons
que ce gène est une cible d’ERRα. De plus, Mortalin est beaucoup plus O‐GlcNAcylée
en absence d’ERRα. Ceci suggère qu’en plus de réguler la transcription de Mortalin,
ERRα est impliqué dans la régulation des modifications post‐traductionelles de
Mortalin, en régulant la voie de signalisation des hexosamines.
4
PREFACE – CONTRIBUTION OF AUTHORS
The writing of this thesis is entirely my own with corrections and editorial
comments by Dr. Vincent Giguère. The work and research presented in this thesis is
also entirely my own with the following exceptions. The ERRα ChIP‐on‐chip and
standard ChIP were optimized and conducted by Catherine Rosa Dufour.
5
ACKNOWLEDGEMENTS
I would like to thank my supervisor, Dr. Vincent Giguère, for giving me the
opportunity to work in his laboratory and for the really stimulating project he
offered me.
I also thank all the present and past lab members. A special thank to Annie
Tremblay, who was really helpful at the beginnig of my Master. Thank to Majid
Ghahremani, for hockey conversations and all the work done in lab management. I
appreciated the help I received from Catherine Rosa Dufour. I am grateful to Carlo
Ouellet for his work with mice. I would like to sincerely thank Geneviève Deblois,
MariePier Levasseur and MarieClaude Perry, who offered me great support, I
appreciated their help and all the discussions we had. Finaly, thank to Lillian
Eichner, Xing Xing Liu, Aymen Shatnawi and Xinhao Zhao, for conversations and
scientific criticisms.
Je veux aussi remercier sincèrement mes parents qui m’ont encouragé tout au long
de mon parcours universitaire, sans leur aide et leur support, je n’aurais pas atteint
le même niveau. Un gros merci à ma fiancée, Valérie De Rop, qui a été d’un grand
support et m’a beaucoup aidé lors de ma maîtrise. Je remercie aussi tous mes
ami(e)s qui m’ont permis de déstresser un peu et de partager mes hauts et mes bas.
6
TABLE OF CONTENTS
ABSTRACT ................................................................................................................................... 2
RÉSUMÉ ........................................................................................................................................ 3
PREFACECONTRIBUTION OF AUTHORS .......................................................................... 4
ACKNOWLEDGEMENTS........................................................................................................... 5
TABLE OF CONTENTS............................................................................................................... 6
LIST OF FIGURES ....................................................................................................................... 8
ABBREVIATIONS ....................................................................................................................... 9
CHAPTER 1 LITTERATURE REVIEW................................................................................11
1.1 NUCLEAR RECEPTORS ................................................................................................... 11
1.1.1 Structure............................................................................................................. 11
1.1.2 Mechanism of action...................................................................................... 12
1.1.3 Subfamilies ........................................................................................................ 13
1.2 ESTROGEN‐RELATED RECEPTOR ISOFORMS...................................................... 14
1.2.1 ERRα action....................................................................................................... 14
1.2.2 ERRα coregulators ......................................................................................... 16
1.2.2.1 PGC‐1α ................................................................................................. 17
1.2.3 ERRα targets..................................................................................................... 18
1.2.4 ERRα functions ................................................................................................ 19
1.3 HEXOSAMINE BIOSYNTHETIC PATHWAY............................................................. 20
1.3.1 O‐GlcNAc Post‐Translational Modification.......................................... 21
1.3.2 Ogt enzyme........................................................................................................ 23
1.3.3 Ogt interacting proteins............................................................................... 24
1.3.4 Ogt and physiological functions ............................................................... 25
1.4 MORTALIN ........................................................................................................................... 26
1.4.1 Mortalin mitochondrial functions ........................................................... 27
1.4.2 Mortalin and cell proliferation.................................................................. 27
1.4.3 Mortalin and physiological dysfunctions ............................................. 28
7
GOAL OF THE STUDY..............................................................................................................30
CHAPTER II MANUSCRIPT .................................................................................................31
INTRODUCTION.......................................................................................................................32
MATERIELS AND METHODS ................................................................................................34
RESULTS.....................................................................................................................................40
Identification of HBP genes targeted by ERRα in livers.......................................... 40
Transcriptional regulation of Mgea5, Ogt and Uap1 by ERRα ............................. 41
Expression of HBP genes in liver, in presence or absence of ERRα ................... 44
ERRα affects proteins O‐GlcNAcylation ......................................................................... 45
Mortalin is more O‐GlcNAcylated in absence of ERRα............................................. 47
Mortalin is an ERRα target ................................................................................................... 49
DISCUSSION...............................................................................................................................51
CONCLUSION.............................................................................................................................56
REFERENCES .............................................................................................................................57
8
LIST OF FIGURES
Figure I. Nuclear Receptor Structure.............................................................................................. 12
Figure 1. ERRα localization on HBP gene by ChIP‐on chip and standard ChIP
validation in mouse livers ................................................................................................................... 41
Figure 2. ERRα and PGC‐1α enhance transcription of Uap1, Mgea5 and Ogt............... 43
Figure 3. HBP RNA quantification in ERRα‐null mice ............................................................. 45
Figure 4. Evaluation of HBP activity by O‐GlcNAcylated proteins..................................... 47
Figure 5. Mortalin O‐GlcNAcylation validation .......................................................................... 49
Figure 6. ERRα is involved in Mortalin transcription regulation....................................... 50
9
ABBREVIATIONS
ACTR activator of thyroid and retinoic acid receptors
AIB1 amplified in breast cancer‐1
CaMKIV calcium/calmodulin‐dependant protein kinase IV
CARM1 Coactivator‐associated arginine methyltransferase 1
ChIP chromatin immunoprecipication
ChIP‐on‐chip Hybridization of chromatin immunoprecipication on a chip
CRTC2 CREB regulated transcription coactivator 2
CTD C‐terminal domain
DBD DNA‐binding domain
EMSA electrophoretic mobility shift assay
ER estrogen receptor
ERR estrogen‐related receptor
ERRE ERR response element
FAO fatty acid oxidation
GABPA GA repeat‐binding protein α
Gfat L‐glutamine:D‐fructose‐6‐phosphate amidotransferase
GR Glucocorticoid receptor
GRIP1 glucocorticoid receptor interacting protein‐1
GRP75 glucose‐related protein 75
HBP Hexosamine biosynthetic pathway
HDAC histone deacetylase
HRE hormone response elements
HSP heat shock proteins
IFN‐γ interferon‐γ
IRS‐1 insulin receptor substrate 1
LBD ligand‐binding domain
LBP ligand binding pocket
LM‐PCR ligation‐mediated PCR
LXR liver X receptors
10
MS Mass spectrometry
MYPT1 myosin phosphatase targeting subunit 1
NCoR nuclear receptor corepressor
NF‐κB nuclear factor‐kappaB
NR nuclear receptor
Oga O‐GlcNAcase
O‐GlcNAc O‐linked N‐acetylglucosamine
Ogt O‐GlcNAc transferase
OXPHOS oxidative phosphorylation
PCR polymerase chain reaction
PD Parkinson’s disease
PKC Protein kinase C
PGC‐1 peroxisome proliferator‐activated receptor gamma coactivator‐1
PNRC proline‐rich nuclear receptor co‐regulatory protein
PPAR peroxisome proliferator‐activated receptors
PR progesterone receptor
Prox1 prospero‐related homeobox 1
PTM post‐translational modifications
qPCR quantitative PCR
RAR Retinoic acid receptor
RIP140 receptor interacting protein of 140 kDa
RT‐PCR real‐time PCR
SMRT silencing mediator of retinoid and thyroid hormone receptor
SRC steroid receptor co‐activators
TCA tricarboxylic acid
TF transcription factor
TPR tetratricopeptide repeat
TR thyroid receptor
TBS‐T Tris‐buffered saline‐Tween
VDAC voltage‐dependent anion channel
11
CHAPTER I – LITTERATURE REVIEW
1.1 NUCLEAR RECEPTORS
Nuclear receptors (NRs) are the largest family of transcription factors (TFs) in
metazoans (Mangelsdorf et al. 1995). First, they were characterized as TFs, that bind
DNA to regulate gene expression when bound by their small lipophilic ligands, like
thyroid hormone or retinoic acid (Evans 1988). NRs are implicated in several
diseases when deregulated. For example, peroxisome proliferator‐activated
receptors (PPARs, NR1Cs) are involved in diabetes and obesity (Evans et al. 2004)
and estrogen receptors (ERs, NR3As) are involved in different cancer types (Deroo
and Korach 2006). NRs are considered good targets for drug discovery because they
respond to small lipophilic molecules. In fact, after the rhodopsin‐like G‐protein‐
coupled receptor, the NRs represent the family of proteins which is most targeted by
drugs (Overington et al. 2006). Considering their major roles in the regulation of
gene expression and the development of several diseases, it is essential to study the
various mechanisms that regulate NRs and how they are involved in multiple
physiological functions.
1.1.1 Nuclear receptors structure
Most NRs share the same structure which is divided in four independent modules: a
modulator domain, a DNA‐binding domain (DBD), an hinge region and a ligand‐
binding domain (LBD) (Giguere 1999) (figure I). The modulator domain, is located
in the N‐terminal region of the receptor and the least conserved region among the
NRs (Warnmark et al. 2003). It contains a transcriptional activation function, called
AF‐1, which activity is not ligand‐dependant and can interact with coregulators,
such as steroid receptor coactivators (SRCs) (Tremblay et al. 1999). The DBD is
composed of two zinc finger modules and is the most conserved domain of NRs. It
binds DNA to specific sequence called hormone response elements (HRE) that
usually corresponds to the half motif AGGTCA. This motif can be repeated once or
12
twice and, in the later case, be directed or inverted (Giguere 1999) (figure Ib).
Similar to the modulator domain, the hinge region differs a lot between the different
NRs. It is a flexible region located between the DBD and the LBD that can rotate to
allow dimerization between different DBDs. Finally, the LBD as its name implies,
serves to bind ligand. However, it also mediates dimerization, interaction with heat
shock proteins (HSP), nuclear localization and contains a transactivation functions,
AF‐2. The LBD sequence is moderately conserved between the NRs, but the
structure is highly conserved.
Figure I. Nuclear Receptor structure.
(a) Schematic representation of a NR structure.
(b) Representation of NR dimers bound to direct (top arrows) or inverted HREs
(bottom arrows).
1.1.2 Mechanism of action
NRs are regulated by different mechanisms. One mechanism is the maintenance of
NRs in the cytoplasm by HSP. When a NR is bound by its specific ligand, it is released
by the HSP, and then translocates to the nucleus where it activates gene
transcription (Pratt and Toft 1997). This mechanism can be observed with steroid
receptors, but not with all NRs. In fact, the majority of the NRs are constitutively in
the nucleus, even in absence of their ligands. They bind to DNA and act as activators
when bound by their ligands, and as repressors when ligand free. This mechanism
was demonstrated with multiple NRs, of which thyroid hormone receptor (TRs,
NR1As) and retinoic acid receptor (RARs, NR1Bs) are good examples (Chen and
13
Evans 1995; Horlein et al. 1995). Moreover, interactions with coactivator or
corepressor proteins can modulate NRs activity. The first NR coactivator to be
identified is SRC‐1, which was shown to enhance progesterone receptor (PR,
NR3C3) activity and other steroid receptors (Onate et al. 1995). Also, the nuclear
receptor corepressor (NCoR) (Horlein et al. 1995) and silencing mediator of retinoid
and thyroid hormone receptor (SMRT) (Chen and Evans 1995) were the first
corepressors to be identified. Since, other important coregulators of NRs have been
discovered, like the peroxisome proliferator‐activated receptor gamma coactivator‐
1α (PGC‐1α), which activates specific NRs, such as PPARγ (Puigserver et al. 1999).
Coregulators are recruited to targeted genes by the NRs and they perform enzymatic
reactions needed to regulate gene expression, such as chromatin remodeling and
histone modifications. Finally, NRs activity can also be modulated by post‐
translational modifications (PTMs), such as phosphorylation, acetylation,
SUMOylation, methylation, ect. For example, the liver X receptors (LXRs, NR1Hs) are
acetylated proteins and their deacetylation corresponds to an increase in their
activity (Li et al. 2007). In contrast, LXRα phosphorylation by Protein kinase Cα
(PKCα) decreases its transcriptional activity (Delvecchio and Capone 2008).
1.1.3 NR subfamilies
As described previously, all NRs share similar structures and mechanisms of action.
However, they differ in their specific ligand and this is what categorizes NRs. The
NRs family can be divided into three subfamilies: endocrine receptors, adopted
orphan receptors and orphan receptors (Alaynick 2008). The endocrine receptors
subfamily is regulated by hormonal ligands, for which they have high affinity. In the
second subfamily, the adopted orphan receptors were discorvered before their
ligand, for which they have usually low affinity. Finally, the last NR subfamily does
not correspond to the first definition given to NR. In fact, NRs were described as TFs
which regulate transcription upon ligand binding (Evans 1988). Yet, no ligand was
identified for the orphan receptor subfamily and it is thought that some may not
14
have a natural ligand. However, their activities can be modulated by synthetic
ligands. At physiological level, they are essentially regulated by interactions with
coactivators or corepressors and by PTMs.
1.2 ESTROGENRELATED RECEPTOR ISOFORMS
The estrogen‐related receptor α (ERRα, NR3B1) is a member of the latest NR
subfamily described above, an orphan receptor. It was the first orphan NR to be
identified along with its isoform ERRβ (NR3B2). ERRα was attibuted this name
because of its high similarity with the ER’s DBD (Giguere et al. 1988). However, the
similarity between ERα and ERRα LBD is relatively low, and it is clear that estrogen
is not an ERRα ligand. The ERR subfamily has two other isoforms: ERRβ (Giguere et
al. 1988), which was described in the same study and ERRγ (NR3B3) identified in
the late 90s, the last orphan NR identified to date (Eudy et al. 1998; Hong et al. 1999;
Heard et al. 2000). ERRα is the most widely expressed, followed by ERRγ and ERRβ.
Their expressions are ubiquitous, but at a higher level in tissues with high energy
demand, like kidney and heart. All of them are also highly expressed in the central
nervous system (Gofflot et al. 2007).
1.2.1 ERRα action
Since ERRα does not have any physiological ligand, its activity is mostly regulated
by PTMs and interactions with coregulators. Several PTMs have been described to
affect ERRα activity and they mostly occur in the modulator domain, but also in the
DBD. Although the modulator domain is a region which is not conserved between
the various NRs, the ERR isoforms make an exception, because the degree of amino
acid identity in this region is high between the three isoforms.
ERRα can be modified by phosphorylation in its modulator domain, on serine 19
and 22. Serine 19 seems to be important for ERRα activity because inhibition of its
15
phosphorylation leads to an increase in ERRα’s transcriptional activity due to
recruitment of ERRα’s coactivators (Vu et al. 2007; Tremblay et al. 2008).
Furthermore, ERRα can be SUMOylated in its modulator domain on lysine 14 and
inhibition of SUMOylation also increases its transcriptional activity. Whereas PTM
on serine 19 is associated with repression of ERRα, phosphorylation at other
residues can also lead to an increase in its activity. In fact, ERRα can be
phosphorylated in its DBD by PKCγ and this increases its DNA‐binding activity, as
well its interaction with coactivators (Barry and Giguere 2005). Another PTM is
associated to ERRα’s DNA‐binding activity. It was recently reported that ERRα can
be acetylated by p300 coactivator associated factor. ERRα acetylation decreases its
DNA‐binding activity, which can be restored when ERRα is deacetylated by the
histone deacetylase (HDAC) 8 and sirtuin 1 (Wilson et al. 2010).
The ERRα’s DBD is composed of two zinc fingers module, like the other NRs. It binds
to the HRE, AGGTCA half‐site, with an extended TCA at the 5’ region (Sladek et al.
1997). This site, named ERR response element (ERRE), was first identified as the
consensus sequence recognized by ERRα using an unbiased approach (Sladek et al.
1997) and confirmed to be ERRα binding motif using genome wide localization of
ERRα by chromatin immunoprecipication (ChIP) followed by hydridization of the
chromatin on a chip (ChIP‐on‐chip) (Dufour et al. 2007). ERRα can act as a
heterodimer with ERRγ, and a monomer or homodimer (Tremblay and Giguere
2007). In addition to the ERRE, ERRα can bind in some cases to the estrogen
response element. It was proposed and demonstrated in vitro that ERRα could
interfere with the ER pathway and bind to the same sites as ER (Yang et al. 1996;
Vanacker et al. 1999), and this was demonstrated about 10 years later at
physiological level. The comparison of genome wide localization of ERα and ERRα
revealed that they mainly have strict binding site and regulate the transcription
independently of each other. However, they target a small subset of common
promoters in breast cancer cells (Stein et al. 2008; Deblois et al. 2009).
16
Usually, the LBD of a NR will dictate its activity. In absence of its ligand, the LBD will
be in an inactive conformation and the binding of a ligand will change the
conformation of the NR, making it an activated TF. However, the orphan nuclear
receptor ERRα does not conform to this rule. In fact, ERRα activates gene
transcription in a constitutive manner. A phenylalanine in its ligand binding pocket
(LBP) is necessary to keep ERRα constitutively active since mutation of the
phenylalanine 329 suppresses this activity (Chen et al. 2001). Moreover, the 3D
structure of ERRα and its isoform ERRγ revealed that, even in absence of ligand,
their LBDs are in an active configuration and they would not have enough space for
a ligand with more than 4 carbon atoms, because the space is occupied by amino
acid side chains (Greschik et al. 2002; Kallen et al. 2004). However, it was recently
demonstrated that the LBP of ERRα can change its conformation to bind to a large
synthetic inverse agonist (Kallen et al. 2007). Moreover, ERRα activity can be
modulated by some synthetic ligands. The most specific for ERRα is the inverse
agonist XCT790, which inhibits ERRα activity by disrupting the interaction between
the orphan NR and its coactivator PGC‐1α (Busch et al. 2004; Willy et al. 2004). At
physiological level, ERRα is in an active conformation as soon as it is expressed and
its activity will depend on the presence of its coregulators.
1.2.2 ERRα coregulators
As described above, ERRα activity is mostly dependent on the presence of
coregulators. Several coactivators enhance ERRα’s transcriptional activity. By
luciferase assays, it was shown that the activator of thyroid and retinoic acid
receptors (ACTR), the glucocorticoid receptor interacting protein 1 (GRIP1) and
SRC‐1, can all increase the transcriptional activity of ERRα (Xie et al. 1999), whereas
PGC‐1α was shown to interact with ERRα by yeast two‐hydrid screen (Huss et al.
2002) and synergistically activate transcription (Laganiere et al. 2004). PGC‐1β, the
proline‐rich nuclear receptor co‐regulatory protein (PNRC) and PNRC2 were also
shown to be ERRα’s coactivators (Zhou et al. 2000; Zhou and Chen 2001; Kamei et
17
al. 2003). In ERα negative breast cancer cells, the coregulator amplified in breast
cancer‐1 (AIB1) was demonstrated to interact with ERRα and enhance its
transcriptional activity (Heck et al. 2009). On the other hand, the receptor
interacting protein of 140 kDa (RIP140) is a corepressor of ERRα (Augereau et al.
2006; Castet et al. 2006). Recently, the homeobox protein prospero‐related
homeobox 1 (Prox1) was demonstrated to be a negative modulator of ERRα. Prox1
can interact with ERRα and PGC‐1α to inhibit their activity and can be located on the
same promoters as ERRα (Charest‐Marcotte et al. 2010).
1.2.2.1 PGC1α
PGC‐1α was first identified in brown adipose tissue and was shown to be involved in
adaptive thermogenesis, due to an increase in its expression upon cold exposure
(Puigserver et al. 1998). Its expression is mostly regulated by nutritional and
hormonal signal, and it acts as a coactivator by enhancing transcriptional activity of
several TFs, such as PPARγ, TR (Puigserver et al. 1998) and glucocorticoid receptor
(GR, NR3C1) (Knutti et al. 2000). PGC‐1α has a major role in mitochondrial
biogenesis and respiration (Wu et al. 1999), but it is also implicated in hepatic
gluconeogenesis and lipoprotein metabolism, skeletal muscle fiber determination,
cicardian clock function, angiogenesis, and macrophage polarization (Lin 2009).
As mention above, PGC‐1α is an ERRα coactivator and both proteins physically
interact resulting in increasing ERRα transcriptional activity (Huss et al. 2002;
Laganiere et al. 2004; Giguere 2008). In absence of PGC‐1α, the transcriptional
activity of ERRα is weak. The presence of this coactivator increases its activity,
making it a potent regulator of gene expression (Schreiber et al. 2003).
Furthermore, both are involved in the regulation of genes linked to mitochondrial
function, like oxidative phosphorylation (OXPHOS) and fatty acid oxidation (FAO). It
should be noted that PGC‐1β can also act as an ERRα’s coactivator. The ERRα’s
18
targets and functions will be discussed later, but its coactivator PGC‐1α is an
important tool to study this orphan NR.
1.2.3 ERRα targets
Since the discovery of ERRα, the techniques used to identify target genes of nuclear
receptors changed a lot. Initially, identification of target genes was mainly based on
the presence of an ERRE in their promoter. Using electrophoretic mobility shift
assay (EMSA) or transfection reporter assays, medium‐chain acyl coenzyme A
dehydrogenase (Sladek et al. 1997), aromatase (Yang et al. 1998), pyruvate
dehydrogenase kinase 4 (Wende et al. 2005), PPARα (Huss et al. 2004),
apolipoprotein A4, TRα (Vanacker et al. 1998), and many others were identified as
ERRα targets. The discovery of new target genes became more efficient with the
arrival of new techniques, for example gene expression microarrays. However, since
ERRα is an orphan NR, it was not possible to just activate it with a ligand and
compare gene expression between activated and non‐activated ERRα. Therefore, the
coactivator PGC‐1α became an essential tool to identify new ERRα targets. With
several approaches, but using all PGC‐1α as a coactivator of ERRα, a few studies
revealed that just like PGC‐1α, ERRα is implicated in the regulation of genes involve
in OXPHOS and mitochondrial biogenesis (Mootha et al. 2004; Schreiber et al. 2004;
Gaillard et al. 2006). Also, ERRα was demonstrated as a key regulator of cytochrome
c, cartinine palmytoytransferase 1a, cytochrome c oxidase 4, ATP synthase b and
many other genes involve in bioenergy homeostasis. Moreover, ERRα is implicated
in a feedback loop. Indeed, it targets its own promoter to activate its transcription,
as well GA repeat‐binding protein α (GABPA) promoter to activate its transcription.
GABPA also targets ERRα promoter and its own promoter to increase their
transcription (Laganiere et al. 2004; Mootha et al. 2004; Dufour et al. 2007).
Recently, the identification of ERRα targets became more powerful with the
incoming of the ChIP‐on‐chip technology, which allowed study of protein‐DNA
19
interaction. It is a large‐scale identification of genomic targets of specific TFs
(Deblois and Giguere 2008). Several studies were done to identify new ERRα
targets. Genome‐wide location analysis of ERRα and its isomer ERRγ in heart tissue
revealed that they are key regulators of bioenergy homeostasis (Dufour et al. 2007).
It was already postulated, mainly through its known interaction with PGC‐1α, that
ERRα might be implicated in OXPHOS and mitochondrial biogenesis (Sladek et al.
1997; Laganiere et al. 2004; Mootha et al. 2004; Schreiber et al. 2004; Gaillard et al.
2006). However, this study revealed that ERRα does not only target a few genes
with mitochondrial functions, but a large number of genes involved in tricarboxylic
acid (TCA) cycle and OXPHOS, as well in FAO and glucose metabolism (Dufour et al.
2007). It was also demonstrated that ERRα targets multiple genes involved in TCA
cycle, OXPHOS, FAO and glucose metabolism in liver (Charest‐Marcotte et al. 2010).
In macrophages, ERRα was shown to be downstream effector for interferon‐γ (IFN‐
γ) and to be required for mitochondrial gene expression and reactive oxygen species
production (Sonoda et al. 2007). This agrees with a previous study that
demonstrated that ERRα is induced by IFN‐γ (Barish et al. 2005). The role of ERRα
is not limited to mitochondrial functions and bioenergy homeostasis. Indeed, ERRα
ChIP‐on‐chip in breast cancer cells revealed that ERRα targets genes involved in
process linked to tumor growth and proliferation, as well the oncogene ERBB2
(Deblois et al. 2009). Furthermore, ERRα is also important in regulation of gene
expression in kidney. Thus, in this tissue it targets ionic channels, as well as
receptors implicated in systemic blood pressure and genes involved in the
angiotension pathway (Tremblay et al. 2010),
1.2.4 ERRα function
The identification of ERRα targets gives a good idea of its physiological functions. Its
role in energy metabolism was confirmed by the generation of ERRα‐null mice. They
are viable, fertile and, with the exception of a reduction in their body weight and
peripheral fat deposits, display no obvious anatomical alterations (Luo et al. 2003).
20
However, the ERRα‐null mice are resistant to high‐fat diet‐induced obesity. The
expression of genes involved in lipid metabolism and adipogenesis were modified in
adipose tissue of those mice. The vital functions of ERRα become more evident
when the mice are submitted to different physiological stresses. Corresponding with
ERRα’s role in macrophages for host defense, the null mice are defective for
bacterial clearance (Sonoda et al. 2007). Also, the ERRα‐null mice present a failure
in cardiac adaptation to chronic pressure overload and a decrease in ATP synthesis
(Huss et al. 2007). They also display a hypotensive phenotype, which can be
explained by the fact that ERRα is a regulator of channels involved in renal Na(+)
and K(+) handling, and some genes in the renin‐angiotensin pathway (Tremblay et
al. 2010). Furthermore, the absence of ERRα results in a defect in adaptive
thermogenesis in brown adipose tissue, due to a reduction of mitochondrial
biogenesis and oxidative capacity, which prevents mice to maintain body
temperature when exposed to cold (Villena et al. 2007). In addition to these
functions, ERRα has a role in tumor growth and cell proliferation in breast cancer, as
mentions above (Deblois et al. 2009). Accordingly, the expression of this NR was
demonstrated to be a potent prognostic factor in breast tumors (Ariazi et al. 2002;
Suzuki et al. 2004).
1.3 HEXOSAMINE BIOSYNTHETIC PATHWAY
The hexosamine biosynthetic pathway (HBP) modulates the PTM O‐linked N‐
acetylglucosamine (O‐GlcNAc) in cells. Between 2% and 5% of glucose uptake goes
into the HBP (McClain and Crook 1996). The enzyme L‐glutamine:D‐fructose‐6‐
phosphate amidotransferase (Gfat) drives the fructose‐6‐phosphate generated by
the glycolysis into this pathway. This is the rate‐limiting step of the HBP (Love and
Hanover 2005). In addition to glucose, the pathway uses glutamine, acetyl‐CoA and
UTP to generate UDP‐GlcNAc, which is used by the enzyme O‐GlcNAc transferase
(Ogt), to modify proteins on serine and threonine residues with the addition of O‐
21
GlcNAc (Love et al. 2010). On the other hand, the enzyme O‐GlcNAcase (Oga)
removes the O‐GlcNAc. Moreover, the O‐GlcNAc PTM can be compared with
phosphorylation since it happens on hydroxyl groups of serine and threonine
residues. To date, over 1,000 proteins have been identified to be O‐GlcNAcylated.
However, contrary to phosphorylation which is regulated by hundreds of kinases
and phosphatases, only two enzymes regulate O‐GlcNAcylation: Ogt and Oga. Most of
proteins that are modified by O‐GlcNAc can also be phosphorylated and it can even
have a competition between O‐GlcNAcylation and phosphorylation on the same
residue (Hart et al. 2007; Wang et al. 2008). The HBP serves as a nutrient and stress
sensor and response by the addition of O‐GlcNAc on proteins involve mostly in gene
expression regulation and metabolism, but also in signal transduction, transport,
translation and structure (Teo et al. 2010a).
Deregulation of the HBP is linked to several diseases. First, an upregulation of this
pathway results in insulin resistance, which leads to type II diabetes (Crook et al.
1993; Park et al. 2010; Teo et al. 2010b). Also, the HBP is deregulated in
neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease
(PD) (Love and Hanover 2005; Dias and Hart 2007; Liu et al. 2009). Recently, this
pathway was reported to be upregulated in breast cancer and necessary to tumor
growth through the enzyme Ogt (Caldwell et al. 2010). The effect of O‐GlcNAcylation
on several proteins has been studied and it is clear that this PTM is linked to some
physiological dysfunction. However, little is known about how the occurrence of this
modification is control.
1.3.1 OGlcNAcylated Posttranslational modification
Initially, proteins glycolysation was thought to be exclusive to the luminal
compartments of the secretory machinery and to the cell surface, and extracellular
matrix (Hart et al. 1989). The identification of a novel saccharide that can be O‐
linked to protein, GlcNAc, revolutionized this dogma. In fact, O‐GlcNAcylated
proteins were found at cell surface as expected with glycosylated proteins. However,
22
this modification also localized in the cytoplasm and in several organelles, like
microsomes, nuclei and the nuclear envelop (Torres and Hart 1984; Holt and Hart
1986; Holt et al. 1987). It became rapidly clear that this O‐GlcNAcylation was
different from classical protein glycosylation, because it has a nucleocytoplasmic
distribution and cannot be elongated.
What happens to O‐GlcNacylated proteins is not well defined. The consequences of
this PTM will largely depend on the initial function of the modified protein. One
important group of proteins for which O‐GlcNAcylation has been well characterized
is TF. Several TFs were shown to be O‐GlcNAcylated, such as Sp1 (Han and Kudlow
1997; Goldberg et al. 2006), c‐myc (Chou et al. 1995a; Chou et al. 1995b), nuclear
factor‐kappaB (NF‐κB) (James et al. 2002; Yang et al. 2008a), p53 (Yang et al. 2006),
STAT5A (Nanashima et al. 2005), and the NR LXR (Anthonisen et al. 2010). For
example, Sp1 O‐GlcNAcylation delays its degradation by the proteasome and
enhances its transcriptional activity, whereas NF‐κB O‐GlcNAcylation disrupts its
interaction with its inhibitor IκB, which consequently enhances its transcriptional
activity. Similarly to Sp1 O‐GlcNAcylation, p53 degradation is delayed when
modified by O‐GlcNAc, due to inhibition of its phosphorylation.
Like TFs, some coactivators were shown to be O‐GlcNAcylated. The CREB regulated
transcription coactivator 2 (CRTC2) can be O‐GlcNAcylated, which inhibits its
phosphorylation and induces its nuclear translocation (Dentin et al. 2008). PGC‐1α
was also demonstrated to be O‐GlcNAcylated, but it is not clear how this
modification affects its activity (Housley et al. 2009). To stay in the transcription
field, RNA polymerase II is also O‐GlcNAcylated. In fact, RNA polymerase II is
activated when phosphorylated in its C‐terminal domain (CTD). But its CTD can also
be O‐GlcNAcylated and cannot be in the same time phosphorylated and O‐
GlcNAcylated (Comer and Hart 2001). This was demonstrated in vitro, but it is not
clear how this modification affects RNA polymerase II activity and if it competes
with its phosphorylation sites in vivo.
23
As mention previously, proteins involved in metabolism also represent another
group where O‐GlcNAcylation has been well studied. Generally, this modification on
enzymes involved in metabolism leads to inhibition of their phosphorylation. For
example, the enzyme glycogen synthase can be O‐GlcNAcylated in hyperglycemia
conditions, reducing its activity due to inhibition of its phosphorylation and
contributing to insulin resistance (Parker et al. 2003). As for the enzyme glycogen
synthase, O‐GlcNAcylation of the calcium/calmodulin‐dependant protein kinase IV
(CaMKIV) inhibits its phosphorylation, leading to activation of this kinase (Dias et al.
2009). Several proteins in the insulin signaling pathway are also O‐GlcNAcylated,
such as insulin receptor substrate 1 (IRS‐1), phosphoinositide‐3 kinase and Akt. An
increase in their O‐GlcNAcylation results in a decrease in response to insulin
signaling due to inhibition of Akt activity or upstream kinases (Vosseller et al. 2002;
Zachara and Hart 2006; Yang et al. 2008b). Finally, O‐GlcNAcylation affects activity
of proteins with other functions, like the cytoskeletal proteins vimentin (Slawson et
al. 2008) and tau (Li et al. 2006), the chaperone HSP60 (Kim et al. 2006), the protein
involves in intracellular adhesion beta‐catenin (Sayat et al. 2008) and many others.
1.3.2 Ogt enzyme
The HBP is essential to achieve the O‐GlcNAc PTM, but only one enzyme is
responsible for the addition of this sugar: Ogt. This enzyme was first identified and
purified from rat liver (Haltiwanger et al. 1992). Since, Ogt gene has been cloned in
other organisms, such as human, C. elegans, plants, and others. Ogt gene localizes
near the centromere at Xq13 in the human genome. Its expression is ubiquitous, but
Ogt is more abundant in brain and pancreas in comparison to other tissues (Kreppel
et al. 1997; Lubas et al. 1997). This agrees with the fact that Ogt could act has a
glucose‐sensor, because glucose level monitoring is really important in those two
organs. The Ogt gene encodes a major isoform of 116 kD which is named ncOgt, and
this is because it localizes to the cytoplasm and the nucleus. Alternative splicing and
a second promoter in intron 5 give rise to two different isoforms, one of 103 kD
24
which localizes in the mitochondria, mOgt, and the shortest isoform of 70 kD, sOgt
(Hanover et al. 2003). All three of them have the same catalytic domain in their CTD,
but differ in the number of tetratricopeptide repeat (TPR) in their N‐terminal
domain. TPRs are found in several proteins and are repetitions of 34 amino acid
sequence important for protein‐protein interaction (Blatch and Lassle 1999). It is
through this domain that Ogt can recognize its substrates, thus it is essential for its
activity. Deletion of all TPRs results in a total loss of Ogt activity and when only the
first 3‐6 TPRs are deleted, Ogt can modify small peptides, but not intact proteins
(Lubas and Hanover 2000; Iyer and Hart 2003). Those observations show that TPR
domain could be important for Ogt specificity and this could explain why there is
only one enzyme to modify over 1,000 proteins with O‐GlcNAc. In addition to Ogt’s
substrates, the TPR domain allows Ogt to interact with multiple partners. It is
thought that the identity of its partners is important, since it will define which
substrates Ogt modifies. The general mechanism of how its partners provide the Ogt
specificity for its target is not well understand, but a few Ogt interacting proteins
have been identified.
1.3.3 Ogt interacting proteins
As mention previously, PGC‐1α can be O‐GlcNAcylated. It has been shown that PGC‐
1α interacts with Ogt to favor the interaction with forkhead box O1 TF, which leads
to its O‐GlcNAcylation and activation (Housley et al. 2009), in response to high
glucose. PGC‐1α is not the only transcriptional coregulator that was demonstrated
to interact with Ogt. The corepressor Sin3a can form a complex with Ogt and HDACs
to repress transcription, particularly at estrogen‐responsive gene promoters (Yang
et al. 2002). Furthermore, OIP106, also known as trafficking protein kinesin binding
1, also has a role in Ogt recruitment for transcriptional regulation by forming a
complex with Ogt and RNA polymerase II in the nucleus. This interaction probably
brings Ogt to transcriptional complexes for O‐GlcNAcylation of TFs or RNA
polymerase II (Iyer et al. 2003). Recently, it was demonstrated that Ogt could also be
25
recruited to MIP‐1α promoter, leading to an increase in the expression of this gene
(Chikanishi et al. 2010). This study identified several potential Ogt interacting
proteins that could mediate its recruitment to MIP‐1α promoter, but they did not
succeed to identify one specifically. However, it is possible that the recruitment of
Ogt to promoters does not lead to O‐GlcNAc modification. This hypothesis relies on a
study which demonstrated that Ogt loses its activity in presence of chromatin, since
chromatin binds UDP‐GlcNAc, leading to the inhibition of Ogt (Okuyama and
Marshall 2004). A lot of TFs were demonstrated to be O‐GlcNAcylated, but
considering this study, the modification must occur in the cytoplasm even if Ogt can
localize to the nucleus. Some other proteins also interact with Ogt and seem to
participate in its activity or specificity. Coactivator‐associated arginine
methyltransferase 1 (CARM1) and myosin phosphatase targeting subunit 1 (MYPT1)
are targets of Ogt and regulate its specificity (Cheung et al. 2008). In absence of
MYPT1, there are less O‐GlcNAcylated proteins even if Ogt expression does not
change, and overexpression of CARM1 modifies Ogt selectivity, leading to a different
profile of O‐GlcNAcylated proteins. Finally, there are not only proteins that can
mediate Ogt specificity, but also lipids. The phospholipid phosphatidylinositol 3,4,5‐
triphosphate recruits Ogt upon insulin activation, in order to modify Akt and IRS1,
leading to activation of the gluconeogenesis and inhibition of glycolysis and
glycogen synthesis (Yang et al. 2008b). The fact that Ogt interacts with several
proteins could explain why even if there are more than 1,000 proteins that are O‐
GlcNAcylated, only one‐enzyme catalyses this modification. Ogt specificity would
rely on interaction with its partners and it could explain why no consensus motif of
O‐GlcNAcylation has been identified yet.
1.3.4 Ogt and physiological functions
The principal function of Ogt is to catalyze the addition of O‐GlcNAc on serine and
threonine residues. The effect of Ogt on physiological functions will normally
depend on which target it modifies. Its role was assessed by deletion and
26
overexpression in mice and cells. First, deletion of Ogt gene leads to embryonic stem
cell lethality in mouse (Shafi et al. 2000). Due to the impossibility to generate viable
mice deficient for Ogt, the same group generated mice lacking this gene in specific
cells type, such as neurons, thymocytes and fibroblasts. As expected, lack of Ogt
results in the loss of O‐GlcNAcylated proteins, but also causes T‐cell apoptosis,
hyperphosphorylation of tau protein in neurons, and growth arrest of fibroblasts
(O'Donnell et al. 2004). On the other hand, Ogt overexpression showed that it has a
role in cell cycle progression, since its overexpression results in a polyploidy caused
by default in cytokinesis (Slawson et al. 2005). It is clear that Ogt is an important
player in regulating several physiological functions and its activity depends on the
presence of its substrate UDP‐GlcNAc, which will increase Ogt activity according to
its concentration (Lubas and Hanover 2000). UDP‐GlcNAc is generated by the HBP
and little is known about the regulation of this pathway, except that between 2‐5%
of glucose uptake goes into it. It is important to study further how this pathway is
regulated to be able to modulate Ogt activity and O‐GlcNAc cycling
1.4 MORTALIN
Mortalin, also known as glucose‐related protein 75 (GRP75) or mitochondrial
HSP70, is a member of the HSP70 family proteins. It is encoded by Hspa9. Like other
members of the HSP70 family, Mortalin is heat uninducible but also responds to
glucose deprivation, oxidative injury, low‐level of radiations and some cytotoxins
(Kaul et al. 2007). The localization of this chaperone is a bit controversial. Initially,
Mortalin was reported to localize in the cytoplasm and act as an anti‐proliferative,
senescence‐inductive protein (Wadhwa et al. 1993). However, with the cloning of its
gene, it became clear that the principal localization of Mortalin is in the
mitochondria, where it plays a role in import of proteins, chaperoning of misfolded
proteins, and energy generation (Webster et al. 1994; Bhattacharyya et al. 1995).
Further studies revealed that Mortalin can also be found in the endoplasmic
reticulum, plasma membrane and vesicles (Domanico et al. 1993; Ran et al. 2000).
27
Thus, the consensus for Mortalin localization in the cell is in the mitochondria, and it
can be found in other organelles of immortal cell lines.
1.4.1 Mortalin mitochondrial functions
Mortalin is encoded by the nuclear genome and is recruited to the protein import
machinery in the mitochondrial matrix by TIM44. Mortalin is the only ATPase
component of the mitochondrial import complex (Schneider et al. 1994). The
importance of Mortalin was demonstrated in yeast, when deletion of its yeast
homologue Ssc1 resulted in death (Craig et al. 1987). It acts with HSP60 to refold
proteins, which can be considered the last step of protein translocation to
mitochondria (Wadhwa et al. 2005; Deocaris et al. 2006). In addition to protein
folding, Mortalin is implicated in the degradation of misfolded proteins, which
cannot be achieved in absence of this chaperone (Savel'ev et al. 1998). Mortalin has
also a role in mitochondrial calcium regulation by mediating the interaction
between the voltage‐dependent anion channel (VDAC) and the Ca(2+)‐release
channel inositol 1,4,5‐triphosphate receptor, two important components in calcium
exchange between the endoplasmic reticulum and the mitochondria (Szabadkai et
al. 2006). Finally, in the mitochondria, Mortalin can act as an antagonist of cell death.
Indeed, p53 is an important tumor supressor and can induce apoptosis in
transformed cells. However, by binding to p53, Mortalin can inhibit p53‐induced
apoptosis and target it to proteasomal degradation (Deocaris et al. 2008b).
1.4.2 Mortalin and cell proliferation
Mortalin influences p53 activity outside of the mitochondria as well. First, cytosolic
Mortalin interacts with p53 and increases the ability of this tumor suppressor to
bind DNA (Iosefson and Azem 2010). Also, it can associate with centrosomes and
remove p53 from them to allow centrosomes duplication (Ma et al. 2006).
Localization of Mortalin to the centrosomes is dependent on the kinase Msp1, which
phosphorylates Mortalin on threonine 62 and serine 65. In absence of this PTM,
28
Mortalin cannot promote centrosomes duplication, leading to a decrease in cell
proliferation (Kanai et al. 2007). Mortalin also plays a role in cell proliferation by
interacting with the protein mevalonate pyrophosphate decarboxylase, leading to a
decrease in the activation of the Ras‐Raf pathway when it is in excess (Wadhwa et al.
2003). In addition to that, its protein level decreases in senescent human fibroblasts
and in aged worms, demonstrating its importance in cell proliferation (Deocaris et
al. 2008a). Furthermore, its overexpression results in lifespan extension in
fibroblasts and C. elegans, and its knockdown leads to cellular growth arrest
(Wadhwa et al. 2004).
1.4.3 Mortalin and physiological dysfunctions
As a major mitochondrial protein, Mortalin is also linked to several physiological
dysfunctions. It is not clear if it is a cause or a consequence, but Mortalin
distribution in normal cells versus transformed cells is different. In the last one,
Mortalin is restricted to the perinuclear region, wheras in normal cells it localizes in
the cytoplasm and mitochondria. Considering its different distribution between
normal and transformed cells and its role in cell proliferation, it is not surprising to
observe that Mortalin protein is overexpressed in hepatocellular carcinoma and
liver cancer metastasis (Yi et al. 2008). A study in colorectal cancer concluded the
same thing, i.e. that Mortalin is overexpressed in this cancer and correlates with a
poor survival (Dundas et al. 2005). A recent study suggests that Mortalin supports
cancer cells resistance to therapy, because its inhibition in leukemia cells results in
an increase in cell death induces by membrane attack complex (Pilzer et al. 2010).
Mortalin seems to be involved in prostate cancer as well. It interacts with the
tetraspanin protein CD9 in prostate cancer cells and participates in the induction of
mitotic catastrophe, which leads to prostate cancer progression (Zvereff et al. 2007).
Cancer is not the only disease that Mortalin is linked to. It has been shown that the
expression of Mortalin decreases in mitochondria of the brain of patients with PD
and in mitochondria of a cellular model of PD. In this particular cellular model, the
29
overexpression of Mortalin enhances the PD phenotype by mitochondrial inhibition,
oxidative stress and proteasomal dysfunction (Jin et al. 2006). Furthermore,
Mortalin is one of the five major proteins that binds to α‐synuclein and DJ‐1, two
critical proteins in PD (Jin et al. 2007). Also, some mutations in Mortalin gene were
reported in patients with PD (De Mena et al. 2009). The role of Mortalin in PD is not
well understood, but one explanation could be a dysfunction in its chaperoning role.
In fact, misfolded proteins have a strong tendency to form neurotoxic insoluble
protein aggregates and could explain why there are so much links between Mortalin
and this disease.
30
GOAL OF THE STUDY
The initial goal of the study was to study the role of the orphan NR ERRα in the
regulation of the HBP. ERRα is known to regulate the transcription of several genes
involved in glucose metabolism and bioenergy regulation. Since the HBP uses 2‐5%
of glucose uptake, we were interested to study if ERRα could have a role in the
regulation of this pathway. The hypothesis is that ERRα regulates the addition of O‐
GlcNAc on certain proteins, by controlling the transcription of genes involved in the
HBP. The goal is to find how ERRα regulates this pathway; if it needs an inducer and
if it can modulate the HBP through its action. The HBP has been studied a lot in the
last decade, but almost all the studies were downstream, i.e. the effect of O‐GlcNAc
addition on proteins activity. However, little is known about the regulation of the
HBP at upstream level.
During the study, I found that in general, proteins are more O‐GlcNAcylated in
absence of ERRα. This was more obvious for one specific protein, Mortalin. With this
interesting data, the goal of the study became to assess the regulation of the
mitochondrial protein Mortalin by ERRα through the HBP.
31
CHAPTER II – MANUSCRIPT
Transcriptional Regulation of Mortalin and the Hexosamine Biosynthetic
Pathway by the Orphan Nuclear Receptor ERRα
This chapter forms the basis of the manuscript: “Transcriptional Regulation of
Mortalin and the Hexosamine Biosynthetic Pathway by the Orphan Nuclear
Receptor ERRα” by Guillaume Sylvain‐Drolet, Catherine Rosa Dufour and Vincent
Giguère
The writing of this manuscript is entirely my own with corrections and editorial
comments by Dr. Vincent Giguère.
32
INTRODUCTION
Nuclear receptors (NRs) are a group of transcription factors (TFs) that modulate
gene expression when bound by their small lipophilic ligands (Evans 1988). Some of
the NRs are called orphan because no natural ligand have been identified yet. The
first orphan NR to be identified is the estrogen‐related receptor α (ERRα, NR3B1),
which was found by its high similarity with the estrogen receptor (ER, NR3A) DNA‐
binding domain (DBD) (Giguere et al. 1988). Even if ERRα has a high structural
homology with ER, it became rapidly clear that estrogen or any other endogenous
small molecule could not activate ERRα. At physiological level, since ERRα does not
have any ligand, its activity is mostly regulated by post‐translational modifications
(PTMs), such as acetylation, phosphorylation and SUMOylation (Barry and Giguere
2005; Vu et al. 2007; Tremblay et al. 2008; Wilson et al. 2010), and by interactions
with coregulators. For example, the peroxisome proliferator‐activated receptor γ
coactivator‐1α (PGC‐1α) is an important ERRα’s coactivator, which physically
interacts with ERRα to increase its transcriptional activity, making it a potent
regulator of gene expression (Huss et al. 2002; Schreiber et al. 2003; Laganiere et al.
2004). On the other hand, the homeobox protein prospero‐related homeobox 1
(Prox1) is a corepressor, inhibiting ERRα/PGC‐1α complex activity (Charest‐
Marcotte et al. 2010). ERRα is involved in transcription control of several metabolic
genes, such as genes implicated in tricarboxylic acid (TCA) cycle, oxidative
phosphorylation (OXPHOS), fatty acid oxidation (FAO) and glucose metabolism
(Dufour et al. 2007; Giguere 2008; Tremblay et al. 2008; Charest‐Marcotte et al.
2010). Considering its important role in energy metabolism, it would not be
surprising that ERRα is involved in the hexosamine biosynthetic pathway (HBP), an
energy sensing pathway directly connected to glucose metabolism.
The HBP modulates the PTM O‐linked N‐Acetylation (O‐GlcNAc) in cells. Between
2% and 5% of glucose uptake is driven from the glycolysis to the HBP by the enzyme
L‐glutamine:D‐fructose‐6‐phosphate amidotransferase (Gfat), which is encoded by
33
the glutamine fructose‐6‐phosphate transaminase 1 (Gfpt1) gene (McClain and
Crook 1996). This pathway generates UDP‐GlcNAc, the substrate used by the
enzyme O‐GlcNAc transferase (Ogt), to modify proteins with the addition of O‐
GlcNAc (Love and Hanover 2005). On the other hand, the enzyme O‐GlcNAcase
(Oga), encoded by meningioma expressed antigen 5 (Mgea5) gene, removes this
PTM. Like phosphorylation, O‐GlcNAcylation occurs on hydroxyl groups of serine
and threonine residues, and often there is a competition between the 2
modifications for the same residue (Hart et al. 2007; Wang et al. 2008). However, in
contrast to phosphorylation which involves hundreds of kinases and phosphatases,
only two enzymes modulates O‐GlcNAcylation: Ogt and Oga. O‐GlcNAc cycling is
involved in many processes of cell physiology, such as gene expression regulation,
metabolism, signal transduction, transport, translation and structure (Teo et al.
2010a). To date, over 1,000 proteins have been reported to be O‐GlcNAcylated.
Moreover, this PTM is essential for embryonic development, since deletion of Ogt
gene leads to embryonic stem cell lethality in mouse (Shafi et al. 2000). Also, the
HBP is linked to type II diabetes and is essential for tumor growth in breast cancer
(Butkinaree et al. ; Crook et al. 1993; Caldwell et al. 2010). The HBP has been
studied a lot to determine the effect of O‐GlcNAcylation on specific protein.
However, little is known about the regulation of this pathway.
This study reveals that several genes of the HBP are ERRα’s targets. This orphan NR
is involved in transcription regulation of the HBP, which is downregulated in
absence of ERRα. However, in its absence, proteins are more O‐GlcNAcylated in
general. This can be observed more specifically when we look to specific proteins,
such as Mortalin, a major chaperone involved in protein translocation to
mitochondria (Wadhwa et al. 2005; Deocaris et al. 2006). Interestingly, Mortalin is
also an ERRα’s target. This suggests that ERRα could modulate proteins activity at
two levels. First, by modulating their gene expression, second by modulating their
PTMs, through the control of the HBP.
34
MATERIALS AND METHODS
Plasmids
pCMX and pCMX‐ERRα were described previously (Laganiere et al. 2004). The
expression vector pcDNA3/HA‐hPGC1α was provided by A. Kralli (Kressler et al.
2002). The reporter plasmids pGL3‐mOgt promoter, pGL3‐mMgea5 promoter and
pGL3‐mUap1 promoter were obtained by high‐fidelity PCR on C57BL/6J mouse
genomic DNA with the following primers:
mOgT: CGCCTCGAGCTGGGCTTGAAACCGTAAGAGG and
CGCAAGCTTGCCGCCACTACTGACAAGAATG;
mMgea5: CTAGCTAGCTAGGCACACTCTCCATCGCCATAACAAAC and
CCCAAGCTTGGGCCCTTCCCCCTTCCTCTCGG;
mUap1: CGACGCGTCGGCCTGCACATGCACATCTGCTGCC and
GAAGATCTTCCAGCGACCGAGAACAGCCAAAG,
and insert into pGL3 plasmids as XhoI/HindIII fragment; NheI/HindIII fragment;
MluI/BglII fragment, respectively. Mouse promoter sequences were obtained from
UCSC genome browser database. The integrity of all plasmids described was verified
by DNA sequencing.
Reporter Assays
Hepa 1‐6 and HEK293 cells, cultured in DMEM (Invitrogen) supplemented with 10%
fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin, in a 5% CO2
environment, were seeded the night before the transfection. Transfection was done
using FUGENE 6 (Roche Diagnostics, Mannheim, Germany) in 12‐well plates with
250 ng luciferase reporter, 200 ng pCMX‐ERRα, 500 ng pcDNA3/HA‐hPGC1α and
200 ng CMV β‐galactosidase transfection efficiency control plasmid. Cells were
harvested and assayed for luciferase activity 24h post‐transfection. Luciferase
counts were normalized to β‐galactosidase activity. Experiments were performed in
35
duplicate and the data presented here are from one representative on three
independent experiments.
ChIP and ChIPonchip
ChIP assays and ChIP‐on‐chip experiments were performed as previously described
(Charest‐Marcotte et al. 2010) but only with ERRα antibody. Chromatin used for the
ChIP‐on‐chip corresponds to 3.3 g of initial liver mass taken from a pool of 24 livers.
Duplicate ERRα ChIP‐on‐chip experiments were performed. Samples were
hybridized to microarray slides containing ~17,000 of the best‐defined mouse
transcripts represented as defined by RefSeq spanning from ‐5.5kb upstream to
+2.5kb downstream of the transcriptional start sites (Agilent 244K microarray)
according to the Agilent mammalian ChIP‐on‐chip protocol version 9.2.
Quantitative RealTime PCR
To assess the enrichment of ERRα at promoters from the HBP identified from the
ChIP‐on‐chip experiments, quantitative PCR (qPCR) was performed using the same
ChIP material used for hydridizations as described previously (Dufour et al. 2007).
The abundance of enriched DNA was assessed by LightCycler 2.0 (Roche) and
QuantiTect® SYBR®Green PCR Kit. Enrichment of DNA fragments was normalized
against one amplified region using the control primers, located approximately 4kb
upstream of the ERRα transcriptional start site. Enrichment at HBP gene promoters
was quantified with the following primers:
Uap1: CCAGCTTGGAAAGTACCGAGTC and GAGAATGCTTCTACCCCAGGGAC;
Glyat: GGTTTTGGGGAACAGAGTGCAGAG and GTGTTGAAGGTTGGCATACAAGTT;
Mgea5: GCCTTTCCTTGGGATAAGCC and CGAGCCAAAATGGTACGTCC;
Ogtpromoter: GGAGTTGCCTAGACAGGGTTGTC and GCGTAACAAGACTACCGACCAAG;
Ogtintron1: GTGGTTAGCTGTGCAGAAATTGCTCTGG and
CCTAAGGCTCGGCTGTAAACATTTATCTCC;
36
Hspa9: GAGAGAAGAGAGGTGGACAGGCATCGC and
CGCAACTGACGCAAGGAGACTGTAATC
Control primers: TTGGCATTGATATTGGGGGTGGGAGCAACT and
GACTTCTTACTTTGACGCTTTCCTCCATCG.
Mice
The ERRα null mice (C57/BL6 background) were previously described (Luo et al.
2003). Male mice (2‐3 months old) were used throughout the study. The mice were
euthanized, and the livers were removed, rinsed in cold PBS, snap frozen in liquid
nitrogen, and stored at ‐80°C until subsequent analysis. The livers were pulverized
using motor and pestle pre‐cold in dry ice. Liquid nitrogen was added regularly to
the powder during the pulverization procedure to prevent thawing. The pulverized
tissues were aliquot for protein and RNA extraction and stored at ‐80°C.
RNA isolation, reverse transcription, and qRTPCR
Using the RNeasy miniprep (QIAGEN) according to the manufacturer’s instructions,
total RNA was isolated from ground mouse livers or from cells grown in a
monolayer, lysed directly in the cell‐culture vessel. RNA was quantified by
spectrophotometry. For each sample, 1 μg of total RNA was used for the reverse
transcription. RNA was reverse transcribed to cDNA using the SuperScript First‐
Strand Synthesis system (Invitrogen) according the manufacturer’s protocol. qPCR
reactions were performed with LightCycler 480 (Roche) and LightCycler 480 SYBR
Green I Master mix (Roche). A standard curve was performed with the following
dilutions: 1/5; 1/10; 1/20; 1/40 and 1/80. The cDNA samples were diluted 1/20
and ran in triplicates, as the standard curve. Values were normalized to Arbp control
gene.
Arbp: GCAGCAGATCCGCATGTCGCTCCG and GAGCTGGCACAGTGACCTCACACGG
Nagk: GGATGCAGTGAGGCTCCTGATTG and GTTCCAGAGATGAGCACAATCCC
37
Uap1: GGCAGTGCTACCAGAGATCAAGAGC and GAAAAAGCGTCTTGTGGGATGGC
Pgm3: CCCAGCATCTCGATCATATCATGTTTCG and GTCCTGCTCCTCCGCACTGG
Ogt: GACATAGCTGTGAAACTGGGAACCG and CATGTGGTCAGGTTTGTTGCCAG
Mgea5: GGGAGAGCCAGAAACCTTCCTC and CTGTCCAAAGCACCTCAATTCCAG
Glyat: CCTGGAGTCCTCAGAAGTCATTAACTGG and
GTTTGATTTGAAAAGATTGGATGCTTGC
Gfpt1: GACAAGAAAGGAAGCTGCGGTC and CCACCACTGCTGCAACATCATC
Esrra : CTCAGCTCTCTACCCAAACGC and CCGCTTGGTGATCTCACACTC
Protein extraction from mice
For each sample, ~100 μl of grinded livers were transferred to a 15 ml tube, to
which was added 1.5 ml of modified RIPA buffer (50 mM Tris‐HCl pH7.4, 1 % NP‐40,
0,25 % sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 100 μM
PUGNAc and 1 pellet COMPLETE mini‐EDTA free ROCHE, per 10 ml of buffer). The
livers were homogenized with a polytron‐type homogenizer (IKA® T10 basic
ULTRA‐TURRAX®) for 3x15 sec. After 1 h incubation at 4°C under constant rotation,
the crude homogenate was centrifuged at 4°C for 10 min at 13,000 rpm. The
concentration of the total liver extract (supernatant) was determined by Micro BCA
Protein Assay Kit (Thermo Scientific), according to the manufacturer’s instructions.
Western blot
Protein extracts (40 μg) were separated on a SDS‐8%PAGE gel, transferred onto
PVDF membranes (Amersham Biosciences) and blocked overnight at 4°C in TBS‐T
(Tris‐buffered saline, 20 mM Tris, 150 mM NaCl and 0,1% Tween) containing 5%
skim milk. For Western blot analysis membranes were incubated 1 h at room
temperature with either an in‐house rabbit polyclonal anti‐ERRα antibody
(Laganiere et al. 2004) (1:10,000), mouse monoclonal anti‐O‐GlcNAc CTD110,6
antibody (Santa Cruz: sc59623, 1:200), mouse monoclonal anti‐O‐Linked‐N‐
38
Acetylglucosamine RL2 antibody (Abcam: ab2739, 1:1,000), mouse monoclonal anti‐
Ogt antibody (Santa Cruz: sc74547, 1:200), mouse monoclonal anti‐α‐Tubulin
antibody (Cederlane: CLT9002, 1:1,000), rabbit polyclonal anti‐HA‐probe Y‐11
(Santa Cruz: sc805, 1:200), rabbit polyclonal anti‐Akt1/2/3 (Santa Cruz: sc8312,
1:200) or rabbit polyclonal anti‐Grp75 antibody (Santa Cruz:sc13967, 1:200)
diluted in TBS‐T containing 1% BSA and 0,02% sodium azide. Following 3 washes in
TBS‐T containing 5% skim milk, the membranes were incubated for 1 h in
secondary antibody, donkey anti‐rabbit IgG‐HRP (GEHealthCare: NA9340V,
1:10,000 in TBS‐T containing 5% skim milk), goat anti‐mouse IgM‐HRP (Santa Cruz:
sc2064, 1:500 in TBS‐T containing 5% skim milk) or sheep anti‐mouse IgG‐HRP
(GEHealthCare: NA931V, 1:10,000 in TBS‐T containing 5% skim milk). The
membranes were washed 4 times in TBS‐T and subsequently the proteins were
detected using Lumi‐Light Western Blotting Substrate (Roche) or Lumi‐LightPLUS
Western Blotting Substrate (Roche).
Coimmunoprecipitations assays
Proteins were isolated from mouse livers as described above. Equal amount of 4
liver lysates from 4 WT or 4 KO mice were pooled together to have 2 mg of proteins
of each group. Immunoprecipitations were pre‐cleared with protein G‐sepharose
(GEHealtCare: 11‐0618‐02) for 30 min at 4°C with rotation. After centrifugation at
5,000 rpm for 2 min at 4°C, supernatants were collected and incubated 2 hours at
4°C with rotation with 4 μg of anti‐HA‐probe, anti‐Akt or anti‐Grp75, described
above. Protein G‐sepharose was added to the lysates and the samples were
incubated 1 h at 4°C with rotation. The samples were centrifuged at 5,000 rpm for 2
min at 4°C and the pellets were washed 4 times with buffer K (20 mM phosphate
buffer pH 7, 150 mM NaCl, 0,1% NP‐40, 5 mM EDTA and 1 pellet COMPLETE mini‐
EDTA free ROCHE, per 10 ml of buffer). The immunoprecipitations were eluted in
western loading buffer (62,5 mM Tris/HCl pH6.8, 10% Glycerol, 2% sodium dodecyl
sulfate, 5% β‐mercaptoethanol, 0,00625% bromophenol blue), and boiled for 5 min.
39
Samples were stored at ‐80°C and Western blotting analysis were conducted later as
described above.
Mass spectrometry analysis
2 mg of lysates from 4 WT livers mouse and 2 mg of lysates from 4 KO livers mouse
were immunoprecipitated with anti‐Akt1/2/3 antibody as described above. The
immunoprecipitations were separated on an acrylamide SDS‐8%PAGE gel. All tools
used for the electrophoresis were soaked in 20% acetic acid overnight. The gel was
stained with Bio‐Safe Coomassie G50 (BioRad 161‐0786) overnight and destained in
ultrapure water 5 hours. The band corresponding to 70 kDa was cut and analysied
by mass spectrometry (MS). The band was digested with trypsin. The peptides were
separated with ESI‐TRAP MS/MS Ion search and analyzed with the Mascot and
Scaffold software.
40
RESULTS
Identification of HBP genes targeted by ERRα in livers
ERRα regulates multiple genes involve in glucose metabolism and we want to
evaluate if it targets as well HBP genes. Localization of TFs on promoters of interest
is a good way to assess a potential role in transcription regulation of specific genes.
First, regulation of the HBP by the orphan NR ERRα in mouse livers was assessed by
chromatin immunoprecipication (ChIP) followed by hydridization of the chromatin
on a chip (ChIP‐on‐chip). Analysis of genome‐wide localization of ERRα revealed
that it binds to several genes involved in the HBP (figure 1A). In fact, ERRα binds
Mgea5, and Ogt on their promoters, the two genes encoding the enzymes controlling
O‐GlcNAc cycling, Oga and Ogt. Moreover, ERRα binds UDP‐N‐acetylglucosamine
pyrophosphorylase (Uap1) promoter, as well as glycine‐N‐acyltransferase (Glyat)
and Ogt introns 1. In all these cases, ERRα localization is closed to the transcription
start site by less than 1,000 bp. However, these targets must be validated by
standard ChIP analysis. Thus, using an ERRα antibody, we proceeded to a ChIP
experiment in mouse livers, followed by quantification of the enriched DNA by
quantitative PCR (qPCR). Compare to the control ChIP, there is an enrichment of 3.8
fold at Mgea5 promoter, 3.5 fold at Uap1 promoter, 13.4 fold at Ogt promoter, 4.1
fold at Ogt intron 1 and 2.8 fold at Glyat intron 1 in ERRα ChIP (figure 1B,C). ChIP‐
on‐chip is a large‐scale tool to identify targets of TFs, but some targets can be
missed. So, following the ERRα ChIP, we looked also if ERRα could bind to the other
HBP genes; N‐Acetylglucosamine kinase (Nagk), phosphomutase 3 (Pgm3) and
Gfpt1. Chromatin enrichment from these genes in ERRα ChIP was at the same level
of the control ChIP, revealing that they are not ERRα targets in those conditions
(figure 1B). The mouse livers ChIP‐on‐chip and ChIP results demonstrated that
ERRα binds to several genes involved in the HBP, including Ogt and Mgea5, which
encode the enzyme that directly regulate the addition and the removal of O‐GlcNAc
on proteins.
41
Figure 1. ERRα localization on HBP gene by ChIP‐on chip and standard ChIP
validation in mouse livers.
(A) Enrichment ratio profiles for ERRα at a few promoters of the HBP: Glyat,
Uap1, Ogt and Mgea5.
(B) Standard ChIP validation of ERRα bound segments in mouse livers.
(C) Scheme demonstrating the HBP with ERRα targets indicated in blue.
Transcriptional regulation of Mgea5, Ogt and Uap1 by ERRα
ERRα binding to HBP genes suggests that it is probably involved in control of their
transcription. To confirm that and evaluate its role in their transcriptional
42
regulation, we proceeded to luciferase assays. Promoters of Uap1, Ogt and Mgea5
genes were cloned upstream to a luciferase reporter gene. For Uap1 reporter, the
region is ‐646bp to ‐4bp of the transcription start site. The Mgea5 reporter
corresponds to ‐1020bp to +40bp and Ogt reporter corresponds to ‐1085bp to
+148bp. These reporters were individually transfected in Hepa1‐6 cells, a
hepatocytes cell lines derived from mouse tumors. At basal level, transcriptional
activity of Uap1 pormoter is about 20,000 RLUs (relative luciferase units), while
110,000 RLUs for Mgea5 promoter and 71,000 RLUs for Ogt promoter. ERRα alone
activates transcription of Uap1 reporter by about 3 fold (figure 2A). Mgea5 and Ogt
reporters’ respond in the same way to ERRα, with around 2 fold activation (figure
2B,C). In addition, PGC‐1α is an ERRα’s coactivator, which enhances its
transcriptional activity (Laganiere et al. 2004). This can be observed when ERRα
and PGC‐1α are cotransfected with Uap1 reporter, transcription is activated by 5.3
fold, while without ERRα, PGC‐1α can not activate transcription of this reporter
(figure 2A). Also, Mgea5 and Ogt reporters are not activated by PGC‐1α alone, while
cotransfection of the coactivator and the NR weakly increases transcriptional
activity, compared to ERRα alone (figure 2B, C).
The binding of ERRα and its role in transcription was assessed in liver tissues and
cultured cells. In order to see if it is a tissue specific regulation, the luciferase assays
were reproduced in HEK293 cells, a human embryonic kidney cell line. The basal
activities of Uap1, Mgea5 and Ogt promoters are 43,000 RLUs, 225,000 RLUs and
47,000 RLUs respectively. As Hepa 1‐6 cells, PGC‐1α is not sufficient to activate
transcription of Uap1, Mgea5 and Ogt reporters (figure 2D,E,F). However, Uap1
reporter is not activated when only ERRα is transfected, it needs the presence of
both, the NR and its coactivator (figure 2D). For Mgea5 and Ogt reporters, ERRα can
activate their transcriptions, which is weakly increased by the addition of PGC‐1α
(figure 2E,F). The results show that ERRα does not only bind to Uap1, Mgea5 and
Ogt promoters, but can also regulates their transcription, by enhancing their
expressions.
43
Figure 2. ERRα and PGC‐1α enhance transcription of Uap1, Mgea5 and Ogt.
(A,B,C) Hepa 1‐6 cells were transfected with the (A) Uap1 promoter, (B) Mgea5
promoter and (C) Ogt promoter reporter construct and 200 ng of ERRα expression
plasmids in the presence or absence of 500 ng PGC‐1α expression plasmids.
(D,E,F) HEK293 cells were transfected with the (D) Uap1 promoter, (E) Mgea5
promoter and (F) Ogt promoter reporter contruct and 200 ng of ERRα expression
plasmids in the presence or absence of 500 ng PGC‐1α expression plasmids. 200 ng
CMV β‐galactosidase transfection efficiency control plasmid was transfected as well
in each conditions and luciferase counts were normalized to β‐galactosidase activity.
Error bars correspond to standard deviation of the duplicates. This experiment is
one representative of three independent experiments.
44
Expression of HBP genes in liver, in presence or absence of ERRα
The ChIP‐on‐chip and ChIP datas revealed that ERRα binds to HBP gene promoters.
In order to assess its role in their regulation, we proceeded to RNA quantification in
the presence or absence of ERRα in mouse livers. The ERRα‐null mice are viable,
fertile and with the exception of a reduction in their body weight and peripheral fat
deposits, have no obvious anatomical alterations (Luo et al. 2003). RNA was isolated
from 8 WT mouse livers and 8 KO mouse livers, reverse transcripted in cDNA, and
quantified by qPCR. Thus, it was possible to compare the expression of the different
HBP genes in presence and absence of ERRα. We observe a significant
downregulation of Glyat, Uap1, Ogt and Mgea5 expressions in ERRα‐null mice
compare to WT (figure 3A, B, C, D). Interestingly, the genes that are significantly
dowregulated in the absence of ERRα correspond to the same that were shown to be
targeted by ERRα in the ChIP‐on‐chip and ChIP analysis (figure 1A, B, C). Mgea5 is
dowregulated by about 45% in absence of ERRα, hence Glyat, Uap1 and Ogt
expressions are all dowregulated by about 20%. Furthermore, in agreement with
the fact that they were not bound by ERRα, there are no significant changes in the
other HBP genes expression between the WT and KO mice. Quantification of Pgm3,
Gfpt1 and Nagk messenger RNA revealed that they are expressed at the same level
between the WT and KO (figure 3E, F, G). So, at basal level, ERRα seems to be
required to maintain expression of several HBP genes, but not all of them. Thus, in
absence of ERRα, Ogt, Mgea5, Glyat and Uap1, all targeted by this orphan NR, are still
expressed, but at a lower level.
45
Figure 3. HBP RNA quantification in ERRα‐null mice.
Reverse Transcription followed by qPCR performed on RNA isolated from mouse
livers (n = 8 WT and 8 KO). Relative expression levels between ERRα null mice and
wild‐type were normalized to acidic ribosomal phosphoprotein (Arbp) levels and
bars represent mean (±SEM). (A) Glyat, (B) Uap1, (C) Ogt, (D) Mgea5, (E) Pgm3, (F)
Gfpt1 and (G) Nagk. *, P < 0.05, **, P < 0.01, ***, P < 0.001; Student’s test.
ERRα affects proteins OGlcNAcylation
The HBP ends by the addition of O‐GlcNAc on serine and threonine residues of
multiple proteins (Love and Hanover 2005). So, measurements of O‐GlcNAcylated
proteins can provide informations on the activity of the pathway in presence or
absence of ERRα. With an antibody that specifically recognizes proteins O‐
GlcNAcylated, it was possible to assess HBP activity in presence or absence of ERRα.
Proteins were isolated from 4 WT or 4 KO mouse livers, and O‐GlcNAcylated
proteins were detected by Western Blot. As the HBP is downregulated in absence of
ERRα as shown in figure 3, we could expect to see less O‐GlcNAcylated proteins in
the KO mice. Interestingly, we observed the opposite. In general, proteins are more
46
O‐GlcNAcylated in mice lacking ERRα compared to the WT (figure 4A). It is
important to remember that RNA expression does not always correspond to protein
expression due to differences in translational control or micro‐RNA expression
activity. So, we looked for Ogt protein expressions, to evaluate if it could explain the
difference we observe between HBP RNA expression and O‐GlcNAcylated proteins.
Contrary to RNA level, which is downregulated by about 20% in absence of ERRα
(figure 3 C), Ogt protein expression does not change between WT and KO mice
(figure 4B). Unfortunately, no commercial antibody againt Oga was avaible during
the time of the study. Thus, the fact that proteins are more O‐GlcNAcylated in
absence of ERRα cannot be explained by an increase in Ogt protein expression. It
should be noted that even if Western Blot allows O‐GlcNAc detection, this is not the
highest sensitive method. In fact, over 1,000 proteins have been identified to be O‐
GlcNAcylated and most of them were identified using mass spectrometry (Hart et al.
2007; Teo et al. 2010a). Further studies using mass spectrometry shoul be perform
in order to identify the proteins that are O‐GlcNAcylated in the ERRα KO mice,
compare to the WT.
Since proteins seem to be more O‐GlcNAcylated in absence of ERRα, we tried to
observe this pattern on specific proteins. We choosed to look for Akt O‐
GlcNAcylation because this PTM is well known and documented on this protein.
Also, it is an interesting link to insulin signaling and glucose metabolism, which
involved several ERRα’s targets (Vosseller et al. 2002; Yang et al. 2008b). To
proceed, we immunoprecipiated (IP) Akt from mouse livers WT and KO and blot for
O‐GlcNAc. In the KO IP, it is possible to observe a weak band at 60 kDa that should
correspond to Akt, but not in the WT IP, suggesting that Akt is more O‐GlcNAcylated
in absence of ERRα (figure 4C). Moreover, an unknown protein having a mass of 75
kDa co‐IP with Akt and is much more O‐GlcNAcylated in absence of ERRα (figure
4C). To identify the unknown protein, we proceeded to mass spectrometry analysis.
Analysis of the different peptides obtained revealed that 139 amino acids matched
with the 679 amino acids of Mortalin protein (figure 4D). Interestingly, Mortalin was
47
already reported to interact with Akt and to be O‐GlcNAcylated (Walgren et al. 2003;
Vandermoere et al. 2007). The results show that in absence of ERRα, proteins are
generally more O‐GlcNAcylated. This can be observed specifically on particular
proteins like Akt and Mortalin.
Figure 4. Evaluation of HBP activity by O‐GlcNAcylated proteins.
(A) Western blot of mouse liver proteins showing O‐GlcNAcylated proteins and (B)
Ogt expression. Equal loading was assessed with α‐Tubulin.
(C) Mouse livers WT (4) and KO (4) total extracts were subjected to
immunoprecipitation with the anti‐Akt antibody (αAkt) followed by Western blot
analysis with the anti‐O‐GlcNAc (αO‐GlcNAc). The left panel corresponds to the
input, while the right panel corresponds to the immunoprecipitation. Both were run
on the same gel and are at the same exposition time.
(D) Peptides obtained by mass spectrometry analysis to identify the protein that Co‐
IP with Akt.
Mortalin is more OGlcNAcylated in absence of ERRα
48
Mortalin is one of the major chaperones in mitochondria and is involved in protein
import from the cytoplasm to the mitochondria (Schneider et al. 1994; Wadhwa et
al. 2005; Deocaris et al. 2006). Since several ERRα’s targets localize to mitochondria,
we decided to focus on Mortalin O‐GlcNAcylation, instead of Akt. The mass
spectrometry analysis identified Mortalin as the Akt partner that was more O‐
GlcNAcylated in ERRα‐null mice (figure 4C, D). To validate this, we proceeded to
Mortalin IP, followed by O‐GlcNAc revelation by Western blot. Using the same
protocol as the Akt IP, we immunoprecipitated Mortalin from WT and KO mouse
livers. As expected, detection of O‐GlcNAcylated proteins revealed a protein with a
mass of 75 kDa that is more O‐GlcNAcylated in the KO compare to the WT, in
Mortalin IP only, not in the control IP (figure 5A). Moreover, by doing an O‐GlcNAc
IP, followed with a Motalin blot, the same profile is revealed. In fact, we used Wheat
Germ Agglutinin (WGA) lectin, which allows isolation of glycoproteins modified with
an O‐linked GlcNAc, to confirm that Mortalin is more O‐GlcNAcylated in absence of
ERRα. As for the IPs, we pooled an equal amount of proteins from 4 mouse livers
WT and 4 KO. With the WGA lectin, we isolated O‐GlcNAcylated proteins from not O‐
GlcNAcylated and proceeded to detection of Mortalin by Western Blot. In the enrich
O‐GlcNAc fraction, we can observe more Mortalin in the ERRα‐null mice, compare to
the WT mice (figure 5B). On the other hand, it is the opposite in the not O‐
GlcNAcylated fraction; Mortalin signal is stronger in the WT mice compare to the KO
(figure 5B). Thus, these results confirm those obtained with the Akt IP. In absence of
ERRα, Mortalin is more O‐GlcNAcylated.
49
Figure 5. Mortalin O‐GlcNAcylation validation.
(A) Mouse livers WT (4) and KO (4) total extracts were subjected to
immunoprecipitation with anti‐Mortalin antibody (αMortalin) followed by a
Western blot against O‐GlcNAc. Membranes were stripped and re‐blot with
αMortalin. (B) Isolation of O‐GlcNAcylated and not O‐GlcNAcylated proteins from
mouse livers WT (4) and KO (4) total extracts with WGA lectins followed by a
Western blot against O‐GlcNAc.
Mortalin is an ERRα target
At this point, we have established that the O‐GlcNAc PTM occurs more often in
absence of the NR ERRα and this was demonstrated more specifically with the
mitochondrial protein, Mortalin. However, we were also interested to see if Mortalin
could be as well transcriptionaly regulated by ERRα. As we did for HBP genes, we
looked if ERRα binds to the Hspa9 promoter in the ChIP‐on‐chip dataset. In basal
mouse livers, ERRα localized to Hspa9 promoter, in a region closed to the
transcription start site (figure 6A). Standard ChIP was used to validate this target. In
comparaison to the control ChIP, the enrichment with ERRα antibody is about 39
fold (figure 6C). As for the HBP gene, the role of ERRα in transcription regulation of
Mortalin was assessed by RNA quantification in WT and ERRα‐null mouse livers.
50
Compare to WT, expression of Mortalin is downregulated by about 20% in absence
of ERRα (figure 6B). Therefore, Mortalin can be considered an ERRα target. This
suggests that ERRα is involved in Mortalin regulation in two different ways, first at
transcriptional level, by binding to its promoter to enhance its transcription, and
second at PTM, by regulating its O‐GlcNAcylation through the HBP.
Figure 6. ERRα is involved in Mortalin transcription regulation.
(A) Enrichment ratio profiles for ERRα at Hspa9 promoter.
(B) Reverse Transcription followed by qPCR performed on RNA isolated from
mouse livers (n = 8 WT and 8 KO). Mortalin relative expression levels between
ERRα null mice and wild‐type was normalized to acidic ribosomal phosphoprotein
(Arbp) levels and bar represents mean (±SEM). **, P < 0.01; Student’s test.
(C) Standard ChIP validation of ERRα bound segments to Hspa9 promoter.
51
DISCUSSION
The orphan NR ERRα is highly important in bioenergy regulation. In fact, it is
involved in transcription regulation of numerous genes related to glycolysis, TCA
cycle, FAO and OXPHOS (Giguere 2008; Charest‐Marcotte et al. 2010). As we were
expecting, ERRα ChIP‐on chip revealed that it is also involved in HBP transcription
regulation, another important pathway in bioenergy regulation. Localization of this
NR closed to Uap1, Ogt, Mgea5 and Glyat transcription start site suggests a role for
ERRα in the control of HBP transcription. This was confirmed by luciferase assays,
which demonstrated that ERRα, in collobaration with its coactivator PGC‐1α,
activates their transcription. Therefore, it shows that ERRα binding to HBP
promoters allows upregulation of their transcription. Moreover, in its absence,
Glyat, Uap1, Ogt and Mgea5 expressions are downregulated between 20 to 45%.
Hence, ERRα acts as a transcriptional enhancer of HBP, but is not essential for its
expression. The HBP uses 2 to 5% of all glucose uptakes to produce UDP‐GlcNAc, the
essential substrate for Ogt to proceed to the PTM O‐GlcNAc. There are strong
evidences that the HBP is an important pathway for nutrient and energy sensing
(Wells et al. 2003; Love and Hanover 2005; Hanover et al. 2010). Hence, the UDP‐
GlcNAc abundancy contributes to cell signaling in different processes, such as
metabolism. So in addition to the long list of genes involved in metabolism and
bioenergy regulation targeted by ERRα, we can add HBP’s genes.
As mentioned above, the HBP gene expression decreases from 20 to 45% in absence
of ERRα. However, it should be noted that this downregulation was measured in
ERRα‐null mice, which probably compensate the lack of ERRα, by an upregulation of
another TF. In fact, the ERRα‐null mice are viable, which demonstrate that even if
ERRα is involved in transcription regulation of important gene for bioenergy
regulation, it is not essential (Luo et al. 2003). It has been suggested that its isoform
ERRγ could compensate, since it shares several target genes with ERRα (Alaynick et
al. 2007; Dufour et al. 2007). However, there is a significant downregulation of HBP
52
genes expression in the absence of ERRα. Even if it is not drastic, considering that it
is at basal level and that this downregulation is on a long period of time, at the end,
it can have important consequences at physiological level.
In previous studies, the role of ERRα became more obvious under different
stimulations or stresses. In fact, at basal level, it is possible to observe a small
decrease in activity of its targets, but when there is an important environmental
change, the absence of ERRα is drastic. For example, the ERRα‐null mice present a
failure in cardiac adaptation to chronic pressure overload and decrease in ATP
synthesis, and they are not able to adapt to cold exposure due to a reduction in
mitochondrial biogenesis and oxidative capacity (Huss et al. 2007; Villena et al.
2007). It would be interesting to stress the ERRα‐null mice regarding the HBP and
assess how they respond. Induction of the HBP has been done in cells, by glucose or
glucosamine treatment, but it is hard to transpose this to mice (Dentin et al. 2008;
Kang et al. 2008). However, McClain et al. have generated transgenic mice that
overexpressed the enzyme Gfat, which increases the HBP flux (Hebert et al. 1996).
Those mice become resistant to insulin signaling. One possibility could be to cross
the ERRα‐null mice with the mice overexpressing Gfat, to evaluate the role of ERRα
in the HBP activity. Since ERRα targets Uap1, Glyat, Ogt and Mgea5 genes, all
downstream to Gfat, it would be interesting to see if the HBP flux is stopped due to a
low level in their expressions. Another possibility is to try a high glucose or
glucosamine diet with the ERRα‐null mice and assess if the HBP is more affected in
the presence or the absence of ERRα.
As a regulator of Ogt and Oga, the two enzymes directly involve in O‐GlcNAc cycling,
we could expect to see a difference in proteins O‐GlcNAcylation in ERRα‐null mice.
Interestingly, even if the absence of ERRα results in a decrease in HBP gene
expression, there are more O‐GlcNAcylated proteins. This suggests that other
players may be involved in O‐GlcNAc cycling. In fact, Ogt enzyme does not act alone
to regulate the addition of O‐GlcNAc on thousands of proteins. It is well known that
53
Ogt specificity and activity occurs through its partners. In fact, Ogt has 9 to 12
tetratricopeptide repeat (TPR) in its N‐terminal domain and they are essential for its
activity, because they allow interactions with other proteins (Lubas and Hanover
2000; Iyer and Hart 2003). Several proteins interact with Ogt through its TPRs
domain, and some recent publications listed Ogt‐interacting proteins and
demonstrated their importance in Ogt activity (Yang et al. 2002; Cheung et al. 2008;
Chikanishi et al. 2010). Interestingly, a few of the Ogt‐interacting proteins are ERRα
targets, such as Basigin, Pard6 and Sin3a (Charest‐Marcotte et al. 2010). It is a
possibility that one of the Ogt‐interacting proteins is drastically downregulated in
ERRα‐null mice, resulting in a decrease in Ogt activity. This could explain why we
observe more O‐GlcNAcylated proteins in absence of ERRα, even if the HBP
expression decreases. Briefly, it should be noted that the regulation of O‐GlcNAc
cycling is more complicated than only expression of Ogt or Oga. Their activities are
dependent on the presence of other proteins. We identified here the orphan NR
ERRα as a regulator of Ogt and Oga expression, but it seems to also regulate other
proteins involved in O‐GlcNAc cycling.
The increase in O‐GlcNAcylated proteins can be observed when we look to an
overview of proteins in ERRα‐null mice, but also on specific proteins. In fact, Akt
immunoprecipitation revealed that it is more O‐GlcNAcylated in the ERRα‐null mice
compare to the WT. However, this phenotype was really more obvious with one Akt‐
interacting protein, Mortalin. It was already established that Mortalin and Akt can
interact together, but the significance of this interaction is poorly documented
(Vandermoere et al. 2007). Moreover, Mortalin was also reported to be O‐
GlcNAcylated, but the effect of this PTM was not studied further (Walgren et al.
2003). Mortalin is a major chaperone involved in import of proteins from the
cytoplasm to the mitochondria (Schneider et al. 1994; Wadhwa et al. 2005; Deocaris
et al. 2006). Interestingly, numerous ERRα target genes are encoded by the nuclear
genome, but act into the mitochondria, such as OXPHOS and TCA cycle enzymes.
Further studies need to be done, but downregulation of metabolic gene due to lack
54
of ERRα could be compensated by a change in Mortalin activity. Even if we don’t
know yet about what happens to Mortalin when O‐GlcNAcylated, we can raise the
hypothesis that as an important regulator of metabolic gene acting in mitochondria,
ERRα also modulates, through PTM, the activity of Mortalin, the protein in charge of
the import of its targets into the mitochondria.
In addition to O‐GlcNAcylation, Mortalin can also be phosphorylated. Mortalin
phosphorylation has been characterized in a few studies, but on tyrosine residues,
which cannot be modified by O‐GlcNAc (Mizukoshi et al. 2001). Recently, a group
reported that Mortalin can also be phosphorylated on Thr 62 and Ser 65, and those
phosphorylations are important for Mortalin localization to the centrosome and
induction of its duplication (Kanai et al. 2007). Since there is often a competition
between phosphorylation and O‐GlcNAcylation, it would be of high interest to
eveluate if this site can be modified by O‐GlcNAc and assess the consequences on
Mortalin activity (Hart et al. 2007; Wang et al. 2008). Since ERRα regulates
transcription of important metabolic genes that are required for cell proliferation,
Mortalin O‐GlcNAcylation could be a way to signal the energetic status of the cells,
thus limiting the proliferation. As mentioned previously, the HBP is an energy and
nutrient sensor. So, the absence of ERRα could be signal through Mortalin O‐
GlcNAcylation, to modulate cell proliferation or mitochondria activity.
In addition to HBP, ERRα targets the Hspa9 promoter, the gene encoding for
Mortalin. Moreover, in absence of ERRα, Mortalin mRNA expression decreased,
suggesting a role for ERRα in Motalin transcriptional regulation. In fact, ERRα
targets Hspa9 expression and regulates O‐GlcNAcylation, suggesting a biphasic
regulation of Mortalin by ERRα. As an HBP regulator, ERRα can control PTM of its
targets through O‐GlcNAcylation. This can be observed with an increase in Mortalin
O‐GlcNAcylation in absence of ERRα. Moreover, Mortalin is not the only ERRα
targets to be O‐GlcNAcylated. For example, nucleoporin 153, lactate dehydrogenase
B and atrophin‐1, all ERRα targets, are also O‐GlcNAcylated proteins (Teo et al.
55
2010a). Therefore, the role of ERRα seems to not be limited to transcription
regulation, but also to induction of O‐GlcNAc PTM, through regulation of the HBP.
More studies need to be done to evaluate if it is the case for other ERRα targets, but
we demonstrate here that one of ERRα’s target, Mortalin, is more O‐GlcNAcylated in
its absence. Since O‐GlcNAcylation affects the activity of the modified proteins, ERRα
could enhance transcription of its targets, as well as HBP genes, to modulate the
activity of its targets through PTM.
Taken together, the results confirm ERRα as a major regulator of bioenergy genes.
This orphan NR modulates the HBP expression and activity. Furthermore, it targets
Mortalin, a mitochondrial chaperone involved in protein import, and is implicated in
its O‐GlcNAcylation.
56
CONCLUSION
In this study, we have demonstrated that the energy sensing pathway HBP is an
ERRα’s target. In fact, ERRα regulates expression of several enzymes involved in this
pathway, which shows the importance of ERRα in bioenergy regulation. In addition
to the HBP, ERRα also regulates the expression of the mitochondrial chaperone
Mortalin, through binding to its promoter. Moreover, in absence of ERRα, proteins
are less O‐GlcNAcylated, which was particularly observed on Mortalin. This shows
that ERRα can regulates Mortalin status in synergy, by enhancing its transcription
through binding to its promoter and by regulation its O‐GlcNAcylation, by regulation
of expression of the HBP.
57
REFERENCE
Alaynick, W.A. 2008. Nuclear receptors, mitochondria and lipid metabolism. Mitochondrion 8(4): 329‐337.
Alaynick, W.A., Kondo, R.P., Xie, W., He, W., Dufour, C.R., Downes, M., Jonker, J.W., Giles, W., Naviaux, R.K., Giguere, V. et al. 2007. ERRgamma directs and maintains the transition to oxidative metabolism in the postnatal heart. Cell Metab 6(1): 13‐24.
Anthonisen, E.H., Berven, L., Holm, S., Nygard, M., Nebb, H.I., and Gronning‐Wang, L.M. 2010. Nuclear receptor liver X receptor is O‐GlcNAc‐modified in response to glucose. J Biol Chem 285(3): 1607‐1615.
Ariazi, E.A., Clark, G.M., and Mertz, J.E. 2002. Estrogen‐related receptor alpha and estrogen‐related receptor gamma associate with unfavorable and favorable biomarkers, respectively, in human breast cancer. Cancer Res 62(22): 6510‐6518.
Augereau, P., Badia, E., Carascossa, S., Castet, A., Fritsch, S., Harmand, P.O., Jalaguier, S., and Cavailles, V. 2006. The nuclear receptor transcriptional coregulator RIP140. Nucl Recept Signal 4: e024.
Barish, G.D., Downes, M., Alaynick, W.A., Yu, R.T., Ocampo, C.B., Bookout, A.L., Mangelsdorf, D.J., and Evans, R.M. 2005. A Nuclear Receptor Atlas: macrophage activation. Mol Endocrinol 19(10): 2466‐2477.
Barry, J.B. and Giguere, V. 2005. Epidermal growth factor‐induced signaling in breast cancer cells results in selective target gene activation by orphan nuclear receptor estrogen‐related receptor alpha. Cancer Res 65(14): 6120‐6129.
Bhattacharyya, T., Karnezis, A.N., Murphy, S.P., Hoang, T., Freeman, B.C., Phillips, B., and Morimoto, R.I. 1995. Cloning and subcellular localization of human mitochondrial hsp70. J Biol Chem 270(4): 1705‐1710.
Blatch, G.L. and Lassle, M. 1999. The tetratricopeptide repeat: a structural motif mediating protein‐protein interactions. Bioessays 21(11): 932‐939.
Busch, B.B., Stevens, W.C., Jr., Martin, R., Ordentlich, P., Zhou, S., Sapp, D.W., Horlick, R.A., and Mohan, R. 2004. Identification of a selective inverse agonist for the orphan nuclear receptor estrogen‐related receptor alpha. J Med Chem 47(23): 5593‐5596.
Butkinaree, C., Park, K., and Hart, G.W. O‐linked beta‐N‐acetylglucosamine (O‐GlcNAc): Extensive crosstalk with phosphorylation to regulate signaling and transcription in response to nutrients and stress. Biochim Biophys Acta 1800(2): 96‐106.
Caldwell, S.A., Jackson, S.R., Shahriari, K.S., Lynch, T.P., Sethi, G., Walker, S., Vosseller, K., and Reginato, M.J. 2010. Nutrient sensor O‐GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1. Oncogene.
Castet, A., Herledan, A., Bonnet, S., Jalaguier, S., Vanacker, J.M., and Cavailles, V. 2006. Receptor‐interacting protein 140 differentially regulates estrogen receptor‐related receptor transactivation depending on target genes. Mol Endocrinol 20(5): 1035‐1047.
58
Charest‐Marcotte, A., Dufour, C.R., Wilson, B.J., Tremblay, A.M., Eichner, L.J., Arlow, D.H., Mootha, V.K., and Giguere, V. 2010. The homeobox protein Prox1 is a negative modulator of ERR{alpha}/PGC‐1{alpha} bioenergetic functions. Genes Dev 24(6): 537‐542.
Chen, J.D. and Evans, R.M. 1995. A transcriptional co‐repressor that interacts with nuclear hormone receptors. Nature 377(6548): 454‐457.
Chen, S., Zhou, D., Yang, C., and Sherman, M. 2001. Molecular basis for the constitutive activity of estrogen‐related receptor alpha‐1. J Biol Chem 276(30): 28465‐28470.
Cheung, W.D., Sakabe, K., Housley, M.P., Dias, W.B., and Hart, G.W. 2008. O‐linked beta‐N‐acetylglucosaminyltransferase substrate specificity is regulated by myosin phosphatase targeting and other interacting proteins. J Biol Chem 283(49): 33935‐33941.
Chikanishi, T., Fujiki, R., Hashiba, W., Sekine, H., Yokoyama, A., and Kato, S. 2010. Glucose‐induced expression of MIP‐1 genes requires O‐GlcNAc transferase in monocytes. Biochem Biophys Res Commun 394(4): 865‐870.
Chou, T.Y., Dang, C.V., and Hart, G.W. 1995a. Glycosylation of the c‐Myc transactivation domain. Proc Natl Acad Sci U S A 92(10): 4417‐4421.
Chou, T.Y., Hart, G.W., and Dang, C.V. 1995b. c‐Myc is glycosylated at threonine 58, a known phosphorylation site and a mutational hot spot in lymphomas. J Biol Chem 270(32): 18961‐18965.
Comer, F.I. and Hart, G.W. 2001. Reciprocity between O‐GlcNAc and O‐phosphate on the carboxyl terminal domain of RNA polymerase II. Biochemistry 40(26): 7845‐7852.
Craig, E.A., Kramer, J., and Kosic‐Smithers, J. 1987. SSC1, a member of the 70‐kDa heat shock protein multigene family of Saccharomyces cerevisiae, is essential for growth. Proc Natl Acad Sci U S A 84(12): 4156‐4160.
Crook, E.D., Daniels, M.C., Smith, T.M., and McClain, D.A. 1993. Regulation of insulin‐stimulated glycogen synthase activity by overexpression of glutamine: fructose‐6‐phosphate amidotransferase in rat‐1 fibroblasts. Diabetes 42(9): 1289‐1296.
De Mena, L., Coto, E., Sanchez‐Ferrero, E., Ribacoba, R., Guisasola, L.M., Salvador, C., Blazquez, M., and Alvarez, V. 2009. Mutational screening of the mortalin gene (HSPA9) in Parkinson's disease. J Neural Transm 116(10): 1289‐1293.
Deblois, G. and Giguere, V. 2008. Nuclear receptor location analyses in mammalian genomes: from gene regulation to regulatory networks. Mol Endocrinol 22(9): 1999‐2011.
Deblois, G., Hall, J.A., Perry, M.C., Laganiere, J., Ghahremani, M., Park, M., Hallett, M., and Giguere, V. 2009. Genome‐wide identification of direct target genes implicates estrogen‐related receptor alpha as a determinant of breast cancer heterogeneity. Cancer Res 69(15): 6149‐6157.
Delvecchio, C.J. and Capone, J.P. 2008. Protein kinase C alpha modulates liver X receptor alpha transactivation. J Endocrinol 197(1): 121‐130.
Dentin, R., Hedrick, S., Xie, J., Yates, J., 3rd, and Montminy, M. 2008. Hepatic glucose sensing via the CREB coactivator CRTC2. Science 319(5868): 1402‐1405.
59
Deocaris, C.C., Kaul, S.C., and Wadhwa, R. 2006. On the brotherhood of the mitochondrial chaperones mortalin and heat shock protein 60. Cell Stress Chaperones 11(2): 116‐128.
‐. 2008a. From proliferative to neurological role of an hsp70 stress chaperone, mortalin. Biogerontology 9(6): 391‐403.
Deocaris, C.C., Takano, S., Priyandoko, D., Kaul, Z., Yaguchi, T., Kraft, D.C., Yamasaki, K., Kaul, S.C., and Wadhwa, R. 2008b. Glycerol stimulates innate chaperoning, proteasomal and stress‐resistance functions: implications for geronto‐manipulation. Biogerontology 9(4): 269‐282.
Deroo, B.J. and Korach, K.S. 2006. Estrogen receptors and human disease. J Clin Invest 116(3): 561‐570.
Dias, W.B., Cheung, W.D., Wang, Z., and Hart, G.W. 2009. Regulation of calcium/calmodulin‐dependent kinase IV by O‐GlcNAc modification. J Biol Chem 284(32): 21327‐21337.
Dias, W.B. and Hart, G.W. 2007. O‐GlcNAc modification in diabetes and Alzheimer's disease. Mol Biosyst 3(11): 766‐772.
Domanico, S.Z., DeNagel, D.C., Dahlseid, J.N., Green, J.M., and Pierce, S.K. 1993. Cloning of the gene encoding peptide‐binding protein 74 shows that it is a new member of the heat shock protein 70 family. Mol Cell Biol 13(6): 3598‐3610.
Dufour, C.R., Wilson, B.J., Huss, J.M., Kelly, D.P., Alaynick, W.A., Downes, M., Evans, R.M., Blanchette, M., and Giguere, V. 2007. Genome‐wide orchestration of cardiac functions by the orphan nuclear receptors ERRalpha and gamma. Cell Metab 5(5): 345‐356.
Dundas, S.R., Lawrie, L.C., Rooney, P.H., and Murray, G.I. 2005. Mortalin is over‐expressed by colorectal adenocarcinomas and correlates with poor survival. J Pathol 205(1): 74‐81.
Eudy, J.D., Yao, S., Weston, M.D., Ma‐Edmonds, M., Talmadge, C.B., Cheng, J.J., Kimberling, W.J., and Sumegi, J. 1998. Isolation of a gene encoding a novel member of the nuclear receptor superfamily from the critical region of Usher syndrome type IIa at 1q41. Genomics 50(3): 382‐384.
Evans, R.M. 1988. The steroid and thyroid hormone receptor superfamily. Science 240(4854): 889‐895.
Evans, R.M., Barish, G.D., and Wang, Y.X. 2004. PPARs and the complex journey to obesity. Nat Med 10(4): 355‐361.
Gaillard, S., Grasfeder, L.L., Haeffele, C.L., Lobenhofer, E.K., Chu, T.M., Wolfinger, R., Kazmin, D., Koves, T.R., Muoio, D.M., Chang, C.Y. et al. 2006. Receptor‐selective coactivators as tools to define the biology of specific receptor‐coactivator pairs. Mol Cell 24(5): 797‐803.
Giguere, V. 1999. Orphan nuclear receptors: from gene to function. Endocr Rev 20(5): 689‐725.
‐. 2008. Transcriptional control of energy homeostasis by the estrogen‐related receptors. Endocr Rev 29(6): 677‐696.
Giguere, V., Yang, N., Segui, P., and Evans, R.M. 1988. Identification of a new class of steroid hormone receptors. Nature 331(6151): 91‐94.
60
Gofflot, F., Chartoire, N., Vasseur, L., Heikkinen, S., Dembele, D., Le Merrer, J., and Auwerx, J. 2007. Systematic gene expression mapping clusters nuclear receptors according to their function in the brain. Cell 131(2): 405‐418.
Goldberg, H.J., Whiteside, C.I., Hart, G.W., and Fantus, I.G. 2006. Posttranslational, reversible O‐glycosylation is stimulated by high glucose and mediates plasminogen activator inhibitor‐1 gene expression and Sp1 transcriptional activity in glomerular mesangial cells. Endocrinology 147(1): 222‐231.
Greschik, H., Wurtz, J.M., Sanglier, S., Bourguet, W., van Dorsselaer, A., Moras, D., and Renaud, J.P. 2002. Structural and functional evidence for ligand‐independent transcriptional activation by the estrogen‐related receptor 3. Mol Cell 9(2): 303‐313.
Haltiwanger, R.S., Blomberg, M.A., and Hart, G.W. 1992. Glycosylation of nuclear and cytoplasmic proteins. Purification and characterization of a uridine diphospho‐N‐acetylglucosamine:polypeptide beta‐N‐acetylglucosaminyltransferase. J Biol Chem 267(13): 9005‐9013.
Han, I. and Kudlow, J.E. 1997. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility. Mol Cell Biol 17(5): 2550‐2558.
Hanover, J.A., Krause, M.W., and Love, D.C. 2010. The hexosamine signaling pathway: O‐GlcNAc cycling in feast or famine. Biochim Biophys Acta 1800(2): 80‐95.
Hanover, J.A., Yu, S., Lubas, W.B., Shin, S.H., Ragano‐Caracciola, M., Kochran, J., and Love, D.C. 2003. Mitochondrial and nucleocytoplasmic isoforms of O‐linked GlcNAc transferase encoded by a single mammalian gene. Arch Biochem Biophys 409(2): 287‐297.
Hart, G.W., Haltiwanger, R.S., Holt, G.D., and Kelly, W.G. 1989. Glycosylation in the nucleus and cytoplasm. Annu Rev Biochem 58: 841‐874.
Hart, G.W., Housley, M.P., and Slawson, C. 2007. Cycling of O‐linked beta‐N‐acetylglucosamine on nucleocytoplasmic proteins. Nature 446(7139): 1017‐1022.
Heard, D.J., Norby, P.L., Holloway, J., and Vissing, H. 2000. Human ERRgamma, a third member of the estrogen receptor‐related receptor (ERR) subfamily of orphan nuclear receptors: tissue‐specific isoforms are expressed during development and in the adult. Mol Endocrinol 14(3): 382‐392.
Hebert, L.F., Jr., Daniels, M.C., Zhou, J., Crook, E.D., Turner, R.L., Simmons, S.T., Neidigh, J.L., Zhu, J.S., Baron, A.D., and McClain, D.A. 1996. Overexpression of glutamine:fructose‐6‐phosphate amidotransferase in transgenic mice leads to insulin resistance. J Clin Invest 98(4): 930‐936.
Heck, S., Rom, J., Thewes, V., Becker, N., Blume, B., Sinn, H.P., Deuschle, U., Sohn, C., Schneeweiss, A., and Lichter, P. 2009. Estrogen‐related receptor alpha expression and function is associated with the transcriptional coregulator AIB1 in breast carcinoma. Cancer Res 69(12): 5186‐5193.
Holt, G.D. and Hart, G.W. 1986. The subcellular distribution of terminal N‐acetylglucosamine moieties. Localization of a novel protein‐saccharide linkage, O‐linked GlcNAc. J Biol Chem 261(17): 8049‐8057.
Holt, G.D., Snow, C.M., Senior, A., Haltiwanger, R.S., Gerace, L., and Hart, G.W. 1987. Nuclear pore complex glycoproteins contain cytoplasmically disposed O‐linked N‐acetylglucosamine. J Cell Biol 104(5): 1157‐1164.
61
Hong, H., Yang, L., and Stallcup, M.R. 1999. Hormone‐independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Biol Chem 274(32): 22618‐22626.
Horlein, A.J., Naar, A.M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C.K. et al. 1995. Ligand‐independent repression by the thyroid hormone receptor mediated by a nuclear receptor co‐repressor. Nature 377(6548): 397‐404.
Housley, M.P., Udeshi, N.D., Rodgers, J.T., Shabanowitz, J., Puigserver, P., Hunt, D.F., and Hart, G.W. 2009. A PGC‐1alpha‐O‐GlcNAc transferase complex regulates FoxO transcription factor activity in response to glucose. J Biol Chem 284(8): 5148‐5157.
Huss, J.M., Imahashi, K., Dufour, C.R., Weinheimer, C.J., Courtois, M., Kovacs, A., Giguere, V., Murphy, E., and Kelly, D.P. 2007. The nuclear receptor ERRalpha is required for the bioenergetic and functional adaptation to cardiac pressure overload. Cell Metab 6(1): 25‐37.
Huss, J.M., Kopp, R.P., and Kelly, D.P. 2002. Peroxisome proliferator‐activated receptor coactivator‐1alpha (PGC‐1alpha) coactivates the cardiac‐enriched nuclear receptors estrogen‐related receptor‐alpha and ‐gamma. Identification of novel leucine‐rich interaction motif within PGC‐1alpha. J Biol Chem 277(43): 40265‐40274.
Huss, J.M., Torra, I.P., Staels, B., Giguere, V., and Kelly, D.P. 2004. Estrogen‐related receptor alpha directs peroxisome proliferator‐activated receptor alpha signaling in the transcriptional control of energy metabolism in cardiac and skeletal muscle. Mol Cell Biol 24(20): 9079‐9091.
Iosefson, O. and Azem, A. 2010. Reconstitution of the mitochondrial Hsp70 (mortalin)‐p53 interaction using purified proteins‐‐identification of additional interacting regions. FEBS Lett 584(6): 1080‐1084.
Iyer, S.P., Akimoto, Y., and Hart, G.W. 2003. Identification and cloning of a novel family of coiled‐coil domain proteins that interact with O‐GlcNAc transferase. J Biol Chem 278(7): 5399‐5409.
Iyer, S.P. and Hart, G.W. 2003. Roles of the tetratricopeptide repeat domain in O‐GlcNAc transferase targeting and protein substrate specificity. J Biol Chem 278(27): 24608‐24616.
James, L.R., Tang, D., Ingram, A., Ly, H., Thai, K., Cai, L., and Scholey, J.W. 2002. Flux through the hexosamine pathway is a determinant of nuclear factor kappaB‐ dependent promoter activation. Diabetes 51(4): 1146‐1156.
Jin, J., Hulette, C., Wang, Y., Zhang, T., Pan, C., Wadhwa, R., and Zhang, J. 2006. Proteomic identification of a stress protein, mortalin/mthsp70/GRP75: relevance to Parkinson disease. Mol Cell Proteomics 5(7): 1193‐1204.
Jin, J., Li, G.J., Davis, J., Zhu, D., Wang, Y., Pan, C., and Zhang, J. 2007. Identification of novel proteins associated with both alpha‐synuclein and DJ‐1. Mol Cell Proteomics 6(5): 845‐859.
Kallen, J., Lattmann, R., Beerli, R., Blechschmidt, A., Blommers, M.J., Geiser, M., Ottl, J., Schlaeppi, J.M., Strauss, A., and Fournier, B. 2007. Crystal structure of human estrogen‐related receptor alpha in complex with a synthetic inverse agonist reveals its novel molecular mechanism. J Biol Chem 282(32): 23231‐23239.
62
Kallen, J., Schlaeppi, J.M., Bitsch, F., Filipuzzi, I., Schilb, A., Riou, V., Graham, A., Strauss, A., Geiser, M., and Fournier, B. 2004. Evidence for ligand‐independent transcriptional activation of the human estrogen‐related receptor alpha (ERRalpha): crystal structure of ERRalpha ligand binding domain in complex with peroxisome proliferator‐activated receptor coactivator‐1alpha. J Biol Chem 279(47): 49330‐49337.
Kamei, Y., Ohizumi, H., Fujitani, Y., Nemoto, T., Tanaka, T., Takahashi, N., Kawada, T., Miyoshi, M., Ezaki, O., and Kakizuka, A. 2003. PPARgamma coactivator 1beta/ERR ligand 1 is an ERR protein ligand, whose expression induces a high‐energy expenditure and antagonizes obesity. Proc Natl Acad Sci U S A 100(21): 12378‐12383.
Kanai, M., Ma, Z., Izumi, H., Kim, S.H., Mattison, C.P., Winey, M., and Fukasawa, K. 2007. Physical and functional interaction between mortalin and Mps1 kinase. Genes Cells 12(6): 797‐810.
Kang, E.S., Han, D., Park, J., Kwak, T.K., Oh, M.A., Lee, S.A., Choi, S., Park, Z.Y., Kim, Y., and Lee, J.W. 2008. O‐GlcNAc modulation at Akt1 Ser473 correlates with apoptosis of murine pancreatic beta cells. Exp Cell Res 314(11‐12): 2238‐2248.
Kaul, S.C., Deocaris, C.C., and Wadhwa, R. 2007. Three faces of mortalin: a housekeeper, guardian and killer. Exp Gerontol 42(4): 263‐274.
Kim, H.S., Kim, E.M., Lee, J., Yang, W.H., Park, T.Y., Kim, Y.M., and Cho, J.W. 2006. Heat shock protein 60 modified with O‐linked N‐acetylglucosamine is involved in pancreatic beta‐cell death under hyperglycemic conditions. FEBS Lett 580(9): 2311‐2316.
Knutti, D., Kaul, A., and Kralli, A. 2000. A tissue‐specific coactivator of steroid receptors, identified in a functional genetic screen. Mol Cell Biol 20(7): 2411‐2422.
Kreppel, L.K., Blomberg, M.A., and Hart, G.W. 1997. Dynamic glycosylation of nuclear and cytosolic proteins. Cloning and characterization of a unique O‐GlcNAc transferase with multiple tetratricopeptide repeats. J Biol Chem 272(14): 9308‐9315.
Kressler, D., Schreiber, S.N., Knutti, D., and Kralli, A. 2002. The PGC‐1‐related protein PERC is a selective coactivator of estrogen receptor alpha. J Biol Chem 277(16): 13918‐13925.
Laganiere, J., Tremblay, G.B., Dufour, C.R., Giroux, S., Rousseau, F., and Giguere, V. 2004. A polymorphic autoregulatory hormone response element in the human estrogen‐related receptor alpha (ERRalpha) promoter dictates peroxisome proliferator‐activated receptor gamma coactivator‐1alpha control of ERRalpha expression. J Biol Chem 279(18): 18504‐18510.
Li, X., Lu, F., Wang, J.Z., and Gong, C.X. 2006. Concurrent alterations of O‐GlcNAcylation and phosphorylation of tau in mouse brains during fasting. Eur J Neurosci 23(8): 2078‐2086.
Li, X., Zhang, S., Blander, G., Tse, J.G., Krieger, M., and Guarente, L. 2007. SIRT1 deacetylates and positively regulates the nuclear receptor LXR. Mol Cell 28(1): 91‐106.
63
Lin, J.D. 2009. Minireview: the PGC‐1 coactivator networks: chromatin‐remodeling and mitochondrial energy metabolism. Mol Endocrinol 23(1): 2‐10.
Liu, F., Shi, J., Tanimukai, H., Gu, J., Grundke‐Iqbal, I., Iqbal, K., and Gong, C.X. 2009. Reduced O‐GlcNAcylation links lower brain glucose metabolism and tau pathology in Alzheimer's disease. Brain 132(Pt 7): 1820‐1832.
Love, D.C. and Hanover, J.A. 2005. The hexosamine signaling pathway: deciphering the "O‐GlcNAc code". Sci STKE 2005(312): re13.
Love, D.C., Krause, M.W., and Hanover, J.A. 2010. O‐GlcNAc cycling: Emerging Roles in Development and Epigenetics. Semin Cell Dev Biol.
Lubas, W.A., Frank, D.W., Krause, M., and Hanover, J.A. 1997. O‐Linked GlcNAc transferase is a conserved nucleocytoplasmic protein containing tetratricopeptide repeats. J Biol Chem 272(14): 9316‐9324.
Lubas, W.A. and Hanover, J.A. 2000. Functional expression of O‐linked GlcNAc transferase. Domain structure and substrate specificity. J Biol Chem 275(15): 10983‐10988.
Luo, J., Sladek, R., Carrier, J., Bader, J.A., Richard, D., and Giguere, V. 2003. Reduced fat mass in mice lacking orphan nuclear receptor estrogen‐related receptor alpha. Mol Cell Biol 23(22): 7947‐7956.
Ma, Z., Izumi, H., Kanai, M., Kabuyama, Y., Ahn, N.G., and Fukasawa, K. 2006. Mortalin controls centrosome duplication via modulating centrosomal localization of p53. Oncogene 25(39): 5377‐5390.
Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P. et al. 1995. The nuclear receptor superfamily: the second decade. Cell 83(6): 835‐839.
McClain, D.A. and Crook, E.D. 1996. Hexosamines and insulin resistance. Diabetes 45(8): 1003‐1009.
Mizukoshi, E., Suzuki, M., Misono, T., Loupatov, A., Munekata, E., Kaul, S.C., Wadhwa, R., and Imamura, T. 2001. Cell‐cycle dependent tyrosine phosphorylation on mortalin regulates its interaction with fibroblast growth factor‐1. Biochem Biophys Res Commun 280(4): 1203‐1209.
Mootha, V.K., Handschin, C., Arlow, D., Xie, X., St Pierre, J., Sihag, S., Yang, W., Altshuler, D., Puigserver, P., Patterson, N. et al. 2004. Erralpha and Gabpa/b specify PGC‐1alpha‐dependent oxidative phosphorylation gene expression that is altered in diabetic muscle. Proc Natl Acad Sci U S A 101(17): 6570‐6575.
Nanashima, N., Asano, J., Hayakari, M., Nakamura, T., Nakano, H., Yamada, T., Shimizu, T., Akita, M., Fan, Y., and Tsuchida, S. 2005. Nuclear localization of STAT5A modified with O‐linked N‐acetylglucosamine and early involution in the mammary gland of Hirosaki hairless rat. J Biol Chem 280(52): 43010‐43016.
O'Donnell, N., Zachara, N.E., Hart, G.W., and Marth, J.D. 2004. Ogt‐dependent X‐chromosome‐linked protein glycosylation is a requisite modification in somatic cell function and embryo viability. Mol Cell Biol 24(4): 1680‐1690.
Okuyama, R. and Marshall, S. 2004. Potential regulation of nuclear UDP‐N‐acetylglucosaminyl transferase (OGT) by substrate availability: ability of
64
chromatin protein to bind UDP‐N‐acetylglucosamine and reduce OGT‐mediated O‐Linked glycosylation. Biol Pharm Bull 27(8): 1293‐1296.
Onate, S.A., Tsai, S.Y., Tsai, M.J., and O'Malley, B.W. 1995. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270(5240): 1354‐1357.
Overington, J.P., Al‐Lazikani, B., and Hopkins, A.L. 2006. How many drug targets are there? Nat Rev Drug Discov 5(12): 993‐996.
Park, K., Saudek, C.D., and Hart, G.W. 2010. Increased Expression of {beta}‐N‐Acetylglucosamindase (O‐GlcNAcase) in Erythrocytes from Individuals with Pre‐diabetes and Diabetes. Diabetes.
Parker, G.J., Lund, K.C., Taylor, R.P., and McClain, D.A. 2003. Insulin resistance of glycogen synthase mediated by o‐linked N‐acetylglucosamine. J Biol Chem 278(12): 10022‐10027.
Pilzer, D., Saar, M., Koya, K., and Fishelson, Z. 2010. Mortalin inhibitors sensitize K562 leukemia cells to complement‐dependent cytotoxicity. Int J Cancer 126(6): 1428‐1435.
Pratt, W.B. and Toft, D.O. 1997. Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocr Rev 18(3): 306‐360.
Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O'Malley, B., and Spiegelman, B.M. 1999. Activation of PPARgamma coactivator‐1 through transcription factor docking. Science 286(5443): 1368‐1371.
Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., and Spiegelman, B.M. 1998. A cold‐inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92(6): 829‐839.
Ran, Q., Wadhwa, R., Kawai, R., Kaul, S.C., Sifers, R.N., Bick, R.J., Smith, J.R., and Pereira‐Smith, O.M. 2000. Extramitochondrial localization of mortalin/mthsp70/PBP74/GRP75. Biochem Biophys Res Commun 275(1): 174‐179.
Savel'ev, A.S., Novikova, L.A., Kovaleva, I.E., Luzikov, V.N., Neupert, W., and Langer, T. 1998. ATP‐dependent proteolysis in mitochondria. m‐AAA protease and PIM1 protease exert overlapping substrate specificities and cooperate with the mtHsp70 system. J Biol Chem 273(32): 20596‐20602.
Sayat, R., Leber, B., Grubac, V., Wiltshire, L., and Persad, S. 2008. O‐GlcNAc‐glycosylation of beta‐catenin regulates its nuclear localization and transcriptional activity. Exp Cell Res 314(15): 2774‐2787.
Schneider, H.C., Berthold, J., Bauer, M.F., Dietmeier, K., Guiard, B., Brunner, M., and Neupert, W. 1994. Mitochondrial Hsp70/MIM44 complex facilitates protein import. Nature 371(6500): 768‐774.
Schreiber, S.N., Emter, R., Hock, M.B., Knutti, D., Cardenas, J., Podvinec, M., Oakeley, E.J., and Kralli, A. 2004. The estrogen‐related receptor alpha (ERRalpha) functions in PPARgamma coactivator 1alpha (PGC‐1alpha)‐induced mitochondrial biogenesis. Proc Natl Acad Sci U S A 101(17): 6472‐6477.
Schreiber, S.N., Knutti, D., Brogli, K., Uhlmann, T., and Kralli, A. 2003. The transcriptional coactivator PGC‐1 regulates the expression and activity of the orphan nuclear receptor estrogen‐related receptor alpha (ERRalpha). J Biol Chem 278(11): 9013‐9018.
65
Shafi, R., Iyer, S.P., Ellies, L.G., O'Donnell, N., Marek, K.W., Chui, D., Hart, G.W., and Marth, J.D. 2000. The O‐GlcNAc transferase gene resides on the X chromosome and is essential for embryonic stem cell viability and mouse ontogeny. Proc Natl Acad Sci U S A 97(11): 5735‐5739.
Sladek, R., Bader, J.A., and Giguere, V. 1997. The orphan nuclear receptor estrogen‐related receptor alpha is a transcriptional regulator of the human medium‐chain acyl coenzyme A dehydrogenase gene. Mol Cell Biol 17(9): 5400‐5409.
Slawson, C., Lakshmanan, T., Knapp, S., and Hart, G.W. 2008. A mitotic GlcNAcylation/phosphorylation signaling complex alters the posttranslational state of the cytoskeletal protein vimentin. Mol Biol Cell 19(10): 4130‐4140.
Slawson, C., Zachara, N.E., Vosseller, K., Cheung, W.D., Lane, M.D., and Hart, G.W. 2005. Perturbations in O‐linked beta‐N‐acetylglucosamine protein modification cause severe defects in mitotic progression and cytokinesis. J Biol Chem 280(38): 32944‐32956.
Sonoda, J., Laganiere, J., Mehl, I.R., Barish, G.D., Chong, L.W., Li, X., Scheffler, I.E., Mock, D.C., Bataille, A.R., Robert, F. et al. 2007. Nuclear receptor ERR alpha and coactivator PGC‐1 beta are effectors of IFN‐gamma‐induced host defense. Genes Dev 21(15): 1909‐1920.
Stein, R.A., Chang, C.Y., Kazmin, D.A., Way, J., Schroeder, T., Wergin, M., Dewhirst, M.W., and McDonnell, D.P. 2008. Estrogen‐related receptor alpha is critical for the growth of estrogen receptor‐negative breast cancer. Cancer Res 68(21): 8805‐8812.
Suzuki, T., Miki, Y., Moriya, T., Shimada, N., Ishida, T., Hirakawa, H., Ohuchi, N., and Sasano, H. 2004. Estrogen‐related receptor alpha in human breast carcinoma as a potent prognostic factor. Cancer Res 64(13): 4670‐4676.
Szabadkai, G., Bianchi, K., Varnai, P., De Stefani, D., Wieckowski, M.R., Cavagna, D., Nagy, A.I., Balla, T., and Rizzuto, R. 2006. Chaperone‐mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J Cell Biol 175(6): 901‐911.
Teo, C.F., Ingale, S., Wolfert, M.A., Elsayed, G.A., Not, L.G., Chatham, J.C., Wells, L., and Boons, G.J. 2010a. Glycopeptide‐specific monoclonal antibodies suggest new roles for O‐GlcNAc. Nat Chem Biol 6(5): 338‐343.
Teo, C.F., Wollaston‐Hayden, E.E., and Wells, L. 2010b. Hexosamine flux, the O‐GlcNAc modification, and the development of insulin resistance in adipocytes. Mol Cell Endocrinol 318(1‐2): 44‐53.
Torres, C.R. and Hart, G.W. 1984. Topography and polypeptide distribution of terminal N‐acetylglucosamine residues on the surfaces of intact lymphocytes. Evidence for O‐linked GlcNAc. J Biol Chem 259(5): 3308‐3317.
Tremblay, A., Tremblay, G.B., Labrie, F., and Giguere, V. 1999. Ligand‐independent recruitment of SRC‐1 to estrogen receptor beta through phosphorylation of activation function AF‐1. Mol Cell 3(4): 513‐519.
Tremblay, A.M., Dufour, C.R., Ghahremani, M., Reudelhuber, T.L., and Giguere, V. 2010. Physiological genomics identifies estrogen‐related receptor alpha as a regulator of renal sodium and potassium homeostasis and the renin‐angiotensin pathway. Mol Endocrinol 24(1): 22‐32.
66
Tremblay, A.M. and Giguere, V. 2007. The NR3B subgroup: an ovERRview. Nucl Recept Signal 5: e009.
Tremblay, A.M., Wilson, B.J., Yang, X.J., and Giguere, V. 2008. Phosphorylation‐dependent sumoylation regulates estrogen‐related receptor‐alpha and ‐gamma transcriptional activity through a synergy control motif. Mol Endocrinol 22(3): 570‐584.
Vanacker, J.M., Bonnelye, E., Delmarre, C., and Laudet, V. 1998. Activation of the thyroid hormone receptor alpha gene promoter by the orphan nuclear receptor ERR alpha. Oncogene 17(19): 2429‐2435.
Vanacker, J.M., Pettersson, K., Gustafsson, J.A., and Laudet, V. 1999. Transcriptional targets shared by estrogen receptor‐ related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta. EMBO J 18(15): 4270‐4279.
Vandermoere, F., El Yazidi‐Belkoura, I., Demont, Y., Slomianny, C., Antol, J., Lemoine, J., and Hondermarck, H. 2007. Proteomics exploration reveals that actin is a signaling target of the kinase Akt. Mol Cell Proteomics 6(1): 114‐124.
Villena, J.A., Hock, M.B., Chang, W.Y., Barcas, J.E., Giguere, V., and Kralli, A. 2007. Orphan nuclear receptor estrogen‐related receptor alpha is essential for adaptive thermogenesis. Proc Natl Acad Sci U S A 104(4): 1418‐1423.
Vosseller, K., Wells, L., Lane, M.D., and Hart, G.W. 2002. Elevated nucleocytoplasmic glycosylation by O‐GlcNAc results in insulin resistance associated with defects in Akt activation in 3T3‐L1 adipocytes. Proc Natl Acad Sci U S A 99(8): 5313‐5318.
Vu, E.H., Kraus, R.J., and Mertz, J.E. 2007. Phosphorylation‐dependent sumoylation of estrogen‐related receptor alpha1. Biochemistry 46(34): 9795‐9804.
Wadhwa, R., Kaul, S.C., Ikawa, Y., and Sugimoto, Y. 1993. Identification of a novel member of mouse hsp70 family. Its association with cellular mortal phenotype. J Biol Chem 268(9): 6615‐6621.
Wadhwa, R., Takano, S., Kaur, K., Aida, S., Yaguchi, T., Kaul, Z., Hirano, T., Taira, K., and Kaul, S.C. 2005. Identification and characterization of molecular interactions between mortalin/mtHsp70 and HSP60. Biochem J 391(Pt 2): 185‐190.
Wadhwa, R., Takano, S., Taira, K., and Kaul, S.C. 2004. Reduction in mortalin level by its antisense expression causes senescence‐like growth arrest in human immortalized cells. J Gene Med 6(4): 439‐444.
Wadhwa, R., Yaguchi, T., Hasan, M.K., Taira, K., and Kaul, S.C. 2003. Mortalin‐MPD (mevalonate pyrophosphate decarboxylase) interactions and their role in control of cellular proliferation. Biochem Biophys Res Commun 302(4): 735‐742.
Walgren, J.L., Vincent, T.S., Schey, K.L., and Buse, M.G. 2003. High glucose and insulin promote O‐GlcNAc modification of proteins, including alpha‐tubulin. Am J Physiol Endocrinol Metab 284(2): E424‐434.
Wang, Z., Gucek, M., and Hart, G.W. 2008. Cross‐talk between GlcNAcylation and phosphorylation: site‐specific phosphorylation dynamics in response to globally elevated O‐GlcNAc. Proc Natl Acad Sci U S A 105(37): 13793‐13798.
67
Warnmark, A., Treuter, E., Wright, A.P., and Gustafsson, J.A. 2003. Activation functions 1 and 2 of nuclear receptors: molecular strategies for transcriptional activation. Mol Endocrinol 17(10): 1901‐1909.
Webster, T.J., Naylor, D.J., Hartman, D.J., Hoj, P.B., and Hoogenraad, N.J. 1994. cDNA cloning and efficient mitochondrial import of pre‐mtHSP70 from rat liver. DNA Cell Biol 13(12): 1213‐1220.
Wells, L., Vosseller, K., and Hart, G.W. 2003. A role for N‐acetylglucosamine as a nutrient sensor and mediator of insulin resistance. Cell Mol Life Sci 60(2): 222‐228.
Wende, A.R., Huss, J.M., Schaeffer, P.J., Giguere, V., and Kelly, D.P. 2005. PGC‐1alpha coactivates PDK4 gene expression via the orphan nuclear receptor ERRalpha: a mechanism for transcriptional control of muscle glucose metabolism. Mol Cell Biol 25(24): 10684‐10694.
Willy, P.J., Murray, I.R., Qian, J., Busch, B.B., Stevens, W.C., Jr., Martin, R., Mohan, R., Zhou, S., Ordentlich, P., Wei, P. et al. 2004. Regulation of PPARgamma coactivator 1alpha (PGC‐1alpha) signaling by an estrogen‐related receptor alpha (ERRalpha) ligand. Proc Natl Acad Sci U S A 101(24): 8912‐8917.
Wilson, B.J., Tremblay, A.M., Deblois, G., Sylvain‐Drolet, G., and Giguere, V. 2010. An Acetylation Switch Modulates the Transcriptional Activity of Estrogen‐Related Receptor {alpha}. Mol Endocrinol.
Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C. et al. 1999. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC‐1. Cell 98(1): 115‐124.
Xie, W., Hong, H., Yang, N.N., Lin, R.J., Simon, C.M., Stallcup, M.R., and Evans, R.M. 1999. Constitutive activation of transcription and binding of coactivator by estrogen‐related receptors 1 and 2. Mol Endocrinol 13(12): 2151‐2162.
Yang, C., Zhou, D., and Chen, S. 1998. Modulation of aromatase expression in the breast tissue by ERR alpha‐1 orphan receptor. Cancer Res 58(24): 5695‐5700.
Yang, N., Shigeta, H., Shi, H., and Teng, C.T. 1996. Estrogen‐related receptor, hERR1, modulates estrogen receptor‐mediated response of human lactoferrin gene promoter. J Biol Chem 271(10): 5795‐5804.
Yang, W.H., Kim, J.E., Nam, H.W., Ju, J.W., Kim, H.S., Kim, Y.S., and Cho, J.W. 2006. Modification of p53 with O‐linked N‐acetylglucosamine regulates p53 activity and stability. Nat Cell Biol 8(10): 1074‐1083.
Yang, W.H., Park, S.Y., Nam, H.W., Kim do, H., Kang, J.G., Kang, E.S., Kim, Y.S., Lee, H.C., Kim, K.S., and Cho, J.W. 2008a. NFkappaB activation is associated with its O‐GlcNAcylation state under hyperglycemic conditions. Proc Natl Acad Sci U S A 105(45): 17345‐17350.
Yang, X., Ongusaha, P.P., Miles, P.D., Havstad, J.C., Zhang, F., So, W.V., Kudlow, J.E., Michell, R.H., Olefsky, J.M., Field, S.J. et al. 2008b. Phosphoinositide signalling links O‐GlcNAc transferase to insulin resistance. Nature 451(7181): 964‐969.
Yang, X., Zhang, F., and Kudlow, J.E. 2002. Recruitment of O‐GlcNAc transferase to promoters by corepressor mSin3A: coupling protein O‐GlcNAcylation to transcriptional repression. Cell 110(1): 69‐80.
68
Yi, X., Luk, J.M., Lee, N.P., Peng, J., Leng, X., Guan, X.Y., Lau, G.K., Beretta, L., and Fan, S.T. 2008. Association of mortalin (HSPA9) with liver cancer metastasis and prediction for early tumor recurrence. Mol Cell Proteomics 7(2): 315‐325.
Zachara, N.E. and Hart, G.W. 2006. Cell signaling, the essential role of O‐GlcNAc! Biochim Biophys Acta 1761(5‐6): 599‐617.
Zhou, D. and Chen, S. 2001. PNRC2 is a 16 kDa coactivator that interacts with nuclear receptors through an SH3‐binding motif. Nucleic Acids Res 29(19): 3939‐3948.
Zhou, D., Quach, K.M., Yang, C., Lee, S.Y., Pohajdak, B., and Chen, S. 2000. PNRC: a proline‐rich nuclear receptor coregulatory protein that modulates transcriptional activation of multiple nuclear receptors including orphan receptors SF1 (steroidogenic factor 1) and ERRalpha1 (estrogen related receptor alpha‐1). Mol Endocrinol 14(7): 986‐998.
Zvereff, V., Wang, J.C., Shun, K., Lacoste, J., and Chevrette, M. 2007. Colocalisation of CD9 and mortalin in CD9‐induced mitotic catastrophe in human prostate cancer cells. Br J Cancer 97(7): 941‐948.