at SciVerse ScienceDirect

Crop Protection 46 (2013) 70e79

Contents lists available

Crop Protection

journal homepage: www.elsevier .com/locate/cropro

Pathogenic and genetic diversity of Didymella rabiei affecting chickpeain Syria

Omar Atik a,d,*, Seid Ahmed b, Mathew M. Abang c, Muhammad Imtiaz b, Aladdin Hamwieh b,Michael Baumb, Ahmed El-Ahmed a, Samer Murad b, Mohammad M. Yabrak d

aDepartment of Plant Protection, Faculty of Agriculture, Aleppo University, Aleppo, Syriab International Center for Agricultural Research in the Dry Areas (ICARDA), P.O. Box 5466, Aleppo, Syriac International Center for Tropical Agriculture (CIAT), P.O. Box 6247, Kampala, UgandadAleppo Agricultural Research Center, General Commission for Scientific Agricultural Research, P.O. Box 4195 Aleppo, Syria

a r t i c l e i n f o

Article history:Received 12 June 2012Received in revised form7 December 2012Accepted 17 December 2012

Keywords:ChickpeaAscochyta blightDidymella rabieiGenetic diversitySyria

* Corresponding author. Aleppo Agricultural Reseasion for Scientific Agricultural Research, P.O. Box 419521 4647200; fax: þ963 (0)21 4644600.

E-mail address: omaratik5@gmail.com (O. Atik).

0261-2194/$ e see front matter � 2012 Elsevier Ltd.http://dx.doi.org/10.1016/j.cropro.2012.12.012

a b s t r a c t

Simple sequence repeats and mating type markers were used to estimate the genetic diversity of 133Didymella rabiei isolates collected from nine provinces of Syria. Moreover, phenotyping was done on 56isolates randomly selected from the different genetic groups using five chickpea genotypes. The geneticdiversity of D. rabiei population was high with inter-population variability accounting for 83% of the totalvariation, whereas the genetic diversity among populations was very low (17%). Principal componentanalysis grouped the isolates from Aleppo, Idlib, Hama, Homs and Hassakeh provinces together, whileDaraa and Tartous were in different groups. Isolates from Lattakia and Suweida provinces formed verydistinct clusters compared to the others. The 56 isolates were grouped into four pathotypes, namely,pathotype-1 (12 isolates), pathotype-2 (13 isolates), pathotype-3 (5 isolates) and pathotype-4 (26 iso-lates) with varying degrees of virulence on the chickpea genotypes. Our findings showed a clear geneticshift toward more virulence over time and space in the populations of D. rabiei in Syria. These resultsstress the need for chickpea breeding materials to be tested for resistance to the more virulent patho-types. Also, concerted action should be taken to ensure the shipment of healthy seeds of internationalchickpea nurseries to avoid D. rabiei genotypes or pathotypes flow from Syria to other countries.

� 2012 Elsevier Ltd. All rights reserved.

1. Introduction

Kabuli chickpea (Cicer arietinum) is one of the major cool-seasonfood legumes produced in the Mediterranean region. Syria pro-duces approximately 42,900 tons of chickpea on about 68,000 ha(FAO, 2010). At the national level, the productivity and productionof chickpea are very lowmainly due to spring planting that exposesthe crop to terminal drought and heat. One of the greatest bioticstresses reducing the yield potential of chickpea is Ascochyta blight,caused by Didymella rabiei (Kovatsch.) Arx, which is considered tobe the most serious disease worldwide (Singh and Reddy, 1996).Yield losses due to Ascochyta blight can reach 100% if environ-mental conditions favor both crop growth and disease develop-ment (Navas-Cortés et al., 1998; Vail and Banniza, 2009).

rch Center, General Commis-Aleppo, Syria. Tel.: þ963 (0)

All rights reserved.

D. rabiei is a haploid, heterothallic Ascomycete fungus that hasbeen reported in 34 countries world-wide and was recentlyreported from Argentina (Pande et al., 2005; Gloria et al., 2012).The life cycle of D. rabiei consists of a single sexual generation perseason which develops on infected overwintering chickpea debris,followed by several asexual generations during the parasitic phaseof the disease cycle (Trapero-Casas et al., 1996). Sexual repro-duction is controlled by a single regulatory locus referred asmating-type locus and alternate sequences at the mating-typelocus are completely dissimilar and code for different regulatorygenes. The presence of opposite mating types (MAT1e1 andMAT1e2) and the teleomorph have been reported from mostchickpea-growing regions in the world (Armstrong et al., 2001;Barve et al., 2003; Peever et al., 2004; Rhaiem et al., 2008; Vail andBanniza, 2009; Atik et al., 2011).

The genetic structures of D. rabiei populations have been esti-mated using differential chickpea genotypes (Udupa et al., 1998;Vail and Banniza, 2008) andmolecular markers (Peever et al., 2004;Varshney et al., 2009). Microsatellite markers revealed high levelsof polymorphism among isolates from Tunisia, USA, Pakistan, Syria

O. Atik et al. / Crop Protection 46 (2013) 70e79 71

and Turkey (Geistlinger et al., 2000; Phan et al., 2003; Peever et al.,2004; Bayraktar et al., 2007; Rhaiem et al., 2008; Ali et al., 2011).One of the most effective, economical and environmentally safeapproach to manage Ascochyta blight of chickpea is the cultivationof resistant cultivars (Singh et al., 1992). Resistance in chickpeacultivars to Ascochyta blight is not durable in some countriesincluding Syria due to high genetic and virulence variability ofD. rabiei populations (Reddy and Kabbabeh, 1985; Imtiaz et al.,2011). Resistance breakdown is the greatest challenge to breedingfor Ascochyta blight resistance in chickpea (Singh and Reddy, 1991).

It is important not only to develop cultivars with durable formsof resistance, but also to monitor the changes in the populationstructures to anticipate resistance breakdown in existing chickpeacultivars and design better strategies to sustain cultivation of highyielding and farmer and consumers preferred cultivars (Pandeet al., 2005; Vail and Banniza, 2009).

Studying the genetic diversity of D. rabiei isolates infecting wildCicer spp. is very important to compare pathogen movement be-tweenwild and cultivated chickpea species. UnderstandingD. rabieigene/genotype flow is especially relevant in a country such as Syriathat lies in the center of origin of chickpea. Comparing the popu-lation structure of the pathogens isolated from wild and cultivatedchickpeas using neutral DNA markers allows for the estimation ofgene flow among populations from different hosts and geographicregions (Singh et al., 1994).

D. rabiei shows high degree of pathogenic and genetic variabilityand Ascochyta blight resistant chickpea cultivars have becomesusceptible in some countries. Variability of D. rabiei has beenreported in Syria and other chickpea-growing countries; Reddy andKabbabeh (1985) identified six races of D. rabiei isolates collectedfrom Syria and Lebanon using eighteen chickpea differentials, and

Fig. 1. Map showing the nine chickpea-growing regions (colored provinces) wher

later Udupa andWeigand (1997) grouped 53 isolates (including thesix races) into three pathotypes based on varying levels of aggres-siveness on three chickpea host differentials. None of the patho-types described by Udupa and Weigand (1997) were virulent onchickpea genotypes ICC-12004 and ICC-3996. Recently, a newD. rabiei pathotype (pathotype-4) was reported in Syria that iscapable of affecting the highly resistant chickpea genotypes (ICC-12004 and ICC-3996) known for their resistance to pathotypes 1, 2and 3. Breeding materials at ICARDA are being screened against thisnew pathotype-4, and so far low levels of resistances have beenobserved (Bayaa et al., 2004; Imtiaz et al., 2011). Since the study byUdupa et al. (1998), little is known about the genetic structure ofD. rabiei populations and the threat posed by pathotype-4 infarmers’ fields in Syria. High genetic diversity has also beenreported from USA, Tunisia and Canada where popular varietieshave become susceptible to new aggressive pathotypes (Peeveret al., 2004; Rhaiem et al., 2008; Vail and Banniza, 2009).

The objective of this study was to determine the genetic struc-ture of D. rabiei populations in Syria and assess the threat to theproduction of popular winter-sown chickpea cultivars in thecountry.

2. Materials and methods

2.1. Sampling and pathogen isolations

During the 2007e2008 and 2008e2009 cropping seasons,farmer fields and research stations in nine major chickpea-growingprovinces of Syria (Aleppo, Hassakeh, Lattakia, Idlib, Hama,Homs, Suweida, Daraa and Tartous) were surveyed (Fig. 1, Table 1).Wild chickpea species (Cicer judaicum, Cicer bijugum and Cicer

e Didymella rabiei isolates collected in 2008/09, 2009/2010 seasons in Syria.

Table 1Number of isolates, collection year and sites of Didymella rabiei used in the study.

Province Collection site Year No offields

Number ofisolates

Aleppo Ein Arab-Corba 2008 1 5Tel Rafaat 2008 1 2Eskan 2008 1 3Daret Eza 2008 1 4Hamediah 2008 1 2Dabek 2008 1 2Bzaa 2008 1 3Ameriya 2008 1 3Al- Bab 2008 1 3Tel Esha 2008 1 2Kobbaseen 2008 1 3Arshaf 2002 1 1Tel Hadya 2002 2 2Yahmoul 2002 1 1Kaljebrin 2002 1 1Tel Hadya 1982 2 2Breda 1982 1 1Kaljebrin 2004 1 1

Idlib Maaret AleNaesan 2008 2 5Fouaa 2008 1 8Tel Sandal 2002 2 2Jeser Al-Shoghour 2002 1 1Idlib Research Station 2002 1 1Sarmeen 1982 2 2Maaret Mosreen 1982 1 1Al-Rouj 1995 1 1

Hasakeh Tel Al-Dahab 2008 2 7Toweneh 2008 1 3Derbaseyeh-Jolbasan 2008 1 2

Lattakia Bustan Al- Basha 2008 1 11Gableh-ICARDA Research Station 2009 1 1

Tartous Gammaseh- Research station 2009 1 7Hama Al-Ghab-Frekeh 2008 1 2

Shateha 2008 1 3Taybet Al-Emam 2008 1 2Kafer Bohom 2008 1 2Skelbieh 2002 3 3Al-Ghab 2002 1 1Al-Ghab 1982 2 2

Homs Em Sharshouh 2008 1 1Gboureen 2008 3 8Tesneen 2008 1 4Keseen 2008 1 1Telbiseh 2008 1 3Al-Farhanieh 2008 1 1

Suweida Al-Ddour 2009 1 1Daraa Nawa 2009 1 1

Sheikh Miskin 2009 1 1Izraa Research Station 2009 1 1Gelleen Research Center 2009 1 3

Total 9 52 58 133

O. Atik et al. / Crop Protection 46 (2013) 70e7972

pinnatifidum) were also surveyed in their natural habitat, and wildaccessions planted at Tartous research station for rejuvenation bythe Genetic Resources Service of ICARDA were also surveyed. Nowild chickpea plants were infected in their native habitat in bothseasons, and only C. pinnatifidum was infected at GammasehResearch Station in Tartous in the 2008e2009 season (Atik et al.,2011). Thus, all wild chickpea samples were collected from thisspecies.

Ascochyta blight infected chickpea plant samples (leaves, stemsand pods) were collected. A total of 110 isolates of D. rabiei wereisolated from farmers’ fields (82 isolates from cultivated chickpea,five isolates from wild chickpea and 23 isolates from nationalagricultural research stations). In addition, 23 D. rabiei isolatesmaintained at the Food Legume Pathology Laboratory of ICARDAwere used in the study, including two isolates (pathotypes 1 and 2)and six races collected in 1982, one isolate (pathotype 3) collected

in 1995, 13 isolates collected in 2002, and one isolate (pathotype 4)previously identified by Bayaa et al. (2004) (Table 1).

Infected samples were surface-disinfected with sodium hypo-chlorite (0.5%) and plated on chickpea seed extractedextrose agar(40 g autoclaved chickpea seeds, 20 g dextrose and 18 g agar in 1 Lof sterile distilled water) and incubated for five days at 20 �C (12-hphotoperiod). The isolates were purified through single spore iso-lation and incubated under the same conditions for genomic DNAanalysis.

2.2. Genotyping

Four discs (5 mm diameter) of D. rabiei single-spore isolateswere inoculated into 250 ml flasks containing 50 ml of potatodextrose broth (PDB) medium. After 4e6 days of incubation ona rotary shaker (100 rpm and 20 �C), mycelia were harvested fromthe flasks by vacuum filtration using two layers of sterilized cheesecloth, lyophilized for five days and stored at �30 �C. Approximately50 mg of the lyophilized mycelium was transferred to microfugetubes and re-lyophilized for an additional day. Mycelium of eachisolate was ground to a fine powder using a bead beater. DNA wasextracted using a modified mini-preparation protocol using thecetyltrimethylammonium bromide (CTAB) method (Chongo et al.,2004; Vail and Banniza, 2009; Atik et al., 2011). The quantity andquality were assessed by running 1 ml of the DNA on 1% agarose gel,stained by ethidium bromide and photographed under UV illumi-nation. Eight microsatellite primer pairs, specific to D. rabiei, wereused to amplify genomic DNA (Table 2). The primers were selectedon the basis of their high polymorphic information content (PIC) asdescribed by different researchers (Geistlinger et al., 2000; Rhaiemet al., 2008; Nourollahi et al., 2010). The PCR was essentially per-formed as described by Geistlinger et al. (2000). PCR reactions werecarried out in 25 ml volumes containing 30 ng of template DNA, 1�PCR buffer, 0.2 mM dNTP’s, one unit of Taq DNA polymerase (RocheDiagnostics, Germany), 2 mM of each primer. Cycling conditionsconsisted of an initial denaturation at 95 �C for 2 min followed by35 cycles of 94 �C for 20 s, 57 �C for 25 s, 67 �C for 23 s, and a finalextension at 72 �C for 5 min. Amplified products were separated in8% polyacrylamide gels and compared with 50 and 100 ng/ml ofstandard l DNA. After electrophoresis the DNA was stained with400 mg ml�1 ethidium bromide and photographed under UVillumination.

Mating types were determined on 133 isolates using multiplexMAT-specific PCR with three primers. MAT1-1 specific primerSp21 (ACAGTGAGCCTGCACAGTTC), MAT1-2 specific primer Tail 5(CGCTATTTTATCCAAGACACACC) and flanking region-specificprimer Com1 (GCATGCCATATCGCCAGT) (Table 2) were combinedin equal concentrations in a single PCR (Barve et al., 2003; Atiket al., 2011).

2.3. Pathotype determination

Fifty six single-spore of D. rabiei isolates were randomly selectedfrom all the different main and sub genetic groups (Fig. 2). In orderto capture both the spatial and temporal variation in the pathogenpopulation, isolates were selected to represent all provinces andcollection years, as well as the six previously described races(Reddy and Kabbabeh, 1985) and four pathotypes (Udupa et al.,1998; Imtiaz et al., 2011).

Five chickpea genotypes with varying levels of Ascochyta blightresistance were used in this study; ICC-12004 and ICC-3996 bothare highly resistant to pathotypes-1, 2 and 3 but susceptible topathotype-4 (Bayaa et al., 2004; Imtiaz et al., 2011); ILC-3279(Ghab-2) resistant to pathotypes-1 and 2 and susceptible topathotypes-3 and 4 (Udupa et al., 1998; Chen et al., 2004); FLIP 82-

Table 2Major allele frequency, allele number, gene diversity and polymorphic information continent of SSR and MAT markers.

Marker Repeat of cloned allele Primer sequence (50 / 30) Major allelefrequency

Samplesize

No. ofobservations

Alleleno

Availability Genediversity

PICa

MAT: SP21 ACAGTGAGCCTGCACAGTTC 0.65 133 133 2 1.00 0.46 0.35Tail 5 CGCTATTTTATCCAAGACACACCCom1 GCATGCCATATCGCCAGT

Ar A03T (GAA)31 TAGGTGGCTAAATCTGTAGG 0.27 133 129 7 0.97 0.79 0.76CAGCAATGGCAACGAGCACG

Ar A06T (CAACAC)7(N)9(CAC)3 CTCGAAACACATTCCTGTGC 0.54 133 131 3 0.99 0.53 0.43GGTAGAAACGACGAATAGGG

ArH02T (GAA)58(GTA)6 CTGTATAGCGTTACTGTGTG 0.32 133 113 9 0.85 0.81 0.78TCCATCCGTCTTGACATCCG

Ar H05T (CTT)18 CATTGTGGCATCTGACATCAC 0.45 133 132 7 0.99 0.72 0.69TGGATGGGAGGTTTTTGGTA

Ar H06T (CAA)9(CAG)7(CAA)21 CTGTCACAGTAACGACAACG 0.42 133 129 8 0.97 0.67 0.61ATTCCAGAGAGCCTTGATTG

ArR04D (GTGTGTAT)2(N)8(GT)10 GCTTAGTTGGGCTTGTTACTT 0.53 133 132 3 0.99 0.54 0.44CACACCTCTCTACCAATGAGAC

Mean 0.45 133 128.43 5.57 0.97 0.65 0.58

a PIC ¼ polymorphic information content.

O. Atik et al. / Crop Protection 46 (2013) 70e79 73

150C (Ghab-3) resistant to pathotypes-1 and 2 and moderatelyresistant to pathotype-3 and susceptible to pathotype-4 (com-mercial variety in Syria) and ILC-263 highly susceptible to allpathotypes and is being used as susceptible check in most ICARDAexperiments (Iqbal et al., 2004). These genotypes were planted ina plastic house (temp. 22 � 2 �C, 14 h photoperiod). Five seeds ofeach genotype were sown in plastic pots (20 cm diameter). Theexperiment was laid out as Alpha designwith only two replicationsdue to limited availability of space in the plastic house. The isolateswere multiplied on chickpea seed extract dextrose agar mediumand incubated for seven days at 20 �C (12 h photoperiod). Two-week old seedlings were inoculated with each isolate until run-off with a spore suspension of 5 � 105 spores/ml, while the con-trol pots were sprayed with distilled water. Pots were covered withplastic bags and incubated at 20 � 1 �C (14 h photoperiod) for 72 hunder high humidity (>90%), then plastic bags were removed andplants were left under the same temperature and light conditions.Mist irrigation (10 s per 1 h) was applied in order to enhance dis-ease development. Disease severity was rated three weeks afterinoculation using a modified 1e9 scoring scale, where 1, healthyplant, no disease; 2, lesions present, but small and inconspicuous;3, lesions easily seen, but plant is mostly green; 4, severe lesionsclearly visible; 5, lesions girdle stems, most leaves show lesions; 6,plant collapsing, tips die back; 7, plant dying, but at least threegreen leaves present; 8, nearly dead plant (virtually no green leavesleft) but still with a green stem; and 9, dead plant (almost no greenparts visible) (Chen et al., 2004).

2.4. Data analyses

Allele sizes for SSR and MAT markers were scored as anapproximate fragment size (bp) at each locus comparing with100 bp ladder (Promega, Madison, USA). Gene diversity index andpolymorphic information content (PIC) values for all markers andpopulations were calculated using the Power Marker V3.25 pro-gram (Vuylsteke et al., 2000; Liu and Muse, 2005). Based on thegenetic distance (Nei, 1973), Principal Co-ordinates Analysis (PCoA)was done using Past V 1.9 program (Hammer et al., 2001; Podaniand Miklos, 2002).

Analysis of molecular variance (AMOVA) between and amongpathogen populations was performed using Gen Alex V3 program(Excoffier et al., 2006). The dendrogram of genetic relationshipsbetween populations was estimated from SSR and MAT data usingthe unweighted pairgroup method using the arithmetic average

(UPGMA). Molecular and pathogenicity data were analyzed andsubjected to bootstrap re-sampling with 1000 replications, andEuclidean distance was measured using Past V3 program V3.25(Hammer et al., 2001).

A dendrogram of pathogenic variance and relationships amongisolates (based on the main cluster dendrogram) was estimatedusing UPGMA and bootstrap re-sampling with 1000 replicationsweremeasured using Past V3 program V3.25 (Hammer et al., 2001).

The Mantel test (Mantel, 1967) was used to test the null hy-pothesis that genetic distances are independent of the pathoge-nicity distances. Mantel test was calculated by Power Marker V3.25by fixing the number of permutation value at 10,000 (Liu andMuse,2005). Disease severity data were analyzed using GENSTAT 12statistical program.

3. Results

3.1. Genetic diversity

Six of the eight microsatellite primers generated reproduciblebanding patterns, and the remaining two primers ArR08T andArR04D were monomorphic in the D. rabiei population. Each of thesix SSR andMATmarkers produced a single amplicon for each locusfrom each isolate as expected for a haploid ascomycete fungus. Twoto nine alleles were detected per locus among all isolates (Table 2).High variability was observed in allele numbers, major allele fre-quency, genetic diversity and PIC for the SSR and MAT markers(Table 2). The total number of marker alleles was 39 and the highestnumber (nine alleles) was produced from ArH02T marker, whereasthe lowest number (two alleles) was recorded from MAT markers.The highest genetic diversity (81%) and PIC (78%) values wererecorded for ArH02T marker; while the lowest (46 and 35%,respectively) were observed for MAT marker. The highest majorallele frequency (65%) was reported from MAT marker, while thelowest from ArH03T (27%).

The cluster analysis showed two major distinct groups (Group-A and B) based on the highest Euclidean distance (Fig. 2). Eachmain group was further divided into sub-groups. Group-A con-sisted of 85 MAT1-1 isolates with two sub-groups. Sub-group A-Iconsisted of 67 isolates from different geographical locationsexcept Lattakia. All Tartous isolates from cultivated and wildchickpea genotypes were included in this genetic subgroup. Sub-group A-II had 18 isolates collected from Lattakia, Aleppo, Idliband Hama, races-1 and 6, and pathotypes-2 and 3. Group-B

Fig. 2. Dendrogram depicting similarities among 133 isolates of Didymella rabiei based on SSR and MAT markers. A ¼ Aleppo, I ¼ Idlib, Ham ¼ Hama, Hom ¼ Homs Has ¼ Hassakeh,L ¼ Lattakia, T ¼ Tartous, D ¼ Daraa, S ¼ Suweida, Wild ¼ Isolates from wild chickpea.

O. Atik et al. / Crop Protection 46 (2013) 70e7974

comprised of 48 MAT1-2 isolates and further divided into two sub-groups. Sub-group B-I consisted of four isolates all collected fromAleppo in the 2007e08 cropping season. In Sub-group B-II, con-sisted of 44 isolates. The B-II subgroup has two clusters B-II-a consisted of 34 isolates from Aleppo, Idlib, Hama, Homs andHassakeh and collected in different seasons. Cluster B-II-b con-sisted of 10 isolates collected in 2002, 2008 and 2009 from Aleppo,Idlib, Hama, Homs and Daraa.

Cluster analysis showed a genetic similarity among pathotype-1and races-3, 4 and 5; pathotype-4 and race-2, and pathotypes-2and 3 and races-1 and 6 (Fig. 2).

Analysis of molecular variance showed inter-population di-versity accounted for 83% of the total variation, whereas diversityamong all populations was very low and accounted only for 17%,and the corresponding Fst value was 0.167 (Table 3)

The PCoA result showed that genetic variation exists amongpathogen populations from different provinces where first andsecond coordinates contributed 53 and 24.8% of the genetic varia-tion, respectively (Fig. 3). High genetic similarity was observedamong D. rabiei populations from Aleppo, Idlib, Hama, Homs andHassakeh provinces. Isolates from Lattakia and Suweida provincesgrouped into two separate distantly related groups with the highest

Fig. 2. (continued).

O. Atik et al. / Crop Protection 46 (2013) 70e79 75

genetic distance. Low genetic variation was observed within Lat-takia and Tartous populations (Fig. 3).

3.2. Pathotype determination

Based on pathogenic variation, the 56 isolates were classifiedinto four groups (Table 4, Fig. 4). The first group (Group-I) consistedof 12 isolates collected from Aleppo, Idlib, Hama, Daraa and Tartousas well as pathotype-1 and races-2, 3, 5 and 6. Also, two isolatescollected from wild chickpea belonged to this group. All isolates inthis group were considered as pathotype-1. The second group(Group-II) consisted of 13 isolates collected from Aleppo, Idlib,Hama, Homs, Lattakia, Daraa and Suweida provinces andpathotype-2 and the isolates are designated as pathotype-2. Thethird group (Group-III) consisted of five isolates collected fromIdlib, Hama, Daraa, Lattakia and Tartous provinces and Pathotype-3and all were designated as pathotype-3. The fourth group (Group-IV), which comprised 26 isolates collected from the eight provinces(except Suweida) and included pathotype-4, races-1 and 4 andthree isolates from wild chickpea spp. were designated as

Table 3Analysis of molecular variance for Didymella rabiei populations from Syria.

Source Degreefreedom

Sum ofsquares

Meansquares

Estimatedvariance

Totalvariation (%)

Among population 7 56.265 8.038 0.392 17Within population 124 243.189 1.961 1.961 83Total 131 299.455 9.999 2.353Fst ¼ 0.167, P < 0.010

pathotype-4. The 13 isolates from the five research centers weregrouped as pathotype-1 (23%); pathotype-2 (15%); pathotype-3(15%) and pathotype-4 (47%).

Races-2, 3, 5 and 6 were grouped into pathotype-1 and races-1and 4 belonged to pathotype-4 (Fig. 4). In this study the Mantel testshowed a very low correlation (r ¼ 0.0009, P ¼ 0.971) betweengenetic similarity and pathogenicity.

4. Discussion

The control of Ascochyta blight is mainly dependent on the useof resistant cultivars due to the high cost of fungicide applicationsin many countries. Identification of new sources of resistance re-quires knowledge of genetic variation in pathogen populations(Peever et al., 2004). The evolution of new virulent D. rabiei races/pathotypes that affect popular winter planted chickpea cultivars inSyria is well documented (Udupa et al., 1998; Bayaa et al., 2004;Imtiaz et al., 2011).

In the present study, the genetic diversity of the D. rabiei isolatesfrom different provinces showed high degree of genetic diversityamong isolates separated in time and space. D. rabiei populationshave been shown to have high genetic diversity in many countrieswhere thehost andpathogenhave co-existed for a long time (WilsonandKaiser,1995). The level of genetic diversitywas found to be quitehigh in Syria and Lebanon (Udupa et al., 1998); Spain (Navas-Cortéset al.,1998); Pakistan (Jamil et al., 2000), Canada (Chongo et al., 2004)and Tunisia (Rhaiem et al., 2008). Genetic analysis of D. rabiei pop-ulation using molecular markers showed that pathogenic diversityoriginated from the introduction of a large number of isolates into

Fig. 3. Principal coordinates analysis showing the genetic variation among Didymella rabiei populations.

O. Atik et al. / Crop Protection 46 (2013) 70e7976

the USA between 1983 and 1984 (Peever et al., 2004). Rhaiem et al.(2006) found a high level of allelic diversity of SSR loci in D. rabieiisolates obtained from five chickpea-growing regions in Tunisia.Genetic diversity was high within populations with correspondinghigh average gene flow and low genetic distances between pop-ulations (Nourollahi et al., 2010). In contrast, Phan et al. (2003) foundlow genetic diversity among Australian D. rabiei isolates collectedbetween 1995 and 2003 compared to the diversity detected inTunisia, Syria, Canada and USA.

The highest allele number, genetic diversity and PIC values werereported for SSR marker ArH02T. The high level of polymorphism(81%) revealed by this marker among D. rabiei isolates indicatedthat the marker is highly valuable to be used in subsequent di-versity studies.

High genetic and pathogenic variation was detected withinpathogen populations from Aleppo, Idlib, Hama, Homs and Has-sakeh, and isolates were distributed in different genetic andpathogenic groups (Figs. 2e4). The two mating types of D. rabieiwere reported in these provinces and sexual reproduction mighthave played a role in increasing the genetic diversity withinpopulations (Atik et al., 2011). Moreover, many farmers in theabove provinces grow winter-sown improved chickpea varietiesthat might have caused a selection pressure on the pathogenpopulations (McDonald and Linde, 2002). The combination ofsexual reproduction and host selection pressure due to winterchickpea planting may explain the high genetic diversity and theevolution of highly aggressive resistance-breaking isolates likepathotype-4.

Principal coordinate analysis showed that the Hassakeh popu-lation clustered with isolates from Aleppo, Idlib, Hama and Homsprovinces. This could be due to the fact that Aleppo is the maingateway into Hassakeh province for agricultural inputs includingseed for planting. The provinces are also closer to Turkey with

which there is exchange of seeds and from where new isolatescould be introduced through infected seeds.

Principal co-ordinates analysis showed that Lattakia and Tar-tous pathogen populations are genetically divergent from theother provinces and this is could be due to geographic isolationcausing low genetic variation. Farmers of the coastal areas growchickpea on a very small scale, which may have contributed to lessvariable D. rabiei populations compared to regions where chickpeais grown on a large scale. Moreover, only MAT1-1 was reportedfrom the two provinces, which suggests that lack of sexualreproduction has led to limited scope for high genetic variability(Atik et al., 2011).

Severe Ascochyta blight development on cultivated chickpea innearby arable lands has an implication on the loss of biodiversity ofchickpea in coastal areas. These areas represent the natural habitatof wild chickpea relatives and most of the wild relatives are foundhere. The expansion of Ascochyta blight-susceptible chickpea couldspread virulent pathotypes that can threaten the wild relatives.Except for C. pinnatifidum, other wild relatives were not infected.This finding is in agreement with that of Can and Ozkilinc (2007)who found Ascochyta blight infection was found only onC. pinnatifidum in Turkey.

The pathogen populations from southern Syria (Daraa andSuweida) formed separate genetic groups. This may be becausemost farmers did not adopt winteresown chickpea, opting insteadfor spring planted chickpea to avoid Ascochyta blight epidemics.Farmers always plant local large-seeded varieties which are moresusceptible to Ascochyta blight than improved Kabuli varieties(Mazid et al., 2009). So the roles of resistant varieties in shaping thepathogen population (e.g. by imposing selection pressure) is min-imal. Chickpea is traditionally grown in spring in the Mediterra-nean region including North Africa, West Asia and South Europe,but higher yield can be achieved by planting chickpea in winter

Table 4Reactions of five chickpea genotypes against 56 isolates of Didymella rabiei.

Chickpea genotypes

Isolatenumber

The originalisolate number

ICC-12004 ICC-3996 ILC-3279(Ghab-2)

FLIP 82-150C(Ghab-3)

ILC-263 Isolatenumber

The originalIsolate number

ICC-12004 ICC-3996 ILC-3279(Ghab-2)

FLIP 82-150C(Ghab-3)

ILC-263

1 1 5 4.5 5 6 7 29 113 4.5 2 2.5 3 82 57 6.5 6 6 8.5 8.5 30 30 2 3 3 4 43 58 6 7 5.5 7.5 8 31 114 2 3 2 2.5 4.54 61 5.5 5.5 5.5 6.5 7 32 115 2 2 2 2 4.55 66 3.5 5 4.5 6.5 8 33 116 2.5 3 3 5 76 6 2 2 2 3 4.5 34 117 4 3.5 7.5 4.5 7.57 69 4 5.5 5.5 6 6 35 35 7 5.5 7 8.5 78 70 2 3 3 3.5 6.5 36 118 5.5 5 3.5 6 6.59 73 6.5 6.5 4 7 8.5 37 37 7 6.5 6.5 8.5 810 10 2 5 3 4.5 4 38 38 7 6.5 7 8 8.511 75 4 2 4.5 4 9 39 119 5 3.5 5 3.5 812 12 3 2 4 5.5 6 40 121 2.5 2.5 5.5 6.5 813 77 2.5 2 2.5 2 8 41 41 7 8 8 8 914 79 6.5 6.5 5.5 7.5 7.5 42 122 2.5 5 3.5 5 715 15 2.5 3.5 3.5 4 5 43 43 7 6 7 8.5 916 81 3 4 3.5 5 6.5 44 123 3 2 8 4.5 917 89 6.5 5 6 7 7.5 45 124 2 2 3.5 3 818 91 7.5 7 3 8.5 8 46 46 3.5 4.5 4.5 4.5 519 92 6.5 6 5.5 8 7.5 47 47 4 4 4 5 8.520 25 2.5 2.5 3.5 5.5 5.5 48 125 3 2 2.5 3 821 104 6 3.5 3.5 6.5 8.5 49 127 5.5 4.5 4.5 7 722 105 2.5 2 5.5 4.5 7 50 128 3.5 2 4.5 5.5 723 106 7 6 6.5 6.5 8.5 51 129 6 5.5 5 7.5 7.524 109 5.5 4 4 5.5 8 52 130 7 5.5 5.5 7 7.525 110 2 2 3 2.5 6 53 131 5.5 6.5 4.5 6.5 8.526 111 2 2.5 2 3 6.5 54 132 2 2 2.5 3 7.527 112 4.5 5 3.5 6 8.5 55 133 2.5 2 3 2 6.528 28 4 4.5 2.5 4.5 6.5 56 106 2.5 3 3.5 5 6.5L.S.D(Fungi) 0.861L.S.D(Genotype) 0.257L.S.D(Fungi � Genotype) 1.925

O. Atik et al. / Crop Protection 46 (2013) 70e79 77

season. The high yield in winter sown chickpea may result frombetter moisture availability and long growing season. However,occurrence of Ascochyta blight infection during spring season maycause considerable damage to the crop at the time of floweringleading to total yield loss (Singh and Hawtin, 1979).

The five chickpea genotypes used in this study representeddifferentials for separating the isolates of D. rabiei into differentpathotypes. A complex pathogenic variability is not surprisingsince the pathogen has a sexual stage in Syria that could generatenew recombinants with varying virulence spectrum (Kaiser, 1997)and adoption of winter chickpea planting causes many diseasecycles that will generate huge propagules that may lead to evo-lution/appearance of new virulent pathogens. We identified 26isolates with similar levels of virulence to pathotype-4 that affectthe highly resistant chickpea genotypes. They were present ineight provinces more than previously reported (Bayaa et al., 2004;Imtiaz et al., 2011). Isolates from Hassakeh and most isolates ofHoms belonged to pathotype-4. This may explain the frequentAscochyta blight epidemics observed in the area that has deci-mated winter planted chickpea (especially in Hassakeh province)during the last few years (Atik et al., 2011). It is likely thatpathotype-4 is more widespread in Syria than is currently thought.Further studies involving more isolates and microsatellite loci arewarranted in order to gain a better understanding of the patho-type and genotypic diversity of the pathogen, especially in areaswith a high likelihood of the occurrence of sexual recombination.

Cluster analysis indicated genetic similarity between races-3, 4and 5 with pathotype-1; race-2 with pathotype-4, and race-1 and 6with pathotypes-2 and 3. On the other hand, Races-2, 3, 5 and 6belong to pathotype-1 and races-1 and 4 belong to pathotype-4. Allisolates from wild chickpea were genetically similar (Sub-group

A-I) andwere classified as pathotype-1 (2 isolates) and pathotype-4(3 isolates). This could be due to the fact that SSRs markers are notlinked to the virulence gene (s). Previous molecular studies ofD. rabiei have found that neutral DNA markers were not correlatedto virulence forms (Navas-Cortés et al., 1998; Udupa et al., 1998;Jamil et al., 2000). The result is not unexpected because the fungusappears to undergo frequent sexual reproduction and randommating (Peever et al., 2004).

This finding contradicts the findings of Udupa et al. (1998)where race-1, 2, 3 and 5 were pathotype-1 and race-4 and 6 werepathotype-2. This may be due to the fact different differentials (ILC-1929, susceptible to all three pathotypes; ILC-482, resistant topathotype I, but susceptible to pathotypes II and III; and ILC-3279,resistant to pathotypes I and II, but susceptible to pathotype III)were used.

Although races-1 and 4 were isolated since the early 1980s, ourpathogenicity test showed that these races were highly aggressiveand most likely belong to pathotype-4; however, they have occur-red at very low frequency in farmers’ fields.

The pathogen populations in research stations consisted of allknown pathotypes but dominated by highly virulent pathogenpopulations indicating that the breeding materials are exposed toawide variety of virulence groups. Hence, it is recommended to testelite chickpea breeding lines where highly virulent pathogenpopulations were identified.

This study has clearly demonstrated the utility of combiningpathotype tests with microsatellite markers to gain an improvedunderstanding of the genetic structure of Syrian populations ofD. rabiei. The pathogen population of D. rabiei has shifted towardmore virulent groups over time and space in Syria. The breedingmaterials for international public goods should be exposed to

Fig. 4. Dendrogram depicting pathogenic similarities among the 56 isolates of Didymella rabiei. A: Aleppo, I: Idlib, Ham: Hama, Hom: Homs, Has: Hassakeh, L: Lattakia, T: Tartous, D:Daraa, S: Suweida, Wild: Isolates from wild chickpea. R1-R6: race-1 e race-6. P1: pathotyp-1; P2: pathtype-2, P3: pathotype-3, P4: pathotype-4.

O. Atik et al. / Crop Protection 46 (2013) 70e7978

highly virulent pathogen populations. The study was limited byour inability to find large isolate sample sizes for populationscollected at different years and from different provinces. How-ever, the bootstrap test of significance performed in this studyenabled us to estimate indices of diversity and population dif-ferentiation with a reasonable degree of confidence (Grünwald

et al., 2003). Future studies should increase the sample size ofrepresentative sub-populations to improve the accuracy ofassessment of the pathogen population structure. Until highlyresistant genotypes reach farmers, integrated Ascochyta blightmanagement should be adopted mainly for winter plantedchickpeas in Syria.

O. Atik et al. / Crop Protection 46 (2013) 70e79 79

References

Ali, Q., Ahsan, M., Tahir, M.H.N., Farooq, J., Waseem, M., Anwar, M., Ahmad, W., 2011.Molecular markers and QTLs for Ascochyta rabiei resistance in chickpea. Int. J.Agro. Vet. Med. Sci. 5, 249e270.

Armstrong, C.L., Chongo, G., Gossen, B.D., Duczek, L.J., 2001. Mating type distribu-tion and incidence of the teleomorph of Ascochyta rabiei (Didymella rabiei) inCanada. Can. J. Plant Pathol. 23, 110e113.

Atik, O., Baum, M., El-Ahmed, A., Ahmed, S., Abang, M.M., Yabrak, M.M., Murad, S.,Kabbabeh, S., Hamwieh, A., 2011. Chickpea Ascochyta blight: disease status andpathogen mating type distribution in Syria. J. Phytopathol. 159, 443e449.

Barve, M.P., Arie, T., Salimath, S., Muehlbauer, F.J., Peever, T.L., 2003. Cloning andcharacterization of the mating type (MAT) locus from Ascochyta rabiei (tele-omorph: Didymella rabiei) and a MAT phylogeny of legume-associated Asco-chyta spp. Fungal Genet. Biol. 39, 151e167.

Bayaa, B., Udupa, S.M., Baum, M., Malhotra, R.S., Kabbabeh, S., 2004. Pathogenicvariability in Syrian isolates of Ascochyta rabiei. In: 5th European Conference onGrain Legumes: Conference Handbook 5th European Conference of Grain Le-gumes 2nd International Conference on Legume Genomics and Genetics. 7e11June 2004, Dijon, France, p. 306.

Bayraktar, H., Dolar, F.S., Tör, M., 2007. Determination of genetic diversity withinAscochyta rabiei (Pass.) Labr. the cause of Ascochyta blight of chickpea in Turkey.J. Plant Pathol. 89, 341e347.

Can, C., Ozkilinc, H., 2007. First report of Ascochyta rabiei causing Ascochyta blight ofCicer pinnatifidum. Plant Dis. 91, 908.

Chen, W., Coyne, T.C.J., Peever, T.L., Muehlbauer, F.J., 2004. Characterization ofchickpea differentials for pathogenicity assay of Ascochyta blight and identifi-cation of chickpea accessions resistant to Didymella rabiei. Plant Pathol. 53,759e769.

Chongo, G., Gossen, B.D., Buchwaldt, L., Adhikari, T., Rimmer, S.R., 2004. Geneticdiversity of Ascochyta rabiei in Canada. Plant Dis. 88, 4e10.

Excoffier, L., Laval, G., Schneider, S., 2006. Arlequin Ver 3.1. An Integrated SoftwarePackage for Population Genetics Data Analysis, Computational and MolecularPopulation Genetics Lab (CMPG). Institute of Zoology, University of Berne,Baltzerstrasse 6, 3012, Bern, Switzerland, pp. 47e50.

FAO, 2010. FAOSTAT Database Results. http://apps.fao/faostat.Geistlinger, J., Weising, K., Winter, P., Kahl, G., 2000. Locus-specific microsatellite

markers for the fungal chickpea pathogen Didymella rabiei (anamorph) Asco-chyta rabiei. Mol. Ecol. 9, 1919e1952.

Gloria, V., Marcelo, A.C., Mercedes, S., Norma, F., Alicia, L., 2012. First report ofAscochyta rabiei causing Ascochyta blight of chickpea in Argentina. Plant Dis..http://dx.doi.org/10.1094/PDIS-02-12-0153-PDN

Grünwald, N.J., Goodwin, S.B., Milgroom, M.G., Fry, W.E., 2003. Analysis of genotypicdiversity data for populations of microorganisms. Phytopathology 93, 738e746.

Hammer, Y., Harper, D.A.T., Ryan, P.D., 2001. PAST: palaeontological Statistics soft-ware package for education and data analysis. Palaeontol. Electron. 4, 9.

Imtiaz, M., Abang, M.M., Malhotra, R.S., Ahmed, S., Bayaa, B., Udupa, S.M., Baum, M.,2011. Pathotype IV, a new and highly virulent pathotype of Didymella rabiei,causing Ascochyta blight in chickpea in Syria. Plant Dis. 95, 1192.

Iqbal, S.M., Ghafoor, A., Ayub, N., Ahmad, Z., 2004. Pathogenic diversity in Ascochytarabiei isolates collected from Pakistan. Pak. J. Bot. 36, 429e437.

Jamil, F., Sarwar, N., Sarwar, M., Khan, J., Geistlinger, J., Kahl, G., 2000. Genetic andpathogenic diversity within Ascochyta rabiei (Pass.) Lab. populations in Paki-stan causing blight of chickpea (Cicer arietinum L. Physiol. Mol. Plant Pathol.57, 243e254.

Kaiser, W.J., 1997. Inter and international spread of Ascochyta pathogens of chickpea,faba bean, and lentil. Can. J. Plant Pathol. 19, 215e224.

Liu, K., Muse, S.V., 2005. Power marker: integrated analysis environment for geneticmarker data. Bioinformitics 21, 2128e2129.

Mantel, N., 1967. The detection of disease clustering and a generalized regressionapproach. Cancer Res. 27, 209e220.

Mazid, A., Amegbeto, K., Shideed, K., Malhotra, R., 2009. Impact of Crop Improve-ment and Management Winter-sown Chickpea in Syria. International Center forAgricultural Research in Dry Areas (ICARDA), Aleppo, Syria.

McDonald, B.A., Linde, C., 2002. Pathogen population genetics, evolutionary po-tential, and durable resistance. Ann. Rev. Phytopathol. 40, 349e379.

Navas-Cortés, J.A., Pérez-Artés, E., Jiménez-Diaz, R.M., Llobell, A., Brainbridge, B.W.,Heale, J.B., 1998. Mating type, pathotype, and RAPDs analysis in Didymella rabiei,the agent of Ascochyta blight of chickpea. Phytoparasitica 26, 199e212.

Nei, M., 1973. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad.Sci. 70, 3321e3323.

Nourollahi, K., Javannikkhah, M., Naghavi, M.R., 2010. Genetic diversity and popu-lation structure of Ascochyta rabiei from the western Iranian Ilam and Ker-manshah provinces using MAT and SSR markers. Mycol. Prog. 10, 1e7.

Pande, S., Siddique, K.H.M., Kishore, G.K., Bayaa, B., Guar, P.M., Gowda, C.L.L.,Bretag, T.W., Crouch, G.H., 2005. Ascochyta blight of chickpea (Cicer arietinumL.): a review of biology, pathogenicity, and disease management. Aust. J. Agr.Res. 56, 317e332.

Peever, T.L., Salimath, S.S., Su, G., Kaiser, W.J., Muehlbauer, J., 2004. Historical andcontemporary multilocus population structure of Ascochyta rabiei (teleomorph:Didymella rabiei) in the Pacific Northwest of the United States. Mol. Ecol. 13,291e309.

Phan, H.T.T., Ford, R., Taylor, P.W.J., 2003. Population structure of Ascochyta rabiei inAustralia based on STMS fingerprints. Fungal Divers. 13, 111e129.

Podani, J., Miklos, I., 2002. Resemblance coefficients and the horseshoe effect inprincipal coordinate analysis. Ecology 83, 3331e3343.

Reddy, M.V., Kabbabeh, S., 1985. Pathogenic variability in Ascochyta rabiei (Pass.)Lab. In Syria and Lebanon. Phytopathol. Mediterr. 24, 265e266.

Rhaiem, A., Chérif, M., Harrabi, M., Strange, R., 2006. First report of Didymella rabieion chickpea debris in Tunisia. Tun. J. Plant Prot. 1, 13e18.

Rhaiem, A., Chérif, M., Peever, T.L., Dyer, P.S., 2008. Population structure and matingsystem of Ascochyta rabiei in Tunisia: evidence for the recent introduction ofmating type 2. Plant Pathol. 57, 540e555.

Singh, K.B., Hawtin, G.C., 1979. Winter planting. Int. Chickpea N. Letter 1, 4.Singh, K.B., Reddy, M.V., 1991. Advances in disease resistance breeding in chickpea.

Adv. Agron. 45, 191e222.Singh, K.B., Reddy, M.V., 1996. Improving chickpea yield by incorporating resistance

to Ascochyta blight. Theor. Appl. Genet. 92, 509e515.Singh, K.B., Reddy, M.V., Haware, M., 1992. Breeding for resistance to Ascochyta

blight in chickpea. In: Singh, K.B., Saxena, M.C. (Eds.), Disease ResistanceBreeding in Chickpea. ICARDA, Aleppo, Syria, pp. 23e54.

Singh, K.B., Malhotra, R.S., Halila, M.H., Knights, E.J., Verma, M.M., 1994. Currentstatus and future strategy in breeding chickpea for resistance to biotic andabiotic stresses. Euphytica 73, 137e149.

Trapero-Casas, A., Navas-Cortés, J.A., Jiménez-Díaz, R.M., 1996. Airborne ascosporesof Didymella rabiei as a major primary inoculum for Ascochyta blight epidemicsin chickpea crops in southern Spain. Eur. J. Plant Pathol. 102, 237e245.

Udupa, S.M., Weigand, F., 1997. Pathotyping of Ascochyta rabiei isolates of Syria. In:DNA Markers and Breeding for Resistance to Ascochyta Blight in Chickpea.Proceedings of the Symposium on “Application of DNA Fingerprinting for CropImprovement: Marker-assisted Selection of Chickpea for Sustainable Agri-culture in the Dry Areas”. ICARDA, Aleppo, Syria, pp. 39e48.

Udupa, S.M., Weigand, F., Saxena, M.C., Kahl, G., 1998. Genotyping with RAPD andmicrosatellite markers resolves pathotype diversity in the Ascochyta blightpathogen of chickpea. Theor. Appl. Genet. 97, 299e307.

Vail, S., Banniza, S., 2008. Structure and pathogenic variability in Ascochyta rabieipopulations on chickpea in the Canadian prairies. Plant Pathol. 57, 665e673.

Vail, S., Banniza, S., 2009. Molecular variability and mating-type of Ascochyta rabieiof chickpea from Saskatchewan, Canada. Aust. J. Plant Pathol. 38, 392e398.

Varshney, R., Pande, S., Kannan, S., Mahendar, T., Sharma, M., Gaur, P., Hoisington, D.,2009. Assessment and comparison of AFLP and SSR based molecular geneticdiversity in Indian isolates of Ascochyta rabiei, a causal agent of Ascochyta blightin chickpea (Cicer arietinum L.). Mycol. Prog. 8, 87e97.

Vuylsteke, M., Mank, R., Brugmans, B., Stem, P., Kuiper, M., 2000. Further charac-terization of AFLP dates as a tool in genetic diversity assessments among maize(Zea mays L.) inbred lines. Mol. Breed. 6, 265e276.

Wilson, A.D., Kaiser, W.J., 1995. Cytology and genetics of sexual compatibility inDidymella rabiei. Mycologia 87, 795e804.