Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
FIFA World Cup or the Olympic Games. Yes, IP has enabled sports to become a multi-billion dollar global industry that supports millions of workers and brings joy to countless sports enthusiasts.
This World IP Day, I ask you to reflect on two things (while you’re not catching up on your favorite sports team!).
Lunch and Learn sessions, In-House Practitioners Workshop and Luncheon, and Table Topics, will be distinctly labeled on the Schedule by Day as “registration required.” Once you’ve registered for a premium event, it will appear under your My Schedule section.
our own goals, and can serve as a source of hope in difficult times.
Sponsorship deals, merchandising, and licensing agreements are key revenue drivers of this industry. Without trademarks and branding, these revenue streams would not exist, and we wouldn’t have the spectacular events to enjoy, to dream about, such as the
Professional Development Opportunities
The Best of Boston
3
Today is World Intellectual Property Day, and it gives me great pleasure
to share with you this early edition of the INTA Daily News. It is full of information and insights to help you plan for the global intellectual property (IP) community’s premier event of the year: the INTA Annual Meeting!
The theme for World IP Day this year is “Reach for Gold: IP and Sports.” It is a celebration of sports, which is close to my heart, and an exploration into how IP fosters innovation and creativity in sports, and supports the protection of the sports industry, the athletes, and the billions of fans around the world.
Sports also brings people together in communities that can span the globe, inspires us to dream and pursue
With this year’s Annual Meeting mobile app, you
have the power to easily navigate and optimize your event experience anywhere, any time. Exclusive to Annual Meeting registrants, the app will provide full access to the daily schedule, speakers, sponsors,
and exhibitors, as well as important notifications about the Meeting and plenty of opportunities to engage with other registrants.
New This YearPremium events such as the Course on International Law and Practice,
Get the App: Mobilize Your Experience
141st Annual Meeting, Boston
A Letter from the President
dailynewsFriday April 26, 2019
3
Download INTA’s 2019 mobile app and take the Annual Meeting into your own hands.
When you post messages and upload photos, remember to use the Annual Meeting hashtag: #INTA2019
JOIN THE #INTA2019 ONLINE CONVERSATION
WE WILL SEE YOU ONLINE.
Ahead of the INTA 2019 Annual Meeting, Association President David Lossignol talks brands, education, and corporate social responsibility.
@GoINTA
@INTA
www.inta.org
@intaglobal
INTA’s 141st Annual Meeting in Boston, Massachusetts (USA)w
Plus the Annual Meeting Mobile App
A Sneak Peek at the Schedule
page 4 page 6 page 13
10,750+ registrants
so far!
Published by: 1webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
Published by:2 web
Pre-Annual Meeting Edition 2019
Location, Location, LocationAt the BCEC itself, energy, water, and waste conservation are at the center of the facility’s daily operating strategy. Power consumption is minimized through sensor-controlled high-efficiency lighting, and all restrooms feature low-flow water devices.
Annual Meeting exhibitors are encouraged to participate in these efforts by placing clean, usable, and non-perishable items in bright blue bins in the back of Hall A. The Massachusetts Convention Center Authority’s C.A.R.E. (Community Assistance by Responsible Events) program will then arrange the transport of these recycling items to local nonprofits.
Finally, in addition to the organized CSR opportunities, there are a number of things that registrants can do to “go green” and offset their carbon footprint on a day-to-day basis at the BCEC:
• Travel smart. Try taking the INTA shuttle, walking, or renting a Hubway bike, to travel to and from the BCEC and your meetings around the city.
• Go wireless. Download the INTA mobile app and go paper-free. Save on paper by connecting your device to the free wireless Internet, rather than printing everything you might need.
• Bottle up. Bring your own water bottle to fill up: there are water coolers available in each meeting room.
• Recycle. Deposit paper, plastic, and glass in receptacles in each meeting room and pre-function area, and dispose of leftover food in compost collection bins around the dining area. l
Published by: World IP Review (Newton Media Limited)
©Newton Media Limited 2019
DISCLAIMERAlthough every effort has been made to verify the accuracy of items in the INTA Daily News, readers are urged to check independently on matters of specific concern or interest. The views and opinions expressed in articles are those of the bylined author and/or interviewee and do not necessarily represent those of INTA or its membership. Non-INTA advertisements in the INTA Daily News in no way connote INTA’s endorsement of the products, services, or messages depicted therein.
www.inta.org@intaglobal#INTA2019www.facebook.com/gointa
Giving Back to Boston
When it comes to corporate social responsibility (CSR), INTA has been spearheading various initiatives within the Association and encouraging its global membership to do their share. The efforts are bolstering the community spirit underpinning INTA’s work and giving back to the diverse communities that it comes into contact with.
CSR is built into INTA’s 2018–2021 Strategic Plan, which explicitly refers to the “social value” of brands. One aspect of the Plan centers on reinforcing consumer trust, and one of the ways that INTA is doing this is by sharing the contribution that brands make to the economy and wider society—from employment opportunities to social welfare initiatives—with a greater audience.
The Annual Meeting always has a huge impact on the local community and economy of the host city. During the event, INTA seeks to highlight valuable global causes and to actively contribute to local charities—and the 141st Annual Meeting in Boston is no different.
When You RegisterINTA has partnered with carbonfund.org to shine a light on the importance of offsetting the Annual Meeting’s carbon footprint. Before even arriving in Boston, registrants can make a US $10 donation during the online registration process as part of the Carbon Credit initiative, and the proceeds of this will go toward tackling global warming.
Pre-Plan for Volunteer EventsCSR events taking place during the Annual Meeting will give registrants the chance to give back to Boston while also getting to know each other.
On Saturday, May 18, Bikes for Kids: A Team-Building and Charity Event will take place from 1:00 pm to 4:00 pm at the Boston Convention and Exhibition Center (BCEC). At this event, teams will complete hands-on exercises to learn the practical skills involved in assembling bikes while gaining new team-building skills.
The finished bikes will be donated to a local nonprofit organization which works with children and young people in the city.
Later in the week on Tuesday, May 21, registrants can get involved in the Offsite Volunteer Service Day–Greater Boston Food Bank from 9:30 am to 12:00 pm. They can lend a helping hand sorting and packing food items for The Greater Boston Food Bank, the largest hunger-relief organization in the region, while networking with other participants.
Registration for the Bikes for Kids event and the Offsite Volunteer Service Day is on a first-come, first-served basis. Space for the events is limited, and advance registration via the Annual Meeting Registration Portal is encouraged. If you do not have the chance to register in advance, you can purchase tickets for these events on site at Registration in Hall B.
Non-refundable fees (US $45 for Bikes for Kids and US $40 for Offsite Volunteer Service Day) must be paid upon registering for the events.
Prepare when You PackOther initiatives to keep in mind, particularly when packing for the Annual Meeting, are donation drives for two local nonprofit organizations that help job seekers.
First, INTA is supporting Dress for Success Boston, which seeks to empower women to achieve economic independence by providing a network of support and professional attire.
You can participate in Dress for Success by coming to Boston equipped with a donation of accessories which would be suitable for an interview, such as new or lightly used handbags, jewelry, belts, scarves, and shoes. New pantyhose or tights can be donated, too, along with new travel-sized toiletries. If you don’t have room in your luggage, you can also donate items online using the organization’s Amazon Wish List.
INTA is also collaborating with Solutions at Work, a nonprofit seeking to break the cycle of poverty and homelessness by providing people with the resources and opportunities to improve their confidence and self-sufficiency.
You can participate in Solutions at Work by donating an item a man could wear to, or use in preparation for, an interview. New or lightly used suits (especially Big and Tall suits), dress ties, dress shoes (especially size 12+) and polish, underwear, dress coats, briefcases, and toiletries are all needed to continue the charity’s important work.
Donations for both Dress for Success and Solutions at Work can be deposited onsite, at the BCEC, Exhibit Level—East Registration foyer. The Greater Boston Convention and Visitors Bureau (CVB) is supporting this initiative by asking its members and partners to bring donations to its offices, and the CVB will then deliver them to the Meeting.
Corporate social responsibility is not just a concept or theory; it is a practical approach to how entities operate. Aislinn Burton looks at some of the ways registrants can give back to the Boston-area community during the 2019 Annual Meeting.
Pro Bono Trademark ClinicKnow an individual, small business, or nonprofit in need of legal services relating to trademarks? For the first time, INTA will be hosting a Pro Bono Trademark Clinic, on May 20, at the BCEC, at which trademark attorneys will be donating their time to provide one-on-one consultations. Contact Stacey Sutton at [email protected]; applications are due May 10.
The Annual Meeting always has a huge impact on the local community
and economy of the hosting city.
“
“
CORPORATE SOCIAL RESPONSIBILITY shutterstock / LeM
anna
Pre-Annual Meeting Edition 2019
Published by: 3
PREVIEW
webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
Topics include marketing; emerging technologies such as 4D printing, artificial intelligence, augmented and virtual reality, and blockchain; brand valuation; and corporate social responsibility (CSR). I encourage you all to take advantage of this programming and add these sessions to your schedule.
Corporate Social ResponsibilityIn addition to featuring CSR in the educational program, this year we are continuing our efforts to incorporate CSR initiatives into our Annual Meeting. On page 2 of this INTA Daily News is an overview of the many opportunities that we as registrants have to give back to the Boston community during our time in the city.
Today—and while you’re in Boston—I want you also to think about how CSR has become a cornerstone for almost all brands. It is now treated as a core business function, and it’s expected by consumers. This touches upon another aspect of our expanded “brand professional” role.
Many brands are really working hard for their communities, doing a lot to help local producers and consumers, or simply people in need. As brand professionals, the task at hand is to ensure that trademarks are able to fulfill their role in our brands’ CSR efforts.
We need to support the business of our brands so that they’re effective in building a better society. Yes, IP triggers innovation and creates
President’s Letter (continued)Brand ProfessionalsFirst, given how complex professional sports has
become and how IP weaves its way into almost every aspect of this industry, think about how our roles are evolving and our responsibilities are expanding beyond that of the traditional “trademark practitioner.” Today, we are working in a much broader context as “brand professionals.”
To be effective in this role, we need to be taking a holistic approach to brands. This means educating ourselves broadly about how our businesses operate or, if you are in a law firm, how your clients’ businesses operate, rather than maintaining a narrow focus on IP.
We should be following global events and marketplace trends, and thinking about how they impact our businesses and IP, and how we should be responding accordingly. Likewise, we should be assessing how our own brand or our clients’ brands might be changing for a variety of internal or external reasons. And we need to understand the consumer. It’s about not only observing the changes in the world around us and in our workplace, but moving with those changes, adapting, and evolving.
EducationBy being more outward-looking in our roles as brand professionals, we will not only become better business partners, but it will also help us to raise the profile of IP and the critical issues we face in
business opportunities, but it also supports our brands’ social initiatives and this presents us with a unique opportunity to give back in our roles as brand professionals.
Brands for a Better SocietyAs INTA’s 2019 President, I’ve launched a Presidential Task Force called “Brands for a Better Society.” Its goal is to show how brands help society at large by focusing on what brands are bringing to communities and by moving beyond the traditional message that trademarks merely protect corporate interests.
We want to remind people how trademarks help to communicate quality and support CSR efforts, for instance. We must illustrate this and do more to promote the positive efforts of the brand community.
I look forward to sharing more about this Task Force during the Annual Meeting Opening Ceremony on Sunday, May 19, at 4:30 pm, and I invite you all to join us. Mark your calendars now!
Until then, on World IP Day, thank you for all you do to build a better society. See you in Boston. l
1We want to remind people
how trademarks help to communicate quality and
support CSR efforts.
“
“
David Lossignol
Get the App: Mobilize Your Experience (continued)To easily find your
way around the Boston Convention and Exhibition Center (BCEC) where the Meeting is being held, refer to the BCEC Maps tab to view the facility’s floor plans. A color-coded floor plan of Halls A and B will illustrate where you can find important spots, including registration, exhibitor booths, Internet stations, Meeting Points 1 and 2, Speed Networking, and Hospitality.
Other Key FeaturesLooking for ways to enrich your connections during the Meeting? Networking is a breeze with in-app e-mailing and social feed features. With a few screen taps, you can connect with other registrants who have opted in, and post and comment on photos from the event.
Want to organize and highlight specific speakers and sessions in one place? “Star” these in the Schedule by Day section, and they will immediately populate under My Schedule.
Also, be sure to provide feedback by completing one of several short event surveys. Your comments will be considered when INTA plans future meetings.
Is this going to be your first time in Boston? Or would you like a refresher on where to go and what to do in the area? The app includes Google-integrated maps of the city for easy traveling and coordination. Plus, INTA has included information about the best places to check out—from restaurants to networking events.
Don’t forget to track your daily score in the mobile app game! Earn
points by completing Annual Meeting and app-related activities such as networking, sending app feedback, and visiting the Exhibition Hall. The Association will post the leaderboard in the Exhibition Hall and award a prize to the user with the most points at the end of the 2019 Annual Meeting. The winner will receive a S $100 gift certificate for a restaurant in Singapore for INTA’s 2020 Annual Meeting.
Get Started NowThe app runs on Android and Apple mobile phones and tablets. While much of the app’s functionality is accessible
offline, registrants should connect to the Internet to take advantage of the app’s full potential.
The majority of the app’s functionalities will begin as default “off,” so if you want to use the app to its optimal capacity, be sure to check out which features you want to activate. These opt-in features include registrant messaging, the in-app social stream, notifications, and the game.
The app is available now in Apple and Google Play app stores. Be sure to download it before the 2019 Annual Meeting so you can modify your schedule, preferences, and contacts. Simply log in with the email address and password connected to your INTA account. Then, utilize the mobile app to the max! l
If you need assistance with the mobile app while you are at the Annual Meeting, please visit the INTA Information Booth on the Exhibit Level.
1
our jobs—within our companies, with our colleagues in other departments, and around the boardroom table. This can help us be viewed as equal partners with a legal background rather than “the lawyers” at the table.
Along these lines, the Annual Meeting’s educational program includes sessions that cover both the important trademark and IP-focused content, and topics that look beyond IP. They feature speakers with varied backgrounds and from diverse industries, and are designed to help us step outside our comfort zone and step into our roles as brand professionals.
shutterstock / leungchopan
Published by:4 webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
Pre-Annual Meeting Edition 2019
Additional fees are applicable for Lunch and Learn, Table Topics, and the In-House Practitioners Workshop and Luncheon. Visit the Registrant Portal
and we’re going to look at why business development matters. It’s not just to make more money: a strong plan is a path to having control of your own career.”
On Saturday, May 18, from 12:00 pm to 1:15 pm, Allan Jarry, CEO and Founder, JARRY IP (Chile) hosts CSA22 Assembling the Super Team: Leveraging Your Group’s Strengths to Maximize Performance, a panel discussion aimed at helping registrants to better understand their teams and identify individual strengths and weaknesses to support group performance.
“As we all know, in team sports great victories are accomplished by great teams, not just great individuals,” says Mr. Jarry. “In our legal teams, it’s no different. Our panel will give you specific tools and advice to help you achieve those victories!”
Table Topics—small group discussions during breakfast or lunch—present another opportunity for registrants to work on their professional development. Several of the discussions will address this topic. (Note: You must pre-register for these events.)
On Saturday, 12:00 pm to 2:00 pm, relevant Table Topics include TSA50 How to Deal with a Difficult Boss, hosted by Robert M. O’Connell, Of Counsel at Fish & Richardson P.C. (USA); and TSA53 #MeToo in Law Firms, led by Agustina Fernández
The Big Win: Building Your Skills to Build Your Value
While the Annual Meeting provides an excellent venue for developing
business with colleagues from across the globe, being a legal professional in 2019 is about far more than focusing on the job at hand. For those who want to ensure they are not just the best they can be at their jobs, but are also recognized as the best colleagues, mentors, and leaders, there are rich opportunities throughout the program to learn key skills for these myriad roles.
As motivational speaker Kaplan Mobray (USA) puts it, “It comes down to giving yourself as many opportunities as you can to deliver a unique perspective or offer something from an angle that only you can provide.” Mr. Mobray’s Lunch and Learn: “The 10Ks of Personal Branding” is on Monday, May 20, 1:15 pm to 3:15 pm.
Mr. Mobray will discuss how to build your personal brand, ensuring that when you interact with current or potential clients and colleagues, you leave a lasting impression. Expect a high-energy session!
At the Annual Meeting’s second Lunch and Learn session, Lunch and Learn: Business Development Skills for Lawyers, on Tuesday, May 21, 1:15 pm to 3:15 pm, Mark Beese, President of Leadership for Lawyers, LLC (USA), will zero in on how to build an effective professional network, as well as how to conduct business development meetings to ensure the best chance of success.
Mr. Beese explains that lawyers today need to learn to adapt better; just waiting for a client to pick up the phone is no longer enough.
“You must be proactive and have conversations to reveal opportunities where you can bring up your unique value proposition and your selling points,” Mr. Beese says.
At the session, he adds, “We’re going to look at skills and habits that will make your business development more effective,
Giambruno, Partner at Fernández Secco & Asociados (Uruguay).
Explaining the context of her Table Topic, Ms. Fernández says: “Workplace sexual misconduct has been going on since women entered the workforce and that is not news. However, the social change that has progressively allowed women to report this conduct has been stealing headlines.”
She adds that it is essential for all firms to have a plan for preventing sexual harassment and, if it does occur, that they know how to handle it.
“I doubt any client would trust us to preserve their brand value, if we show ourselves to be unable to adequately manage our own challenges,” Ms. Fernández says.
On Sunday, May 19, 12:00 pm to 2:00 pm, junior lawyers may find TSU65 How to Be a Superstar Associate, hosted by Jessica Sganga, Associate at Knobbe Martens (USA), especially useful for their professional development.
It’s not just established professionals who can add skills to their portfolio in Boston. On Saturday, May 18, students will have the opportunity to attend a Career Development Day at the Annual Meeting.
Students will learn practical skills to best position themselves to get the best jobs, including mastering the art of the interview at an Interview Skills Panel; and developing one of the most relevant Annual Meeting skills—making connections, at Networking 101.
Then, these students—as well as young practitioners, new INTA members, and first-time registrants to the Annual Meeting—will have a chance to practice their networking skills at the Annual Meeting Registrant First-Time Orientation and Reception, 3:00 pm to 5:00 pm on Saturday. If you see them there, please do make them feel welcome. Who knows, maybe one of them is your next superstar associate!
From developing a personal brand to handling difficult bosses, there is a wide array of professional development opportunities available in Boston. Peter Scott reports.
For registrants who are more advanced in their careers, two sessions are particularly noteworthy from a professional development perspective. CSA50 Trademark Administrators Idea Exchange and Best Practices on Saturday, 3:00 pm to 4:15 pm, provides an opportunity to join an interactive session covering best practices and career development topics. The rotating roundtable format allows you to choose the topics best suited to your goals, and will ensure lively discussion.
The In-House Practitioners Workshop and Luncheon: Demonstrating the Value of Your Brand Team on Sunday, 9:30 am to 2:30 pm (advance registration required), is a must-attend exclusively for in-house practitioners, to discuss a range of topics from how to demonstrate the value of your work through metrics to how best to use technology to support and transform your brand teams.
With increasing pressure from internal stakeholders on in-house intellectual property teams to demonstrate the positive effects they have on their businesses, this workshop is not to be missed. l
Mark BeeseKaplan Mobray
PROFESSIONAL DEVELOPMENT
Get a Grip on the 2019 Annual Meeting!INTA Mobile AppDownload the 2019 INTA Annual Meeting mobile app to tap into everythingthat’s happening, to personalize your schedule, and to ease networking.
Thank you to our mobile app sponsors:
Available at:
Some of these activities require advance registration and incur fees. Check the Registration Portal.
[email protected]+44 (0) 207 186 1800
www.ipcentrum.com
LAUNCH SEQUENCE
G2 SHUT DOWN
EPV MIGRATION
G2 CR SEPARATION
P2 CLIENT ONBOARDINGCAUTO 1CINST 1
P1 CLIENT ONBOARDINGG2 PR SEPARATION
P2 PARTNER ONBOARDING
PAUTO 1
PINST 1
P1 PARTNER ONBOARDING
MIGRATION TEST OK
PROD ENV
START UP
Preparing for launch ...“Continually push further and without being limited by convention, to prove that the ‘truly special’ can be done, regardless of whether it is absolutely necessary to do so. Without a drive towards such things, the world would solely be functional.”
The imminent launch of IPC Renew, by IP Centrum, marks the final few weeks of the renewals industry as we’ve all known it to date.
After five years of the most intense service development programme imaginable, we are proud to finally introduce to the world’s greatest IP formalities professionals, the future of renewals.
Follow the launch: @ipcentrum
Sign up for early access: www.ipcentrum.com/renewals
C
M
Y
CM
MY
CY
CMY
K
IPC Renew - Preparing for Launch - 240x340.pdf 2 06/04/2019 16:21:26
Published by:6 webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
Pre-Annual Meeting Edition 2019
“Our panel will explore the availability of copyright and trademark protection for fictional characters in several key jurisdictions, as well as options for enforcing rights in fictional characters against counterfeits and other infringements,” he says.
The panel will consider how rights
A Sneak Peek at Educational Sessions
With five days of educational programs and networking
opportunities, the Annual Meeting presents a unique opportunity for brand and trademark professionals to come together and learn about issues that are shaping both industry and legal practice.
It would be impossible to preview all that this year’s Annual Meeting has to offer, but here is a little taste of the type of sessions that will take place in Boston.
On Saturday, May 18, 12:00 pm to 1:15 pm, find out how and why fictional characters in movies, TV shows, comic books, and other media are increasingly important intellectual property (IP) in CSA20 Character Wars: Trademarks vs. Copyright Protection for Fictional Characters.
Jeffrey R. Cadwell, Partner at Dorsey & Whitney LLP (USA), who will be moderating the session, explains that fictional characters—like sports mascots or TV characters—are very valuable assets.
in characters can be protected and enforced by a patchwork combination of trademark and copyright laws across different jurisdictions, including in China, Europe, Mexico, and the United States.
One of the panelists, Chantal Koller, Managing Director, Trademarks at Novagraaf Switzerland SA (Switzerland), says, “Since Voldermort was acquitted from all his crimes in a fictional process held in Paris in November 2018, and Peppa Pig was recently confirmed not to be a tapir but indeed a character deserving trademark protection by the General Court of the European Union, your favorite characters may want to get the legal protection they deserve.”
“Come and listen to our panel discussions on how we can offer them optimal worldwide IP protection,” Ms. Koller adds.
On Sunday, May 19, 10:15 am to 12:00 pm, registrants can attend CSU02 The Times They Are a Changin’: Maximizing the Perspectives Around Us to explore the value of diversity initiatives and how to overcome the challenges in implementing them.
The session will be led by Jennifer M. Mikulina, Partner at McDermott Will & Emery LLP (USA).
“We are excited to discuss a variety of diversity-related topics with our panelists, including the challenges that law firms and corporations face from a diversity perspective, and the efforts that could really make a difference to help move the needle on diversity in the legal profession,” she says.
Speaking at the session, Monique E. Liburd, Trademark Counsel at Google (USA), says that she and the other panelists look forward to sharing their own experiences in the diversity and inclusion
With more than 300 educational offerings at the Annual Meeting, Aislinn Burton previews just a handful of sessions that will be discussing hot topics—from the protection of much-loved fictional characters, to combating counterfeits on a budget, to the interplay of advertising and trademarks in sports.
space, across different organization styles, industries, and initiatives.
“It should be an engaging discussion that will inspire the audience to evaluate instituting or supplementing their own diversity and inclusion programs,” according to Ms. Liburd.
The following day, on Monday, May 20, 10:15 am to 11:30 am, a panel of in-house counsel will discuss their strategies for eliminating fakes in the market
Jeffrey Cadwell
Monique Liburd
SESSIONS TO WATCH
It should be an engaging discussion that will inspire the audience to evaluate instituting or supplementing their own
diversity and inclusion programs.
Monique Liburd
““
INTA DAILY NEWS ADVERTISING SPECS
INTA DAILY NEWS ADVERTISING SPECS
webwww.facebook.com/INTA #INTA2018 @INTA2018 www.inta.org Published by:
§§ QQuuaalliittyy || RReelliiaabbllee || IInnvvaalluuaabbllee §§ FFooccuuss Patents, Trademarks, Copyrights, Trade Secrets, Unfair Competition Licensing, Counseling, Litigation, Transaction
FFeeaattuurreess Our patent attorneys and patent engineers hold outstanding and advanced academic degrees We are dedicated to provide the best quality service in IPRs Our international clients include AArrmmaannii,, BBaaiidduu,, BBeecckkhhooffff,, BBYYDD,, CCIICCCC,, CCyypprreessss,, DDrr.. RReeddddyy,, IInntteerrcceepptt,, IInntteerrDDiiggiittaall,, GGlleeaassoonn,, GGrreennzzeebbaacchh,, HHaarriibboo,, IInntteerrcceepptt,, LLeennoovvoo,, LLuuppiinn,, MMoottoorroollaa,, MMPPSS,, NNoovvaaLLeedd,, OOppppoo,, PPiirraammaall,, SScchhootttt GGllaass,, SSuunn PPhhaarrmmaa,, TToorrrreenntt,, TTooyyoo IInnkk
PPhhiilloossoopphhyy To provide competent legal services that other firms cannot comparably provide Selecting, edifying and nurturing peoples who have the following personalities: learned in expertise, morally earnest and sincerely behaved in mind and strictly disciplined between give and take
AAddddrreessss:: 1133tthh FFlloooorr,, 2277,, SSeecc.. 33,, CChhuunngg SSaann NN.. RRooaadd,, TTaaiippeeii,, TTaaiiwwaann ℡℡ TTeelleepphhoonnee:: 888866--22--2255885566668888 FFaaxx:: 888866--22--2255998899990000//2255997788998899 EE--mmaaiill:: eemmaaiill@@ddeeeeppnnffaarr..ccoomm..ttww WWeebb ssiittee:: hhttttpp::////wwwwww..ddeeeeppnnffaarr..ccoomm..ttww
▓▓▓▓▓▓▓▓▓▓▓▓ IIIIIIIIPPPPPPPP RRRRRRRRiiiiiiiigggggggghhhhhhhhtttttttt PPPPPPPPrrrrrrrroooooooosssssssseeeeeeeeccccccccuuuuuuuuttttttttiiiiiiiioooooooonnnnnnnn &&&&&&&& LLLLLLLLiiiiiiiittttttttiiiiiiiiggggggggaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn
▓▓▓▓▓▓▓▓▓▓▓▓ CCCCCCCCoooooooorrrrrrrrppppppppoooooooorrrrrrrraaaaaaaatttttttteeeeeeee LLLLLLLLeeeeeeeeggggggggaaaaaaaallllllll &&&&&&&& CCCCCCCCoooooooonnnnnnnnssssssssuuuuuuuullllllllttttttttiiiiiiiinnnnnnnngggggggg
▓▓▓▓▓▓▓▓▓▓▓▓ IIIIIIIIPPPPPPPP VVVVVVVVaaaaaaaalllllllluuuuuuuueeeeeeee--------AAAAAAAAddddddddddddddddeeeeeeeedddddddd SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeeessssssss
Since 1992 ...Since 1992 ...Since 1992 ...Since 1992 ... Territories: Taiwan, Mainland China, Hong Kong, and Macau Fields: Mechanics, Chemistry, Pharmacy, Biology, Electronics, Optics, Telecommunications, and Computer Sciences
INTA DAILY NEWS ADVERTISING SPECS
webwww.facebook.com/INTA www.inta.org Published by:
Founded in 1962 | Intellectual Property Lawyers | TechniciansThis year our firm is represented at INTA´s 141st Annual Meeting
by Claudia Serritelli, Esq.
Maipú 757, 5th floor | C1006ACI | Buenos Aires | ARGENTINAA
P F E(5411) 4322-4176 (5411) 4322-4157/4145 [email protected] [email protected]|
ESTUDIO CHALOUPKA
H
#INTA2019 @INTA2019
Published by: 7
Pre-Annual Meeting Edition 2019
Joining them on the panel will be Mary A. Carragher, Chief Counsel, Global Marketing and Media at Mondelēz International (USA); and Lena C. Saltos, Associate General Counsel, Global Director of Intellectual Property at Urban Outfitters, Inc. (USA). Ms. Carragher says that the panel will “showcase the many ways corporate and product marketing leverages the current spotlight placed on environmental and cultural sensitivity, along with identifying what can and has gone wrong—legally and reputationally—for some.”
Also on Tuesday, 3:30 pm to 4:45 pm, speakers will discuss online marketplace and advertising platforms and the mechanisms which address the sale of counterfeits, in CT52 Advances in E-Commerce and Advertising: How Platforms Address Cyber Fraud.
Shwetasree Majumder, Principal at Fidus Law Chambers (India), explains that despite the global tightening of privacy regulations, cyber criminals always seem to be a few steps ahead.
“In keeping with the demands of the situation on the ground, lawyers and courts are pushing creative boundaries to come up with solutions to tackle cyber fraud by means that are often a mix of IP law and criminal law with intermediaries, brand owners, and
while adhering to budgetary constraints at CM01 The Cost of Combating Counterfeits: How to Maximize Your Return on a Limited Budget.
How to prioritize spending by country and region, the cost-effective management of customs recordation, and collaboration with other brands will be among the topics discussed by Michelle Brownlee, Trademark Counsel at Bose Corporation (USA); Paola Piccoli, Head of Brand Enforcement at Maus Frères (France); and Angela Lynnette Wilson, Assistant General Counsel at Hallmark Cards Inc. (USA); and Jennifer Dirks, Brand and IP Protection Manager at Epson America, Inc. (USA).
On Tuesday, May 21, 10:15 am to 11:30 am, panelists will explore how corporate disclosures regarding their efforts to address social, environmental, and health risks are likely to impact their brands at CT03 Brand Protection and the Intersection of Trademarks, Advertising, and Corporate Social Responsibility.
Natasha N. Reed, Counsel, and Gare Smith, Partner, both based at Foley Hoag LLP (USA), explain that the session will cover the interrelationship between trademarks, false advertising, and corporate social responsibility compliance requirements.
other stakeholders coming together for a common cause,” she says.
The session will offer some practical ideas to tackle the problem, with real-life examples of what works and what doesn’t, adds Ms. Majumder.
Then, on Wednesday, May 22, 11:45 am to 1:00 pm, speakers will offer practical advice and insight on the advertising and regulatory challenges facing brand owners in different countries at CW21 Advertising and Branding Restrictions (Interplay of Regulatory, Right of Publicity, and TM Issues).
According to panelist Paola Gelato, Partner at Studio Legale Jacobacci & Associati (Italy), the session will cover the interplay of regulation, the right to publicity, and trademarks in the context of advertising and branding restrictions, particularly in sports.
Ms. Gelato adds that recent decisions of the Court of Justice of the European Union and the Italian Courts have protected well-known brands such as Adidas, Asics, and Puma by recognizing enhanced communication advertising power as a key function of sports trademarks.
The session takes place in the context of a number of major sporting events which are scheduled in 2019, including the FIFA Women’s World
Cup in France and the Rugby World Cup in Japan.
According to Ms. Gelato, the strengthened position of trademark owners, in relation to advertising, will be a key topic of discussion at the session. l
webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
Head to www.inta.org/2019AM to view the full schedule of events and sessions taking place at the 2019 Annual Meeting.
SESSIONS TO WATCH
Shwetasree Majumder
On-site registration will also be available for INTA’s corporate social responsibility initiatives and Networking Excursions taking place over the five days of the Annual Meeting, but you should make the most of the Registrant Portal by planning ahead and signing up for sessions, events, and excursions in advance.
First-timersINTA will hold the Annual Meeting First-Time Attendee Orientation and Reception at the BCEC, 3:00 pm to 5:00 pm on Saturday, May 18. For
Guiding You Through the 2019 Annual Meeting
The Boston Convention and Exhibition Center (BCEC) is the
place to be for almost all of the activities at the 2019 Annual Meeting, including sessions and workshops, Table Topics, exhibits, Hospitality, Speed Networking, committee meetings, the In-House Practitioners Reception and various receptions. In fact, the only goings-on outside of the BCEC are the Anticounterfeiting Workshop, one charity event, Networking Excursions, and the Grand Finale.
RegistrationThe registration desk will open at the BCEC, Hall B1, at 9:00 am on Saturday, May 18.
INTA will e-mail registrants a “Know Before You Go” document in early May. This document will contain an e-ticket and barcode which you will need to show at the Registration Desk to receive your badge—and you’ll need your badge to access all Annual Meeting events (and the shuttle buses).
If you are registering on site, owe a balance on your registration fee, and/or have changes to your name or your firm or company name, please go directly to New Registrations—otherwise, go to Express Check-in.
first-timers, this is an exciting and friendly introduction to the Annual Meeting and a great opportunity to network with other newcomers, as well as with veteran registrants who will be on-hand to share their tips for getting the most out of the Annual Meeting.
Getting to the ConferenceINTA will provide morning and afternoon shuttles to and from a number of hotels and the BCEC; check out the Registrant Portal for the full schedule and route. Driving services Lyft and Uber also serve Boston along with taxis, and bike share program Hubway is an alternative travel option.
Be Part of the Story Make sure you pick up a copy of the INTA Daily News from stands around the BCEC for the latest features on industry-related topics, and photos and news from the Annual Meeting.
Also, download the INTA mobile app to have instant access to all the information you need, from room locations to the daily schedules.
In addition, to also be part of the story, share your experiences at Annual Meeting by posting comments and
The 2019 Annual Meeting is easy to get around. Aislinn Burton provides the key information.
photos on social media—incorporating the #INTA2019 hashtag into your messages.
Opening CeremonyHear INTA President David Lossignol and INTA CEO Etienne Sanz de Acedo share their vision for the future of the Association and for brands at the Opening Ceremony and Keynote Address on Sunday, May 19, 4:30 pm to 6:00 pm. Michael Haddad, a professional athlete and United Nations climate change champion, will deliver this year’s inspirational Keynote Address.
Grand FinaleJoin us for a final night of fun, food, and networking at the Grand Finale: A Night of Experiences at Boston’s Museum of Science, which is home to a 65-million-year-old Triceratops fossil. The event will take place on Wednesday, May 22, 7:00 pm to 11:00 pm; during that time, shuttle buses will run between selected hotels and the museum. Substantial hors d’oeuvres and drinks will be provided.
For more information on what to expect at the Annual Meeting, and how to participate, make sure you check out the Registrant Portal! l
Michael Haddad
Pre-Annual Meeting Edition 2019
Published by:8 webwww.facebook.com/gointa @intaglobal www.inta.org#INTA2019
EXHIBITION HALL
Get to the Exhibition Hall!Plan your visit to the Exhibition Hall before you arrive! Be sure to schedule time to visit the exhibitors and get on-the-spot answers to your questions from service and product providers.
545
543 443
945
943
941
939
937
935
745
743
741 740
739
737
735
845
843
841
839
837
835
944
942
940
938
936
934
844
842
840
838
836
834
344444 345
342
340
338
336
334
244
242
240
238
236
234
245
243
241
239
237
235
145
143
141
139
137
135
933
931
929
927
925
923
921
919
928
926
924
922
920
918
828
826
824
822
820
818
829
827
825
823
821
819
729
727
725
723
721
719
917
915
913
911
909
914
912
910
908
644
642
628
626
624
622
620
618
428
426
424
422
420
418
610
608
606
815
813
811
809 609
907
901
713
707
701
641
635
619
601700801
535 435 335
529
527 427
419
525
523
521
519
329
327
325 225
323
321
319 219 119
515
513
511
509
507
514
512
510
508
506
504
502
500
314
312
310
308
306
214
212
206
304
302
300
415
413
411
409
407
405
403
401
215
213
211
209
207
205
203
201
115
113
111
109
107
101501 301
KEY LOCATIONS● Hospitality● Exhibition Hall● Speed Networking
● Meeting Points● Freeman Service Center● Restrooms
● Entrance● Exit
MEETING POINT 1
ME
ETI
NG
PO
INT
2
INTE
RN
ET
STA
TIO
NS
INTA 2019
162 Exhibitors
From 39 Countries
From 6 Continents
Asia 48
Europe 48
North America 56
South America 5
Africa 4
Oceania 1
From 7 Industry Sectors:l Associations l Governmentl Law Firmsl Law Schools l Management/
Business Solutions l Media/Publishingl Registry/Domain
Exhibition Hall Hoursl Sunday, May 19
10:00 am–4:00 pml Monday, May 20
10:00 am–4:00 pml Tuesday, May 21
10:00 am–4:00 pml Wednesday, May 22
10:00 am–2:00 pm
Pre-Annual Meeting Edition 2019
Published by: 9webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
EXHIBITION HALL
Exhibitor Booth101domain.com 515ABPI-Brazilian Intellectual Property Association 824ACCOLADE IP Ltd. 209Actio IP 937Acumass 707Adastra IP 243Afilias 513African Regional Intellectual Property Organization (ARIPO) 115AIPPI, International Association for the Protection of Intellectual Property 820,822Al Adwani Law Firm 342ALIAT LEGAL 411Alt Legal 727,729Alvarez Delucio 929Alyafi IP Group 713Anaqua 701AppDetex 819,821Applied Marketing Science 606,608Asesores del Caribe 927Asia IP 244ASIPI: Inter-American Association of Intellectual Property 818Beijing Gaowo IP Law Firm 610Beijing Globe-Law Law Firm 933Beijing Saintbuild Intellectual Property Agency Co., Ltd. 511Beijing Sanyou Intellectual Property Agency Ltd. 901Beijing Uni-intel Patent and Trademark Law Firm 739Beyond Attorneys at Law 835,837Billtrader 644Boss & Young IP Legal, Greater China 529Brand Institute, Inc. 907BrandShield 426,428Bufete Mejia & Asociados 139,141C&H IP LAW LIMITED 823,825CARIBBEAN TRADEMARK SERVICES - GEORGE C.J. MOORE, P.A. 401Catchword Branding 345CheckMark Network 300China IP Magazine 838Cislo & Thomas LLP/Patentfiler.com 834Com Laude 737CompuMark 301Computer Packages Inc. (CPI) 700CONSOR 500,502Copyright Clearance Center 314Corsearch 619Cosmovici Intellectual Property 234,236Co-Talent Intellectual Property Firm 840CounterFind 844CPA Global 501CSC 201Darts-ip 609Dastani & Dastani LLP 325Dennemeyer Group 119Docket Alarm 938Duong & Tran Intellectual Property Law Firm 308Eldib & Co Attorneys at Law 239,241EnCirca 826,828Equinox by Work AnyWare 839,841Eurasian Patent Organization (EAPO) 745Fairsky Law Office 924The Global IP Matrix 306Gorodissky & Partners 740Gridlogics 344Guangzhou JUNCY Intellectual Property Agency 743Hong Kong Trade Development Council 323HSM IP LTD 601IAM 920Intellectual Property Publishing House Co., Ltd. 111,113Intels Group 912,914InterNetX GmbH 338Inventa International 219INVESTIP 911Iolite Softwares Private Limited 213IP Fee Calculator ApS 842IP Trend Eurasia 642ipan Delegate Group 419IPPro 622IPzen 908,910Japan Patent Office (JPO)/Japan External Trade Organization (JETRO) 206Kangxin Partners, P.C. 335Kayming Intellectual Property (Shenzhen) Co., Ltd. 926Keisen Associates 527Kondrat & Partners 413Korean Association for Intellectual Property Services (KAIPS) 235,237
Exhibitor BoothKorean Intellectual Property Office (KIPO) 212,214Leaders League 635LEAO Intellectual Property-Brazilian IP Firm 915LexisNexis 403Lexsynergy Limited 928Lighthouse IP 919The Luzzatto Group 519,521Managing Intellectual Property-IP Stars 504,506Markify 512,514Marksmen 618,620MaxVal 836Michigan State University- College of Law & A-CAPP Center 942Mikhailyuk, Sorokolat & Partners 809,811Morningside IP 913Moser Taboada 922NAM & NAM 523,525Namied Patent & Trademark Law Office 923Nanjing Jingwei Patent & Trademark 135,137NBS Intellectual Sdn Bhd 935Nevium Intellectual Property Consultants 211Noli IP Solutions PC 741Nominet 735Novagraaf 535OAPI 107,109O P Solutions, Inc. 145OpSec Security 334,336Oxford University Press 215Pacific Patent Multiglobal 422,424Page Vault 925Patentus 945Patrix IP Helpware 801PAVIS GmbH 535The PCT Network 443Pham & Associates 205Pintz and Partners LLC 909Quality Brands Protection Committee of China Association of Enterprises with Foreign Investment (QBPC) 917
Quantify IP 304Questel 242Rouse Myanmar 931RWS 319,321S.S. Rana & Co 641SafeBrands 312Safenames 415SBZL IP Law Firm 405Schmitt & Orlov IPR 827,829Sedo.com 340Selvam and Selvam 543Singh & Associates, Founder- Manoj K Singh Advocates and Solicitors 813,815Sjiem Fat & Mahabir 203SK Worldwide, Ltd. 302SMAS Intellectual Property 238,240SOJUZPATENT 624Sortify.tm 444Sugimura & Partners 225SURYS, Inc. 939TM Cloud Inc. 626,628TM TKO 409Trademark Clearinghouse 207The Trademark Lawyer Magazine 407TrademarkNow 427Trademarks & Brands Online 420trainMARK: The next level of trademark practice 940University of New Hampshire School of Law--Franklin Pierce Center 545Vantage Asia 921Vash Patent Ltd 310Vidhani Associates 941VIVANCO & VIVANCO Associates 507,509Vox Populi Registry 435Watson & Band 723,725WebTMS Ltd./Intellectual Property Online Ltd. 719,721Western Union Business Solutions 143WilyFish 245WiseTime, by Practice Insight 934,936Witmart Inc. 843,845Wolters Kluwer 327,329World Intellectual Property Organization (WIPO) 101World IP Review 418World Trademark Review (WTR) 918YUHONG IP Law Firm 508,510Zola Suite 944
Pre-Annual Meeting Edition 2019
Published by:10 webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
RECEPTIONS
INTA’s Pre-Annual Meeting Receptions are planned exclusively for
INTA members and non-members to learn more about INTA’s 2019 Annual Meeting in Boston. Attendees brought friends, co-workers, and prospective members to find out more about INTA’s 2019 Annual Meeting and to discover all the benefits INTA offers.
INTA values and appreciates the hard work and efforts of the hosts who planned 25 receptions in 19 countries between February 28 and May 6, 2019. l
Networking Around the World: INTA Pre-Annual Meeting Reception Roundup
7
3 5
1 8
RECEPTION DATE HOST FIRM LOCATION
February 28, 2019 Di Blasi Parente & Associados Rio de Janeiro, Brazil
March 19, 2019 LDS Łazewski Depo & Partners and POLSERVICE Patent and Trademark Attorneys Office Warsaw, Poland
March 21, 2019 Gowling WLG Moscow, Russia
March 21, 2019 Grünecker Patent Attorneys and Attorneys-At-Law Munich, Germany
March 22, 2019 Schwarz Schӧnherr Vienna, Austria
March 28, 2019 International Trademark Association New York, USA
April 10, 2019 Watson & Band and Shanghai Pudong Intellectual Property Association Shanghai, China
April 11, 2019 Cavelier Abogados Bogotá, Colombia
April 11, 2019 Marval, O’Farrell & Mairal Buenos Aries, Argentina
April 11, 2019 Leason Ellis LLP New York, USA
April 17, 2019 Seed IP Seattle, USA
April 18, 2019 Coblentz Patch Duffy & Bass LLP San Francisco, USA
1
2
3
4
5
6
7
8
9
10
11
12
Pre-Annual Meeting Edition 2019
Published by: 11webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
RECEPTIONS
6 12
10 6
119
4 2
Pre-Annual Meeting Edition 2019
Published by: 13webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
BOSTON HIGHLIGHTS
Visit the “Little Italy” of BostonBoston’s North End has long been called the “Little Italy” of Boston, with a range of boutique grocery stores and eateries lining its quaint, narrow cobblestone streets.
Three Networking Excursions (Saturday, May 18; Monday, May 20; Tuesday, May 21) will take place in the North End, complete with a guided tour covering how to spot authentic ingredients and how to prepare them. The excursions are US $119.
Head to the Market Faneuil Hall Marketplace and Quincy Market (4 South Market Street) will propel your senses, including your taste buds, into high gear. Amidst shops and pushcarts filled with merchandise are plenty of restaurants and food kiosks. Here, you can devour Boston-area traditional eats like New England chowder, brown bread, and cream pie.
Within a Mile of the Boston Convention and Exhibition CenterIf you’re looking to stay close to the Convention Center, there’s plenty to choose from.
Eat, Explore, Experience
As one of the oldest cities in the United States, Boston has a rich history, but
it is also an area of modern economic and cultural excellence. There is no shortage of places to explore in Boston. Head out on your own or, better yet, INTA is offering a number of Networking Excursions during the Annual Meeting to help registrants make the most of everything that the city has to offer.
You can use the Registration Portal to book yourselves (and your guests) onto these excursions, ahead of the Annual Meeting.
“Eat” BostonFeast at a Traditional Bostonian EateryThe Summer Shack (50 Dalton Street) is a casual restaurant specializing in New England-style seafood. With an offering of at least 10 different types of oysters every day, lobsters in various sizes and styles, and local fish/seafood, the Summer Shack offers tourists a quintessential culinary experience.
INTA is running a Networking Excursion to the Summer Shack on Saturday, May 18, 6:00 pm to 9:00 pm. Registration costs US $155.
• 75 on Liberty Wharf is an America-inspired bistro, boasting a selection of innovative New England-style fare using locally sourced ingredients (220 Northern Avenue).
• by CHLOE is a plant-based restaurant, offering delicious and wholesome vegan food (107 Seaport Boulevard).
• City Tap House is a rustic but comfortable American pub, serving 60 draft lines of craft beer from around the world (10 Boston Wharf Road).
• Empire is a 14,000 square-foot boutique Asian restaurant with an extensive menu ranging from sushi, to noodles, to wok dishes, to special delicacies (1 Marina Park Drive).
Explore BostonBe Guided Through HistoryIn a city where there is so much to see, including sites of rich historical significance, the task of selecting which attractions to visit can be daunting. INTA is running three Boston Revealed Networking Excursions (Saturday, May 18; Sunday, May 19; Tuesday, May 21) of varying lengths to help you experience as much of Boston as possible. The excursions, which cost from US $48 to US $143, all include a
There’s plenty to eat, see, and do during your spare time at the Annual Meeting, but if you’re not sure where to start, here are a few ideas to get you going, as Aislinn Burton reports.
guided tour spanning Boston’s historic, religious, and political context.
Take a Trip into the Heart of Beacon HillOn this Networking Excursion, enjoy an overview of the State House, the 54th Regiment Memorial, and views of the Back Bay. The trip includes a tour of private homes in Beacon Hill, providing an unrivaled behind-the-scenes glimpse of the Yankee region’s most favored historical neighborhood.
The trip, which will take place on Monday, May 20, 1:00 pm to 4:30 pm, costs US $100.
Be Inspired by ArtFounded in 1936, the Institute of Contemporary Art (25 Harbor Shore Drive) is the oldest non-collecting art institution in the United States. Located on the waterfront, it presents contemporary art including music, film, video, and performance, as well as experiential learning opportunities.
Go Back in Time with JFKU.S. President John F. Kennedy was born and educated in Boston, and now the John F. Kennedy Presidential Library & Museum (Columbia Point) is home to political memorabilia, audiovisual material, and family photographs. Boston’s North End: traditionally known as Little Italy
Beacon Hill
Lunch and Learn: Professional DevelopmentBuilding a personal brand with Kaplan Mobray:Monday, May 20Succeeding at business development with Mark Beese:Tuesday, May 21
Visit the Registrant Portal to make a reservation
MENU ON THE
shutterstock / Christopher Penler
shutterstock / Sean Pavone
Pre-Annual Meeting Edition 2019
Published by:14 webwww.facebook.com/gointa #INTA2019 @intaglobal www.inta.org
practitioner. “It also helped expand my network as my match introduced me to her contacts!” What could be better than that? l
BOSTON HIGHLIGHTS
Fenway Park
The city is home to the Boston Red Sox, the Major
League Baseball (MLB) team that’s won nine World Series
championships (including in 2018).
Sign up for the Newcomers Match program by April 30, using the submission form on the Registration Portal.
“
“
The site also has breathtaking views of Boston, the Harbor Islands, and Boston Harbor.
Boston Tea Party Ships & MuseumAt the Boston Tea Party Ships & Museum (Congress Street) you will encounter live actors, interactive exhibits, and authentically restored tea ships. The floating museum offers the opportunity to participate, explore, and learn about the events that led up to the American Revolution in what is guaranteed to be a memorable experience.
Freedom Trail Tour: Walk into HistoryTake a Walk into History with 18th century costumed guides and visit a
collection of museums, churches, parks, ships, and other historic markers that tell the story of America’s history. Tours operate hourly every day, departing from Boston Common Visitor Information Center (Tremont Street).
Experience BostonHave a Ball with the Red SoxThe city is home to the Boston Red Sox, the Major League Baseball (MLB) team that’s won nine World Series championships (including in 2018). The stadium, Fenway Park (4 Jersey Street), opened in 1912, and is the oldest stadium in MLB.
You can purchase tickets to tour the stadium (up to 30 days before each tour date) on the Red Sox website but, if you don’t fancy a solo tour, INTA is hosting a Networking Excursion to a Red Sox game on the evening of Saturday, May 18. The cost of the event is US $169, and includes a voucher to sample the one and only Fenway Frank.
All Aboard the Charles RiverGet adventurous and rent a canoe, paddleboard, or kayak to enjoy the city of Boston (and other sites, like the world-famous Harvard
University) from a whole new viewpoint. Paddle Boston (Soldier’s Field Road) offers a range of activity and rental packages.
Take a Trip to Castle IslandCastle Island, a peninsula on the shore of Boston Harbor, is technically no longer an island, having been connected to the mainland in 1928. However, the peninsula remains the site of a fort erected in 1634, making it a great place to explore or simply sit and enjoy the view.
registrants will offer them the inside scoop on the Annual Meeting and tips on how to maximize their time during the five days of education and networking opportunities.
For the Newcomers Match, INTA, in advance of the Meeting, pairs peers based on a short online survey that considers, when possible, similarities such as roles, years of experience, organization types, and
Newcomers Match Program Pairs Annual Meeting First-Timers
The 2019 Annual Meeting will get off to a friendly start for first-
time registrants thanks to INTA’s Newcomers Match program. The Association has expanded the program this year to allow all first-timers to enroll, after running a successful pilot for a limited number of participants at last year’s Annual Meeting.
Because an event that draws 10,000+ people can seem overwhelming at first, the Newcomers Match program offers peers a built-in way to make an easy connection right from the start. From there, it’s a great opportunity for each duo to navigate a portion of the Meeting together and share impressions and experiences.
About 1,000 registrants will be attending the INTA Annual Meeting for the first time this year.
The program complements the warm welcome given to first-timers who attend the Annual Meeting Registrant First-Time Orientation and Reception, which will be held on Saturday, May 18, 3:00 pm to 5:00 pm, at the Boston Convention and Exhibition Center (BCEC). Young practitioners, students, and new INTA members may also attend the Orientation, at which return
regions. Participants will find out about their match in early May and are encouraged to connect via e-mail and meet up at the BCEC early on in order to jointly attend one or more educational sessions, receptions, or other activities.
Last year’s test program matched 120 participants—with good results. “It was nice to have a familiar face at such a large meeting,” said one in-house
People Watch in the ParkThe Greenway (185 Kneeland Street), located in the heart of Boston, welcomes millions of visitors every year to gather, rest, and play. The public park has multiple lawns, water features, and food trucks, and it hosts a variety of free programs and events throughout the year, including farmers’ markets, exercise classes, and exhibitions.
Thanks to the Boston Convention & Visitors Bureau for their suggestions for this guide. l
For first-time registrants at the Annual Meeting, there is lots of support available to help you make the most of your experience.
Platinum Sponsors
Gold Sponsors
Bronze Sponsors
Silver Sponsors
Boston, Massachusetts | May 18–May 22, 2019
Thank You to Our Sponsors
shutterstock / Marcio Jose Bastos Silva
Newcomers Match Program Pairs Annual Meeting First-Timers
Platinum Sponsors
Gold Sponsors
Bronze Sponsors
Silver Sponsors
Boston, Massachusetts | May 18–May 22, 2019
Thank You to Our Sponsors
Immerse yourself in the issues, people, and solutions that define the fast-moving global IP industry in the center of Asia’s IP hub.
Pre-register online at www.inta.org/2020AM or on site in Boston through May 22, 2019
Pre-registration Open for INTA Members
Singapore | April 25–29, 2020
142nd
Reserve Your Spot in Singapore
SAVE 10% Pre-register byMay 22, 2019
INTA Member Special