Oral Oncology 45 (2009) 486–491

Contents lists available at ScienceDirect

Oral Oncology

journal homepage: www.elsevier .com/locate /ora loncology

Oropharyngeal carcinoma in non-smokers and non-drinkers: A role for HPV

Elizabeth Andrews a, William T. Seaman c, Jennifer Webster-Cyriaque b,c,d,*

a College of Dental Medicine, Western University of Health Sciences, Pamona, CA 91766-1854, USAb School of Dentistry, University of North Carolina at Chapel Hill, NC 27599-7295, USAc Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, NC 27599-7295, USAd School of Medicine, Department of Microbiology and Immunology, CB#7455, University of North Carolina at Chapel Hill, NC 27599-7295, USA

a r t i c l e i n f o

Article history:Received 30 April 2008Received in revised form 8 July 2008Accepted 9 July 2008Available online 21 November 2008

Keywords:OropharynxCancerHPVVirusTransmissionSequence analysis

1368-8375/$ - see front matter � 2008 Published bydoi:10.1016/j.oraloncology.2008.07.008

* Corresponding author. Address: School of Mediciogy and Immunology, CB#7455, University of North27599-7295, USA. Tel.: +1 (919) 966 8911; fax: +1 (9

E-mail address: jennifer_cyriaque@dentistry.unc.e

s u m m a r y

Incidence of oropharyngeal squamous cell carcinoma (OSCC) increased 3% annually from 1973 to 2001.OSCC’s can be attributed to tobacco and alcohol, but 25% are unlinked to typical risks. Case–control stud-ies on HPV detection in non-smoking/non-drinking (NS/ND) OSCC patients have not previously been per-formed. The primary objective of this study was to determine whether high-risk HPV infection wassignificantly associated with development of oral squamous malignancy in non-smokers/non-drinkers.

A chart review of 802 OSCC patients from the UNC Pathology Archives (1995–2006) yielded 40 non-smoker/non-drinker subjects. Utilizing a case–control design, 18 cancer cases and 22 benign biopsy con-trols were consecutively identified. Biopsy tissue was subjected to (i) HPV-L1 consensus PCR andsequencing (ii) real-time PCR. Chi-square and logistic regression analysis was employed.

Logistic regression analysis determined that cases were 6.1 (OR 95% CI, 1.3–28) times more likely tohave HPV infection in their tumors than controls. High-risk HPV-DNA was readily detected in the tonsilsand base of tongue (oropharynx) of 14/18 cases and 6/22 controls by both consensus and real-time PCR.Of high-risk HPV containing lesions, 85% (17/20) originated in the oropharynx (chi-square, p = 0.03). Highrisk HPV was also detected in benign biopsies of the oropharynx in 30% (3/10) of individuals who had aprevious oral cancer (chi-square, p = 0.006).

The infectious nature of OSCC in NS/ND was revealed by consistent detection of HPV, suggesting HPV’spotential role in transforming oral epithelium, providing further evidence of the need to screen the oro-pharynx for HPV in NS/ND.

� 2008 Published by Elsevier Ltd.

Introduction

Head and neck squamous cell carcinoma (HNSCC) is a signifi-cant cause of morbidity and mortality with 30,000 new cases inthe US each year. While the incidence of HNSCC has remained sta-ble, the incidence of oropharyngeal squamous cell carcinoma(OSCC), a subset of HNSCC, increased 2–3% annually (1973–2001).1 A recent study of SEER data analyzed cancer incidence insites of consistent Human Papillomavirus (HPV) detection includ-ing base of tongue, tonsils, lingual tonsil, and Waldeyer’s ring.From 2000 to 2004, the incidence of malignancy at these sites in-creased annually by 5.22% (p < 0.05).2 Traditionally, OSCC is char-acterized by a poor prognosis, with an overall 5 year survivalrate of 59.4%, accounting for �8000 deaths/year in the US. ManyOSCCs can be attributed to exposures such as tobacco and alcohol,but there is a subset of patients with neither of these risk factors

Elsevier Ltd.

ne, Department of Microbiol-Carolina at Chapel Hill, NC

19) 966 3683.du (J. Webster-Cyriaque).

who still develop cancer.3 Also, only a fraction of smokers anddrinkers develop cancer, suggesting cofactors including oncogenicviruses or other infectious agents as risk factors.2,3

HPV’s are epitheliotropic, oncogenic DNA viruses with greaterthan 120 different types identified to date. Low-risk, episomalHPV’s (HPV6/11) induce benign proliferation of epithelium. In con-trast, high-risk oncogenic types, HPV16/18, are commonly, but notalways, found integrated into host DNA. The role of HPV16/18 hasbeen firmly established, by strong epidemiologic association, as theetiologic agent in cervical cancer.4 High-risk type HPV-E6 andE7onco-proteins target the p53 and pRB tumor suppressor path-ways rendering these pathways dysfunctional in the majority ofHPV related human cancers.

High-risk HPV DNA has been consistently detected in 20% ofHNSCCs overall and in 20–72% of the OSCC subset.2,4,5 It has beenproposed that high-risk type HPV infection has contributed tothe increase in OSCC. To date, no studies have addressed HPV-asso-ciated OSCC in non-smokers and non-drinkers (NS/ND). Thepurpose of this case–control study was to determine whetherhigh-risk HPV infection was significantly associated with oralmalignancy in the absence of tobacco/alcohol risk. A secondary

E. Andrews et al. / Oral Oncology 45 (2009) 486–491 487

objective of the following studies was to determine the sensitivityof a novel, HPV-based real-time assay as compared to consensusPCR within tissues from this case–control population.

Methods and materials

Subjects

This study was approved by the School of Medicine, Institu-tional Review Board University of North Carolina, Chapel Hill(IRB# 05-DENT-1263-ORC). Study subjects were identified throughthe UNC Healthcare Cancer Registry of >22,000 cases (1995-pres-ent). This Registry maintains a database of all patients diagnosedand/or treated for malignant neoplasm’s at UNC Healthcare. Ofall registered cases, 802 had a cancer in any oral cavity and peri-oral site. There were 458 subjects with oropharynx or oral cavitycancer. All subjects were selected based on having no prior or cur-rent use of tobacco and/or alcohol, confirmed by chart review.Sixty-one subjects were excluded due to undocumented habit his-tory in the database. Sixty-eight were confirmed to be NS/ND bychart review, and 47 of these had a lesion in the oropharynx or var-ious oral cavity sites. Tissue samples were consecutively retrievedbased on site of tumor and on date (1995–2005), starting with sub-jects who were more recently biopsied. Benign control tissues weredefined as those not demonstrating any properties associated withmalignancy (i.e. mitotic figures, hyperchromasia, pleomorphism,and increased nuclear/cytoplasmic ratio). Additional control be-nign tonsil tissue was assayed from previous sleep apnea subjectswithout a cancer history. Other benign tissues came from UNC Oraland Maxillofacial Pathology Archives (1995–2006). Cases, compris-ing 2.5% (18/734) of this registry subset, were subjects with a his-tologically diagnosed cancer (confirmed by two independentpathologists). Controls were chosen based on biopsies histological-ly confirmed as benign. A subset of these benign controls had a pre-vious history of OSCC.

Sample size calculation

Sample size was calculated utilizing a two-sample comparisonof proportions estimation. Based on previous studies we estimatedthe proportion of exposed controls to be 5% and exposed cases tobe P60%. From this estimation, it was determined that thereshould be 18 cancer cases and 18 histologically benign controls.There were a total of 22 controls, 10 benign controls had a previouscancer history and 12 benign controls had no cancer history.

Preparation of specimens

Paraffin blocks containing tumor tissue from 40 patients wereretrieved, 5u sections were cut from the block. Blades were disin-fected with alcohol for each sample and the microtome was ad-justed to insure a new region of the cutting surface was beingused for each block. Five to ten of resultant sequential scrolls fromeach individual block were placed in an eppendorff tube, deparaff-inized and DNA extracted using DNAeasy protocol (Qiagen,Valencia, Ca). Amplifiable quality of DNA was confirmed by PCR as-say targeting the human beta-actin, or 18S genes.6 HeLa cell, animmortalized HPV-18(+) cell line, was used as a positive control.All control samples were prepared and analyzed in parallel withclinical specimens to ensure proper reaction conditions weremaintained. Special care was taken to control contamination. Todetect possible DNA contamination, all tests included a negativecontrol amplification containing double distilled, autoclaved, fil-tered water and PCR reagents. PCR assays were carried out usingdedicated PCR area for reaction setup, dedicated positive displace-ment pipettors and single use aliquots of all reagents including

primers and enzyme. At least two replicates/sample were ana-lyzed, and DNA from HPV(�) fibromas interspersed as anothernegative control.

HPV- L1 PCR assay

All samples were screened for the presence of HPV using a stan-dard nested PCR assay, described elsewhere,7–10 consisting of theMY09/11 primer set (primary PCR) and GP5+/6+ primer set (sec-ondary PCR). These primers are consensus degenerate primerscomplementary to the conserved L1 region of HPV. PCR productswere separated by gel electrophoresis. In initial amplification, MYPCR detected a product size of �450 bp. Second step MY/GP PCRdetected a product size of �140 bp. To insure accuracy, all sampleswere tested in replicate (2–3x0s).

HPV-16/18 L1 multiplex real-time PCR assay

DNA was employed for real-time PCR amplification of the L1 re-gion of the HPV genome. Briefly, DNA, Lightcycler TaqMan MasterMix (Roche) and the Roche Lightcycler 480 detection system wereused for amplification. Detection of HPV16L1 DNA was performedusing HPV16L1F (50TTGTTGGGGTAACCAACTATTTGTTACTGTT30)and HPV16L1R (50CCTCCCCATGTCGTAGGTACTCCTTAAAG30) asprimers and HPV16L1PROBE (506-FAM-GTCATTATGTGCTGCCA-TATCTACTTC-TAM30) as a TAqMan probe. Detection of HPV18L1DNA was performed using HPV18L1F (50ATCAATTATTTGTTAC-TGTGGTAGATACCACTCC30) and HPV18L1R (50GCTATACTGCTTA-AATTTGGTAGCATCATATTGC30) as primers and HPV18L1PROBE(50HEX-GTCATTATGTGCTGCCATATCTACTTC-TAM30as a TAqManprobe. Cellular Human APOB gene was amplified to ensure the qual-ity of the DNAs using HAPBF (50TGAAGGTGGAGGACATTCCTCTA30)and HAPBR (50CTGGAATTGCGATTTCTGGTAA30) as primers and HAP-BPROBE (50CY5-CGAGAATCACCCTGCCAGACTTCCGT-BHQ230) as aTAqMan probe. Analysis of the data was performed with the associ-ated LightCycler 480 software (Roche).

DNA sequencing

Specimens with amplification products of the expected sizewere considered HPV(+), were purified with ExoSap-IT reagent(USB, Cleveland, Ohio, USA) followed by direct sequencing of thetargeted HPV region using ABI Big Dye� terminator reagents (Ap-plied Biosystems, Foster City, CA) and an ABI PRISM 3730 DNA Se-quencer (UNC Genome Analysis Facility). Amplimers weresequenced in both forward and reverse orientations and comparedusing NCBI Blast2. Sequencing analysis was performed with VectorNTI 10.1.1 (Invitrogen) utilizing DNA extracted sequences from (+)subjects, HeLa, HPV-18 (Genbank-U89349), HPV-16 (Genbank-K02718) and Siha (Genbank-U89348). A Guide Tree (VectorNTI),which resembles a phylogenetic tree, was calculated after se-quence alignment using the Neighbor-Joining method whichworks on a matrix of distances between all pairs of sequences tobe analyzed and relates degree of divergence between sequences.

Statistical analysis

Comparisons of general characteristics were made by Pearson’sChi-square test for categorical variables. In all evaluations p val-ues 6 0.05 were considered statistically significant. Factors utilizedfor analysis include the categorical variables sex, age at diagnosis,race, high-risk HPV presence, and tumor/biopsy location. Tradi-tionally, OSCC’s arise in males >60 years of age. Because of this,age was analyzed as a dichotomous variable with the cut point of60 years. A logistic regression (LR) model was used to evaluatethe association between several factors and HPV status in NS/ND

488 E. Andrews et al. / Oral Oncology 45 (2009) 486–491

cancer (cases) and NS/NDs with benign biopsies (controls). To mea-sure the association with HPV, the odds ratios (ORs) and 95% con-fidence intervals (CIs) were calculated. Because of the small samplesize, the LR model could only assess two variables in the analysis.The variables utilized in this analysis were the main outcome ofinterest, HPV infection and location of tumor/biopsy, as these arehypothesized to be associated with malignancy. Computationswere performed using STATA statistical software (Version 9.2, Sta-tistics/Data Analysis, Stata Corp, College Station, Texas, USA).

Results

In this study of 40 NS/ND, there were 18 subjects with cancer(cases) and 22 subjects with a benign biopsy (controls), 10 subjectswith a previous cancer history and subsequent benign biopsy and12 with a benign biopsy and no previous cancer history. Compara-tive analysis of subject characteristics determined that the meanage of the cases was 56, while the mean age of the controls was57.5 (mean age with a previous cancer history was 59, and 56 yearsin the subjects with no previous cancer history) (Table 1). With re-gard to distribution of sites biopsied, 89% of cancer cases had theircancer originate in the oropharynx and 45% of controls had a be-nign biopsy from this region.

In order to detect multiple HPV types simultaneously within asingle subject sample, we developed a novel real-time PCR assayusing multiplexed HPV16 and HPV18 specific probes/primers tar-geting the L1 region as well as primer/probe for an internal stan-dard human APO-B. This has significant advantages overconsensus PCR in that the assay is single tube reaction that is typespecific and quantifiable. DNA from paraffin embedded tissue wasanalyzed by both the novel multiplex real-time PCR assay and con-sensus PCR. With the exception of 7 benign controls that were nottested with real-time PCR due to lack of tissue, all other tissueswere analyzed in this way (Table 2). By real-time, of 18 cancer/cases, 11 were found to harbor HPV16 and 3 were HPV18-positive.Of the 10 controls with previous cancer history, 3/10 were HPV-po-sitive, 2 with HPV16 and 1 with HPV18.

Consensus degenerate PCR of the HPV-L1 region in this popula-tion detected HPV in half of the subjects (20/40). Amplimers fromall of those that were positive were sequenced and results of thealignment analysis are found in Fig. 1 and Table 2. Highly con-served HPV signature sequences were consistently detected andare highlighted. High-risk HPV16 was detected in 13 of the sub-jects. High-risk HPV18 was detected in 7 of the subjects. The rela-tionship between clinical isolates was assessed by phylogeneticanalysis (NJ method) (Fig. 2). Consensus PCR found 78% (14/18)of the cancer/cases were HPV-positive, all of which were high-risktype (Table 3). In controls with previous cancer history, 30% hadHPV in base of tongue biopsy tissue, all of high-risk type. In con-trols without previous cancer history, 25% (3/12) were HPV18-po-

Table 1Study subject characteristics

Characteristic Cases Controls

Cancer(18/40)% (n)

Benign W/prev CA(10/40) % (n)

Benign W/out CA(12/40) % (n)

Mean age 56 (13.9 SD) 59 (15.8 SD) 56 (17 SD)Male 44 (8/18) 40 (4/10) 58 (7/12)White 89 (16/18) 80 (8/10) 75 (9/12)

Location of BXTonsils 56 (10/18) 40 (4/10) 33 (4/12)Base of tongue 33 (6/18) 20 (2/10) 0Oral tongue 11 (2/18) 40 (4/10) 67 (8/12)

HPV+ 78 (14/18) 30 (3/10) 25 (3/12)

SD, standard deviation; BX, biopsy.

sitive and these biopsies were from the oral cavity and tonsils(Table 3).

A secondary objective was to validate this novel, HPV-basedmultiplex real-time assay. Comparison of consensus PCR, the goldstandard, to real-time targeting the same region detected completeconcordance between real-time and consensus PCR for HPV16 andHPV18 detection in both cases and controls. Of the 14 cases thatwere HPV-positive with consensus PCR, all 14 showed concordantresults for the high-risk HPV type detected by consensus PCR.Three of four cancer/cases were consensus PCR-negative and werenegative with real-time PCR. In the benign/controls, real-time PCRdetected the same type of HPV in 75% of controls which were HPV-positive with consensus PCR. Of the 11 benign/controls, HPV-neg-ative by consensus PCR, 4 were HPV-positive with real-time PCR,perhaps reflecting differences in assay sensitivity level.

From the bivariate chi-square analysis, characteristics that weresignificantly associated with high-risk HPV infection included (1)having a cancer diagnosis and (2) a biopsy located in the orophar-ynx (p value < 0.05) (Table 4). A logistic regression model that ana-lyzed the variables HPV status and biopsy/tumor site, was utilizedto determine the odds of high-risk HPV infection in cancers of NS/ND. The analysis determined that NS/ND cancer/cases were 6.1(95% C.I. 1.3–28) times more likely to have HPV infection than pa-tients with a benign diagnosis, adjusted for oropharynx. The confi-dence interval was wide due to the sample size, but was found tobe significant p = 0.02 (Table 4).

Discussion

Today, it is generally agreed that viruses are implicated in 10–20% of all cancers, with DNA oncogenic viruses like HPV, often tar-geting the p53 and pRb tumor suppressor pathways resulting incell cycle alteration.11–13 Greater than 90% of cervical cancers arerelated to HPV infection and in a majority of these cervical cancers,high-risk HPV types 16 and 18 are implicated.14 Oral mucosa, espe-cially oropharyngeal mucosa, is similar histologically to cervicalmucosa. The presence of HPV in oral mucosa suggests that, as incervical cancer, HPV infection may also play a similar role in thetransformation of oral epithelium. While it has been postulatedthat the path to cancer formation is a distinct multi-step process,it also appears that there may be two major pathways leading tooral carcinogenesis: p53 mutation and DNA tumor viral pathogen-esis.9 The transformation to cancer in the setting of HPV infectionis distinct when risk factors, such as smoking and or drinking, arenot present. The significance of infectious agents in oral cancershas not been fully demonstrated in persons without any knownrisk factors.

This study supports the hypothesis that high-risk HPV infectionis a predominant risk factor in the development of oropharyngealsquamous cell carcinoma, in patients who do not smoke or drink.Of 741 individuals from the UNC Registry with a documented(ever/never) history of alcohol and tobacco use, with oral cavityor oropharynx cancer, 70% were smoker and drinkers, 17% weresmokers, 4% were drinkers and only 9% were NS/ND, without typ-ical risk. The mean age of this study population was well belowthat of average, the age of most oropharyngeal cancer patients inthe US is over 65 years.15 Similar to other case–control studieswe consistently detected HPV in OSCC.9,16,17 Oral cancer patientswith no exposure to smoking and/or drinking were 6.1 times morelikely to have HPV DNA in there tumors than the NS/ND benigncontrols, when adjusting for location. This odds ratio is lower thanthose reported by case studies that examined HPV in associationwith traditional risk factors. Previous studies have shown a strongassociation of high-risk sexual practices with a resultant OSCC.9

These practices were not examined by this study, but may be animportant risk factor in the possible transmission of these

Table 2HPV L1 presence detected by consensus and real-time PCR

Cancer Sample Location L1 PCR Multiplex L1 real-time HPV

MY Nested MY/GP Sequence/HPV type

Cases 1A Tonsil + + 16 161B Tonsil + + 16 162A Tonsil + + 16 162B Tonsil + + 16 163 BOT + + 16 164 BOT � + 16 167 BOT � � NONE 189 BOT � + 16 1613 BOT � + 16 1618 Tonsil � � NONE NONE21 Tongue � + 18 16/1823 Tongue + + 16 1635 Tonsil � + 18 1836 Tonsil � � None None38 Tonsil � � None None39 Tonsil � + 18 1840 Tonsil � + 16 1651 BOT + + 16 16

Controls Benign prev CA 52 BOT + + 16 1612 BOT � + 16 161A Tonsil � � None NT2A Tonsil � � None NT2B Tonsil � � None NT15 Tongue � � None None20 Tongue � � None None27 Tongue � � None None32 Tongue � � None None37 Tonsil � + 18 1816 Tongue � � None None

Benign no CA HX 24 Tongue � � None None28 Tongue � � None None42 Tongue � � None 1845 Tongue � � None 1847 Tongue � � None 1848 Tongue � � None 1850 Tongue � + 18 1853 Tonsil � � None NT54 Tonsil � � None NT55 Tonsil � + 18 NT56 Tonsil � + 18 NT

NT (not tested); None (no HPV detected).

Figure 1 Alignments of HPV L1 DNA sequences from oral cancer and benign biopsies of NS/ND. Seven regions of HPV L1 signature sequence, highlighted in yellow, weredetected in all positive samples. A hallmark of HPV16 was a 3 base pair (BP) and 4 BP deletion in only the HPV 16 positive subjects. (For interpretation of color in Fig.1, thereader is referred to the web version of this article.)

E. Andrews et al. / Oral Oncology 45 (2009) 486–491 489

Figure 2 Phylogenetic analysis of HPVL1 sequences from NS/ND. Phylogeneticanalysis shows distinct ancestry by HPV type. HPV16 types originate from oneancestral node and the HPV18 sequences are similar to each other and least relatedto the 16 types.

Table 3Relationship of high risk HPV presence by location and diagnosis

Characteristic Cases Controls

HPV + cancerN = 14

HPV + benign W/CAN = 3

HPV + benign W/outN = 3

% High/low risk 100/0 100/0 100/0% Oropharynx 86 100 67

490 E. Andrews et al. / Oral Oncology 45 (2009) 486–491

infectious agents and should be addressed in future studies. Otherlimitations of this study include small sample size. We have shownfor the first time that 78% (N = 18) of NS/ND OSCC cases had high-risk HPV in their tumors (p < 0.006), predominantly HPV16, asdetermined by sequence and subsequent phylogenetic analysisand also using a novel HPV-based real-time assay. Consistent withthe secondary aims of this study, we were able to validate the use

Table 4Characteristics associated with HPV infection and logistic regression model for OSCC in N

Chi-square analysis

Characteristic HPV+ % (n) P-value

Age < 60 (30) 57 (17/30) 0.1a

Age > 60 (10) 30 (3/10)

Male (19) 63 (12/19) 0.1a

Female (21) 38 (8/21)

White (33) 48 (16/33) 0.7a

Other (7) 57 (14/7)

Oropharynx (26) 65 (13/26) 0.008a

Oral cavity (14) 21 (3/14)

CasesCancer (18) 78 (14/18) 0.006a

ControlsBenign W/CA (10) 30 (3/10)Benign W/out CA (12) 25 (33/12)

HPV+ – –

OR, odds ratio; CI, confidence interval.a Chi-square analysis.

of multiplex real-time PCR as a potential diagnostic tool. The abil-ity to multiplex provides a significant advantage when dealingwith limited amounts of tissue or nucleic acid. Further, the assaywas equivalent to the gold standard in its detection of HPV in tu-mor tissues.

High-risk HPV types were consistently detected in the orophar-ynx of cancer cases. As previously shown, the base of tongue andtonsil, which comprise the oropharynx, were often sites of malig-nancy.18 Hence, location of infection is significant to developmentof malignancy in this population. Of the cases in this study, HPVinfection was detected in 5/6 (83%) cases with a cancer originatingin the base of tongue and in 12/14 (86%) of all oropharyngeal can-cers. D’Souza et al. detected high-risk HPV in 72% (N = 100) of theiroropharyngeal cancer cases and determined that high-risk HPVwas strongly associated with OSCC, regardless of exposure toestablished risk factors.9 Many oral cancers originate in the baseof the tongue and often go undetected, due to the location beingdifficult to view. Consistent detection of HPV infection in the baseof tongue highlights the importance of targeting other oropharyn-geal regions for preventive screening/intervention even in thosepersons without traditional risk factors. High-risk HPV was de-tected in 30% of benign controls with a previous cancer history,in follow up benign biopsies from the oropharynx. Interestingly,all had a previous cancer in the same site as the subsequent nega-tive biopsy. High-risk HPV infection in the same location as the ori-ginal cancer may heighten the potential for future recurrence inthese individuals, warranting close follow up. High-risk HPV18was detected in the tonsils of 3 benign controls without a previouscancer history. Others have reported that HPV16 presence is re-lated to oral malignancy in 95% of HPV associated HNSCC.18 Thedetection of HPV18 in this subset was interesting, as HPV18 doesnot share the same oral oncogenic potential as HPV16.

Approximately 20% of adults become infected with HPV16 intheir lifetime.19 Prophylactic HPV vaccines based on virus-like par-ticles (VLPs) have been successfully tested in clinical trials. Thesevaccines are safe and effective in the prevention of persistent infec-tion and subsequent pre-malignant cervical disease, and are nowbeing introduced onto the market.19 The presence of HPV in orop-hayngeal cancers may warrant the use of vaccination in boys aswell as girls 9–15 years of age, for oral cancer prophylaxis. AsHPV is associated with 1/5 of head and neck cancers, prophylaxismay result in a significant decrease in the incidence of disease.

S/ND

LR analysis

Logistic regression model unadjusted or adjusted or (95% CI)

9.6 (1.7–52.2)3.6 (0.7–19.1)

9.3 (2.1–39.9)6.1 (1.3–28)

E. Andrews et al. / Oral Oncology 45 (2009) 486–491 491

In this small case–control study we have identified close linksbetween HPV and OSCC in NS/ND. Early identification of this virusand prevention is desirable as this oncovirus may act as a crucialmarker of malignancy susceptibility. Identifying patients with per-sistent infection and treating them with close follow up may alsobe important to reduce future cancers. The findings in this reporthave significant public health implications and will be importantto the management and counseling of non-smoking/non-drinkingoral cancer patients.

Conflict of interest statement

None declared.

Acknowledgements

We are indebted to study participants, to Webster-Cyriaque LabMembers for helpful discussion, to Carol Shores, to Marion Couchand to the NIAID ACTG/NIDCR OHARA 1 U01 AI068636-01/BRS-ACURE-Q-06-00160.T002-002.

References

1. Shiboski CH, Schmidt BL, Jordan RC. Tongue and tonsil carcinoma: increasingtrends in the US population ages 20–44 years. Cancer 2005;103(9):1843–9.

2. Chaturvedi AK, Engels EA, Anderson WF, Gillison ML. Incidence trends forhuman papillomavirus related and unrelated oral squamous cell carcinomas inthe United States. J Clin Oncol 2008;26:612–9.

3. Blot WJ, McLaughlin JK, Winn DM, et al. Smoking and drinking in relation tooral and pharyngeal cancer. Cancer Res 1988;48(11):3282–7.

4. Fakhry C, Gillison ML. Clinical implications of human papillomavirus in headand neck cancers. J Clin Oncol 2006;24(17):2606–11.

5. Begum S, Cao D, Gillison M, Zahurak M, Westra WH. Tissue distribution ofhuman papillomavirus 16 DNA integration in patients with tonsillar carcinoma.Clin Cancer Res 2005;11(16):5694–9.

6. Nazarenko I, Lowe B, Darfler M, Ikonomi P, Schuster D, Rashtchian A. Multiplexquantitative PCR using self-quenched primers labeled with a singlefluorophore. Nucleic Acids Res 2002;30(9):e37.

7. Fuessel Haws AL, He Q, Rady PL, et al. Nested PCR with the PGMY09/11 andGP5(+)/6(+) primer sets improves detection of HPV DNA in cervical samples. JVirol Meth 2004;122(1):87–93.

8. Harwood CA, Spink PJ, Surentheran T, et al. Degenerate and nested PCR: Ahighly sensitive and specific method for detection of human papillomavirusinfection in cutaneous warts. J Clin Microbiol 1999;37(11):3545–55.

9. D’Souza G, Kreimer AR, Viscidi R, et al. Case–control study of humanpapillomavirus and oropharyngeal cancer. N Engl J Med 2007;356(19):1944–56.

10. Pizzighella S, Pisoni G, Bevilacqua F, Vaona A, Palu G. Simultaneouspolymerase chain reaction detection and restriction typing for thediagnosis of human genital papillomavirus infection. J Virol Meth1995;55(2):245–56.

11. Talbot SJ, Crawford DH. Viruses and tumours – an update. Eur J Cancer2004;40(13):1998–2005.

12. Baseman JG, Koutsky LA. The epidemiology of human papillomavirusinfections. J Clin Virol 2005;32(Suppl 1):S16–24.

13. Sellers WR, Kaelin Jr WG. Role of the retinoblastoma protein in thepathogenesis of human cancer. J Clin Oncol 1997;15(11):3301–12.

14. Walboomers JM, Jacobs MV, Manos MM, et al. Human papillomavirus is anecessary cause of invasive cervical cancer worldwide. J Pathol 1999;189(1):12–9.

15. Weinberger PM, Yu Z, Haffty BG, et al. Molecular classification identifies asubset of human papillomavirus-associated oropharyngeal cancers withfavorable prognosis. J Clin Oncol 2006;24(5):736–47.

16. Pintos J, Black MJ, Sadeghi N, et al. Human papillomavirus infection and oralcancer: a case–control study in Montreal, Canada. Oral Oncol.

17. Dahlstrom KR, Adler-Storthz K, Etzel CJ, et al. Human papillomavirus type 16infection and squamous cell carcinoma of the head and neck in never-smokers:a matched pair analysis. Clin Cancer Res 2003;9(7):2620–6.

18. Gillison ML. Human papillomavirus-associated head and neck cancer is adistinct epidemiologic, clinical, and molecular entity. Semin Oncol 2004;31(6):744–54.

19. Koutsky LA, Ault KA, Wheeler CM, et al. A controlled trial of a humanpapillomavirus type 16 vaccine. N Engl J Med 2002;347(21):1645–51.