Embed Size (px)
Citation preview
ON THE ASSOCIATION BETWEEN PANIC DISORDER AND
AUTONOMIC REGULATION WITH SPECIAL FOCUS ON THE
ROLES OF RESPIRATION AND ON THE CATECHOL-O-
METHYLTRANSFERASE GENE
KRISTINA ANNERBRINK
2008
Department of Pharmacology
Institute of Neuroscience and Physiology
The Sahlgrenska Academy at University of Gothenburg
Sweden
Printed by Chalmers Reproservice, Göteborg, Sweden
Previously published papers were reproduced with kind permission from the publishers.
© Kristina Annerbrink 2008
ISBN 978-91-628-7636-4
2
Abstract
ON THE ASSOCIATION BETWEEN PANIC DISORDER AND AUTONOMIC
REGULATION WITH SPECIAL FOCUS ON THE ROLES OF RESPIRATION AND THE
CATECHOL-O-METHYLTRANSFERASE GENE
Kristina Annerbrink Department of Pharmacology, Institute of Neuroscience and Physiology, The Sahlgrenska Academy, University of
Gothenburg, Box 431, SE-405 30, Göteborg, Sweden
Background and aims: Panic disorder is a psychiatric disorder characterized by sudden attacks of intense anxiety. It displays a lot of features suggesting that it may be associated with an underlying aberration in the autonomic regulation of heart activity and respiration: i) the attacks are often characterized by respiratory symptoms and symptoms from the heart, ii) the attacks can be elicited by respiratory stimulants, iii) between attacks, patients with panic disorder often display enhanced respiratory variability and reduced heart rate variability, and iv) patients with panic disorder display enhanced prevalence of respiratory disorders and enhanced mortality in cardiovascular disease. Addressing the reasons for these physiological aberrations may help in elucidating the pathophysiology underlying panic disorder, and shed light on why this disorder is associated with enhanced mortality in cardiovascular disease. Serotonin is believed to be a neurotransmitter of great importance for panic disorder, as well as for the regulation of respiration: one main purpose of the animal studies presented in this thesis hence was to increase our knowledge regarding the role of serotonin in respiratory regulation, the hypothesis being that aberrations in respiration may cause the anxiety attacks, and that serotonin-modulating drugs may prevent panic attacks partly by stabilizing the regulation of respiration. In the first part of the thesis, data is presented on the effects on respiration in freely moving rats of various serotonergic compounds. The second part of this thesis is focused on genetic variations that may be associated with panic disorder. Orexin is a neuropeptide of suggested importance for both respiratory regulation and arousal. We investigated two polymorphisms in the orexin receptors 1 and 2, HCRTR1 Ile408Val and HCRTR2 Val308Iso, in panic disorder patients and healthy controls. Catechol-O-methyltransferase (COMT) is an enzyme that degrades catecholamines such as dopamine and noradrenaline, and may thus be of importance for both autonomic control and psychiatric symptoms. The functional Val158Met polymorphism in this gene has been associated with panic disorder in several studies; in an attempt to replicate this finding, we genotyped this polymorphism in the same group of panic disorder patients. In a separate cohort, we also explored if the same polymorphism is associated with risk factors for cardiovascular disease. Observations: 1) Serotonin depletion with para-chlorophenylalanine decreased respiratory rate and increased respiratory variability. 2) Chronic treatment with serotonin reuptake inhibitors increased respiratory rate. 3) Acute treatment with serotonin reuptake inhibitors, as well as the serotonin releasing drugs d-fenfluramine and m-CPP, and the 5-HT1A antagonist WAY-100635, decreased respiratory rate. 4) The HCRTR2 Val308Iso polymorphism was significantly associated with panic disorder in women. 5) In line with previous studies in Caucasian samples, the COMT Val158 allele was significantly more frequent in PD patients than controls. 6) Met158 allele carriers displayed significantly higher waist-hip-ratio, sagittal diameter, systolic and diastolic blood pressure, and heart rate, than Val158 allele carriers in a population of healthy men. Conclusions: Our results suggest that serotonin exert a modulatory role on respiration, and support the notion that an influence on respiration may contribute both to the anxiogenic and the anti-panic effects of serotonergic drugs. The association between panic disorder and the hypocretin receptor-2 Val308Iso polymorphism is a novel finding in need of replication, whereas the association between panic disorder and the COMT Val158 allele can by now be regarded as confirmed. The association between the COMT Val158Met polymorphism and cardiovascular risk factors is of interest, but does not support the theory that this polymorphism contributes to the enhanced mortality in cardiovascular disease seen in panic disorder patients. Key words: panic disorder – serotonin – respiration – polymorphism – COMT Val158Met – HCRTR2 G1246A – blood pressure – anthropometry ISBN 978-91-628-7636-4
3
This thesis is based on the following papers, which will be referred to in the text
by their roman numerals:
I. Annerbrink K, Olsson M, Melchior LK, Hedner J, Eriksson E. Serotonin depletion
increases respiratory variability in freely moving rats: implications for panic disorder.
International Journal of Neuropsychopharmacology, Mar;6(1):51-6, 2003.
II. Olsson M, Annerbrink K, Bengtsson F, Hedner J, Eriksson E. Paroxetine influences
respiration in rats: implications for the treatment of panic disorder. European
Neuropsychopharmacology, Jan;14(1):29-37, 2004.
III. Annerbrink K, Olsson M, Hedner J, Eriksson E. Acute and chronic treatment with
serotonin reuptake inhibitors exert opposite effects on respiration in rat: Implications
for panic disorder. Submitted manuscript.
IV. Annerbrink K, Westberg L, Olsson M, Andersch S, Sjödin I, Holm G, Allgulander C,
Eriksson E. Panic disorder is associated with the Val308Iso polymorphism in the
hypocretin receptor gene. Submitted manuscript.
V. Annerbrink K, Westberg L, Olsson M, Allgulander C, Andersch S, Sjödin I, Holm G,
Eriksson E. Association between the catechol-O-methyltransferase Val158Met
polymorphism and panic disorder: a replication. Submitted manuscript.
VI. Annerbrink K, Westberg L, Nilsson S, Rosmond R, Holm G, Eriksson E. Catechol
O-methyltransferase Val158Met polymorphism is associated with abdominal obesity
and blood pressure in men. Metabolism, May;57(5):708-11, 2008.
4
Table of contents List of abbreviations................................................................................................................... 6 Introduction to panic disorder .................................................................................................... 7
Treatment ............................................................................................................................... 8 Biological theories of panic disorder ..................................................................................... 9 Serotonin and panic disorder................................................................................................ 11 Panic disorder and respiration .............................................................................................. 12 Genetics................................................................................................................................ 12 Comorbidity ......................................................................................................................... 13
Psychiatric ........................................................................................................................ 13 Somatic – general ............................................................................................................. 14 Somatic – cardiac ............................................................................................................. 14 Somatic – respiratory ....................................................................................................... 15
Additional background information ......................................................................................... 15 Respiratory physiology ........................................................................................................ 16 Serotonin and respiration ..................................................................................................... 17 Are genes influencing arousal and/or respiration involved in panic disorder? .................... 18 Orexin................................................................................................................................... 19 The gene encoding catechol-O-methyl transferase .............................................................. 20
Papers I-VI: Aims, Results, and Discussion ............................................................................ 22 Summary .................................................................................................................................. 32 Acknowledgements .................................................................................................................. 34 Appendix: Material and methods ............................................................................................. 35
Animal studies (Paper I-III) ................................................................................................. 35 Ethics................................................................................................................................ 35 Animals ............................................................................................................................ 35 Respiratory measurement ................................................................................................. 35 Gas exposure (Paper I-II) ................................................................................................. 36 Analysis of serum paroxetine and fluoxetine (Paper II and III)....................................... 36 Statistics ........................................................................................................................... 36
Genetic studies (Paper IV-VI).............................................................................................. 37 Ethics................................................................................................................................ 37 Subjects ............................................................................................................................ 37 Molecular genetics ........................................................................................................... 37 Pyrosequencing® (Paper IV-IV)...................................................................................... 37 Sequenom® (Paper IV and V) ......................................................................................... 38 Genotyping ....................................................................................................................... 38 Statistical analysis ............................................................................................................ 39
References ................................................................................................................................ 40
5
List of abbreviations
BP Blood pressure
CBT Cognitive-behavioural therapy
CCHS Congenital central hypoventilation syndrome
COMT Catechol-O-methyltransferase
DSM Diagnostic and statistical manual of mental disorders
HCRT1 Hypocretin receptor-1
HCRT2 Hypocretin receptor-2
mCPP m-Chlorophenylpiperazine
MV Minute ventilation
MVP Mitral valve prolapse
PA Panic attack
PCPA Para-chlorophenylalanine
PCR Polymerase chain reaction
PD Panic disorder
RR Respiratory rate
SFA Suffocation false alarm theory
SNP Single nucleotide polymorphism
SRI Serotonin reuptake inhibitor
TD Tryptophan depletion
TV Tidal volume
6
Introduction to panic disorder
Panic disorder (PD) is an anxiety disorder characterized by recurrent, unprovoked panic
attacks (PAs) that develop suddenly and peak within minutes. The typical PA can be
described as a discrete period of intense physical discomfort accompanied by a fear of losing
control, having a heart attack, dying, or going crazy. Respiratory symptoms such as
breathlessness, a feeling of being smothered, and hyperventilation, are usually prominent.
Other commonly reported symptoms are palpitations, chest pain, sweating, tremor, and
dizziness. In addition, PAs are typically accompanied by an urge to flee. The frequency of the
PAs vary from several attacks a day to only a few attacks a year, and the severity of each
attack can range from limited symptom attacks to full-blown PAs.
Isolated PAs are not uncommon in the general population, so for the criteria of PD
according to Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV) to be met,
the attacks must feature four or more of the symptoms listed in Table 1, and be followed by at
least one month of persistent concern about having another attack, worry about the possible
implications or consequences of the attacks, or a significant behavioral change related to the
attacks (American Psychiatric Association, DSM-IV-TR, 2000). Since PAs can occur in a
number of conditions unrelated to PD (i.e. substance abuse, intoxication, hyperthyroidism,
and post traumatic stress disorder) differential diagnostic considerations are essential.
PD has an estimated life time prevalence of 3-5% (Grant et al 2006; Kessler et al 1994),
and women are 2-3 times more likely to develop PD than men (Eaton et al 1994). The age of
onset is typically between late adolescence and early adulthood, and the course is usually
chronic (American Psychiatric Association, DSM-IV-TR, 2000). In most long-term studies, a
majority of patients report PAs at follow-up, and duration of illness and presence of
agoraphobia, rather than severity and frequency of PAs, seem to be negative predictors
(Katschnig and Amering 1998). As a chronic disorder, PD can be very debilitating, and
patients often report significant social impairment and decreased work ability. In a study by
Markowits and co-workers, almost 50% of the patients had been unable to engage in social
activities in the last two weeks (Markowitz et al 1989), and Massion and co-workers reported
that 65% of patients with PD without agoraphobia were unemployed (Massion et al 1993). In
the United States, PD has been reported as the fourth most costly condition of all disorders in
terms of decreased work productivity (Kessler et al 2001).
7
Table 1.
Criteria for Panic Attacks
(American Psychiatric Association, DSM-IV-TR, 2000)
A discrete period of intense fear or discomfort, in which four or
more of the following symptoms developed abruptly and reached
a peak within 10 minutes:
1. palpitations, pounding heart, or accelerated heart rate
2. sweating
3. trembling or shaking
4. sensations of shortness of breath or smothering
5. feeling of choking
6. chest pain or discomfort
7. nausea or abdominal distress
8. feeling dizzy, unsteady, light-headed, or faint
9. derealisation (feeling of unreality)
10. fear of losing control
11. fear of dying
12. paresthesias (numbness or tingling sensations)
13. chills or hot flushes
Treatment
Serotonin reuptake inhibitors (SRIs) are considered first line treatment for PD. Citalopram,
clomipramine, escitalopram, fluoxetine, fluvoxamine, and sertraline have all demonstrated
efficacy, and most patients benefit from this treatment (Ballenger et al 1998; Den Boer and
Westenberg 1988; Michelson et al 1998; Modigh et al 1992; Pohl et al 1998; Stahl et al 2003;
Wade et al 1997). In fact, the effectiveness of the SRIs in PD treatment is remarkable; the vast
majority of patients with pure PD hence become panic free within months (Modigh 1987),
and controlled clinical trials seldom fail to prove superiority for these drugs over placebo.
8
This indicates that the effect size of SRIs is in fact superior in PD treatment as compared to
their efficacy in the treatment of major depression.
When treatment with SRIs is initiated, an initial increase in anxiety is often experienced
by PD patients (Coplan et al 1992). It is thus recommended to start with a low dose that is
slowly increased until the effective dose is reached. It usually takes weeks before symptom
improvement can be observed, and continuous improvement can be expected for as long as a
year after treatment is started.
The monoamine oxidase inhibitors, which also facilitate monoaminergic
neurotransmission, are also highly effective in the treatment of PD, but seldom used because
of their adverse side effects (Modigh 1987; Tyrer and Shawcross 1988). Benzodiazepines at
high dosage are effective but probably less effective than SRIs, and are generally avoided
because of their abuse and dependence potential. They can however be of value especially in
the early treatment stage before the SRIs have reached their full effect (Andersch et al 1991;
Tesar 1990).
Cognitive-behavioural therapy (CBT) in PD includes psychoeducation, anxiety
management skills, cognitive reframing, breathing training, and exposure to somatic cues, and
has been shown to significantly reduce panic symptoms (Hofmann and Smits 2008; Mitte
2005). Recently, internet-based therapy has also been evaluated as an attractive option with
the potential of reaching large number of patients at a reasonable cost (Andersson et al 2005;
Kiropoulos et al 2008). There are few randomized studies comparing CBT, SRIs, and placebo,
but some studies find the combination of SRIs and CBT to be more effective than either
treatment alone (Barlow et al 2000; van Apeldoorn et al 2008).
Biological theories of panic disorder
The pathophysiology underlying PD is not known, but many theories regarding the origin of
the disorder have been put forward. Below follows a short description of some of the most
influential of these hypotheses.
PD has been discussed in terms of chronic hyperarousal, which could result in a
hyperresponsiveness to various anxiety provoking stimuli (Knott et al 1997; Pillay et al 2006;
Uchida et al 2008). The underlying reason for this suggested hyperarousal has been discussed
in terms of abnormalities in central lactate metabolism (Maddock et al 2008), brain stem
structures (Uchida et al 2008), and EEG patterns (Knott et al 1997), and is currently the focus
of much interest.
9
The noradrenergic neurons originating in the locus coeruleus are believed to play a
central role in mediating the fight-or-flight response to dangerous or life-threatening events.
One theory is that PD results from an augmented synaptic transmission in the locus coeruleus
which triggers PAs even in the absence of perceived or actual danger (Kandel 1983). A
vicious cycle may occur when either stressful experiences or physiologic stress caused by a
medical condition increases locus coeruleus activity, leading to fear-reactions including
physiological symptoms such as chest or abdominal pain. These internal physical symptoms
may in turn further augment locus coeruleus activity and lead to worsening anxiety (Elam et
al 1984; Elam et al 1981; Kandel 1983; Katon and Roy-Byrne 1989; Svensson 1987; Zaubler
and Katon 1998).
The neuroanatomical model put forward by Gorman and co-workers hypothesizes that
PAs are analogous to a conditioned fear response, and that the attacks are mediated by a fear
network centred in the amygdala, hippocampus, medial prefrontal cortex, and hypothalamus.
This fear network is suggested to be hyper-sensitive in PD patients most likely due to genetic
predispositions, and conditioned to set off either in certain psychological contexts or as a
consequence of certain somatic symptoms. (Gorman et al 2000)
Hyperventilation is a common symptom during PAs. The hyperventilation theory
suggests that it is the hyperventilation that causes the anxiety attack by decreasing arterial
pCO2 (Ley 1985). This theory has inspired psychological treatment methods, such as
breathing training, which have shown positive effects (de Beurs et al 1995; Meuret et al 2004;
Roth 2005). Argue against this theory, however, does the fact that it is CO2-inhalation, rather
than monitored hyperventilation, which may cause PAs in PD patients (Garssen et al 1996;
Maddock and Carter 1991; Papp et al 1993a; Rapee et al 1992; Zandbergen et al 1990).
An alternative explanation, the suffocation false alarm theory (SFA), was proposed by
Donald F. Klein in 1993 (Klein 1993). It postulates the existence of a physiological
suffocation alarm system, involving central chemoreceptors that monitor information about
potential suffocation. Hyperventilation, panic and an urge to flee are highly adequate
responses to threatening hypercarbia or hypoxia, but PAs are believed to occur when the
alarm is erroneously activated in susceptible individuals. Contrary to the locus coeruleus and
neuroanatomical models described above, a distinction between fear reactions and panic is
made by Dr. Klein, who focuses on the fact that PAs are often characterized by marked
respiratory symptoms, such as hyperventilation, shortness of breath, and a feeling of being
smothered, which are symptoms not generally present during fear. The existence of a
suffocation alarm system is illustrated by studies in children with congenital central
10
hypoventilation syndrome (CCHS, also called Ondine's curse). In this rare condition, the
autonomic control of breathing is impaired which leads to sleep apnoeas. If PD is
characterized by an abnormally low suffocation alarm threshold, CCHS can be said to have an
abnormally high suffocation alarm threshold, and may hence represent the physiological
converse of PD. Interestingly, children with CCHS have been found to be significantly less
anxious than other chronically ill children investigated (Pine et al 1994).
Serotonin and panic disorder
Regardless of the specific brain regions involved in the pathophysiology of PD, the
effectiveness of SRIs suggests that serotonergic neurons are of importance. The influence of
brain serotonergic activity on anxiety in PD patients is however complex, as illustrated by the
fact that acute administration of SRIs often elicits a paradoxical increase in anxiety, and that
the serotonin releasing drugs d-fenfluramine (Garattini et al 1987) and m-
chlorophenylpiperazine (mCPP) (Eriksson et al 1999) also provoke anxiety, and even PAs, in
PD patients (Charney et al 1987; Hollander et al 1990; Mortimore and Anderson 2000;
Targum and Marshall 1989). Why acute facilitation of serotonergic activity elicits anxiety in
responsive subjects, whereas long-term treatment with SRIs prevents PAs, is intriguing.
Acute tryptophan depletion (TD) is an effective way to acutely lower brain levels of
serotonin by up to 90%, and has been widely used to study serotonergic neurotransmission in
human subjects. TD does not exert any major effect on anxiety levels in PD patients, but
enhances the panic provoking effects of agents such as yohimbine and CO2 in PD patients
(but not healthy controls) (Goddard et al 1994; Hood et al 2006; Miller et al 2000; Schruers et
al 2000). It also augments the ventilatory response to CO2 in PD patient (Kent et al 1996).
Conversely, increasing serotonin availability by subchronic administration of the serotonin
precursor L-5-hydroxytryptophan inhibits spontaneous PAs (Kahn et al 1987b); moreover,
somewhat unexpectedly, the same compound has also been reported to counteract CO2-
inhalation-induced panic in PD patients also at acute administration (Schruers et al 2000), as
does subchronic administration of SRIs (Bertani et al 1997; Perna et al 1997; Shlik et al 1997;
van Megen et al 1997).
Also brain-imaging studies have provided support for an involvement of serotonin in
PD. There are hence reports suggesting PD to be associated with a reduced density of
serotonin transporters as well as 5-HT1A receptors, and that these aberrations are partly
restored by effective treatment (Maron et al 2004; Nash et al 2008; Neumeister et al 2004).
11
Panic disorder and respiration
As briefly discussed above, the possible link between the regulation of respiration and PD has
been the subject of extensive studying in the last decades. The interest in this matter stems
from the marked respiratory symptoms present during PAs, which distinguish them from fear
reactions in general (Klein 1993), and that respiratory stimulants such as CO2, sodium lactate,
pentagastrin, and doxapram have been shown to provoke panic in patients with PD (Abelson
and Nesse 1994; Abelson et al 1996; Geraci et al 2002; Gorman et al 1984; Kent et al 2001;
Lee et al 1993; Liebowitz et al 1984; McCann et al 1997; Papp et al 1997; Pitts and McClure
1967; Rainey et al 1985; van Megen et al 1994; Woods et al 1986). It has also been shown
that PD patients display larger respiratory pattern variability than healthy individuals, both
while awake and during sleep, and that this can not solely be explained by more sighing
(Abelson et al 2001; Bystritsky and Shapiro 1992; Gorman et al 1988a; Martinez et al 2001;
Papp et al 1993a; Papp et al 1993b; Perna et al 1994; Schwartz et al 1996; Stein et al 1995;
Wilhelm et al 2001a; Wilhelm et al 2001b).
It has been suggested that PD with respiratory symptoms differ from PD without
respiratory symptoms (Klein 1993; Meuret et al 2006; Nardi et al 2008; Onur et al 2007), the
respiratory subtypes being more sensitive to panic provocations in the laboratory with
substances such as CO2 and caffeine (Abrams et al 2006; Biber and Alkin 1999; Freire et al
2008; Nardi et al 2007; Nardi et al 2006), and showing respiratory irregularities to a greater
extent than the non-respiratory subtype (Beck et al 2000; Bystritsky et al 2000).
Some studies have demonstrated lowered end-tidal CO2 in patients with PD as
compared to healthy controls or patients with other anxiety diagnosis, suggesting chronic
hyperventilation (Bass et al 1989; Gorman et al 1984; Hegel and Ferguson 1997; Moynihan
and Gevirtz 2001; Papp et al 1997; Rapee 1986; Wilhelm et al 2001b). This has however not
been replicated in all studies (Zandbergen et al 1993), and there is evidence to suggest that
only PD patients of the respiratory subgroup hyperventilate chronically (Moynihan and
Gevirtz 2001), but also evidence that chronic hyperventilation is not diagnostically specific to
PD but occurs in non-PD anxiety patients as well (van den Hout et al 1992).
Genetics
Family and twin studies have consistently demonstrated that the etiology of PD is influenced
by genetic factors; first-degree relatives of affected probands have a 4-10-fold increase in the
12
risk of developing PD compared to the general population and twin studies estimate the
heritability to up to 50% (Crowe et al 1983; Goldstein et al 1994; Hettema et al 2001; Maier
et al 1993; Smoller and Tsuang 1998). The mode of inheritance is most likely multifactorial,
with several genes exerting minor effects on the phenotype.
Genetic dissection of complex traits like psychiatric disorders has proven difficult, and
positive findings from one study have often not been replicated in independent samples.
However, in recent years some specific polymorphisms have been reported to be associated
with PD in several independent studies, namely the catechol-O-methyl transferase (COMT)
Val158Met polymorphism (Domschke et al 2007), the angiotensin converting enzyme
insertion/deletion polymorphism (Bandelow et al 2007; Erhardt et al 2008; Olsson et al
2004c), and the adenosine 2A receptor polymorphism (Deckert et al 1998; Hamilton et al
2004).
Comorbidity
Psychiatric
When concern about the next PA results in avoidant behaviour, the patients may develop
agoraphobia. In DSM-IV agoraphobia is defined as anxiety about being in places or situations
from which escape might be difficult or embarrassing or in which help might not be available
if escape is needed. For the diagnostic criterion to be met, the patient needs to avoid the feared
situations (i.e. standing in line, being on a bridge, travelling), endure them with great distress,
or require the presence of a companion. Also, the symptoms should not be explained by other
conditions such as social or specific phobias (American Psychiatric Association, DSM-IV-
TR, 2000).
PD is also highly comorbid with a range of psychiatric disorders apart from
agoraphobia, i.e. other anxiety disorders, mood disorders, substance abuse disorders, and
somatoform disorders. Depressive disorders, including bipolar disorder, are the conditions
most commonly reported to co-occur with PD, followed by other anxiety disorders (Faravelli
et al 2004; Jacobi et al 2004; Merikangas et al 1996; Roy-Byrne et al 2000; Weissman et al
1997; Wittchen et al 1998a; Wittchen et al 1998b; Vollrath et al 1990).
13
Somatic – general
The physiological symptoms of PD can readily be confused with those associated with
various medical conditions, both by patients and by health workers. Patients with undiagnosed
PD are likely to seek emergency treatment believing that they suffer from a serious medical
condition, such as a heart attack. If PD is unrecognized as a possible diagnosis by the medical
staff, the patients are likely to receive unnecessarily extensive and costly medical workups for
their somatic symptoms, while not receiving adequate treatment for their PD (Zaubler and
Katon 1998).
Apart from being confused with various somatic conditions, PD is also closely
associated with several somatic illnesses, including vestibular dysfunction (Jacob et al 1996),
headache (Marazziti et al 1999), and irritable bowel syndrome (Kaplan et al 1996). The
relationship between PD and cardiovascular disorders and respirator disorders, respectively,
are discussed below.
Somatic – cardiac
Although much effort is made to explain to the PD patient that their condition is benign, there
are in fact reports showing an increase in cardiac morbidity and mortality in PD (Coryell et al
1982; Coryell et al 1986; Smoller et al 2007; Weissman et al 1990; Zaubler and Katon 1996;
Zaubler and Katon 1996). A decreased parasympathetic tone, as measured by the heart rate
variability between inspiration and expiration, has repeatedly been found in PD patients as
compared to controls (Kawachi et al 1995; Klein et al 1995; Yeragani et al 1993; Yeragani et
al 1995). Such an imbalance of the autonomic regulation of the heart is a known risk factor
for sudden cardiac death (de Bruyne et al 1999; Dekker et al 2000; Tsuji et al 1996), and may
thus provide an explanation for the increase in cardiac mortality reported in PD. Effective
anti-panic treatment has been suggested to increase heart rate variability (Garakani et al 2008;
Tucker et al 1997), and may thus potentially decrease the risk of cardiac mortality. Studies
have also found increased QT variability in PD patients (Sullivan et al 2004; Yeragani et al
2002a; Yeragani et al 2000), reflecting an abnormal ventricular repolarisation, which may
lead to malignant ventricular arrhythmias and sudden cardiac death (Adamson and Vanoli
2001).
An association between mitral valve prolapse (MVP) and PD has been suggested (Filho
et al 2008). It has been speculated that the underlying mechanism is that the tachycardia and
high levels of catecholamines associated with PAs may cause desynchronization of the
14
contractions of the heart and hence to anatomic abnormalities of the mitral valve leaflets,
resulting in MVP (Channick et al 1981; Gorman et al 1988b). This hypothesis is supported by
findings that MVP associated with PD may be clinically distinct from MVP occurring in the
absence of PD (Weissman et al 1987). Researchers have also speculated that the same
increase in sympathetic discharge may lead to cardiomyopathy (Gillette et al 1985; Kahn et al
1987a) as well as chronic hypertension which are both found at increased rate in PD patients
(Bell et al 1988; Davies et al 1999; Katon 1984; Todd et al 1995; Weissman et al 1990).
Somatic – respiratory
The prevalence of respiratory illnesses, such as asthma and chronic obstructive pulmonary
disease, in patients with PD is significantly higher than in patients without psychiatric illness
or with other psychiatric disorders (Spinhoven et al 1994; Zandbergen et al 1991). Studies on
asthma show that up to 42% of patients experienced panic during asthma attacks and 6.5% to
24% of asthmatic patients meet DSM criteria for PD (Carr 1998; Carr et al 1994; Shavitt et al
1992; Yellowlees et al 1987; Yellowlees et al 1988). When examining patients referred for
pulmonary function testing, 17% were found to have PAs and 11% had PD (Pollack et al
1996).
It is debated whether PD leads to respiratory illness, or if respiratory illness leads to
PD. The intermittent hypercapnia associated with obstructive pulmonary diseases increases
locus coeruleus activity, which could cause panic and hyperventilation (Zandbergen et al
1991). In addition, cognitive processes in anxiety-prone individuals may predispose them to
catastrophize somatic sensations associated with respiratory illnesses, and thus make them
overly concerned about the consequences of their respiratory symptoms (Carr et al 1994;
Porzelius et al 1992). The prevalence of childhood respiratory illnesses among patients with
PD is much higher than among patients with other psychiatric disorders, which has led
researchers to suggest that these patients may be conditioned to become anxious in response
to respiratory symptoms experienced as adults (Zandbergen et al 1991).
Additional background information
The studies presented in this thesis are based on the view discussed above that PD is
associated with an aberration in autonomic control of respiration and cardiovascular activity.
The aim of papers I-III was to use animal experiments in order to shed further light on the
15
possibility that serotonin influences the regulation of respiration, and that this influence may
be of importance both for the anxiogenic and the anti-panic effects of serotonergic drugs. The
aim of paper IV was to examine the possible association between panic disorder and two
genes influencing a neuropeptide exerting an established influence on respiration as well as
arousal, e.g. orexin. And the aims of paper IV and V was to investigate if a gene that is likely
to influence both the autonomic nervous system and the brain, i.e. the COMT gene, is
associated with panic disorder (as has previously been suggested), and if it may contribute to
the well-established co-morbidity between panic disorder and cardiovascular disease. While I
have provided background information regarding panic disorder above, I will, in the
following paragraphs, give a brief background to the other specific areas addressed in this
thesis, namely i) the regulation of respiration, with special focus on the possible role of
serotonin, ii) the neuropeptide orexin, and iii) the COMT Val158Met polymorphism.
Respiratory physiology
The respiratory system aims to maintain proper tissue concentrations of O2, CO2 and H+. In
order to achieve this, O2 is transferred into the blood while, at the same time, CO2 is removed
from the blood. This gas exchange takes place in the alveoli of the lungs where – due to
pressure gradients and factors related to chemical affinity – O2 diffuses from the alveoli into
the blood, whereas CO2 diffuses from the blood into the alveoli.
The main areas involved in ventilatory control are located in the brainstem: 1) the
dorsal respiratory group situated in the nucleus tractus solitarius in the dorsal medulla, 2) the
ventral respiratory group located in the ventrolateral part of the medulla, and 3) the pontine
respiratory group located in the dorsal lateral pons. An intricate interplay between neurons
located in these regions, as well as influences from other parts if the brain upon these neurons,
will under normal conditions lead to an adequate control of breathing.
Breathing, and thereby the chemical homeostasis of O2, CO2, and H+ in blood and
tissues, is constantly controlled by input from the central and peripheral chemoreceptors.
These are highly sensitive to changes in gas tension and provide rapid feedback to the
brainstem respiratory control system. It is believed that alterations of CO2 concentration and
local tissue H+ concentration provide the most powerful stimuli for adjustment of ventilation.
The localization of central chemoreceptors is a matter of controversy. Once thought to
lie in the surface of the ventral medulla (Loeschcke 1973; Mitchell 1969), they are, according
16
to more recent evidence. Probably more widely distributed; several brain stem nuclei thus
contain chemosensitive neurons that are now candidates for this role, such as the nucleus
tractus solitarius and the medullary raphe (Coates et al 1993; Wang et al 1998). The central
chemoreceptors monitor H+ changes in cerebral spinal fluid, which are partly the result of
changes in blood CO2 levels; the blood-brain barrier thus is almost impermeable to H+,
whereas the lipid-soluble CO2 rapidly passes into the central nervous system and subsequently
reacts with water to form carbonic acid that in turn dissociates into H+ and carbonate.
The peripheral chemoreceptors are located in the carotid bodies, at the bifurcations of
the common carotid arteries, and in the aortic body. These receptors are sensitive mainly to
changes in O2, although they respond to changes in CO2 and H+ as well. The sensory signals
from the peripheral chemoreceptors are transmitted via the vagal and glossopharyngeal nerves
into a primary relay station located in the nucleus tractus solitarius of the brain stem.
The number of breaths during a given unit of time is generally referred to as the
respiratory rate (RR). The volume of air exchanged via each breath is called tidal volume
(TV). The total amount of air exchanged per minute – RR x TV – is termed minute ventilation
(MV).
An increase in the partial pressure of CO2 may be experimentally induced by inhalation
of exogenous CO2. Even small amounts of CO2 provide a powerful stimulus to the human
respiratory control system, increasing both RR and TV and their product MV. Intra-individual
respiratory variability – i.e. variations in TV and RR – is a measure assumed to reflect the
sensitivity of the mechanisms controlling respiration (Feldman et al 2003).
Serotonin and respiration
Serotonergic nerve terminals are present in many respiratory nuclei, such as the nucleus
tractus solitarii, the hypoglossal nucleus, and the preBötzinger complex (Feldman et al 2003;
Richerson et al 2005; Richter et al 2003), and researchers have hence investigated the possible
connection between serotonin and respiration for decades. However, in what direction
serotonin influences baseline respiration, and the response to CO2, remains a matter of
controversy.
When analyzing respiratory data, it is important to take into consideration that factors
such as restraint, stress, age, gender, species, anaesthesia, and level of consciousness, may
lead to divergences in outcome. Several studies, all performed on anaesthetized or otherwise
17
pretreated animals, suggest that serotonin is a respiratory stimulant (Holtman et al 1987;
Lalley 1986; Manzke et al 2003; Martin-Body and Grundy 1985; Millhorn et al 1980;
Millhorn et al 1983; Mueller et al 1980; Murakoshi et al 1985; Richerson 2004; Sapru and
Krieger 1977; Severson et al 2003; Taylor et al 2004), while other studies, in awake animals,
on the contrary point to an inhibiting role for serotonin on the regulation of respiration
(Annerbrink et al 2003; Bach et al 1993; Mitchell et al 1983; Olson 1987; Struzik et al 2002).
Apart from the influence of sleep/wakefulness, another factor that may have contributed to the
lack of congruence between studies is the possibility that different serotonergic receptor
subtypes may exert different effects on ventilatory regulation.
According to a theory recently launched by Richerson and co-workers, and based
mainly on in vitro experiments, serotonergic neurons not only modulate respiration, but
actually serve as the central chemoreceptors detecting acidosis and enhanced CO2-levels
(Richerson 2004; Severson et al 2003). This theory is however not undisputed, one counter-
argument being that neurons may well detect pH changes in vitro and modulate the central
chemoreflex without being chemoreceptors per se (Guyenet et al 2008; Mulkey et al 2004).
Also, drugs known to radically alter serotonin transmission, such as PCPA, SRIs, and various
serotonin receptor agonists and antagonists, do not exert any dramatic effects on respiration in
humans, which might have been expected if serotonergic neurons were indeed identical to the
long-sought central chemoreceptors.
Are genes influencing arousal and/or respiration involved in panic
disorder?
In the search for genes influencing the risk of developing PD, genes of importance for
respiration and/or arousal are, for reasons discussed above, potential candidates. One pathway
related to both respiration and cardiovascular control is the angiotensin system (Atlas 2007;
Jennings 1994; Olsson et al 2004b), which has also been suggested to be involved in the
pathophysiology underlying PD (Shekhar et al 2006). Supporting the notion that genes of
importance for autonomic regulation may be involved in panic disorder , we have previously
shown the I allele in the functional angiotensin converting enzyme insertion/deletion
polymorphism to be significantly more frequent in male PD patients as compared to controls
(Olsson et al 2004c); a finding that has later been replicated by Bandelow and co-workers
(Bandelow et al 2007).
18
A second messenger molecule of importance for respiration (Spyer and Thomas 2000)
as well as for arousal (Miller and O´Callaghan 2006) is adenosine. The observation that a
polymorphism in the gene encoding the adenosine 2A receptor (Deckert et al 1998; Hamilton
et al 2004) appears to be associated with PD hence lends further support for the notion that
susceptibility to PD may be related to genes of importance for inter-individual differences
with respect to the regulation of respiration and/or arousal.
A third transmitter molecule of possible importance for arousal is neuropeptide S
(Jungling et al 2008; Rizzi et al 2008; Vitale et al 2008). Interestingly, a functional
polymorphism in the gene encoding this peptide was also recently associated with PD in male
patients (Okamura et al 2007). This finding however still awaits replication.
Orexin is another neuropeptide that regulates arousal (Adamantidis and de Lecea
2008), and that is also involved in the regulation of respiration (Williams and Burdakov
2008), hence making it an intriguing candidate in the search for PD-related genes. However,
as yet no studies regarding the possible role of orexin-related genes in PD have been
published (see below).
Serotonin-related genes, such as the serotonin transporter promoter polymorphism (5-
HTTLPR), have been thoroughly investigated in PD, but so far with negative or conflicting
results (Blaya et al 2007). We are in the process of genotyping a number of serotonin-related
genes in our PD population, but the results thus far are disappointing.
Orexin
Orexins (also called hypocretins) are excitatory neuropeptide hormones. While neurons
containing orexin originate almost exclusively from the lateral hypothalamus perifornical area
and the dorsomedial hypothalamus (de Lecea et al 1998; Kuwaki 2008; Sakurai et al 1998),
orexin containing nerve terminals are widely distributed in the hypothalamus, thalamus,
cerebral cortex, circumventricular organs, brain stem, and spinal cord, where they influence a
wide range of physiologic and behavioral processes related to food-intake, wakefulness, and
metabolism (de Lecea et al 1998; Elias et al 1998; Nambu et al 1999; Sakurai et al 1998). One
of the key roles for orexin is to regulate sleep and wakefulness by activating monoaminergic
and cholinergic neurons in the hypothalamus and brain stem which maintain wake-periods;
the fact that orexin deficiency causes narcolepsy underlines its importance in this context
(Sakurai 2007). A key role for orexins in the arousal response to fear-related stimuli has also
been suggested; prepro-orexin-knockout mice show diminished locomotor and cardiovascular
19
response in the resident-intruder paradigm designed to induce emotional stress (Kayaba et al
2003), and orexin/ataxin 3 transgenic mice with ablated orexin neurons display diminished
cardiovascular response to air-jet stress paradigm (Zhang et al 2006a).
Orexin is also believed to play a role in respiratory regulation, especially in awake
states (Kuwaki 2008). Axons of orexin-containing neurons project to respiration-related sites,
such as the nucleus tractus solitarius, pre-Bötzinger complex, and the hypoglossal, raphe,
retrotrapezoid, and phrenic nuclei (Berthoud et al 2005; Fung et al 2001; Peyron et al 1998;
Young et al 2005). Intracerebroventricular administration of orexin promotes respiration
(Zhang et al 2005) and orexin-deficient mice exposed to stressors increase their respiration
less as compared to control mice (Kayaba et al 2003; Zhang et al 2006b). Also, prepro-orexin
knockout mice were found to have higher RR and lower TV than wild type mice, and their
response to CO2 is decreased. The attenuated response to CO2 can be partly restored by
supplementing orexin; moreover, the orexin antagonist SB-334867 decreases the MV
response to CO2 when administered to wild type mice (Zhang et al 2006b).
Orexin has recently been suggested to be a key substance in PD since orexin cells in the
dorsomedial hypothalamus express c-Fos in panic-prone rats after lactate infusion, but not in
controls (Johnson et al 2008), and since systemic silencing of prepro-orexin gene expression
using RNA interference methods blocks lactate-induced increases in heart rate and blood
pressure (BP), and attenuates expression of anxiety-like behaviour on the social interaction
test (Truitt et al 2007).
The gene encoding catechol-O-methyl transferase
COMT is a catabolic enzyme located in postsynaptic neurons that deactivates the
catecholamine neurotransmitters dopamine, noradrenaline and adrenaline, as well as other
substances with a catechol structure (such as catecholestrogens). The COMT gene contains a
functional polymorphism, the COMT Val158Met polymorphism that results in an amino acid
substitution of methionine (Met) for valine (Val) at codon 158. The Met allele is thermolabile
and has one-fourth of the enzymatic activity of the Val allele (Lachman et al 1996; Lotta et al
1995). Since COMT metabolizes important neurotransmitters, the Val158Met polymorphism
has been extensively studied in association studies. The results have been conflicting, but
several studies suggest this polymorphism to be linked with schizophrenia (Lewandowski
2007) and cognitive function (Tunbridge et al 2006). In addition, several studies suggest that
the Val allele is more common in female Caucasian PD patients, as compared to controls
20
(Domschke et al 2004; Hamilton et al 2002; Rothe et al 2006). Specifically, the Val allele
appears to be more common in female Caucasian PD patients, as compared to controls
(Domschke et al 2007).
As described above, PD is associated with increased cardiovascular mortality. Since the
COMT enzyme plays an important role in inactivating catecholamines, the COMT
Val158Met polymorphism could tentatively provide a link between PD and cardiovascular
disorders. To what extent the COMT Val158Met polymorphism is associated with
cardiovascular disease however remains to be established.
21
Papers I-VI: Aims, Results, and Discussion
PAPER I: Does serotonin depletion obtained by means of para-chlorophenylalanine
administration alter baseline ventilation, CO2 response, and respiratory variability
in rat?
To further explore the involvement of serotonin in respiratory regulation, we examined the
effect of the serotonin synthesis inhibitor PCPA, at a dose previously shown to cause a
marked reduction in brain serotonin levels in rat (Eden et al 1979), on baseline respiratory
patterns and on CO2 responsiveness in freely moving male Wistar rats.
PCPA induced an overall hyperventilation at baseline due to an increase in TV
accompanied by a decrease in RR. After CO2 exposure, there was no difference between
controls and PCPA-treated rats regarding MV, although PCPA-treated animals maintained a
higher TV and lower RR. The finding that PCPA induced hyperventilation without affecting
CO2 responsiveness is a replication of earlier findings in rats (McCrimmon 1995), and is well
in line with the finding by Struzik and co-workers showing that lowering serotonin levels in
man by means of tryptophan depletion elevates baseline respiration without affecting
responsiveness to CO2 (Struzik et al 2002).
Of the serotonergic compounds investigated in this thesis (se also Paper II-III), only
PCPA actually affected MV. It is possible that, in the doses administered, only PCPA caused
a dramatic enough alteration in serotonin levels for a serotonergic effect on MV to be
apparent. However, not even PCPA affected the CO2 response. The results thus support a
modulatory role for serotonin in respiratory regulation, rather than a role for serotonergic
neurons as chemoreceptors (as recently suggested) (Richerson 2004).
In line with the notion that serotonergic neurons may serve as chemoreceptors, many
studies have suggested serotonin to be a respiratory stimulant (Holtman et al 1987; Lalley
1986; Manzke et al 2003; Martin-Body and Grundy 1985; Millhorn et al 1980; Millhorn et al
1983; Mueller et al 1980; Murakoshi et al 1985; Richerson 2004; Sapru and Krieger 1977;
Severson et al 2003; Taylor et al 2004), which is not consistent with our findings. This
discrepancy may be due to the fact that the rats in our study were awake and unrestrained,
whereas the animals in the studies cited above all had been anesthetized or otherwise
pretreated.
Respiratory variability, i.e. the intra-individual variability in TV and RR, is enhanced in
patients with PD (Abelson et al 2001; Martinez et al 2001; Papp et al 1997; Stein et al 1995;
22
Yeragani et al 2002b). We found that TV and MV variability, but not RR variability, were
higher in PCPA-treated rats as compared to control rats both at baseline and during
CO2exposure. The observation that serotonin depletion enhances respiratory variability in rat,
in conjunction with the study by Yeragani and co-workers showing that serotonin reuptake
inhibition may decrease respiratory variability in PD patients (Yeragani et al 2004), makes it
tempting to speculate that an aberration in brain serotonergic transmission may be a
mechanism of importance for the increase in respiratory variability associated with PD. If so,
a hypothetical reason for the beneficial effect of the SRIs in PD may be an ability of these
compounds to stabilize respiration.
PAPER II. Does serotonin reuptake inhibition alter baseline respiration and CO2
response?
Successful antipanic treatment antagonizes not only spontaneous but also panicogen-induced
anxiety attacks (Bocola et al 1998; Gorman et al 1997; Perna et al 2001; Pohl et al 1998; Pols
et al 1996). If the panic response induced by CO2 and lactate is due to cognitive
misinterpretation of non-specific somatic stimuli (Goldberg 2001), and/or to a hyperreactive
fear network (Gorman et al 2001; Sinha et al 2000), the counteracting influence of SRIs on
the panic response could be explained by an influence of these drugs on cognitive function
and/or on fear generating circuits. On the other hand, if CO2- and lactate-induced PAs are due
to the effects of these compounds on respiration, an explanation for the beneficial effect of
SRIs could be related to the ability of serotonin to modulate respiration. It has been suggested
that CO2- and lactate-induced panic is specifically related to an activation of chemoreceptors
(Klein 1993); a possible mechanism of action for the antipanic effect of SRIs could thus
tentatively be to reduce chemoreceptor hyperresponsiveness.
The finding that SRIs reduce the ventilatory response to CO2 in PD patients (Bocola et
al 1998) may be regarded as support for the assumption that they influence chemoreceptor
responsiveness. However, since the ventilatory response to CO2 in subjects experiencing
panic could be due to heightened anxiety, the attenuated hyperventilation seen after SRI
treatment could also be secondary to the antipanic effect rather than due to a direct influence
on neuronal circuits involved in the regulation of respiration.
In order to examine the possible effect of antipanic treatment on chemoreceptor
responsiveness, we studied the effect of the SRI paroxetine on baseline respiration and on
CO2 response in freely moving Wistar rats. The most consistent finding of these experiments
23
was that paroxetine caused an increase in baseline RR both after 5 and 15 weeks of treatment,
without significantly affecting TV or MV. The increase in RR following CO2 exposure was
reduced after 15, but not 5, weeks of paroxetine treatment.
In conclusion, these findings do not suggest that paroxetine affects chemoreceptor
responsiveness since no overall change in MV was apparent during the experiment. However,
the results do suggest that chronic treatment with paroxetine modulates respiratory pattern,
both at baseline and – after long term treatment – during CO2 exposure, so that RR is
enhanced and TV reduced.
The lag phase with respect to the effect of paroxetine on CO2 response does not argue
against the possibility that this effect may contribute to the antipanic effect of these drugs in
man. When used to treat PD, the SRIs thus display a considerable delay with respect to onset
of action, and continuous improvement is observed months after treatment has been initiated
(Davidson 1998; Modigh et al 1992).
PAPER III. a) Is the respiratory effect of acute SRI administration opposite to that
of chronic treatment? b) Do other serotonergic drugs also affect respiration?
The aim of the present study was to compare the respiratory effect of acute SRI administration
with that of chronic treatment, the à priori hypothesis being that acute administration would
exert the opposite effect of chronic treatment – i.e. that it would reduce RR – just as acute SRI
administration exerts the opposite effect to that of chronic treatment on anxiety in PD patients.
In Paper II we showed that administration of the SRI paroxetine for 5 or 15 weeks
increases RR in awake, unrestrained freely moving rats (Olsson et al 2004a). This finding was
confirmed in the present study; a significant increase in RR was thus observed after 23 days
of fluoxetine administration and onwards. Analysis of fluoxetine and norfluoxetine showed a
gradual increase in serum levels as measured 24 h after the latest drug injection. This increase,
however, can not by itself explain the increase in RR, since even higher serum levels were
observed 1 h after drug injection without a reduction in RR to be at hand.
When SRIs were administered acutely, we instead observed a dose-dependent decrease
in RR. Acute administration of SRIs increases synaptic levels of serotonin by blocking the
reuptake inhibitor (Stahl 1998) but, at the same time, also silences serotonergic nerve cell
activity due to autoreceptor (5HT1A) activation (Aghajanian et al 1970; Blier and de
Montigny 1985). If serotonergic neurons stimulate respiration by chemoreceptor activation
(see above), an inhibition of serotonergic cell firing may indeed lead to reduced RR. The
24
observed effect on RR could thus be explained either in terms of enhanced extracellular
concentrations of serotonin, or by a feed-back inhibition of serotonergic neurons.
To address the latter possibility, we administered the 5-HT1A agonist 8-OH-DPAT at
doses known to effectively reduce the firing rate in serotonergic neurons without influencing
postsynaptic 5-HT1A receptors (Blier and de Montigny 1990; Forster et al 1995; Sharp et al
1989). Since there was no observable effect on respiration after 8-OH-DPAT administration,
no support was obtained for the theory that the effect of SRIs is secondary to 5-HT1A-
mediated inhibition of serotonergic neurons. Another study in awake freely moving guinea
pigs showed an increase in RR after 8-OH-DPAT administration (Stone et al 1997). Although
this observation differs from our negative finding, it also argues against the notion that
inhibition of serotonergic cell firing reduces RR. Notably, in humans, 5HT1A agonists neither
reduce panic attacks nor elicit them (Sheehan et al 1993; van Vliet et al 1996) which is in line
with the lack of effect of low-dose 8-OH-DPAT administration on respiration.
To explore the alternative explanation to the reduction in RR seen after acute SRI
administration, i.e. that it is secondary to enhanced synaptic serotonin levels, two compounds
known to effectively increase extracellular levels of serotonin, mCPP and d-fenfluramine
(Eriksson et al 1999; Laferrere and Wurtman 1989), were administered. Both these
compounds caused a robust decrease in RR, thus supporting the notion that the effect of acute
SRI administration on RR is secondary to enhanced serotonin levels in the synapse.
The 5HT1A antagonist WAY-100635 enhances the firing of some but not all
serotonergic neurons in awake animals (Fornal et al 1996; Kasamo et al 2001; Mlinar et al
2005). The observation that WAY-100635 elicited the same effect as acute administration of
fluoxetine, paroxetine, mCPP, and d-fenfluramine, i.e. a reduction in RR, thus further
supports the idea that serotonin exerts an inhibitory influence on this parameter.
When WAY-100635 is co-administered with an SRI, the former drug may counteract
the inhibitory influence of the latter on serotonergic cell firing, and hence potentiate the
stimulatory influence on extracellular levels of serotonin (Arborelius et al 1996; Hjorth 1993;
Invernizzi et al 1996). The finding that WAY-100635 plus fluoxetine did not reduce RR
significantly more than did either drug alone (although the effect of the combination was
numerically larger) suggests that RR-modulating serotonergic neurons are not inhibited by
SRIs. This may also explain why 8-OH-DPAT had no observable effect on respiration.
The present observation, that the effect of acute administration of an SRI on RR in rat
is opposite to that of subchronic treatment adds to an already existing body of data suggesting
that the effect of subchronic treatment with SRIs on serotonergic output, at least in some
25
neuronal circuits, is opposite in direction to that observed after acute administration (Stahl
1998). SRIs are not only devoid of antipanic effects during the first days of PD treatment, but
initially often aggravate anxiety (Nutt and Glue 1989; Pohl et al 1988), and drugs causing a
marked and immediate increase in synaptic serotonin concentrations, such as fenfluramine
and mCPP, do not exert acute anti-anxiety effects, but, on the contrary, may elicit anxiety in
patients with panic disorder (Charney et al 1987; Mortimore and Anderson 2000). Recently,
acute SRI administration to man has been found to enhance amygdala reactivity (Bigos et al
2008) whilst subchronic treatment reduces it (Harmer et al 2006).
As the results of Paper II, those of paper III do not suggest that serotonergic drugs in
the doses used induce either a hyper- or hypoventilation, but rather modulates the respiratory
pattern. We hypothesize that respiratory irregularities caused by serotonergic imbalance may
be of central importance for both anxiety symptoms and respiratory irregularities observed in
patients with PD, and that the effects of serotonergic drugs on anxiety in PD patients may in
fact be secondary to effects on respiration. In line with this, the effects of fenfluramine,
mCPP, and acute administration of SRIs with respect to RR in rat were opposite to that seen
after subchronic treatment, just as all the former treatment enhance anxiety whereas the latter
prevents panic attacks.
The experiments presented in papers I-III in this thesis were all performed on rats, an
animal often used to study respiration. In an ongoing clinical study we are exploring the
effects of acute and subchronic SRI administration on respiratory parameters in patients with
panic disorder and depression, respectively, the hypothesis being that acute administration
will reduce RR, and that this effect will be correlated with an initial increase in anxiety in PD
patients. In contrast, we predict long-term treatment to be associated with an increase in RR
that will be accompanied by a prevention of panic attacks. In addition, a possible influence on
respiratory variability as well as on CO2 responsiveness will be assessed.
PAPER IV. Is panic disorder associated with the polymorphisms HCRTR1
Ile408Val and HCRTR2 G1246A in orexin receptors 1 and 2?
Since PD has been suggested to be due to an aberration in the control of respiration, the
neuropeptide orexin (hypocretin), – which is believed to play a key role in respiratory
regulation (Creveling 2003; Kayaba et al 2003; Kuwaki 2008; Zhang et al 2005; Zhang et al
2006b) – is a transmitter of possible importance for PD pathophysiology. In this vein, studies
showing orexin cells in the dorsomedial hypothalamus to express c-Fos after lactate infusion
26
in panic-prone rats but not in controls, and silencing of the prepro-orexin gene expression to
impede the increase in heart rate, BP, and anxiety-like behaviour seen after lactate-infusion,
recently prompted the suggestion that orexin may indeed be of importance for the
development of PD (Truitt et al 2007). Similarly, the suggested role for orexin in mediating
arousal (Sakurai et al 2005; Winsky-Sommerer et al 2004; Yoshida et al 2006) is intriguing in
this context, since PD has been proposed to be associated with a state of chronic hyperarousal
(Knott et al 1997; Pillay et al 2006; Uchida et al 2008).
To explore the possible importance of orexin for PD in humans – which to our
knowledge never has been done before – we investigated the possible association between PD
and two polymorphisms in the orexin receptors: the Ile408Val polymorphism in the gene
encoding the hypocretin receptor 1 (HCRTR1) and the Val308Iso (G1246A) polymorphism in
the gene encoding the hypocretin receptor 2 (HCRTR2). We chose these two polymorphisms
because they have previously been associated with biological traits; the HCRTR2 Val308Iso
polymorphism has thus been associated with cluster headache (Rainero et al 2007; Schurks et
al 2006) and the HCRTR1 Ile408Val polymorphism to polydipsia in schizophrenic patients
(Fukunaka et al 2007; Meerabux et al 2005).
Whereas no association between the HCRTR1 Ile408Val polymorphism and PD was
found, the A-allele of the HCRTR2 Val308Iso polymorphism was significantly more frequent
in patients than in controls. After dividing the populations according to gender, this
association was seen in female patients only. Gender-specific effects of various
polymorphisms are not unusual; however the small sample size, and therefore lack of power,
in the male patient population, must also be considered when interpreting this difference.
The HCRTR2 gene is located on chromosome 6p12.1, consists of 7 exons (100 kbp),
and is expressed exclusively in the brain (Sakurai et al 1998). The possible functional
significance of the valine to isoleucine amino acid substitution at position 308 is as yet
unknown, but it has been suggested to interfere with the dimerization process of the receptor
(Rainero et al 2007).
Since this is a novel finding, it needs to be replicated in independent samples. We
however suggest that future research regarding the role of orexin in PD may prove fruitful.
27
PAPER V. Is the association between the COMT Val158Met polymorphism and
panic disorder possible to replicate?
COMT is a ubiquitous enzyme of importance for the degradation of both catecholamines and
estrogens (Creveling 2003). The coding region of the COMT gene comprises a single
nucleotide polymorphism (SNP) resulting in a Val to Met substitution (Val158Met). This
SNP has been shown to influence the activity and thermal stability of the enzyme in vitro
(Lachman et al 1996; Lotta et al 1995), the Val allele resulting in up to four times the
enzymatic activity of the Met allele at body temperature (Chen et al 2004; Lachman et al
1996). Catecholamines have been attributed importance for the generation of panic attacks
(Kandel 1983), and they also mediate the sympathetic input on the heart; variations in COMT
activity may thus be linked both to the psychological aspects of PD and to some of the
somatic consequences, such as high BP (Wilkinson et al 1998) and enhanced mortality in
cardiovascular disease (Coryell et al 1982; Coryell et al 1986; Smoller et al 2007; Weissman
et al 1990; Zaubler and Katon 1998; Zaubler and Katon 1996).
An association between the Val158Met polymorphism and PD does indeed get
support from several independent studies suggesting the Val allele to be more common in
Caucasian PD patients than in controls; after splitting for gender, these associations were
however found only in the female subgroups. (Domschke et al 2007). The association
between this polymorphism and PD being one of the more promising findings from
psychiatric association studies, we deemed it important to address if it could be replicated in
our group of PD patients as well. We indeed found the Val158 allele to be significantly more
frequent in PD patients than controls; moreover, when splitting for gender, the association
was significant in both male and female subgroups. Since all PD populations investigated to
date are relatively small, it is possible that the lack of association in male patients in earlier
studies have been due to low power.
Interestingly, in Asian samples an association opposite to that observed in Caucasian
samples has been found; in Asian samples, it is thus the Met allele of the Val158Met
polymorphism, rather than the Val allele, that appears to be associated with PD (Woo et al
2004; Woo et al 2002). Since any functional polymorphism involved in an important
biological pathway may be expected to elicit numerous adaptive mechanisms, its net effect on
the phenotype is likely to be dependent on the presence of other polymorphisms in genes
encoding other proteins in the same pathway. This may thus explain why one allele may
predispose to a certain trait in subjects from one part of the world whereas the other allele of
28
the same polymorphism may be associated to the same trait in other regions. Also, the
possibility that a polymorphism that is in linkage disequilibrium with the investigated
polymorphism in one part of the world, but less so in another region, is of functional
importance, and responsible for the observed association, should not be disregarded.
Several studies also suggest a role for the COMT Val158Met polymorphism and other
anxiety-related traits in women. In these studies, it is however usually the Met allele that
appears to be associated with traits such as harm avoidance (Enoch et al 2003), episodic
anxiety (Olsson et al 2005), low extraversion, high neuroticism (Stein et al 2005), and
heightened reactivity in corticolimbic circuits (Drabant et al 2006); in contrast, Hettema and
co-workers found an association between the Val allele on the one hand and neuroticism and
anxiety disorders on the other (Hettema et al 2008). The Val158Met polymorphism has also
been studied in relation to processing of emotional stimuli in amygdala and prefrontal cortex
in PD patients and healthy probands with positive although conflicting results; PD patients
carrying the Val allele reacted more to faces expressing negative emotions (Domschke et al
2008) whereas healthy subjects carrying the Met allele were found to react more to unpleasant
stimuli (Smolka et al 2005).
Of possible relevance in this context is also the association between the COMT
Val158Met polymorphism and cognition. Dopamine levels in the prefrontal cortex are critical
for modulating cognitive function, and hence the COMT Val158Met polymorphism has been
thoroughly investigated with regard to cognitive tasks. In these studies, this polymorphism
has been relatively consistently shown to modulate performance on tasks related to prefrontal
cortex activation (Bilder et al 2002; de Frias et al 2005; Diamond et al 2004; Egan et al 2001;
Goldberg et al 2003; Joober et al 2002; Malhotra et al 2002; Mattay et al 2003); in short, the
Met allele seems to be associated with better performance on tasks involving working
memory and executive functioning, but also associated with impaired emotional processing
(Tunbridge et al 2006).
The tonic/phasic model of dopamine system regulation has been used to explain the
complex relationship between cognitive function and the COMT Val158Met polymorphism
(Bilder et al 2004; de Frias et al 2008; Wilkerson and Levin 1999). In this model,
consideration is given to what type of dopaminergic activation that is required to perform a
certain task. The tonic activity is suggested to be characterized by a constant, slow firing of
dopamine neurons in the prefrontal cortex, and of assumed importance for sustained attention.
The phasic activity, on the other hand, is characterized by transient, high-amplitude
dopaminergic activity, and critical for updating and gating new information. While the Met
29
allele is assumed to augment the tonic component leading to increased stability but decreased
flexibility, the Val allele is assumed to promote the phasic component. This may be relevant
also to the relationship between Val158Met on the one hand and PD and other anxiety
disorders on the other; while Val carriers could be assumed to filter sensations generated by
increased autonomic arousal less effectively, Met carriers may be characterized by a lack of
flexibility that makes them more likely to brood and get stuck in negative thought-spirals.
In this context, it should also be stressed that broadly defined anxiety is not to be
regarded as pathological, but, on the contrary, adds useful diversity needed for long-time
survival of the species. It is probably rarely the case that one allele variant is always
beneficial, whereas the other is always detrimental; rather, different variants probably result in
phenotypes that may all be of benefit depending on the requirements.
In conclusion, our results, together with previous studies, strongly suggest that the
COMT Val158Met polymorphism is of importance for the development of PD. We suggest
this to be one of the more robust findings obtained in psychiatric association studies so far.
In conclusion, our results, together with previous association studies, strongly suggest
that the COMT Val158Met polymorphism is of importance for the development of PD, and
further studies regarding the role of catecholamines and autonomic control in PD patients are
highly warranted.
PAPER VI. Is the COMT Val158Met polymorphism associated with cardiovascular
risk factors?
The COMT enzyme degrades catecholamines and estrogens (Creveling 2003) – both of which
are of known importance for cardiovascular risk factors such as obesity and hypertension
(Esler 1993; Halford et al 2004; Louet et al 2004; Muller et al 2003; Tchernof and Despres
2000) – and the COMT gene has previously been associated with hypertension (Hagen et al
2007; Kamide et al 2007). This gene being associated both with PD and with cardiovascular
disease might hence be one contributing factor to the co-morbidity between the two.
To further explore this possibility, we investigated the possible association between the
COMT Val158Met polymorphism on the one hand, and BP and anthropometry on the other,
in 240 middle-aged Swedish men, all 51 years old, who were recruited by means of the
population register and free from antihypertensive medication.
Subjects with two copies of the low-activity Met158 allele had significantly higher
waist-hip-ratio, sagittal diameter, systolic BP, diastolic BP, and heart rate than subjects with
30
two copies of the high-activity Val158 allele, heterozygous subjects displaying values in
between. This is intuitively attractive since the Met allele results in slower degradation of
catecholamines, which could be expected to raise BP and heart rate. However, the only
previous study examining the effect of the COMT Val158Met polymorphism and BP found
an association between systolic BP and the low-activity Val158 allele in a large Norwegian
population (Hagen et al 2007).
Our á priori hypothesis was that the COMT Val158Met polymorphism could provide a
link between PD and the elevated BP often observed in PD patients (Bell et al 1988; Davies et
al 1999; Katon 1984; Todd et al 1995; Weissman et al 1990) as well as with the enhanced
mortality in cardiovascular disease associated with PD. However, since we found the Val158
allele to be associated with PD, but carriers of the Met158 variant to have higher BP and
higher WHR, no support for this theory was gained.
.
31
Summary
♦ Serotonin depletion with PCPA induced hyperventilation in freely moving rats due to
an increase in TV, but did not affect CO2 response. This observation – that is in line
with some previous studies – is of importance, since it refutes the theory based on in
vitro studies, and studies using anaesthetized animals, that serotonin is crucial for CO2
responsiveness and that it exerts mainly a stimulatory influence of respiration. PCPA
also increased respiratory variability, suggesting that the respiratory abnormalities
observed in patients with PD may be due to alterations in brain serotonergic
neurotransmission.
♦ Acute treatment with the SRIs paroxetine and fluoxetine decreased RR, as did acute
treatment with the serotonin releasing drugs d-fenfluramine and m-CPP and the 5-
HT1A antagonist WAY-100635. Due to a corresponding increase in TV, there were
however usually no significant effects on MV. The results suggest that acutely
increasing serotonin levels in the synapse reduces rather than increases RR, and hence
reinforce the conclusion that serotonin does not exert any clear-cut stimulatory
influence on respiration in awake animals.
♦ Chronic treatment with the SRIs fluoxetine and paroxetine for at least three weeks
exerted an effect on RR opposite to that obtained by acute administration of SRIs (as
well as of serotonin releasers), i.e. it increased RR. As with acute treatment, no
marked effect on MV was observed – again suggesting that serotonin plays a
modulatory role on respiratory pattern, rather than exerting a clear-cut stimulatory or
inhibitory influence. The opposite effects of acute and chronic SRI administration,
respectively, may be the result of adaptive processes in certain neuronal circuits
obtained by long-term but not acute SRI exposure. In line with our results, acute
administration of SRIs, fenfluramine and mCPP enhances anxiety in PD patients,
whereas long-term administration with SRIs prevents panic attacks. Further studies are
required to establish if the effects of these drugs on respiration are of direct
importance for their effects on anxiety in PD patients, or if reversal of the functional
effects of acute SRI to its opposite upon long-term administration is a general
32
phenomenon that occurs independently in both respiration-modulating and anxiety-
modulating serotonergic pathways.
♦ A polymorphism in the orexin-receptor 2, HCRTR2 G1246A, was significantly
associated with panic disorder in female patients only. This is the first report providing
direct support for an involvement of the respiration- and arousal-modulating peptide
orexin in panic disorder, and the result should hence be interpreted with caution until
replicated. Our observation is however in excellent agreement with preclinical data
suggesting orexin to play a pivotal role in an animal model of PD.
♦ The Val allele in the COMT Val158Met polymorphism was found to be significantly
more frequent in PD patients than controls. This is a replication of earlier findings in
Caucasian samples, although we found the association in both male and female
subgroups whereas earlier studies have demonstrated the effect in female patients
only. We suggest that the association between the Val allele of the COMT Val158Met
polymorphism and panic disorder may by now be regarded as one of the few findings
from psychiatric association studies that could be regarded as definitely confirmed.
♦ The COMT Val158Met polymorphism was also associated with cardiovascular risk
factors in our sample of healthy middle-aged men. The low activity Met allele was
however associated with significantly higher WHR, sagittal diameter, systolic blood
pressure, diastolic blood pressure, and heart rate; this study hence provided no support
for the theory that the COMT gene may contribute to the association between PD and
cardiovascular mortality.
33
Acknowledgements
My supervisor Elias Eriksson is gratefully acknowledged for generously sharing his vast
knowledge on research, university politics, and various other things.
I would also like to express my sincere gratitude to:
Marie Olsson and Lars Westberg, senior colleagues and valued friends, who have contributed
extensively to the projects in this thesis.
Co-workers and friends in the research group: Jessica Bah Rösman, Britt-Marie Benbow, Olle
Bergman, Gunilla Bourghardt, Agneta Ekman, Benita Gezelius, Monika Hellstrand, Susanne
Henningsson, Hoi-Por Ho, Lydia Melchior, Jonas Melke, Christer Nilsson, Inger Oscarsson,
Erik Studer, and Petra Suchankova.
Co-authors and collaborators; Christer Allgulander, Sven Andersch, Finn Bengtsson,
Annalena Carlred, Carin Carlquist, Tomas Eriksson, Jan Hedner, Göran Holm, Birgitta
Holmgren, Agneta Holmäng, Staffan Nilsson, Hans Nissbrandt, Roland Rosmond, and
Ingemar Sjödin.
My family; Björn, Hanna, Lena, and Bengt.
This thesis was sponsored by the Swedish Research Council (grant No8668), the Swedish
Brain Power Initiative, Torsten and Ragnar Söderberg’s Foundation, the Lundberg
foundation, Wilhelm and Martina Lundgren Scientific Foundation, H Lundbeck, Glaxo
SmithKline, BristolMyers Squibb
34
Appendix: Material and methods
Animal studies (Paper I-III)
Ethics
The studies have has been carried out in accordance with the Guide for the Care and Use of
Laboratory Animals, as adopted and promulgated by the NIH (NIH publication No. 85-23,
revised 1985), and were approved by the Ethics Committee for Animal Experiments,
University of Gothenburg, Sweden.
Animals
Male Wistar rats were used. Before the experiments, the rats were housed under controlled
conditions: temperature 21-22ºC, humidity 55-65%. Food and water were available ad libitum
at all times except during the experiments.
Respiratory measurement
All experiments took place in a silent room with lights on and an observer placed
approximately 1 m from the rat. Two different equipments were used to measure respiration
in freely moving rats: In Paper I-III, the plethysmograph used to measure ventilation was built
in our laboratory, made of Plexiglas and cylindrical in shape (height 235 mm, diameter 290
mm, volume 15.5 l). A sensor membrane, responding to pressure differences in the
plethysmograph caused by the animal breathing, was connected to a Macintosh computer
(software: MacLab) via a transducer.). In Paper III, the Unrestrained Whole Body
Plethysmograph from Buxco Research Systems (Wilmington, NC, USA) was also used. The
animals were able to move freely inside the plethysmograph at all times.
Before the day of the acute experiment, the animals were habituated to the
plethysmograph on three different days (15 min + 15 min + 15 min). Before recording started
on the day of the experiment, the animals were rated by means of gross observation with
respect to motor activity. Animals that were not still after having spent 10-15 minutes in the
plethysmograph were disqualified. The rater was blind as to whether the rat was given saline
35
or active substance. RR (breaths per min=BPM), TV (ml/breath), and MV (ml/min) were
registered during two minutes.
Gas exposure (Paper I-II)
The gas used was either 100% CO2 or a control gas consisting of 20% O2 and 80% N2. The
gas was administered through a valve in the plethysmograph, with a constant inflow rate of
approximately 3 litres per minute, regulated by a BS300 regulator and a Dynamal inflow-rate
meter (Air Liquide, Gothenburg, Sweden). Duration of gas administration was 10-35 seconds
depending on the CO2 concentration desired. Another valve was used for pressure monitoring.
A 2001 VTCM gas meter (Comfort-Control, Uppsala, Sweden) was used to measure the level
of CO2 as well as the temperature within the plethysmograph.
Analysis of serum paroxetine and fluoxetine (Paper II and III)
Mixed arteriovenous trunk blood was collected for analysis after decapitation of the rats. The
blood was allowed to clot for 20–30 min in the collecting test tube at room temperature and
then centrifuged at 2500 g for 10 min. Supernatant serum was then transferred into a new test
tube, frozen, and kept stored at −70 °C until analysis was performed.
Serum concentrations of paroxetine were assessed using high-performance liquid
chromatography connected to a UV-detector working at an excitation/emission wavelength of
210 nm at the Department of Psychiatry, Linköping University Hospital.
Serum concentrations of fluoxetine and norfluoxetine were assessed using high-
performance liquid chromatography followed by liquid chromatography tandem mass
spectrometry at the Division of Clinical Chemistry and Pharmacology, Lund University
Hospital.
Statistics
Between-group and in-group differences were evaluated statistically using ANOVA followed
by Fisher’s PLSD test (Paper I-III), unpaired t-test (Paper I-III), or paired t-test (Paper I and
III). In addition, two way ANOVAs were performed in Paper I. All values are expressed as
mean (±SD) and p≤0.05 was considered statistically significant.
36
Genetic studies (Paper IV-VI)
Ethics
All participants provided written informed consent. The study protocol was approved by the
Ethics committees at the University of Gothenburg and the Umeå University.
Subjects
The subjects in Paper VI were drafted from the general population of Göteborg, Sweden, and
consisted of 240 men born in 1944 who were recruited for a study of obesity,
anthropometrics, and cardiovascular risk factors (Rosmond et al 1998). These subjects were
also used as controls in Paper IV and V, as were 269 women born in 1956 and recruited for
the same purpose (Rosmond and Bjorntorp 1998).
The patients with PD in Paper IV and V were recruited from the Göteborg Anxiety
Syndrome Society (Ångestsyndromsällskapet, Göteborg, Sweden), from the private
psychiatric practices of Dr Sven Andersch, Gothenburg, and Dr Christer Allgulander,
Stockholm, and among subjects who had participated in controlled drug trials.
Molecular genetics
Venous blood was collected from each subject, and genomic deoxyribonucleic acid was
isolated using the QIAamp DNA blood Mini Kit (Qiagen, Chatsworth, CA).
Pyrosequencing® (Paper IV-IV)
Pyrosequencing (Nordfors et al 2002) is a method of DNA sequencing using the polymerase
transcription process itself. To initiate incorporation of nucleotides at the desired location the
DNA polymerase uses a short sequence primer, which hybridizes close to the investigated
polymorphism. The nucleotides are added in a pre-programmed order, and when a nucleotide
is incorporated the release of pyrophosphate starts a luciferase-catalyzed enzymatic reaction
generating visible light which can be detected by a charge coupled device camera and seen as
a peak in a pyrogram. The Assay Design Software, Biotage Version 1.0.6 was used.
37
Sequenom® (Paper IV and V)
Sequenom is a high-throughput SNP analysis tool based on multiplex polymerase chain
reaction (PCR) with subsequent single base primer extension, followed by an analysis with
MALDI-TOF-MS (van den Boom and Ehrich 2007). One extension primer per SNP is added
to the PCR products together with the nucleotides. The extension primers anneal to their
specific PCR product, the base before the SNP and the following extension is depending on
the allele. The extension product will be elongated either with one or two bases and their
different masses are separated in the mass spectrometer, rendering a spectrogram with the
genotypes of all SNPs in the plex. TyperAnalyzerFS © software Version 1.0.1.46 was used to
assess the results.
Genotyping
The COMT Val158Met polymorphism (SNP ID: rs4680) was analysed using Pyrosequencing
(Paper VI) or Sequenom (Paper V). The HCRTR2 G1246A polymorphism (SNP ID:
rs2653349) was assessed using Sequenom and, for samples for which the Sequenom analysis
failed, with Pyrosequencing. The HCRTR1 Ile408Val polymorphism (SNP ID: rs2271933)
was analyzed using Pyrosequencing. All primers used in the analyses are listed in Table 2.
Table 2a. Primers used in Pyrosequencing
Gene SNP Forward (5′-3′) Reverse (5′-3′) Sequencing (5′-3′) Ta
COMT rs4680 tcaccatcgagatcaacccc acaacgggtcaggcatgca tggtggatttcgctg 62º
HCRTR1 rs2271933 atccagagtcacacaggcagaaa tccttgcagagccgatgct tgctcagagattttgga 58º
HCRTR2 rs2653349 tgtggcggctgaaataaag tcatctggcctgacaaggtatcta gcccggatgttgatg 58º
38
Table 2b. PCR primers and extension primers used in Sequenom
Gene SNP Oligo Sequence Oligo Sequence2 Extension primer
COMT rs4680 acgttggatgttttccaggtctga
caacgg
acgttggatgacccagcggatg
gtggattt gtgtggatttcgctggc
HCRTR2 rs2653349 acgttggatgataaagcagatcc
gagcccag
acgttggatggatagcaaattgc
aaatacc
agcacattgcaaataccaaaag
cacaa
Statistical analysis
For statistical analysis logistic regression (Paper IV), chi-square analysis and Fisher’s exact
tests (Paper V), and linear regression (Paper VI) were used. Hardy-Weinberg equilibrium was
checked in all control samples by comparing the observed genotype frequencies with the
expected ones using chi-square analyses. Levels of significance were corrected for multiple
comparisons using Bonferroni corrections.
39
References
Abelson JL, Nesse RM (1994): Pentagastrin infusions in patients with panic disorder. I. Symptoms and cardiovascular responses. Biol Psychiatry 36:73-83.
Abelson JL, Nesse RM, Weg JG, Curtis GC (1996): Respiratory psychophysiology and anxiety: cognitive intervention in the doxapram model of panic. Psychosom Med 58:302-313.
Abelson JL, Weg JG, Nesse RM, Curtis GC (2001): Persistent respiratory irregularity in patients with panic disorder. Biol Psychiatry 49:588-595.
Abrams K, Rassovsky Y, Kushner MG (2006): Evidence for respiratory and nonrespiratory subtypes in panic disorder. Depress Anxiety 23:474-481.
Adamantidis A, de Lecea L (2008): Physiological arousal: a role for hypothalamic systems. Cell Mol Life Sci 65:1475-1488.
Adamson PB, Vanoli E (2001): Early autonomic and repolarization abnormalities contribute to lethal arrhythmias in chronic ischemic heart failure: characteristics of a novel heart failure model in dogs with postmyocardial infarction left ventricular dysfunction. J Am Coll Cardiol 37:1741-1748.
Aghajanian GK, Graham AW, Sheard MH (1970): Serotonin-containing neurons in brain: depression of firing by monoamine oxidase inhibitors. Science 169:1100-1102.
Andersch S, Rosenberg NK, Kullingsjo H, Ottosson JO, Bech P, Bruun-Hansen J, et al (1991): Efficacy and safety of alprazolam, imipramine and placebo in treating panic disorder. A Scandinavian multicenter study. Acta Psychiatr Scand Suppl 365:18-27.
Andersson G, Bergstrom J, Carlbring P, Lindefors N (2005): The use of the Internet in the treatment of anxiety disorders. Curr Opin Psychiatry 18:73-77.
Annerbrink K, Olsson M, Melchior LK, Hedner J, Eriksson E (2003): Serotonin depletion increases respiratory variability in freely moving rats: implications for panic disorder. Int J Neuropsychopharmacol 6:51-56.
Arborelius L, Nomikos GG, Hertel P, Salmi P, Grillner P, Hook BB, et al (1996): The 5-HT1A receptor antagonist (S)-UH-301 augments the increase in extracellular concentrations of 5-HT in the frontal cortex produced by both acute and chronic treatment with citalopram. Naunyn Schmiedebergs Arch Pharmacol 353:630-640.
Atlas SA (2007): The renin-angiotensin aldosterone system: pathophysiological role and pharmacologic inhibition. J Manag Care Pharm 13:9-20.
Bach KB, Lutcavage ME, Mitchell GS (1993): Serotonin is necessary for short-term modulation of the exercise ventilatory response. Respir Physiol 91:57-70.
Ballenger JC, Wheadon DE, Steiner M, Bushnell W, Gergel IP (1998): Double-blind, fixed-dose, placebo-controlled study of paroxetine in the treatment of panic disorder. Am J Psychiatry 155:36-42.
Bandelow B, Saleh K, Pauls J, Domschke K, Wedekind D, Falkai P (2007): Insertion/deletion polymorphism in the gene for angiotensin converting enzyme (ACE) in panic disorder: A gender-specific effect? World J Biol Psychiatry:1-5.
Barlow DH, Gorman JM, Shear MK, Woods SW (2000): Cognitive-behavioral therapy, imipramine, or their combination for panic disorder: A randomized controlled trial. JAMA 283:2529-2536.
Bass C, Lelliott P, Marks I (1989): Fear talk versus voluntary hyperventilation in agoraphobics and normals: a controlled study. Psychol Med 19:669-676.
Beck JG, Shipherd JC, Ohtake P (2000): Do panic symptom profiles influence response to a hypoxic challenge in patients with panic disorder? A preliminary report. Psychosom Med 62:678-683.
40
Bell CC, Hildreth CJ, Jenkins EJ, Carter C (1988): The relationship of isolated sleep paralysis and panic disorder to hypertension. J Natl Med Assoc 80:289-294.
Bertani A, Perna G, Arancio C, Caldirola D, Bellodi L (1997): Pharmacologic effect of imipramine, paroxetine, and sertraline on 35% carbon dioxide hypersensitivity in panic patients: a double-blind, random, placebo-controlled study. J Clin Psychopharmacol 17:97-101.
Berthoud HR, Patterson LM, Sutton GM, Morrison C, Zheng H (2005): Orexin inputs to caudal raphe neurons involved in thermal, cardiovascular, and gastrointestinal regulation. Histochem Cell Biol 123:147-156.
Biber B, Alkin T (1999): Panic disorder subtypes: differential responses to CO2 challenge. Am J Psychiatry 156:739-744.
Bigos KL, Pollock BG, Aizenstein HJ, Fisher PM, Bies RR, Hariri AR (2008): Acute 5-HT Reuptake Blockade Potentiates Human Amygdala Reactivity. Neuropsychopharmacology.
Bilder RM, Volavka J, Czobor P, Malhotra AK, Kennedy JL, Ni X, et al (2002): Neurocognitive correlates of the COMT Val(158)Met polymorphism in chronic schizophrenia. Biol Psychiatry 52:701-707.
Bilder RM, Volavka J, Lachman HM, Grace AA (2004): The catechol-O-methyltransferase polymorphism: relations to the tonic-phasic dopamine hypothesis and neuropsychiatric phenotypes. Neuropsychopharmacology 29:1943-1961.
Blaya C, Salum GA, Lima MS, Leistner-Segal S, Manfro GG (2007): Lack of association between the Serotonin Transporter Promoter Polymorphism (5-HTTLPR) and Panic Disorder: a systematic review and meta-analysis. Behav Brain Funct 3:41.
Blier P, de Montigny C (1985): Serotoninergic but not noradrenergic neurons in rat central nervous system adapt to long-term treatment with monoamine oxidase inhibitors. Neuroscience 16:949-955.
Blier P, de Montigny C (1990): Electrophysiological investigation of the adaptive response of the 5-HT system to the administration of 5-HT1A receptor agonists. J Cardiovasc Pharmacol 15 Suppl 7:S42-48.
Bocola V, Trecco MD, Fabbrini G, Paladini C, Sollecito A, Martucci N (1998): Antipanic effect of fluoxetine measured by CO2 challenge test. Biol Psychiatry 43:612-615.
Bystritsky A, Craske M, Maidenberg E, Vapnik T, Shapiro D (2000): Autonomic reactivity of panic patients during a CO2 inhalation procedure. Depress Anxiety 11:15-26.
Bystritsky A, Shapiro D (1992): Continuous physiological changes and subjective reports in panic patients: a preliminary methodological report. Biol Psychiatry 32:766-777.
Carr RE (1998): Panic disorder and asthma: causes, effects and research implications. J Psychosom Res 44:43-52.
Carr RE, Lehrer PM, Rausch LL, Hochron SM (1994): Anxiety sensitivity and panic attacks in an asthmatic population. Behav Res Ther 32:411-418.
Channick BJ, Adlin EV, Marks AD, Denenberg BS, McDonough MT, Chakko CS, et al (1981): Hyperthyroidism and mitral-valve prolapse. N Engl J Med 305:497-500.
Charney DS, Woods SW, Goodman WK, Heninger GR (1987): Serotonin function in anxiety. II. Effects of the serotonin agonist MCPP in panic disorder patients and healthy subjects. Psychopharmacology (Berl) 92:14-24.
Chen J, Lipska BK, Halim N, Ma QD, Matsumoto M, Melhem S, et al (2004): Functional analysis of genetic variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain. Am J Hum Genet 75:807-821.
Coates EL, Li A, Nattie EE (1993): Widespread sites of brain stem ventilatory chemoreceptors. J Appl Physiol 75:5-14.
41
Coplan JD, Gorman JM, Klein DF (1992): Serotonin related functions in panic-anxiety: a critical overview. Neuropsychopharmacology 6:189-200.
Creveling CR (2003): The role of catechol-O-methyltransferase in the inactivation of catecholestrogen. Cell Mol Neurobiol 23:289-291.
Crowe RR, Noyes R, Pauls DL, Slymen D (1983): A family study of panic disorder. Arch Gen Psychiatry 40:1065-1069.
Davidson JR (1998): The long-term treatment of panic disorder. J Clin Psychiatry 59 Suppl 8:17-21; discussion 22-13.
Davies SJ, Ghahramani P, Jackson PR, Noble TW, Hardy PG, Hippisley-Cox J, et al (1999): Association of panic disorder and panic attacks with hypertension. Am J Med 107:310-316.
de Beurs E, van Balkom AJ, Lange A, Koele P, van Dyck R (1995): Treatment of panic disorder with agoraphobia: comparison of fluvoxamine, placebo, and psychological panic management combined with exposure and of exposure in vivo alone. Am J Psychiatry 152:683-691.
de Bruyne MC, Kors JA, Hoes AW, Klootwijk P, Dekker JM, Hofman A, et al (1999): Both decreased and increased heart rate variability on the standard 10-second electrocardiogram predict cardiac mortality in the elderly: the Rotterdam Study. Am J Epidemiol 150:1282-1288.
de Frias CM, Annerbrink K, Westberg L, Eriksson E, Adolfsson R, Nilsson LG (2005): Catechol O-methyltransferase Val158Met polymorphism is associated with cognitive performance in nondemented adults. J Cogn Neurosci 17:1018-1025.
de Frias CM, arklund P, Eriksson E, Larsson A, Öman L, Annerbrink K, et al (2008): Influence of COMT gene polymorphism on fMRI-assessed sustained and transient
activity during a working memory task. Manuscript. de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, et al (1998): The
hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A 95:322-327.
Deckert J, Nothen MM, Franke P, Delmo C, Fritze J, Knapp M, et al (1998): Systematic mutation screening and association study of the A1 and A2a adenosine receptor genes in panic disorder suggest a contribution of the A2a gene to the development of disease. Mol Psychiatry 3:81-85.
Dekker JM, Crow RS, Folsom AR, Hannan PJ, Liao D, Swenne CA, et al (2000): Low heart rate variability in a 2-minute rhythm strip predicts risk of coronary heart disease and mortality from several causes: the ARIC Study. Atherosclerosis Risk In Communities. Circulation 102:1239-1244.
Den Boer JA, Westenberg HG (1988): Effect of a serotonin and noradrenaline uptake inhibitor in panic disorder; a double-blind comparative study with fluvoxamine and maprotiline. Int Clin Psychopharmacol 3:59-74.
Diamond A, Briand L, Fossella J, Gehlbach L (2004): Genetic and neurochemical modulation of prefrontal cognitive functions in children. Am J Psychiatry 161:125-132.
Domschke K, Deckert J, O'Donovan M C, Glatt SJ (2007): Meta-analysis of COMT val158met in panic disorder: ethnic heterogeneity and gender specificity. Am J Med Genet B Neuropsychiatr Genet 144B:667-673.
Domschke K, Freitag CM, Kuhlenbaumer G, Schirmacher A, Sand P, Nyhuis P, et al (2004): Association of the functional V158M catechol-O-methyl-transferase polymorphism with panic disorder in women. Int J Neuropsychopharmacol 7:183-188.
Domschke K, Ohrmann P, Braun M, Suslow T, Bauer J, Hohoff C, et al (2008): Influence of the catechol-O-methyltransferase val158met genotype on amygdala and prefrontal cortex emotional processing in panic disorder. Psychiatry Res 163:13-20.
42
Drabant EM, Hariri AR, Meyer-Lindenberg A, Munoz KE, Mattay VS, Kolachana BS, et al (2006): Catechol O-methyltransferase val158met genotype and neural mechanisms related to affective arousal and regulation. Arch Gen Psychiatry 63:1396-1406.
Eaton WW, Kessler RC, Wittchen HU, Magee WJ (1994): Panic and panic disorder in the United States. Am J Psychiatry 151:413-420.
Eden S, Bolle P, Modigh K (1979): Monoaminergic control of episodic growth hormone secretion in the rat: effects of reserpine, alpha-methyl-p-tyrosine, p-chlorophenylalanine, and haloperidol. Endocrinology 105:523-529.
Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM, Straub RE, et al (2001): Effect of COMT Val108/158 Met genotype on frontal lobe function and risk for schizophrenia. Proc Natl Acad Sci U S A 98:6917-6922.
Elam M, Yao T, Svensson TH, Thoren P (1984): Regulation of locus coeruleus neurons and splanchnic, sympathetic nerves by cardiovascular afferents. Brain Res 290:281-287.
Elam M, Yao T, Thoren P, Svensson TH (1981): Hypercapnia and hypoxia: chemoreceptor-mediated control of locus coeruleus neurons and splanchnic, sympathetic nerves. Brain Res 222:373-381.
Elias CF, Saper CB, Maratos-Flier E, Tritos NA, Lee C, Kelly J, et al (1998): Chemically defined projections linking the mediobasal hypothalamus and the lateral hypothalamic area. J Comp Neurol 402:442-459.
Enoch MA, Xu K, Ferro E, Harris CR, Goldman D (2003): Genetic origins of anxiety in women: a role for a functional catechol-O-methyltransferase polymorphism. Psychiatr Genet 13:33-41.
Erhardt A, Lucae S, Kern N, Unschuld PG, Ising M, Lieb R, et al (2008): Association of polymorphisms in the angiotensin-converting enzyme gene with syndromal panic attacks. Mol Psychiatry 13:242-243.
Eriksson E, Engberg G, Bing O, Nissbrandt H (1999): Effects of mCPP on the extracellular concentrations of serotonin and dopamine in rat brain. Neuropsychopharmacology 20:287-296.
Esler MD (1993): Catecholamines and essential hypertension. Baillieres Clin Endocrinol Metab 7:415-438.
Faravelli C, Abrardi L, Bartolozzi D, Cecchi C, Cosci F, D'Adamo D, et al (2004): The Sesto Fiorentino study: point and one-year prevalences of psychiatric disorders in an Italian community sample using clinical interviewers. Psychother Psychosom 73:226-234.
Feldman JL, Mitchell GS, Nattie EE (2003): Breathing: rhythmicity, plasticity, chemosensitivity. Annu Rev Neurosci 26:239-266.
Filho AS, Maciel BC, Martin-Santos R, Romano MM, Crippa JA (2008): Does the association between mitral valve prolapse and panic disorder really exist? Prim Care Companion J Clin Psychiatry 10:38-47.
Fornal CA, Metzler CW, Gallegos RA, Veasey SC, McCreary AC, Jacobs BL (1996): WAY-100635, a potent and selective 5-hydroxytryptamine1A antagonist, increases serotonergic neuronal activity in behaving cats: comparison with (S)-WAY-100135. J Pharmacol Exp Ther 278:752-762.
Forster EA, Cliffe IA, Bill DJ, Dover GM, Jones D, Reilly Y, et al (1995): A pharmacological profile of the selective silent 5-HT1A receptor antagonist, WAY-100635. Eur J Pharmacol 281:81-88.
Freire RC, Lopes FL, Valenca AM, Nascimento I, Veras AB, Mezzasalma MA, et al (2008): Panic disorder respiratory subtype: a comparison between responses to hyperventilation and CO2 challenge tests. Psychiatry Res 157:307-310.
43
Fukunaka Y, Shinkai T, Hwang R, Hori H, Utsunomiya K, Sakata S, et al (2007): The orexin 1 receptor (HCRTR1) gene as a susceptibility gene contributing to polydipsia-hyponatremia in schizophrenia. Neuromolecular Med 9:292-297.
Fung SJ, Yamuy J, Sampogna S, Morales FR, Chase MH (2001): Hypocretin (orexin) input to trigeminal and hypoglossal motoneurons in the cat: a double-labeling immunohistochemical study. Brain Res 903:257-262.
Garakani A, Martinez JM, Aaronson CJ, Voustianiouk A, Kaufmann H, Gorman JM (2008): Effect of medication and psychotherapy on heart rate variability in panic disorder. Depress Anxiety.
Garattini S, Mennini T, Samanin R (1987): From fenfluramine racemate to d-fenfluramine. Specificity and potency of the effects on the serotoninergic system and food intake. Ann N Y Acad Sci 499:156-166.
Garssen B, Buikhuisen M, van Dyck R (1996): Hyperventilation and panic attacks. Am J Psychiatry 153:513-518.
Geraci M, Anderson TS, Slate-Cothren S, Post RM, McCann UD (2002): Pentagastrin-induced sleep panic attacks: panic in the absence of elevated baseline arousal. Biol Psychiatry 52:1183-1189.
Gillette PC, Smith RT, Garson A, Jr., Mullins CE, Gutgesell HP, Goh TH, et al (1985): Chronic supraventricular tachycardia. A curable cause of congestive cardiomyopathy. JAMA 253:391-392.
Goddard AW, Sholomskas DE, Walton KE, Augeri FM, Charney DS, Heninger GR, et al (1994): Effects of tryptophan depletion in panic disorder. Biol Psychiatry 36:775-777.
Goldberg C (2001): Cognitive processes in panic disorder: an extension of current models. Psychol Rep 88:139-159.
Goldberg TE, Egan MF, Gscheidle T, Coppola R, Weickert T, Kolachana BS, et al (2003): Executive subprocesses in working memory: relationship to catechol-O-methyltransferase Val158Met genotype and schizophrenia. Arch Gen Psychiatry 60:889-896.
Goldstein RB, Weissman MM, Adams PB, Horwath E, Lish JD, Charney D, et al (1994): Psychiatric disorders in relatives of probands with panic disorder and/or major depression. Arch Gen Psychiatry 51:383-394.
Gorman JM, Askanazi J, Liebowitz MR, Fyer AJ, Stein J, Kinney JM, et al (1984): Response to hyperventilation in a group of patients with panic disorder. Am J Psychiatry 141:857-861.
Gorman JM, Browne ST, Papp LA, Martinez J, Welkowitz L, Coplan JD, et al (1997): Effect of antipanic treatment on response to carbon dioxide. Biol Psychiatry 42:982-991.
Gorman JM, Fyer MR, Goetz R, Askanazi J, Liebowitz MR, Fyer AJ, et al (1988a): Ventilatory physiology of patients with panic disorder. Arch Gen Psychiatry 45:31-39.
Gorman JM, Goetz RR, Fyer M, King DL, Fyer AJ, Liebowitz MR, et al (1988b): The mitral valve prolapse--panic disorder connection. Psychosom Med 50:114-122.
Gorman JM, Kent J, Martinez J, Browne S, Coplan J, Papp LA (2001): Physiological changes during carbon dioxide inhalation in patients with panic disorder, major depression, and premenstrual dysphoric disorder: evidence for a central fear mechanism. Arch Gen Psychiatry 58:125-131.
Gorman JM, Kent JM, Sullivan GM, Coplan JD (2000): Neuroanatomical hypothesis of panic disorder, revised. Am J Psychiatry 157:493-505.
Grant BF, Hasin DS, Stinson FS, Dawson DA, Goldstein RB, Smith S, et al (2006): The epidemiology of DSM-IV panic disorder and agoraphobia in the United States: results from the National Epidemiologic Survey on Alcohol and Related Conditions. J Clin Psychiatry 67:363-374.
44
Guyenet PG, Stornetta RL, Bayliss DA (2008): Retrotrapezoid nucleus and central chemoreception. J Physiol 586:2043-2048.
Hagen K, Pettersen E, Stovner LJ, Skorpen F, Holmen J, Zwart JA (2007): High systolic blood pressure is associated with Val/Val genotype in the catechol-o-methyltransferase gene. The Nord-Trondelag Health Study (HUNT). Am J Hypertens 20:21-26.
Halford JC, Cooper GD, Dovey TM (2004): The pharmacology of human appetite expression. Curr Drug Targets 5:221-240.
Hamilton SP, Slager SL, De Leon AB, Heiman GA, Klein DF, Hodge SE, et al (2004): Evidence for genetic linkage between a polymorphism in the adenosine 2A receptor and panic disorder. Neuropsychopharmacology 29:558-565.
Hamilton SP, Slager SL, Heiman GA, Deng Z, Haghighi F, Klein DF, et al (2002): Evidence for a susceptibility locus for panic disorder near the catechol-O-methyltransferase gene on chromosome 22. Biol Psychiatry 51:591-601.
Harmer CJ, Mackay CE, Reid CB, Cowen PJ, Goodwin GM (2006): Antidepressant drug treatment modifies the neural processing of nonconscious threat cues. Biol Psychiatry 59:816-820.
Hegel MT, Ferguson RJ (1997): Psychophysiological assessment of respiratory function in panic disorder: evidence for a hyperventilation subtype. Psychosom Med 59:224-230.
Hettema JM, An SS, Bukszar J, van den Oord EJ, Neale MC, Kendler KS, et al (2008): Catechol-O-methyltransferase contributes to genetic susceptibility shared among anxiety spectrum phenotypes. Biol Psychiatry 64:302-310.
Hettema JM, Neale MC, Kendler KS (2001): A review and meta-analysis of the genetic epidemiology of anxiety disorders. Am J Psychiatry 158:1568-1578.
Hjorth S (1993): Serotonin 5-HT1A autoreceptor blockade potentiates the ability of the 5-HT reuptake inhibitor citalopram to increase nerve terminal output of 5-HT in vivo: a microdialysis study. J Neurochem 60:776-779.
Hofmann SG, Smits JA (2008): Cognitive-behavioral therapy for adult anxiety disorders: a meta-analysis of randomized placebo-controlled trials. J Clin Psychiatry 69:621-632.
Hollander E, Liebowitz MR, DeCaria C, Klein DF (1990): Fenfluramine, cortisol, and anxiety. Psychiatry Res 31:211-213.
Holtman JR, Jr., Dick TE, Berger AJ (1987): Serotonin-mediated excitation of recurrent laryngeal and phrenic motoneurons evoked by stimulation of the raphe obscurus. Brain Res 417:12-20.
Hood SD, Hince DA, Robinson H, Cirillo M, Christmas D, Kaye JM (2006): Serotonin regulation of the human stress response. Psychoneuroendocrinology 31:1087-1097.
Invernizzi R, Bramante M, Samanin R (1996): Role of 5-HT1A receptors in the effects of acute chronic fluoxetine on extracellular serotonin in the frontal cortex. Pharmacol Biochem Behav 54:143-147.
Jacob RG, Furman JM, Durrant JD, Turner SM (1996): Panic, agoraphobia, and vestibular dysfunction. Am J Psychiatry 153:503-512.
Jacobi F, Wittchen HU, Holting C, Hofler M, Pfister H, Muller N, et al (2004): Prevalence, co-morbidity and correlates of mental disorders in the general population: results from the German Health Interview and Examination Survey (GHS). Psychol Med 34:597-611.
Jennings DB (1994): The physicochemistry of [H+] and respiratory control: roles of PCO2, strong ions, and their hormonal regulators. Can J Physiol Pharmacol 72:1499-1512.
Joober R, Gauthier J, Lal S, Bloom D, Lalonde P, Rouleau G, et al (2002): Catechol-O-methyltransferase Val-108/158-Met gene variants associated with performance on the Wisconsin Card Sorting Test. Arch Gen Psychiatry 59:662-663.
45
Jungling K, Seidenbecher T, Sosulina L, Lesting J, Sangha S, Clark SD, et al (2008): Neuropeptide S-mediated control of fear expression and extinction: role of intercalated GABAergic neurons in the amygdala. Neuron 59:298-310.
Kahn JP, Drusin RE, Klein DF (1987a): Idiopathic cardiomyopathy and panic disorder: clinical association in cardiac transplant candidates. Am J Psychiatry 144:1327-1330.
Kahn RS, Westenberg HG, Verhoeven WM, Gispen-de Wied CC, Kamerbeek WD (1987b): Effect of a serotonin precursor and uptake inhibitor in anxiety disorders; a double-blind comparison of 5-hydroxytryptophan, clomipramine and placebo. Int Clin Psychopharmacol 2:33-45.
Kamide K, Kokubo Y, Yang J, Matayoshi T, Inamoto N, Takiuchi S, et al (2007): Association of genetic polymorphisms of ACADSB and COMT with human hypertension. J Hypertens 25:103-110.
Kandel ER (1983): From metapsychology to molecular biology: explorations into the nature of anxiety. Am J Psychiatry 140:1277-1293.
Kaplan DS, Masand PS, Gupta S (1996): The relationship of irritable bowel syndrome (IBS) and panic disorder. Ann Clin Psychiatry 8:81-88.
Kasamo K, Suzuki T, Tada K, Ueda N, Matsuda E, Ishikawa K, et al (2001): Endogenous 5-HT tonically inhibits spontaneous firing activity of dorsal hippocampus CA1 pyramidal neurons through stimulation of 5-HT(1A) receptors in quiet awake rats: in vivo electrophysiological evidence. Neuropsychopharmacology 24:141-151.
Katon W (1984): Panic disorder and somatization. Review of 55 cases. Am J Med 77:101-106. Katon W, Roy-Byrne PP (1989): Panic disorder in the medically ill. J Clin Psychiatry 50:299-
302. Katschnig H, Amering M (1998): The long-term course of panic disorder and its predictors. J
Clin Psychopharmacol 18:6S-11S. Kawachi I, Sparrow D, Vokonas PS, Weiss ST (1995): Decreased heart rate variability in men
with phobic anxiety (data from the Normative Aging Study). Am J Cardiol 75:882-885.
Kayaba Y, Nakamura A, Kasuya Y, Ohuchi T, Yanagisawa M, Komuro I, et al (2003): Attenuated defense response and low basal blood pressure in orexin knockout mice. Am J Physiol Regul Integr Comp Physiol 285:R581-593.
Kent JM, Coplan JD, Martinez J, Karmally W, Papp LA, Gorman JM (1996): Ventilatory effects of tryptophan depletion in panic disorder: a preliminary report. Psychiatry Res 64:83-90.
Kent JM, Papp LA, Martinez JM, Browne ST, Coplan JD, Klein DF, et al (2001): Specificity of panic response to CO(2) inhalation in panic disorder: a comparison with major depression and premenstrual dysphoric disorder. Am J Psychiatry 158:58-67.
Kessler RC, Greenberg PE, Mickelson KD, Meneades LM, Wang PS (2001): The effects of chronic medical conditions on work loss and work cutback. J Occup Environ Med 43:218-225.
Kessler RC, McGonagle KA, Zhao S, Nelson CB, Hughes M, Eshleman S, et al (1994): Lifetime and 12-month prevalence of DSM-III-R psychiatric disorders in the United States. Results from the National Comorbidity Survey. Arch Gen Psychiatry 51:8-19.
Kiropoulos LA, Klein B, Austin DW, Gilson K, Pier C, Mitchell J, et al (2008): Is internet-based CBT for panic disorder and agoraphobia as effective as face-to-face CBT? J Anxiety Disord.
Klein DF (1993): False suffocation alarms, spontaneous panics, and related conditions. An integrative hypothesis. Arch Gen Psychiatry 50:306-317.
Klein E, Cnaani E, Harel T, Braun S, Ben-Haim SA (1995): Altered heart rate variability in panic disorder patients. Biol Psychiatry 37:18-24.
46
Knott V, Bakish D, Lusk S, Barkely J (1997): Relaxation-induced EEG alterations in panic disorder patients. J Anxiety Disord 11:365-376.
Kuwaki T (2008): Orexinergic modulation of breathing across vigilance states. Respir Physiol Neurobiol.
Lachman HM, Papolos DF, Saito T, Yu YM, Szumlanski CL, Weinshilboum RM (1996): Human catechol-O-methyltransferase pharmacogenetics: description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics 6:243-250.
Laferrere B, Wurtman RJ (1989): Effect of D-fenfluramine on serotonin release in brains of anaesthetized rats. Brain Res 504:258-263.
Lalley PM (1986): Serotoninergic and non-serotoninergic responses of phrenic motoneurones to raphe stimulation in the cat. J Physiol 380:373-385.
Lee YJ, Curtis GC, Weg JG, Abelson JL, Modell JG, Campbell KM (1993): Panic attacks induced by doxapram. Biol Psychiatry 33:295-297.
Lewandowski KE (2007): Relationship of catechol-O-methyltransferase to schizophrenia and its correlates: evidence for associations and complex interactions. Harv Rev Psychiatry 15:233-244.
Ley R (1985): Agoraphobia, the panic attack and the hyperventilation syndrome. Behav Res Ther 23:79-81.
Liebowitz MR, Fyer AJ, Gorman JM, Dillon D, Appleby IL, Levy G, et al (1984): Lactate provocation of panic attacks. I. Clinical and behavioral findings. Arch Gen Psychiatry 41:764-770.
Loeschcke HH (1973): Respiratory chemosensitivity in the medulla oblongata. Acta Neurobiol Exp (Wars) 33:97-112.
Lotta T, Vidgren J, Tilgmann C, Ulmanen I, Melen K, Julkunen I, et al (1995): Kinetics of human soluble and membrane-bound catechol O-methyltransferase: a revised mechanism and description of the thermolabile variant of the enzyme. Biochemistry 34:4202-4210.
Louet JF, LeMay C, Mauvais-Jarvis F (2004): Antidiabetic actions of estrogen: insight from human and genetic mouse models. Curr Atheroscler Rep 6:180-185.
Maddock RJ, Buonocore MH, Copeland LE, Richards AL (2008): Elevated brain lactate responses to neural activation in panic disorder: a dynamic 1H-MRS study. Mol Psychiatry.
Maddock RJ, Carter CS (1991): Hyperventilation-induced panic attacks in panic disorder with agoraphobia. Biol Psychiatry 29:843-854.
Maier W, Lichtermann D, Minges J, Oehrlein A, Franke P (1993): A controlled family study in panic disorder. J Psychiatr Res 27 Suppl 1:79-87.
Malhotra AK, Kestler LJ, Mazzanti C, Bates JA, Goldberg T, Goldman D (2002): A functional polymorphism in the COMT gene and performance on a test of prefrontal cognition. Am J Psychiatry 159:652-654.
Manzke T, Guenther U, Ponimaskin EG, Haller M, Dutschmann M, Schwarzacher S, et al (2003): 5-HT4(a) receptors avert opioid-induced breathing depression without loss of analgesia. Science 301:226-229.
Marazziti D, Toni C, Pedri S, Bonuccelli U, Pavese N, Lucetti C, et al (1999): Prevalence of headache syndromes in panic disorder. Int Clin Psychopharmacol 14:247-251.
Markowitz JS, Weissman MM, Ouellette R, Lish JD, Klerman GL (1989): Quality of life in panic disorder. Arch Gen Psychiatry 46:984-992.
Maron E, Kuikka JT, Shlik J, Vasar V, Vanninen E, Tiihonen J (2004): Reduced brain serotonin transporter binding in patients with panic disorder. Psychiatry Res 132:173-181.
47
Martin-Body RL, Grundy HR (1985): Effects of neurotoxin-induced brainstem lesions on the respiratory responses of conscious rats. Clin Exp Pharmacol Physiol 12:427-437.
Martinez JM, Kent JM, Coplan JD, Browne ST, Papp LA, Sullivan GM, et al (2001): Respiratory variability in panic disorder. Depress Anxiety 14:232-237.
Massion AO, Warshaw MG, Keller MB (1993): Quality of life and psychiatric morbidity in panic disorder and generalized anxiety disorder. Am J Psychiatry 150:600-607.
Mattay VS, Goldberg TE, Fera F, Hariri AR, Tessitore A, Egan MF, et al (2003): Catechol O-methyltransferase val158-met genotype and individual variation in the brain response to amphetamine. Proc Natl Acad Sci U S A 100:6186-6191.
McCann UD, Slate SO, Geraci M, Roscow-Terrill D, Uhde TW (1997): A comparison of the effects of intravenous pentagastrin on patients with social phobia, panic disorder and healthy controls. Neuropsychopharmacology 16:229-237.
McCrimmon DR, Mitchell, G.S., Dekin, M.S. (1995): Glutamate, GABA, and serotonin in ventilatory control. In: Dempsey JA editor. Regulation of Breathing, Second edition ed. New York: Dekker, pp 151-217.
Meerabux J, Iwayama Y, Sakurai T, Ohba H, Toyota T, Yamada K, et al (2005): Association of an orexin 1 receptor 408Val variant with polydipsia-hyponatremia in schizophrenic subjects. Biol Psychiatry 58:401-407.
Merikangas KR, Angst J, Eaton W, Canino G, Rubio-Stipec M, Wacker H, et al (1996): Comorbidity and boundaries of affective disorders with anxiety disorders and substance misuse: results of an international task force. Br J Psychiatry Suppl:58-67.
Meuret AE, White KS, Ritz T, Roth WT, Hofmann SG, Brown TA (2006): Panic attack symptom dimensions and their relationship to illness characteristics in panic disorder. J Psychiatr Res 40:520-527.
Meuret AE, Wilhelm FH, Roth WT (2004): Respiratory feedback for treating panic disorder. J Clin Psychol 60:197-207.
Michelson D, Lydiard RB, Pollack MH, Tamura RN, Hoog SL, Tepner R, et al (1998): Outcome assessment and clinical improvement in panic disorder: evidence from a randomized controlled trial of fluoxetine and placebo. The Fluoxetine Panic Disorder Study Group. Am J Psychiatry 155:1570-1577.
Miller HE, Deakin JF, Anderson IM (2000): Effect of acute tryptophan depletion on CO2-induced anxiety in patients with panic disorder and normal volunteers. Br J Psychiatry 176:182-188.
Millhorn DE, Eldridge FL, Waldrop TG (1980): Prolonged stimulation of respiration by endogenous central serotonin. Respir Physiol 42:171-188.
Millhorn DE, Eldridge FL, Waldrop TG, Klingler LE (1983): Centrally and peripherally administered 5-HTP have opposite effects on respiration. Brain Res 264:349-354.
Mitchell GS, Smith CA, Vidruk EH, Jameson LC, Dempsey JA (1983): Effects of p-chlorophenylalanine on ventilatory control in goats. J Appl Physiol 54:277-283.
Mitchell RA (1969): Respiratory chemosensitivity in the medulla oblongata. J Physiol 202:3P-4P.
Mitte K (2005): A meta-analysis of the efficacy of psycho- and pharmacotherapy in panic disorder with and without agoraphobia. J Affect Disord 88:27-45.
Mlinar B, Tatini F, Ballini C, Nencioni S, Della Corte L, Corradetti R (2005): Differential autoinhibition of 5-hydroxytryptamine neurons by 5-hydroxytryptamine in the dorsal raphe nucleus. Neuroreport 16:1351-1355.
Modigh K (1987): Antidepressant drugs in anxiety disorders. Acta Psychiatr Scand Suppl 335:57-74.
48
Modigh K, Westberg P, Eriksson E (1992): Superiority of clomipramine over imipramine in the treatment of panic disorder: a placebo-controlled trial. J Clin Psychopharmacol 12:251-261.
Mortimore C, Anderson IM (2000): d-Fenfluramine in panic disorder: a dual role for 5-hydroxytryptamine. Psychopharmacology (Berl) 149:251-258.
Moynihan JE, Gevirtz RN (2001): Respiratory and cognitive subtypes of panic. Preliminary validation of Ley's model. Behav Modif 25:555-583.
Mueller RA, Lundberg D, Breese G (1980): Effects of different monoamine oxidase inhibitors on respiratory activity in rats with chronically impaired central serotonergic function. Acta Pharmacol Toxicol (Copenh) 47:285-293.
Mulkey DK, Stornetta RL, Weston MC, Simmons JR, Parker A, Bayliss DA, et al (2004): Respiratory control by ventral surface chemoreceptor neurons in rats. Nat Neurosci 7:1360-1369.
Muller M, van der Schouw YT, Thijssen JH, Grobbee DE (2003): Endogenous sex hormones and cardiovascular disease in men. J Clin Endocrinol Metab 88:5076-5086.
Murakoshi T, Suzue T, Tamai S (1985): A pharmacological study on respiratory rhythm in the isolated brainstem-spinal cord preparation of the newborn rat. Br J Pharmacol 86:95-104.
Nambu T, Sakurai T, Mizukami K, Hosoya Y, Yanagisawa M, Goto K (1999): Distribution of orexin neurons in the adult rat brain. Brain Res 827:243-260.
Nardi AE, Freire RC, Zin WA (2008): Panic disorder and control of breathing. Respir Physiol Neurobiol.
Nardi AE, Valenca AM, Lopes FL, de-Melo-Neto VL, Freire RC, Veras AB, et al (2007): Caffeine and 35% carbon dioxide challenge tests in panic disorder. Hum Psychopharmacol 22:231-240.
Nardi AE, Valenca AM, Lopes FL, Nascimento I, Veras AB, Freire RC, et al (2006): Psychopathological profile of 35% CO2 challenge test-induced panic attacks: a comparison with spontaneous panic attacks. Compr Psychiatry 47:209-214.
Nash JR, Sargent PA, Rabiner EA, Hood SD, Argyropoulos SV, Potokar JP, et al (2008): Serotonin 5-HT1A receptor binding in people with panic disorder: positron emission tomography study. Br J Psychiatry 193:229-234.
Neumeister A, Bain E, Nugent AC, Carson RE, Bonne O, Luckenbaugh DA, et al (2004): Reduced serotonin type 1A receptor binding in panic disorder. J Neurosci 24:589-591.
Nordfors L, Jansson M, Sandberg G, Lavebratt C, Sengul S, Schalling M, et al (2002): Large-scale genotyping of single nucleotide polymorphisms by Pyrosequencingtrade mark and validation against the 5'nuclease (Taqman((R))) assay. Hum Mutat 19:395-401.
Nutt DJ, Glue P (1989): Clinical pharmacology of anxiolytics and antidepressants: a psychopharmacological perspective. Pharmacol Ther 44:309-334.
Okamura N, Hashimoto K, Iyo M, Shimizu E, Dempfle A, Friedel S, et al (2007): Gender-specific association of a functional coding polymorphism in the Neuropeptide S receptor gene with panic disorder but not with schizophrenia or attention-deficit/hyperactivity disorder. Prog Neuropsychopharmacol Biol Psychiatry 31:1444-1448.
Olson EB, Jr. (1987): Ventilatory adaptation to hypoxia occurs in serotonin-depleted rats. Respir Physiol 69:227-235.
Olsson CA, Anney RJ, Lotfi-Miri M, Byrnes GB, Williamson R, Patton GC (2005): Association between the COMT Val158Met polymorphism and propensity to anxiety in an Australian population-based longitudinal study of adolescent health. Psychiatr Genet 15:109-115.
49
Olsson M, Annerbrink K, Bengtsson F, Hedner J, Eriksson E (2004a): Paroxetine influences respiration in rats: implications for the treatment of panic disorder. Eur Neuropsychopharmacol 14:29-37.
Olsson M, Annerbrink K, Hedner J, Eriksson E (2004b): Intracerebroventricular administration of the angiotensin II receptor antagonist saralasin reduces respiratory rate and tidal volume variability in freely moving Wistar rats. Psychoneuroendocrinology 29:107-112.
Olsson M, Annerbrink K, Westberg L, Melke J, Baghaei F, Rosmond R, et al (2004c): Angiotensin-related genes in patients with panic disorder. Am J Med Genet B Neuropsychiatr Genet 127B:81-84.
Onur E, Alkin T, Tural U (2007): Panic disorder subtypes: further clinical differences. Depress Anxiety 24:479-486.
Papp LA, Klein DF, Gorman JM (1993a): Carbon dioxide hypersensitivity, hyperventilation, and panic disorder. Am J Psychiatry 150:1149-1157.
Papp LA, Klein DF, Martinez J, Schneier F, Cole R, Liebowitz MR, et al (1993b): Diagnostic and substance specificity of carbon-dioxide-induced panic. Am J Psychiatry 150:250-257.
Papp LA, Martinez JM, Klein DF, Coplan JD, Norman RG, Cole R, et al (1997): Respiratory psychophysiology of panic disorder: three respiratory challenges in 98 subjects. Am J Psychiatry 154:1557-1565.
Perna G, Battaglia M, Garberi A, Arancio C, Bertani A, Bellodi L (1994): Carbon dioxide/oxygen challenge test in panic disorder. Psychiatry Res 52:159-171.
Perna G, Bertani A, Caldirola D, Smeraldi E, Bellodi L (2001): A comparison of citalopram and paroxetine in the treatment of panic disorder: a randomized, single-blind study. Pharmacopsychiatry 34:85-90.
Perna G, Bertani A, Gabriele A, Politi E, Bellodi L (1997): Modification of 35% carbon dioxide hypersensitivity across one week of treatment with clomipramine and fluvoxamine: a double-blind, randomized, placebo-controlled study. J Clin Psychopharmacol 17:173-178.
Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG, et al (1998): Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18:9996-10015.
Pillay SS, Gruber SA, Rogowska J, Simpson N, Yurgelun-Todd DA (2006): fMRI of fearful facial affect recognition in panic disorder: the cingulate gyrus-amygdala connection. J Affect Disord 94:173-181.
Pine DS, Weese-Mayer DE, Silvestri JM, Davies M, Whitaker AH, Klein DF (1994): Anxiety and congenital central hypoventilation syndrome. Am J Psychiatry 151:864-870.
Pitts FN, Jr., McClure JN, Jr. (1967): Lactate metabolism in anxiety neurosis. N Engl J Med 277:1329-1336.
Pohl R, Yeragani VK, Balon R, Lycaki H (1988): The jitteriness syndrome in panic disorder patients treated with antidepressants. J Clin Psychiatry 49:100-104.
Pohl RB, Wolkow RM, Clary CM (1998): Sertraline in the treatment of panic disorder: a double-blind multicenter trial. Am J Psychiatry 155:1189-1195.
Pollack MH, Kradin R, Otto MW, Worthington J, Gould R, Sabatino SA, et al (1996): Prevalence of panic in patients referred for pulmonary function testing at a major medical center. Am J Psychiatry 153:110-113.
Pols HJ, Hauzer RC, Meijer JA, Verburg K, Griez EJ (1996): Fluvoxamine attenuates panic induced by 35% CO2 challenge. J Clin Psychiatry 57:539-542.
Porzelius J, Vest M, Nochomovitz M (1992): Respiratory function, cognitions, and panic in chronic obstructive pulmonary patients. Behav Res Ther 30:75-77.
50
Rainero I, Rubino E, Valfre W, Gallone S, De Martino P, Zampella E, et al (2007): Association between the G1246A polymorphism of the hypocretin receptor 2 gene and cluster headache: a meta-analysis. J Headache Pain 8:152-156.
Rainey JM, Jr., Frohman CE, Warner K, Bates S, Pohl RB, Yeragani V (1985): Panic anxiety and lactate metabolism. Psychopharmacol Bull 21:434-437.
Rapee R (1986): Differential response to hyperventilation in panic disorder and generalized anxiety disorder. J Abnorm Psychol 95:24-28.
Rapee RM, Brown TA, Antony MM, Barlow DH (1992): Response to hyperventilation and inhalation of 5.5% carbon dioxide-enriched air across the DSM-III-R anxiety disorders. J Abnorm Psychol 101:538-552.
Richerson GB (2004): Serotonergic neurons as carbon dioxide sensors that maintain pH homeostasis. Nat Rev Neurosci 5:449-461.
Richerson GB, Wang W, Hodges MR, Dohle CI, Diez-Sampedro A (2005): Homing in on the specific phenotype(s) of central respiratory chemoreceptors. Exp Physiol 90:259-266; discussion 266-259.
Richter DW, Manzke T, Wilken B, Ponimaskin E (2003): Serotonin receptors: guardians of stable breathing. Trends Mol Med 9:542-548.
Rizzi A, Vergura R, Marzola G, Ruzza C, Guerrini R, Salvadori S, et al (2008): Neuropeptide S is a stimulatory anxiolytic agent: a behavioural study in mice. Br J Pharmacol 154:471-479.
Rosmond R, Bjorntorp P (1998): Psychiatric ill-health of women and its relationship to obesity and body fat distribution. Obes Res 6:338-345.
Rosmond R, Dallman MF, Bjorntorp P (1998): Stress-related cortisol secretion in men: relationships with abdominal obesity and endocrine, metabolic and hemodynamic abnormalities. J Clin Endocrinol Metab 83:1853-1859.
Roth WT (2005): Physiological markers for anxiety: panic disorder and phobias. Int J Psychophysiol 58:190-198.
Rothe C, Koszycki D, Bradwejn J, King N, Deluca V, Tharmalingam S, et al (2006): Association of the Val158Met catechol O-methyltransferase genetic polymorphism with panic disorder. Neuropsychopharmacology 31:2237-2242.
Roy-Byrne PP, Stang P, Wittchen HU, Ustun B, Walters EE, Kessler RC (2000): Lifetime panic-depression comorbidity in the National Comorbidity Survey. Association with symptoms, impairment, course and help-seeking. Br J Psychiatry 176:229-235.
Sakurai T (2007): The neural circuit of orexin (hypocretin): maintaining sleep and wakefulness. Nat Rev Neurosci 8:171-181.
Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, et al (1998): Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92:1 page following 696.
Sakurai T, Nagata R, Yamanaka A, Kawamura H, Tsujino N, Muraki Y, et al (2005): Input of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron 46:297-308.
Sapru HN, Krieger AJ (1977): Effect of 5-hydroxytryptamine on the peripheral chemoreceptors in the rat. Res Commun Chem Pathol Pharmacol 16:245-250.
Schruers K, Klaassen T, Pols H, Overbeek T, Deutz NE, Griez E (2000): Effects of tryptophan depletion on carbon dioxide provoked panic in panic disorder patients. Psychiatry Res 93:179-187.
Schurks M, Kurth T, Geissler I, Tessmann G, Diener HC, Rosskopf D (2006): Cluster headache is associated with the G1246A polymorphism in the hypocretin receptor 2 gene. Neurology 66:1917-1919.
51
Schwartz GE, Goetz RR, Klein DF, Endicott J, Gorman JM (1996): Tidal volume of respiration and "sighing" as indicators of breathing irregularities in panic disorder patients. Anxiety 2:145-148.
Severson CA, Wang W, Pieribone VA, Dohle CI, Richerson GB (2003): Midbrain serotonergic neurons are central pH chemoreceptors. Nat Neurosci 6:1139-1140.
Sharp T, Bramwell SR, Grahame-Smith DG (1989): 5-HT1 agonists reduce 5-hydroxytryptamine release in rat hippocampus in vivo as determined by brain microdialysis. Br J Pharmacol 96:283-290.
Shavitt RG, Gentil V, Mandetta R (1992): The association of panic/agoraphobia and asthma. Contributing factors and clinical implications. Gen Hosp Psychiatry 14:420-423.
Sheehan DV, Raj AB, Harnett-Sheehan K, Soto S, Knapp E (1993): The relative efficacy of high-dose buspirone and alprazolam in the treatment of panic disorder: a double-blind placebo-controlled study. Acta Psychiatr Scand 88:1-11.
Shekhar A, Johnson PL, Sajdyk TJ, Fitz SD, Keim SR, Kelley PE, et al (2006): Angiotensin-II is a putative neurotransmitter in lactate-induced panic-like responses in rats with disruption of GABAergic inhibition in the dorsomedial hypothalamus. J Neurosci 26:9205-9215.
Shlik J, Aluoja A, Vasar V, Vasar E, Podar T, Bradwejn J (1997): Effects of citalopram treatment on behavioural, cardiovascular and neuroendocrine response to cholecystokinin tetrapeptide challenge in patients with panic disorder. J Psychiatry Neurosci 22:332-340.
Sinha S, Papp LA, Gorman JM (2000): How study of respiratory physiology aided our understanding of abnormal brain function in panic disorder. J Affect Disord 61:191-200.
Smolka MN, Schumann G, Wrase J, Grusser SM, Flor H, Mann K, et al (2005): Catechol-O-methyltransferase val158met genotype affects processing of emotional stimuli in the amygdala and prefrontal cortex. J Neurosci 25:836-842.
Smoller JW, Tsuang MT (1998): Panic and phobic anxiety: defining phenotypes for genetic studies. Am J Psychiatry 155:1152-1162.
Spinhoven P, Ros M, Westgeest A, Van der Does AJ (1994): The prevalence of respiratory disorders in panic disorder, major depressive disorder and V-code patients. Behav Res Ther 32:647-649.
Stahl SM (1998): Mechanism of action of serotonin selective reuptake inhibitors. Serotonin receptors and pathways mediate therapeutic effects and side effects. J Affect Disord 51:215-235.
Stahl SM, Gergel I, Li D (2003): Escitalopram in the treatment of panic disorder: a randomized, double-blind, placebo-controlled trial. J Clin Psychiatry 64:1322-1327.
Stein MB, Fallin MD, Schork NJ, Gelernter J (2005): COMT polymorphisms and anxiety-related personality traits. Neuropsychopharmacology 30:2092-2102.
Stein MB, Millar TW, Larsen DK, Kryger MH (1995): Irregular breathing during sleep in patients with panic disorder. Am J Psychiatry 152:1168-1173.
Stone RA, Barnes PJ, Chung KF (1997): Effect of 5-HT1A receptor agonist, 8-OH-DPAT, on cough responses in the conscious guinea pig. Eur J Pharmacol 332:201-207.
Struzik L, Duffin J, Vermani M, Hegadoren K, Katzman MA (2002): Effects of tryptophan depletion on central and peripheral chemoreflexes in man. Respir Physiol Neurobiol 133:183-195.
Sullivan GM, Kent JM, Kleber M, Martinez JM, Yeragani VK, Gorman JM (2004): Effects of hyperventilation on heart rate and QT variability in panic disorder pre- and post-treatment. Psychiatry Res 125:29-39.
52
Svensson TH (1987): Peripheral, autonomic regulation of locus coeruleus noradrenergic neurons in brain: putative implications for psychiatry and psychopharmacology. Psychopharmacology (Berl) 92:1-7.
Targum SD, Marshall LE (1989): Fenfluramine provocation of anxiety in patients with panic disorder. Psychiatry Res 28:295-306.
Taylor NC, Li A, Green A, Kinney HC, Nattie EE (2004): Chronic fluoxetine microdialysis into the medullary raphe nuclei of the rat, but not systemic administration, increases the ventilatory response to CO2. J Appl Physiol 97:1763-1773.
Tchernof A, Despres JP (2000): Sex steroid hormones, sex hormone-binding globulin, and obesity in men and women. Horm Metab Res 32:526-536.
Tesar GE (1990): High-potency benzodiazepines for short-term management of panic disorder: the U.S. experience. J Clin Psychiatry 51 Suppl:4-10; discussion 50-13.
Todd GP, Chadwick IG, Yeo WW, Jackson PR, Ramsay LE (1995): Pressor effect of hyperventilation in healthy subjects. J Hum Hypertens 9:119-122.
Truitt WA, Sajdyk TJ, Dietrich AD, Oberlin B, McDougle CJ, Shekhar A (2007): From anxiety to autism: spectrum of abnormal social behaviors modeled by progressive disruption of inhibitory neuronal function in the basolateral amygdala in Wistar rats. Psychopharmacology (Berl) 191:107-118.
Tsuji H, Larson MG, Venditti FJ, Jr., Manders ES, Evans JC, Feldman CL, et al (1996): Impact of reduced heart rate variability on risk for cardiac events. The Framingham Heart Study. Circulation 94:2850-2855.
Tucker P, Adamson P, Miranda R, Jr., Scarborough A, Williams D, Groff J, et al (1997): Paroxetine increases heart rate variability in panic disorder. J Clin Psychopharmacol 17:370-376.
Tunbridge EM, Harrison PJ, Weinberger DR (2006): Catechol-o-methyltransferase, cognition, and psychosis: Val158Met and beyond. Biol Psychiatry 60:141-151.
Tyrer P, Shawcross C (1988): Monoamine oxidase inhibitors in anxiety disorders. J Psychiatr Res 22 Suppl 1:87-98.
Uchida RR, Del-Ben CM, Busatto GF, Duran FL, Guimaraes FS, Crippa JA, et al (2008): Regional gray matter abnormalities in panic disorder: a voxel-based morphometry study. Psychiatry Res 163:21-29.
Wade AG, Lepola U, Koponen HJ, Pedersen V, Pedersen T (1997): The effect of citalopram in panic disorder. Br J Psychiatry 170:549-553.
van Apeldoorn FJ, van Hout WJ, Mersch PP, Huisman M, Slaap BR, Hale WW, 3rd, et al (2008): Is a combined therapy more effective than either CBT or SSRI alone? Results of a multicenter trial on panic disorder with or without agoraphobia. Acta Psychiatr Scand 117:260-270.
van den Boom D, Ehrich M (2007): Discovery and identification of sequence polymorphisms and mutations with MALDI-TOF MS. Methods Mol Biol 366:287-306.
van den Hout MA, Hoekstra R, Arntz A, Christiaanse M, Ranschaert W, Schouten E (1992): Hyperventilation is not diagnostically specific to panic patients. Psychosom Med 54:182-191.
van Megen HJ, Westenberg HG, den Boer JA, Haigh JR, Traub M (1994): Pentagastrin induced panic attacks: enhanced sensitivity in panic disorder patients. Psychopharmacology (Berl) 114:449-455.
van Megen HJ, Westenberg HG, den Boer JA, Slaap B, Scheepmakers A (1997): Effect of the selective serotonin reuptake inhibitor fluvoxamine on CCK-4 induced panic attacks. Psychopharmacology (Berl) 129:357-364.
van Vliet IM, Westenberg HG, den Boer JA (1996): Effects of the 5-HT1A receptor agonist flesinoxan in panic disorder. Psychopharmacology (Berl) 127:174-180.
53
Wang W, Pizzonia JH, Richerson GB (1998): Chemosensitivity of rat medullary raphe neurones in primary tissue culture. J Physiol 511 ( Pt 2):433-450.
Weissman MM, Bland RC, Canino GJ, Faravelli C, Greenwald S, Hwu HG, et al (1997): The cross-national epidemiology of panic disorder. Arch Gen Psychiatry 54:305-309.
Weissman MM, Markowitz JS, Ouellette R, Greenwald S, Kahn JP (1990): Panic disorder and cardiovascular/cerebrovascular problems: results from a community survey. Am J Psychiatry 147:1504-1508.
Weissman NJ, Shear MK, Kramer-Fox R, Devereux RB (1987): Contrasting patterns of autonomic dysfunction in patients with mitral valve prolapse and panic attacks. Am J Med 82:880-888.
Wilhelm FH, Trabert W, Roth WT (2001a): Characteristics of sighing in panic disorder. Biol Psychiatry 49:606-614.
Wilhelm FH, Trabert W, Roth WT (2001b): Physiologic instability in panic disorder and generalized anxiety disorder. Biol Psychiatry 49:596-605.
Wilkerson A, Levin ED (1999): Ventral hippocampal dopamine D1 and D2 systems and spatial working memory in rats. Neuroscience 89:743-749.
Wilkinson DJ, Thompson JM, Lambert GW, Jennings GL, Schwarz RG, Jefferys D, et al (1998): Sympathetic activity in patients with panic disorder at rest, under laboratory mental stress, and during panic attacks. Arch Gen Psychiatry 55:511-520.
Williams RH, Burdakov D (2008): Hypothalamic orexins/hypocretins as regulators of breathing. Expert Rev Mol Med 10:e28.
Winsky-Sommerer R, Yamanaka A, Diano S, Borok E, Roberts AJ, Sakurai T, et al (2004): Interaction between the corticotropin-releasing factor system and hypocretins (orexins): a novel circuit mediating stress response. J Neurosci 24:11439-11448.
Vitale G, Filaferro M, Ruggieri V, Pennella S, Frigeri C, Rizzi A, et al (2008): Anxiolytic-like effect of neuropeptide S in the rat defensive burying. Peptides.
Wittchen HU, Nelson CB, Lachner G (1998a): Prevalence of mental disorders and psychosocial impairments in adolescents and young adults. Psychol Med 28:109-126.
Wittchen HU, Reed V, Kessler RC (1998b): The relationship of agoraphobia and panic in a community sample of adolescents and young adults. Arch Gen Psychiatry 55:1017-1024.
Vollrath M, Koch R, Angst J (1990): The Zurich Study. IX. Panic disorder and sporadic panic: symptoms, diagnosis, prevalence, and overlap with depression. Eur Arch Psychiatry Neurol Sci 239:221-230.
Woo JM, Yoon KS, Choi YH, Oh KS, Lee YS, Yu BH (2004): The association between panic disorder and the L/L genotype of catechol-O-methyltransferase. J Psychiatr Res 38:365-370.
Woo JM, Yoon KS, Yu BH (2002): Catechol O-methyltransferase genetic polymorphism in panic disorder. Am J Psychiatry 159:1785-1787.
Woods SW, Charney DS, Loke J, Goodman WK, Redmond DE, Jr., Heninger GR (1986): Carbon dioxide sensitivity in panic anxiety. Ventilatory and anxiogenic response to carbon dioxide in healthy subjects and patients with panic anxiety before and after alprazolam treatment. Arch Gen Psychiatry 43:900-909.
Yellowlees PM, Alpers JH, Bowden JJ, Bryant GD, Ruffin RE (1987): Psychiatric morbidity in patients with chronic airflow obstruction. Med J Aust 146:305-307.
Yellowlees PM, Haynes S, Potts N, Ruffin RE (1988): Psychiatric morbidity in patients with life-threatening asthma: initial report of a controlled study. Med J Aust 149:246-249.
Yeragani VK, Pohl R, Balon R, Jampala VC, Jayaraman A (2002a): Twenty-four-hour QT interval variability: increased QT variability during sleep in patients with panic disorder. Neuropsychobiology 46:1-6.
54
Yeragani VK, Pohl R, Berger R, Balon R, Ramesh C, Glitz D, et al (1993): Decreased heart rate variability in panic disorder patients: a study of power-spectral analysis of heart rate. Psychiatry Res 46:89-103.
Yeragani VK, Pohl R, Jampala VC, Balon R, Ramesh C, Srinivasan K (2000): Increased QT variability in patients with panic disorder and depression. Psychiatry Res 93:225-235.
Yeragani VK, Pohl R, Srinivasan K, Balon R, Ramesh C, Berchou R (1995): Effects of isoproterenol infusions on heart rate variability in patients with panic disorder. Psychiatry Res 56:289-293.
Yeragani VK, Radhakrishna RK, Tancer M, Uhde T (2002b): Nonlinear measures of respiration: respiratory irregularity and increased chaos of respiration in patients with panic disorder. Neuropsychobiology 46:111-120.
Yeragani VK, Rao R, Tancer M, Uhde T (2004): Paroxetine decreases respiratory irregularity of linear and nonlinear measures of respiration in patients with panic disorder. A preliminary report. Neuropsychobiology 49:53-57.
Yoshida K, McCormack S, Espana RA, Crocker A, Scammell TE (2006): Afferents to the orexin neurons of the rat brain. J Comp Neurol 494:845-861.
Young JK, Wu M, Manaye KF, Kc P, Allard JS, Mack SO, et al (2005): Orexin stimulates breathing via medullary and spinal pathways. J Appl Physiol 98:1387-1395.
Zandbergen J, Bright M, Pols H, Fernandez I, de Loof C, Griez EJ (1991): Higher lifetime prevalence of respiratory diseases in panic disorder? Am J Psychiatry 148:1583-1585.
Zandbergen J, Lousberg HH, Pols H, de Loof C, Griez EJ (1990): Hypercarbia versus hypocarbia in panic disorder. J Affect Disord 18:75-81.
Zandbergen J, van Aalst V, de Loof C, Pols H, Griez E (1993): No chronic hyperventilation in panic disorder patients. Psychiatry Res 47:1-6.
Zaubler TS, Katon W (1998): Panic disorder in the general medical setting. J Psychosom Res 44:25-42.
Zhang W, Fukuda Y, Kuwaki T (2005): Respiratory and cardiovascular actions of orexin-A in mice. Neurosci Lett 385:131-136.
Zhang W, Sakurai T, Fukuda Y, Kuwaki T (2006a): Orexin neuron-mediated skeletal muscle vasodilation and shift of baroreflex during defense response in mice. Am J Physiol Regul Integr Comp Physiol 290:R1654-1663.
Zhang W, Shimoyama M, Fukuda Y, Kuwaki T (2006b): Multiple components of the defense response depend on orexin: evidence from orexin knockout mice and orexin neuron-ablated mice. Auton Neurosci 126-127:139-145.
55
