Page 1 of 23

Cerium regulates expression of alternative methanol dehydrogenases 1

in Methylosinus trichosporium OB3b 2

3

By 4

5

Muhammad Farhan Ul Haque1*, Bhagylakshmi Kalidass1* Nathan Bandow2, Erick A. Turpin2, Alan 6

A. DiSpirito2 and Jeremy D. Semrau1# 7

8

1Department of Civil and Environmental Engineering, University of Michigan, Ann Arbor, MI, 9

48109-2125 10

2Roy J. Carver Department of Biochemistry, Biophysics and Molecular Biology, Iowa State 11

University, Ames, IA, 50011 12

13

#To whom correspondence should be addressed. Email: jsemrau@umich.edu; 14

Phone: (734) 764-6487; Fax: (734) 763-2275 15

16

*These authors contributed equally to the manuscript 17

18

Running title: Effect of cerium on gene expression in methanotrophs 19

20

AEM Accepted Manuscript Posted Online 21 August 2015Appl. Environ. Microbiol. doi:10.1128/AEM.02542-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 2 of 23

ABSTRACT 21

Methanotrophs have multiple methane monooxygenases that are well-known to be regulated 22

by copper, i.e., a “copper-switch”. At low copper:biomass ratios the soluble methane 23

monooxygenase (sMMO) is expressed while expression and activity of the particulate methane 24

monooxygenase (pMMO) increases with increasing availability of copper. In many 25

methanotrophs there are also multiple methanol dehydrogenases (MeDH), one based on Mxa 26

and another based on Xox. Mxa-MeDH is known to have calcium in its active site, while Xox-27

MeDHs have been shown to have rare earth elements in their active site. Here we show 28

expression of Mxa-MeDH and Xox-MeDH in Methylosinus trichosporium OB3b significantly 29

decreased and increased respectively when grown in the presence of cerium but the absence of 30

copper as compared to the absence of both metals. Expression of sMMO and pMMO was not 31

affected. In the presence of copper the effect of cerium on gene expression was less 32

significant, i.e., expression of Mxa-MeDH in the presence of copper and cerium was slightly 33

lower as compared to just the presence of copper, but Xox-MeDH was again found to increase 34

significantly. As expected, the addition of copper caused sMMO and pMMO expression to 35

significantly decrease and increase respectively, but the simultaneous addition of cerium had 36

no discernable effect on MMO expression. As a result, it appears Mxa-MeDH can be uncoupled 37

from methane oxidation by sMMO in M. trichosporium OB3b, but not from pMMO. 38

39

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 3 of 23

INTRODUCTION 40

It is well-known that microorganisms have diverse mechanisms to sense and respond to metals 41

in their environment. These mechanisms typically include strategies to regulate gene 42

expression in response to the presence or absence of metals such as copper, zinc, iron, 43

manganese, arsenic, and mercury (e.g., 1-4). One such phenomenon is the “copper-switch” in 44

methanotrophs. That is, these microbes utilize methane as their sole growth substrate, but 45

have two different monooxygenases for the initial oxidation of methane to methanol. One, the 46

particulate methane monooxygenase (pMMO) is found in the intracytoplasmic membranes of 47

these microbes, and its expression and activity increases with increasing availability of copper. 48

The second, the soluble methane monooxygenase (sMMO) is found in the cytoplasm and is only 49

expressed when copper is unavailable (5). These two forms of MMO have very different 50

structures, activities, and substrate ranges (5-14), and so careful consideration of the form of 51

MMO expressed is critical for understanding methanotrophic ecology as well for various 52

applications of methanotrophy, including the removal of chlorinated solvents and methane, a 53

potent greenhouse gas (5, 10, 12, 15). 54

55

Further, interest in commercial application of methanotrophy has dramatically accelerated in 56

recent years, in part due to increased methane supplies given advances in hydraulic fracturing 57

of shale formations. As a result, methane prices have become quite low, with the wellhead 58

price of natural gas dropping from $10.79 per 1000 ft3 in July 2008 to $3.38 per 1000 ft3 in 59

December 2012 (16). A great deal of effort has thus been put forward to determine how to 60

best valorize methane, e.g., through the use of methanotrophs to convert methane into 61

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 4 of 23

products such as single-cell protein, bioplastics, biofuels, and osmo-protectants, amongst other 62

compounds (5, 17, 18). Given that the two MMOs have very different activities and affinities 63

for methane, any use of a methanotrophic platform to valorize methane is strongly affected by 64

the form of MMO present. 65

66

Recent findings, however, indicate that the subsequent step in the general pathway of methane 67

oxidation, i.e., the oxidation of methanol by the methanol dehydrogenase, may also play a 68

critical role in the application of methanotrophy for environmental and commercial purposes. 69

First, it was reported in 2006 that the pMMO likely forms a supercomplex with a 70

pyrroquinolone quinone (PQQ)-linked methanol dehydrogenase (MeDH). Cryoelectron 71

microscopy work done by Myronova et al., (19) indicated that the PQQ-linked MeDH likely 72

forms a “cap” to the pMMO “body”, with the PQQ-linked MeDH residing in the periplasmic 73

space. Subsequent studies support this conclusion and indicate that the PQQ-linked MeDH and 74

pMMO supercomplex is anchored via the intracytoplasmic membranes (20). Other research 75

also suggests that electron transfer from the PQQ-linked MeDH to pMMO may occur in vivo 76

(21, 22). As such, any attempt to utilize pMMO-expressing cells for any specific application 77

should also consider efforts to stabilize the PQQ-linked MeDH-pMMO supercomplex and also 78

ensure effective back transfer of electrons from the MeDH to pMMO to drive pMMO activity. 79

80

Interestingly, not only are there two known forms of MMO in methanotrophs, most 81

methanotrophs also have an alternative methanol dehydrogenase. As mentioned above, it is 82

well-known that methanol is oxidized to formaldehyde via a periplasmic PQQ-linked MeDH. 83

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 5 of 23

This enzyme is a heterotetrameric protein (α2β2) with two 66-kDa (α) subunits (MxaF) and two 84

8.5 kDa (β) subunits (MxaI). In this MeDH, calcium is in the active site and is coordinated with 85

the PQQ group (23). It was initially believed that this enzyme was critical for methylotrophic 86

growth on methanol as no methanol dehydrogenase activity was observed in mutants defective 87

in the production of this protein (24). Subsequently, however, it was found that there is a 88

homolog to the large subunit, termed XoxF, with 50% sequence identity to MxaF (25, 26). This 89

also encodes a PQQ-dependent methanol dehydrogenase that is associated with the periplasm 90

(26, 27), but appears to be composed only of a single subunit with a predicted mass of 65 kDa 91

(28) or associated with the small subunit of MxaI (26), depending on the microbe. Further, it is 92

often observed that multiple homologs of XoxF are found in the genome of a variety of 93

methylotrophs and methanotrophs (25, 26, 29, 30). 94

95

Xox-MeDH, however, appears to have a rare earth element in its active site. Studies in 96

Methylobacterium radiotolerans and Methylobacterium extorquens AM1 showed that cerium 97

and lathanum both increased methanol oxidation by Xox-MeDH (31, 32). Such increase was not 98

due to increased expression of xoxF, but more likely due to post-translational activation (32). 99

Further, simple yet elegant studies showed that growth and overall MeDH activity of a M. 100

extorquens AM1 mutant in which mxaF was disrupted was severely limited in the absence of 101

lanthanum but growth recovered in its presence, regardless if calcium was simultaneously 102

present or not (32). Such results indicate that lanthanum was required for the activity of Xox-103

MeDH. Subsequent studies supported these findings, i.e., it was found that growth of the 104

Methylacidiphilum fumariolicum SolV was enhanced in the presence of multiple rare earth 105

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 6 of 23

elements (e.g., cerium, lanthanum, praseodymium and neodymium [33]). Purification of the 106

active MeDH of M. fumariolicum SolV grown in the presence of praseodymium showed ~0.5-0.7 107

atoms of praseodymium per monomer, indicating that this may be part of the active site. 108

Subsequent crystallization of this MeDH revealed it to be encoded by XoxF, and that rare earth 109

metals were in the crystal structure (33). 110

111

Given these findings, we speculated that under selective growth conditions differential 112

expression of not only genes encoding for polypeptides of sMMO and pMMO would vary, but 113

genes encoding for the two alternative forms of MeDH would also vary. Here we report on the 114

effect of varying amounts of copper and cerium on gene expression and growth of 115

Methylosinus trichosporium OB3b. 116

117

METHODS AND MATERIALS 118

Bacterial growth conditions 119

M. trichosporium OB3b was grown on nitrate mineral salt (NMS) medium (34) using >18MΩ▪cm 120

H2O at 30 °C in 250 ml Erlenmeyer flasks under constant shaking at 200 rpm. Varying amounts 121

of copper (as CuCl2) and/or cerium (as CeCl3) prepared in >18MΩ▪cm H2O were added and 122

cultures harvested in the late exponential phase for analysis. Copper and cerium stock solutions 123

were filter sterilized using 0.2 µm polyethersulfone membranes. All chemicals used were of 124

American Chemical Society grade or better. All conditions were performed using biological 125

triplicates. 126

127

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 7 of 23

Protein quantification 128

The procedure outlined by Semrau, et al. (35) was used to quantify protein concentrations. 129

Briefly, 5 mls of cultures of M. trichosporium OB3b was concentrated to 1 ml and digested in 130

2M NaOH (0.4 ml 5M NaOH per 1.0 ml of culture) at 98 °C for 15 min. The Bradford assay (Bio-131

Rad Laboratories, Hercules, CA) was then used to determine protein concentration following 132

manufacturer instructions. A plot of protein concentrations vs. different optical densities at 600 133

nm (OD600) of cultures of M. trichosporium OB3b yielded a linear regression with an OD600 of 1.0 134

equal to 850 µg protein per ml (R2 = 0.995). This correlation was used to calculate protein 135

concentration for all cultures. 136

137

Metal measurements 138

Copper and cerium associated with biomass and remaining in the supernatant after growth 139

were determined as described earlier (36). Briefly, cultures of M. trichosporium OB3b were 140

centrifuged at 5000 × g for 10 min at 4 °C. The supernatant was then transferred to sterile 141

plastic tubes and stored at -80 °C. Cell pellets were re-suspended in 1 mL of fresh NMS medium 142

without any added metals and then also stored at -80 °C. For subsequent metal analyses, 143

inductively coupled plasma mass spectrometry (ICP-MS; Agilent Technologies, Santa Clara, CA) 144

was used. All samples were first thawed at room temperature with supernatant samples then 145

diluted in NMS with 5% HNO3 (vol/vol) to achieve a final concentration of 2% HNO3 (vol/vol). 146

Cell suspensions were first acidified in 1 mL of 70% HNO3 (vol/vol) and then digested for 2 hours 147

at 95˚C. Digested cell suspensions were then diluted with sterile NMS medium to achieve a 148

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 8 of 23

final HNO3 concentration of 2 % (vol/vol). Triplicate biological samples were analyzed with each 149

sample measured five times. 150

151

Isolation of Methanobactin. 152

M. trichosporium OB3b was cultured for methanobactin in 0.2 or 1.0 µM CuSO4 amended NMS 153

medium in sequential batch reactors and mb-SB2 purified from the spent medium as previously 154

described (37). 155

156

Nucleic acid extraction and cDNA preparation 157

Total RNA extraction from M. trichosporium OB3b was performed as described earlier (36). 158

Briefly, 2.5 ml of stop solution (5% buffer equilibrated phenol [pH 7.3] in ethanol) was first 159

added to cultures (22.5 ml) to stop synthesis of new mRNA. Cell pellets were then collected by 160

centrifugation at 5,000 × g for 10 min at 4 °C. The cells were re-suspended in 0.75 ml of 161

extraction buffer before lysis using 20 % SDS, 20% lauryl sarkosine, and bead beating. 162

Subsequent steps of RNA extraction were then performed as described previously (35, 38). 163

Total RNA was then subjected to RNase-free DNase treatment until free of DNA contamination 164

as via PCR amplification of the 16S rRNA gene. The purified RNA was quantified 165

spectrophotometrically using NanoDrop (NanoDrop ND1000; NanoDrop Technologies, Inc., 166

Wilmington, DE). RNA samples were stored at 80 °C and used for cDNA synthesis within 2 days 167

of extraction. DNA-free total RNA (500 ng) was treated with Superscript III reverse transcriptase 168

for reverse transcription of mRNA to cDNA (Invitrogen, Carlsbad, CA) following the 169

manufacturer’s instructions. 170

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 9 of 23

171

Reverse transcription-quantitative PCR (RT-qPCR) 172

Gene specific primers (Table 1) were used for the RT-qPCR analyses of pmoA, mmoX, mxaF, 173

mxaI, xoxF1, xoxF2, and 16S rRNA in M. trichosporium OB3b grown under different 174

concentrations of copper and cerium. Gel electrophoresis and sequencing analyses were 175

performed to verify the specificities of these primers. Amplifications were performed in 96-well 176

reaction PCR plates using Mx3000P QPCR systems (Stratagene, La Jolla, CA) as previously 177

described (39). Each qPCR reaction was carried out in 20 μl total volume that contained: cDNA 178

(0.8 μl), Brilliant III SYBR Green QPCR Mastermix (1X) (Agilent Technologies, Santa Clara, CA), 179

ROX dye (15 nM), forward and reverse primers (0.5 μM each), and nuclease-free sterile water 180

(Ambion, life technologies, Grand Island, NY). Thermal cycler program for qPCR consisted of 40 181

cycles of denaturation (95 °C for 30 s), annealing (58 °C for 20 s) and extension (68 °C for 30 s) 182

after an initial denaturation at 95 °C for 10 min. After the completion of amplification cycles, 183

qPCR products were subjected to melting curve analysis with temperature ranging from 55 °C 184

to 95 °C to confirm their specificity. The threshold amplification cycle (Ct) values were then 185

imported from MxPro (Stratagene, La Jolla, CA) into Microsoft Excel to quantify the relative 186

expression of different genes. Relative gene expression levels were calculated using 187

comparative Ct method (2−ΔΔCt) (40) method with 16S rRNA as the housekeeping gene. ). 188

Calibration curves for examined qPCR products are shown in Supplementary Figure S1. 189

190

191

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 10 of 23

Electrophoresis and N-terminal Sequence 192

Sodium dodecyl sulfate-polyacrylamine gel electrophoresis was performed on precast NuPAGE 193

4-12% Bis-Tris gradient gels from Invitrogen (Life Technologies, CA) with MES SDS running 194

buffer. Gels were stained for total protein with Coomassie brilliant blue R or blotted for N-195

terminal sequencing. Proteins were blotted onto polyvinyledene difluoride (PVDF) Plus transfer 196

membranes (Micron Separations, Inc. Westboro, MA) using an Xcell II Blot Module (Invitrogen, 197

Carlsbad, CA) according to the manufacturer’s specifications. 198

199

Amino Acid Sequence 200

Amino acid sequence analyses were performed via Edman degradation with a Perkin Elmer 201

Biosystems Model 494 Procise protein/peptide sequencer with an on-line Perkin Elmer Applied 202

biosystems Model 140C PTA Amino Acid Analyzer. Sequence analysis was performed on 203

samples electrobloted to PVDF membranes as described above. 204

205

Spectroscopy 206

UV-visible absorption spectra were determined on a Cary 50 (Varian Inc. Palo Alto, CA) 207

spectrophotometer. Cerium titration experiments were performed using 50 µM aqueous 208

solutions of methanobactin prepared in > 18MΩ▪cm H2O. 209

210

Isothermal Titration Calorimetry 211

Isothermal titration calorimetry (ITC) was performed at 25°C using a GE Microcal ITC200 212

microcalorimeter (GE Healthcare, Piscataway, NJ). Titrant solution was 1 mM CeCl3, and was 213

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 11 of 23

prepared using > 18MΩ▪cm H2O. The injections were added at 180 sec intervals, and based on 214

injection volume the duration of the injection was predetermined by the software. An injection 215

volume of 1.5 µl into a cell containing 100 µM methanobactin in > 18MΩ▪cm H2O with a stir 216

rate of 800 rpm was used for all injections. The instrument was cleaned between experiments, 217

and the sample cell washed according to the manufacturer’s recommendation. The sample cell 218

was then conditioned with 100 µM methanobactin to remove residual metal. Data was 219

analyzed using nonlinear least-squares curve fitting in Origin 7.0 software (GE Healthcare) 220

following subtraction of the heat of dilution of CeCl3 into > 18MΩ▪cm H2O. 221

222

RESULTS 223

In the presence of varying amounts of copper and cerium, little difference of the growth of M. 224

trichosporium OB3b was observed (Figure S2). As found earlier (36, 39), copper associated with 225

biomass significantly increased (approximately three orders of magnitude; p < 6 x 10-3) with the 226

addition of copper (Figure 1A). Interestingly, as cerium was added, the amount of cerium 227

associated with biomass also increased significantly (by three to four orders of magnitude; p < 228

1.1 x 10-4; Figure 1B), and in fact, most of the added cerium (> 98%) was cell-associated. Cerium 229

binding by methanobactin was determined via spectral changes and isothermal calorimetry. 230

The spectral changes in methanobactin were minor following cerium addition and suggest 231

association is only to the enethiol groups and not to the oxazolone rings of methanobactin 232

(Supplementary Figure S3A). The binding of cerium by methanobactin, KCe = 4.35 x 103 M-1 233

(Supplementary Figure S3B and S3C) was orders of magnitude lower than that found earlier for 234

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 12 of 23

copper, KCu = 1018 to 1058 M-1 (41-43) and copper displaced cerium associated with 235

methanobactin (results not shown). 236

237

Quantitative PCR (qPCR) of cDNA was then performed to determine if varying amounts of 238

copper and cerium affected expression of the various forms of both methane monooxygenase 239

and methanol dehydrogenase. As found previously (35, 36, 39) the addition of copper reduced 240

mmoX expression by ~four orders of magnitude (Figure 2A) while pmoA expression increased 241

~54-fold (Figure 2B), with both changes significant (p = 0.03 and 7.6 x 10-3, respectively). The 242

addition of cerium, however, did not significantly affect either mmoX or pmoA expression in 243

either the presence or absence of copper. 244

245

Expression of mxaF and mxaI however, did respond to both the addition of copper or cerium 246

(Figure 2C and 2D). When 25 µM cerium was added in the absence of copper, both mxaF and 247

mxaI expression decreased over 50-fold as compared to no added cerium and copper (p = 6.3 x 248

10-3 and 1.9 x 10-3, respectively). In the presence of 10 µM copper, the simultaneous addition 249

of 25 µM cerium caused mxaF and mxaI expression to be reduced by over 2.5-fold each as 250

compared to when no cerium was added in the presence of copper (p = 7.6 x 10-3 and 8.4 x 10-3, 251

respectively). Further, mxaF expression increased ~two-fold in the presence of 10 µM copper 252

as compared to no added copper (p = 0.038), while mxaI expression also increased ~2.4-fold (p 253

= 0.05). Expression of mxaF and mxaI in the presence of both copper and cerium, however, was 254

similar to that found in the absence of both metals (p = 0.4 and 0.5, respectively). 255

256

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 13 of 23

Expression of both xoxF1 and xoxF2 (Figure 2E and F) increased over an order of magnitude 257

when cerium was added as compared to when both metals were absent (p = 3.3 x 10-4 and 4.7 x 258

10-3 respectively). In the presence of 10 µM copper, the expression of both xoxF1 and xoxF2 259

was not significantly different from that observed in the absence of both metals (p = 0.7 and 260

0.6, respectively). With the simultaneous addition of 25 µM cerium, however, xoxF1 and xoxF2 261

expression increased by approximately 9- and 3.5-fold, respectively, and again such increases 262

were significant (p = 7.0 x 10-3 and 0.02, respectively). 263

264

Given the response of mxaF, xoxF1, and xoxF2 expression to the presence of cerium in the 265

absence of copper, it appears that under some conditions, i.e., sMMO-expressing conditions, 266

that Xox-methanol dehydrogenase could replace the Mxa-methanol dehydrogenase. This was 267

examined more closely through SDS-PAGE protein gels. Given the similar sizes of XoxF1/F2 and 268

MxaF (65 and 66 kDa, respectively – 23, 28, 44), the presence of the small subunit of Mxa-269

methanol dehydrogenase, MxaI (8.5 kDa; 23), was tracked under varying growth concentrations 270

of copper and cerium. As can be seen in Figure 3, in the absence of copper and cerium, a strong 271

band at ~8.5 kDa was observed in the cell-free extract of M. trichosporium OB3b, and this band 272

was absent when 25 µM cerium was added. This band was visible, however, in the presence of 273

copper regardless of the presence or absence of cerium. The N-terminal sequence of this band 274

was determined, and all identified amino acids (10 of the first 11, with one unidentified residue) 275

aligned with the predicted amino acid sequence of MxaI from M. trichosporium OB3b 276

(Supplementary Figure S4). 277

278

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 14 of 23

DISCUSSION 279

Here we show that multiple metals affect gene expression in M. trichosporium OB3b. That is, in 280

addition to the canonical “copper-switch” that is well-known to control expression of the two 281

forms of MMO (5), cerium also appears to regulate expression of multiple methanol 282

dehydrogenases found in this methanotroph. Specifically, expression of mxaF and mxaI 283

decreased significantly in the presence of cerium but with no added copper as compared to the 284

absence of both metals, while xoxF1 and xoxF2 increased. These findings suggest that Xox-285

methanol dehydrogenase could replace MxaF-methanol dehydrogenase when M. trichosporium 286

OB3b was expressing sMMO. Cerium, however, had little effect on mxaF or mxaI expression 287

under pMMO-expressing conditions, i.e., when 10 μM copper was present. Such findings 288

support earlier conclusions that the pMMO forms a supercomplex with the Mxa-MeDH (19, 20) 289

and that this complex is critical for the oxidation of methane in methanotrophs under pMMO-290

expressing conditions, i.e., in the presence of copper. Our findings suggest, however, that Mxa-291

MeDH is not essential in sMMO-expressing conditions; rather Xox-MeDH is sufficient for the 292

further oxidation of methanol. Further, SDS-PAGE data and subsequent N-terminal sequencing 293

show that in the absence of copper but the presence of cerium, the MxaI polypeptide was not 294

evident, suggesting that as found for methylotrophs, Xox-MeDH is active in M. trichosporium 295

OB3b and requires only XoxF, and not MxaI (28). 296

297

The finding that multiple metals affect gene expression in M. trichosporium is intriguing. It 298

suggests that this microbe has multiple mechanisms to sense and collect both copper and 299

cerium, and that these mechanisms may play a role in controlling the relative expression of 300

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 15 of 23

Mxa- and Xox-methanol dehydrogenases. It has been shown that copper uptake in M. 301

trichosporium OB3b is regulated by the chalkophore, methanobactin, and a regulatory model 302

has been proposed whereby methanobactin serves to enhance the magnitude of the “copper-303

switch” but is not the basis of the switch (35). By analogy, there appears to be a separate 304

mechanism by which cerium is sensed by M. trichosporium OB3b, but it should be stressed that 305

this mechanism is still unknown. It does not appear that methanobactin is the mechanism for 306

cerium uptake as it was only loosely bound to methanobactin and copper displaced cerium 307

from methanobactin, yet most of the added cerium was found to be cell-associated. This is 308

intriguing for although cerium is considered a rare earth element, as noted elsewhere (33), such 309

metals are not actually “rare” as they are a significant fraction of the earth’s crust. Rather, they 310

are considered “rare” given that most species of these elements are sparingly soluble. From 311

the data presented here, it is tempting to speculate that systems for the uptake of rare earth 312

elements exist, and that the availability of and competition for these metals may have a 313

significant effect on overall methanotrophic community composition and activity. 314

315

It is recommended that this work be extended to see what, if any other rare earth elements 316

also affect expression of Mxa- vs. Xox-MeDH in methanotrophs and to also determine if any 317

growth parameters, e.g., yield and carbon conversion efficiency, are enhanced in the presence 318

of rare earth elements, particularly in sMMO-expressing conditions. It may be that rare earth 319

elements affect methanotrophic community composition as well as specific gene expression, 320

and that simple strategies whereby the presence of rare earth elements is controlled can 321

enhance the utility of methanotrophs for a variety of environmental and industrial applications. 322

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 16 of 23

323

ACKNOWLEDGEMENTS 324

This research was supported by the Office of Science (BER), U.S. Department of Energy. 325

326

REFERENCES 327

1. Giedroc DP, Arunkumar AI. 2007. Metal sensor proteins: nature’s metalloregulated 328

allosteric switches. Dalton Trans. 29: 3107-3120. 329

2. Guerra AJ, Giedroc DP. 2012. Metal site occupancy and allosteric switching in bacterial 330

metal sensor proteins. Arch Biochem Biophy. 519: 210-222. 331

3. Lee J-W, Helmann JD. 2007. Functional specialization within the Fur family of 332

metalloregulators. Biometals. 20: 485-499. 333

4. Prisic S, Hwang H, Dow A, Baranaby O, Pan TS, Lonzanida JA, Chazin WJ, Steen H, Husson 334

RN. 2015. Zinc regulates a switch between primary and alternative S18 ribosomal 335

proteins in Mycobacterium tuberculosis. Mol Microbiol. In press. DOI: 336

10.1111/mmi.13022. 337

5. Semrau JD, DiSpirito AA, Yoon S. 2010. Methanotrophs and copper. FEMS Microbiol Rev 338

34: 496-531. 339

6. Choi D-W, Kunz R, Boyd ES, Semrau JD, Antholine WE, Han J-I, Zahn JA, Boyd JM, de la 340

Mora A, DiSpirito AA. 2003. The membrane-associated methane monooxygenase 341

(pMMO) and pMMO-NADH:quinone oxidoreductase complex from Methylococcus 342

capsulatus Bath. J Bacteriol. 185: 5755-5764. 343

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 17 of 23

7. Colby, J., D. I. Stirling, and H. Dalton. 1977. Soluble methane mono-oxygenase of 344

Methylococcus capsulatus (Bath): its ability to oxygenate n-alkanes, n-alkenes, ethers, 345

and alicyclic, aromatic and heterocyclic compounds. Biochem J. 165: 395–402. 346

8. Collins MLP, Buchholz LA, Remsen CC. 1991. Effect of copper on Methylomonas albus 347

BG8. Appl Environ Microbiol. 57: 1261-1264. 348

9. Dalton H. 1980. Oxidation of hydrocarbons by methane monooxygenases from a variety 349

of microbes. Adv Appl Microbiol. 26: 71-87. 350

10. Lee S-W, Keeney DR, Lim D-H, DiSpirito AA, Semrau JD. 2006. Mixed pollutant 351

degradation by Methylosinus trichosporium OB3b expressing either soluble or 352

particulate methane monooxygenase: can the tortoise beat the hare? Appl Environ 353

Microbiol. 72: 7503-7509. 354

11. Lieberman RL, Rosenzweig AC. 2005. Crystal structure of a membrane-bound 355

metalloenzyme that catalyses the biological oxidation of methane. Nature. 434: 177-356

182. 357

12. Lontoh S, Semrau JD. 1998. Methane and trichloroethylene degradation by 358

Methylosinus trichosporium expressing particulate methane monooxygenase. Appl 359

Environ Microbiol. 64: 1106-1114. 360

13. Rosenzweig AC, Frederick CA, Lippard SJ, Nordlund P. 1993. Crystal structure of a 361

bacterial non-haem iron hydroxylase that catalyses the biological oxidation of methane. 362

Nature. 366: 537-543. 363

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 18 of 23

14. Stirling DI, Colby J, Dalton H. 1979. A comparison of the substrate and electron-donor 364

specificities of the methane mono-oxygenases from three strains of methane-oxidizing 365

bacteria. Biochem. J. 177: 361-364. 366

15. Yoon S, Carey JN, Semrau JD. 2009. Feasibility of atmospheric methane removal using 367

methanotrophic biotrickling filters. Appl Microbiol Biotech. 83: 949-956. 368

16. U.S. Energy Information Administration. 369

http://www.eia.gov/dnav/ng/hist/n9190us3m.htm. Accessed April 21, 2015. 370

17. Khmelenina VN, Rozova ON, But SY, Mustakhimov II, Reshetnikov AS, Beschastnyi AP, 371

Trotsenko YA. 2015. Biosynthesis of secondary metabolites in methanotrophs: 372

biochemical and genetic aspects (review). Appl Biochem Microbiol. 51: 150-158. 373

18. Strong PJ, Xie S, Clarke WP. 2015. Methane as a resource: can the methanotrophs add 374

value? Environ Sci Technol. 49: 4001-4008. 375

19. Myronova N, Kitmitto A, Collins RF, Miyaji A, Dalton H. 2006. Three-dimensional 376

structure determination of a protein supercomplex that oxidizes methane to 377

formaldehyde in Methylococcus capsulatus (Bath). Biochem. 45: 11905-11914. 378

20. Culpepper MA, Rosenzweig AC. Structure and Protein−Protein Interac ons of Methanol 379

Dehydrogenase from Methylococcus capsulatus (Bath). Biochem. 53 (2014): 6211-6219. 380

21. Leak DJ, Dalton H. 1983. In vivo studies of primary alcohols, aldehydes, and carboxylic 381

acids as electron donors for the methane mono-oxygenase in a variety of 382

methanotrophs. J Gen Microbiol. 129: 3487-3497. 383

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 19 of 23

22. Stanley SH, Prior SD, Leak DJ, Dalton H. 1983. Copper stress underlies the fundamental 384

change in intracellular location of methane monooxygenase in methane-oxidising 385

organisms: Studies in batch and continuous cultures. Biotechnol Lett 5: 487-492. 386

23. Williams PA, Coates L, Mohammed F, Gill R, Erskine PT, Coker A, Wood SP, Anthony C, 387

Copper JB. 2005. The atomic resolution structure of methanol dehydrogenase from 388

Methylobacterium extorquens. Acta Cryst. D61: 75-79. 389

24. Nunn D, Lidstrom ME. 1986. Phenotypic characterization of 10 methanol oxidation 390

mutant classes in Methylobacterium sp. strain AM1. J Bacteriol. 166: 591-597. 391

25. Skovran E, Palmer AD, Rountree AM, Good NM, Lidstrom ME. 2011. XoxF is required for 392

expression of methanol dehydrogenase in Methylobacterium extorquens AM1. J 393

Bacteriol. 193: 6032-6038. 394

26. Wu ML, Wessels HJCT, Pol A, Op den Camp HJM, Jetten MSM, van Niftrik L, Keltjens JT. 395

2015. XoxF-type methanol dehydrogenase from the anaerobic methanotroph 396

“Candidatus Methylomirabilis oxyfera”. Appl Environ Microbiol. 81: 1442-1451. 397

27. Harms N, Ras J, Koning S, Reijnders WNM, Stouthamer AH, van Spanning RJM. 1996. 398

Genetics of C1 metabolism regulation in Paracococcus dentrificans, p. 126-132. In 399

Lidstrom ME, Tabita FR (ed), Microbial growth on C1 compounds. Kluwer Academic 400

Publisher, Dordrecht Netherlands. 401

28. Schmidt S, Christen P, Kiefer P, Voholt JA. 2010. Functional investigation of methanol 402

dehydrogenase-like protein XoxF in Methylobacterium extorquens AM1. Microbiol. 156: 403

2575-2586. 404

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 20 of 23

29. Matsen JB, Yang S, Stein LY, Beck D, Kalyuzhnaya MG. 2013. Global molecular analyses 405

of methane metabolism in methanotrophic alphaproteobacterium, Methylosinus 406

trichosporium OB3b. Part I: transcriptomic study. Front Microbiol. 4:40. 407

30. Lapidus A, Clum A, LaButti K, Kaluzhnaya MG, Lin S, Beck DAC, Glavina del Rio T, Nolan 408

M, Mavromatis K, Huntemann M, Lucas S, Lidstrom ME, Ivanova N, Chistoserdova L. 409

2011. Genomes of three methylotrophs from a single niche reveal the genetic and 410

metabolic divergence of the Methylophilaceae. J Bacteriol. 193: 3757-3764. 411

31. Hibi Y, Asai K, Arafuka H, Hamajima M, Iwama T, Kawai K. 2011. Molecular structure of 412

La3+-induced methanol dehydrogenase-like protein in Methylobacterium radiotolerans. 413

J Biosci Bioeng. 111: 547-549. 414

32. Nakagawa T, Mitsui R, Tutani A, Sasa K, Tashiro S, Iwama T, Hayakawa T, Kawai K. 2012. 415

A catalytic role of XoxF1 as La3+-dependent methanol dehydrogenase in 416

Methylobacterium extorquens strain AM1. PLoS One. 7: e50480. 417

33. Pol A, Barends TRM, Dietl A, Khadem AF, Eygensteyn J, Jetten MSM Op den Camp HJN. 418

2014. Rare earth metals are essential for methanotrophic life in volcanic mudpots. 419

Environ Microbiol. 16: 255-264. 420

34. Whittenbury R, Phillips KC, Wilkinson JF. 1970. Enrichment, isolation and some 421

properties of methane-utilizing bacteria. J Gen Microbiol. 61: 205-218. 422

35. Semrau JD, Jagadevan S, DiSpirito AA, Khalifa A, Scanlan J, Bergman BH, Freemeier BC, 423

Baral BS, Bandow NS, Vorobev A, Haft DH, Vuilleumier S, Murrell JC. 2013. 424

Methanobactin and MmoD work in concert to act as the “copper-switch” in 425

methanotrophs. Environ Microbiol 15:3077–3086. 426

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 21 of 23

36. Kalidass B, Farhan Ul Haque M, Baral BS, DiSpirito AA, Semrau JD. 2014. Competition 427

between metals for binding to methanobactin enables expression of soluble methane 428

monooxygenase in the presence of copper. Appl Environ Microbiol. 81: 1024-2031. 429

37. Bandow NL, Gallager WH, Behling, L, Choi DW, Semrau JD, Hartsel SC, Gilles VS, DiSpirito 430

AA. 2011. Isolation of methanobactin from the spent media of methane oxidizing 431

bacteria. Meth. Enzymol. 495: 260 - 269. 432

38. Vorobev A, Jagadevan S, Baral BS, DiSpirito AA, Freemeier BC, Bergman BH, Bandow NL, 433

Semrau JD. 2013. Detoxification of mercury by methanobactin from Methylosinus 434

trichosporium OB3b. Appl Environ Microbiol. 79:5918–5926. 435

39. Farhan Ul Haque M, Kalidass B, Vorobev A, Baral BS, DiSpirito AA, Semrau JD. 2015. 436

Methanobactin from Methylocystis strain SB2 affects gene expression and methane 437

monooxygenase activity in Methylosinus trichosporium OB3b. Appl Environ Microbiol. 438

81: 2466-2473. 439

40. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative CT 440

method. Nat Protoc. 3:1101–1108. 441

41. Choi DW, Zea CJ, Do YS, Semrau JD, Antholine WE, Hargrove MS, Pohl NL, Boyd ES, 442

Geesey GG, Hartsel SC, Shafe PH, McEllistrem MT, Kisting CJ, Campbell D, Rao V, de la 443

Mora AM, Dispirito AA. 2006. Spectral, kinetic, and thermodynamic properties of Cu(I) 444

and Cu(II) binding by methanobactin from Methylosinus trichosporium OB3b. 445

Biochemistry 45:1442-1453. 446

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 22 of 23

42. El Ghazouani A, Basle A, Firbank SJ, Knapp CW, Gray J, Graham DW, Dennison C. 2011. 447

Copper-binding properties and structures of methanobactins from Methylosinus 448

trichosporium OB3b. Inorg Chem 50:1378-1391. 449

43. Pesch M-L, Christl I, Hoffmann M, Kraemer SM, Kretzschmar R. 2012. Copper 450

complexation of methanobactin isolated from Methylosinus trichosporium: OB3b: pH-451

dependent speciation and modeling. J Inorgan Biochem 116:55 - 62. 452

44. Kalyuzhnaya MG, Hristova KR, Lidstrom ME, Chistoserdova L. 2008. Characterization of a 453

novel methanol dehydrogenase in representatives of Burkholderiales: implications for 454

environmental detection of methylotrophy and evidence for convergent evolution. J 455

Bacteriol. 190: 3817-3823. 456

45. Knapp CW, Fowle DA, Kulczycki E, Roberts JA, Graham DW. 2007. Methane 457

monooxygenase gene expression mediated by methanobactin in the presence of 458

mineral copper sources. Proc. Natl Acad Sci. 104: 12040-12045. 459

460

461

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Page 23 of 23

FIGURE LEGENDS 462

Figure 1. Metals associated with the biomass of M. trichosporium OB3b grown in the presence 463

of varying amounts of copper and cerium. (A) Copper. (B) Cerium. Errors bars represent the 464

standard deviation of triplicate samples. Columns in each plot labeled by different letters are 465

significantly different (P < 0.05). 466

467

Figure 2. RT-qPCR of (A) mmoX , (B) pmoA, (C) mxaF, (D) mxaI, (E) xoxF1, and (F) xoxF2 genes 468

in M. trichosporium OB3b grown in the presence of varying amounts of copper and cerium. 469

Errors bars represent the standard deviation of triplicate samples. Columns in each plot labeled 470

by different letters are significantly different (P < 0.05). 471

472

Figure 3. SDS-polyacrylamide gel electrophoresis of cell-free extracts of M. trichosporium OB3b 473

grown with varying amounts of copper and cerium. (S) molecular weight standards [kDa], (1) 474

M. trichosporium OB3b grown with 0 µM copper plus 0 µM cerium, (2) M. trichosporium OB3b 475

grown with 0 µM copper plus 25 µM cerium (3) M. trichosporium OB3b grown with 10 µM 476

copper plus 0 µM cerium, (4) M. trichosporium OB3b grown with 10 µM copper plus 25 µM 477

cerium. 478

479

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Table 1. Primers used in this study.

primer Targeted gene Sequence (5’ – 3’) Reference

qpmoA_FO pmoA TTCTGGGGCTGGACCTAYTTC 45 qpmoA_RO CCGACAGCAGCAGGATGATG qmmoX_FO mmoX TCAACACCGATCTSAACAACG 45 qmmoX_RO TCCAGATTCCRCCCCAATCC

q16S rRNA_FO 16S rRNA GCAGAACCTTACCAGCTTTTGAC 45 q16S rRNA_RO CCCTTGCGGGAAGGAAGTC qmxaF_FO mxaF CTACATGACCGCCTATGACG This study qmxaF_RO ATTGGCCTTGTTGAAGTCGT qmxaI_FO mxaI TACGATCCCAAGCATGACCC This study qmxaI_RO CGTAGATCCATTTGCCGCTC qxoxF1_FO xoxF1 TCAAGGACAAGGTGTTCGTC This study qxoxF1_RO CGAGCCGTCCTTGATGTTAT qxoxF2_FO xoxF2 GCGCGAAGGATTGGGAATAT This study qxoxF2_RO GCCTCGTAATTCATGCACAG

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on Decem

ber 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from