Upload
others
View
10
Download
0
Embed Size (px)
Citation preview
Nano Res
1
Oligonucleotide delivery by chitosan-functionalized
porous silicon nanoparticles
Morteza Hasanzadeh Kafshgari1, §, Bahman Delalat1, §, Wing Yin Tong1, Frances J. Harding1, Martti
Kaasalainen2, Jarno Salonen2, Nicolas H. Voelcker1 ()
Nano Res., Just Accepted Manuscript • DOI 10.1007/s12274-015-0715-0
http://www.thenanoresearch.com on January 8, 2015
© Tsinghua University Press 2014
Just Accepted
This is a “Just Accepted” manuscript, which has been examined by the peer-review process and has been
accepted for publication. A “Just Accepted” manuscript is published online shortly after its acceptance,
which is prior to technical editing and formatting and author proofing. Tsinghua University Press (TUP)
provides “Just Accepted” as an optional and free service which allows authors to make their results available
to the research community as soon as possible after acceptance. After a manuscript has been technically
edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP
article. Please note that technical editing may introduce minor changes to the manuscript text and/or
graphics which may affect the content, and all legal disclaimers that apply to the journal pertain. In no event
shall TUP be held responsible for errors or consequences arising from the use of any information contained
in these “Just Accepted” manuscripts. To cite this manuscript please use its Digital Object Identifier (DOI® ),
which is identical for all formats of publication.
Nano Research
DOI 10.1007/s12274-015-0715-0
Oligonucleotide delivery by chitosan-
functionalized porous silicon
nanoparticles
Morteza Hasanzadeh Kafshgari1, §,
Bahman Delalat1, §, Wing Yin Tong1,
Frances J. Harding1, Martti Kaasalainen2,
Jarno Salonen2, Nicolas H. Voelcker1*
1ARC Centre of Excellence in
Convergent Bio-Nano Science and
Technology, Mawson Institute,
University of South Australia, GPO Box
2471, Adelaide SA 5001, Australia 2 Department of Physics and Astronomy,
University of Turku, FI-20014 Turku,
Finland
§ These authors contributed equally to
this work
Chitosan coating of oligonucleotide-loaded porous silicon
nanoparticles afforded sustained oligonucleotide release in vitro and
enhanced nanoparticle permeation across the cell membrane.
Prof. Nicolas H. Voelcker, https://bionanotech.unisa.edu.au/
Oligonucleotide delivery by chitosan-functionalized porous silicon nanoparticles
Morteza Hasanzadeh Kafshgari1, §, Bahman Delalat1, §, Wing Yin Tong1, Frances J. Harding1, Martti
Kaasalainen2, Jarno Salonen2, Nicolas H. Voelcker1 ()
§
Received: day month year
Revised: day month year
Accepted: day month year
(automatically inserted by
the publisher)
© Tsinghua University Press
and Springer-Verlag Berlin
Heidelberg 2014
KEYWORDS
Nanoparticles
Porous silicon
Chitosan
Gene delivery
ABSTRACT
Porous silicon nanoparticles (pSiNPs) are a promising nanocarrier system for
drug delivery owing to their biocompatibility, biodegradability and non-
inflammatory nature. Here, we investigate the fabrication and characterization
of thermally hydrocarbonized pSiNPs (THCpSiNPs) and chitosan-coated
THCpSiNPs for therapeutic oligonucleotide delivery. Chitosan coating after
oligonucleotide loading significantly improves sustained oligonucleotide
release and suppressed burst release effects. Moreover, cellular uptake,
endocytosis and cytotoxicity of oligonucleotide-loaded THCpSiNPs are
evaluated in vitro. Standard cell viability assays demonstrate that cells
incubated with the NPs at a concentration of 0.1 mg/mL are 95% viable. In
addition, chitosan coating significantly enhances the uptake of oligonucleotide-
loaded THCpSiNPs across the cell membrane. Moreover, histopathological
analysis of liver, kidney, spleen and skin tissue collected from mice receiving
NPs further demonstrates the biocompatible and non-inflammatory property
of the NPs as a gene delivery vehicle for intravenous and subcutaneous
administration in vivo. Taken together, these results suggest that THCpSiNPs
provide a versatile platform that could be used as efficient vehicles for the
intracellular delivery of oligonucleotides for gene therapy.
Address correspondence to Nicolas H. Voelcker, [email protected]
Nano Research
DOI (automatically inserted by the publisher)
Research Article
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
2 Nano Res.
1 Introduction
In recent years, oligonucleotide drugs have
emerged to yield promising results in the treatment
of a wide range of diseases, including cancer, AIDS,
neurological and cardiovascular disorders [1-3]. For
example, aptamers have become legitimate
alternatives to therapeutic antibodies [4]. Likewise,
antisense RNA and small interfering RNA (siRNA)
can be used to modulate gene expression and
activity [5, 6]. In contrast to small molecule drugs,
which suffer from poor specificity, selectivity and
off-target effects, oligonucleotides can be targeted at
specific molecular pathways (via aptamers) and
genes (via antisense RNA and siRNA). Many
functional therapeutic oligonucleotides have been
uptaken by cells in vitro and the expression of these
oligonucleotides in different tissues has been
demonstrated in vivo, however, human clinical trials
of gene therapies have been not satisfactory except
a couple of individual cases of success against a
background of unexpectedly high morbidity and
mortality rates [7-10].
Viral vectors possess certain advantages for
transfection, including high efficiency and stable
integration of exogenous oligonucleotide into the
host genome, however, they are subjected to several
problems such as immunogenicity, toxicity, large-
scale production challenges and limitations in the
size of the DNA insert. In case of lentiviruses,
random integration into the host genome risks
inducing tumorigenic mutations and generating
active viral particles through recombination [7, 8,
11]. Therefore, in order to minimize potential side
effects, and to improve methods of gene delivery,
non-viral vectors are a promising alternative,
offering a higher degree of safety and ease of
manufacture [8, 12]. In this context, emphasis has
been placed on cationic lipids and polymers, which
can trap nucleic acids via electrostatic interactions
[5]. Moreover, certain cationic polymers
disintegrate into low molecular weight fragments
under physiological conditions, which can be
excreted from the body without inducing
significant cytotoxicity [13]. However, cationic
polymers still possess significant drawbacks when
applied to nucleic acid delivery: limited delivery
efficiency, toxicity at higher concentrations,
potential induction of adverse interactions with the
biological cellular fluid environment contains
negatively charged macromolecules, and a
disability to reach target cells beyond the
vasculature [12, 14, 15].
Porous silicon (pSi), which is available in the form
of membranes, micro- and nanoparticles is a high
surface area, biocompatible and bioresorbable form
of silicon [16], widely employed in biomedical
applications including drug delivery of proteins [17,
18], enzymes [19, 20], nitric oxide [21], small
molecular drugs [22-24] and nucleic acids [16, 25].
Oligonucleotide delivery from pSi based vectors has
been successfully demonstrated recently using
mesoporous silicon microparticles loaded with
nanoliposomes that contained siRNA [25]. The pore
size of pSi can be tuned from a few nm to hundreds
of nm by adjusting the current density as well as the
type and concentration of dopant during the
electrochemical anodization of single crystal silicon
[16, 23]. Similarly, pSi porosity can be adjusted
between 40 and 80% [16, 26]. Pore size and porosity
are important parameters for determining the drug
loading and the degradation rates of the pSi
excipient [16, 23]. In contrast to mesoporous silica,
pSi degrades in physiological environments.
Furthermore, pSi is well tolerated in vitro and in
vivo and its degradation product, silicic acid, is non-
toxic and is rapidly cleared by the body [16, 27].
However, freshly prepared pSi degrades rapidly in
aqueous medium, and needs to be modified
chemically using processes such as oxidation,
silanization, hydrosilylation [16, 28] or coating with
polymers [16, 28] to improve its stability to a level
that is useful for drug delivery. Doing so affords a
biodegradable material with a wide stability
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
3 Nano Res.
window, ranging from minutes to months [16].
A method to produce a very stable Si-C layer on the
pSi surface, thermal hydrocarbonization (THC), has
been recently developed by Salonen and co-workers
[29, 30] THC involves adsorption of acetylene at
room temperature to the pSi surface, followed by
formation of carbon-silicon bonds at around 500 °C.
In contrast to freshly etched pSi, THCpSi surfaces
are resistant to degradation in the short term, even
in harsh chemical environments. Nevertheless, they
do degrade over longer timeframes [29, 31, 32].
Models of oral drug delivery suggest that
THCpSiNPs can deliver a therapeutic drug payload
to the surface of the intestine, which results in drug
permeation across the intestinal epithelial layer
without loss of activity [33]. In vivo, THCpSiNPs
have been reported to sustain release of a peptide
model drug for several days when implanted
subcutaneously [34].
Owing to the hydrophobicity of THCpSiNPs, it is
important to further functionalize the surface of
THCpSiNPs to avoid particle aggregation under
physiological conditions. One method by which this
can be achieved is by coating THCpSiNPs with
polymers, including polyelectrolytes and
polysaccharides [28, 35, 36]. Chitosan is a
biodegradable, biocompatible polysaccharide that is
particularly suitable to employ for this purpose [14,
37]. Its positive charge promotes electrostatic
interactions between the pSiNP and negatively
charged oligonucleotides and cell membranes,
facilitating both the loading of particles and uptake
of the nanocarrier into the cell interior [38].
Chitosan has several interesting features relevant to
drug delivery applications [14, 37, 39, 40], including
its mucoadhesive properties which enhance
mucosal penetration. Previously, Wu and Sailor
used chitosan hydrogel to cap porous silicon
dioxide films to provide a pH-responsive insulin
release [41].
To the best of our knowledge, the combination of
chitosan and pSiNPs has not been reported yet.
Here, we investigated the loading of
oligonucleotides into and release from THCpSiNPs
with and without chitosan coating. Our hypothesis
was that chitosan coating of oligonucleotide-loaded
pSi would enable better control over the
oligonucleotide release kinetics. We also studied
and compared THCpSiNP cytotoxicity and cellular
uptake in vitro using laser scanning confocal
microscopy and transmission electron microscopy.
In order to further evaluate the biocompatibility, we
investigated the histological changes of organs in
mice receiving intravenous and subcutaneous
administration of the CS/oligo/THCpSiNPs.
2 Experimental 2.1 Materials
Silicon wafers (p+ type, 0.01–0.02 Ωcm) were
obtained from Siegert Consulting Co., Aachen,
Germany. A low molecular weight chitosan with an
average degree of deacetylation 71% and molecular
weight 119 kDa (see Electronic Supplementary
Material (ESM), Fig. S1, S2 and S3, Table S1) was
obtained from Sigma-Aldrich (St. Louis, MO).
Ethanol (EtOH), glacial acetic acid, phosphate
buffered saline (PBS), human serum male AB
plasma (HSP), ethylenediaminetetraacetic acid
(EDTA), hydrogen chloride (HCl), sodium sulphite,
sodium metasilicate pentahydrate, Trizma®
hydrochloride (Tris–HCl), ammonium molybdate,
sodium hydroxide (NaOH), 1-decene, tris-2,3,6-
(dimethylaminomethyl)phenol (DMP-30),
dodecenylsuccinic anhydride (DDSA), Embed812
resin (procure 812), Araldite® 502 epoxy resin,
osmium tetroxide solution (for electron microscopy,
4% in H2O), sucrose, uranyl acetate were purchased
from Sigma-Aldrich and used as received.
Hydrofluoric acid (HF, 38-40%) was obtained from
Merck Millipore (Darmstadt, Germany). Cellulose
membrane dialysis tube (Mw cut-off 50000 Da;
Spectra/Por Biotech-Grade) was obtained from
Cole-Parmer (Chicago, IL).
5’→GAGGCTTTGATCGTCAAGTTT→3’ (short
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
4 Nano Res.
single strand oligonucleotide) and 5’→FAM-
GAGGCTTTGATCGTCAAGTTT→3’ (FAM-labeled
oligo, single short oligonucleotide strand) were
synthesized by GeneWorks (Thebarton, SA,
Australia).
For mammalian cell culture, the following reagents
were used: paraformaldehyde solution (4%,
Electron Microscopy Sciences, Ft Washington, MD).
DMEM culture medium, Opti-MEM culture
medium, fetal bovine serum (FBS), L-glutamine,
penicillin, streptomycin, amphotericin B, Hoechst
33342 (all from Invitrogen, Carlsbad, CA), sterile
0.01 M PBS, pH 7.4 (PBS), Triton X100, propidium
iodide (PI), fluorescein diacetate (FDA), phalloidin-
TRITC (all from Sigma-Aldrich), lactate
dehydrogenase cytotoxicity assay kit II (LDH,
Abcam, Cambridge, UK), fluoro-gel mounting
medium (ProSciTech, Kirwan, Qld, Australia) and
trypsin (0.05%, EDTA 0.53 mM, Invitrogen) were all
used as received. Incubation of cells with
THCpSiNPs took place at 37 oC unless otherwise
stated. All solutions were prepared using
ultrapurified water supplied by a Milli-Q system
(Millipore, Billerica, MA). BSR cells, a clone of
immortalized baby hamster kidney fibroblast cells
(ATCC CCL-10) from American Type Culture
Collection (Manassas, VA), were used in the in vitro
experiments.
For histopathological studies, the following
reagents were used: neutral buffered formalin was
purchased from Chem-Supply (Gillman, SA,
Australia). Staining reagents, Lillie-Mayer’s
hematoxylin and eosin (H&E) were obtained from
Australian Biostain P/L (Traralgon, VIC, Australia).
2.2 Fabrication of THCpSiNPs
THCpSiNPs were fabricated according to the
previously reported procedure [21, 29] from p+ type
(0.01–0.02 Ωcm) silicon wafers by periodically
etching at 50 (2.2 s period) and 200 (0.35 s period)
mA/cm2 in a solution of 1:1 HF(38%):EtOH for 20
min. Afterwards, the THCpSi films were detached
from the substrate by abruptly increasing the
current density to electropolishing conditions
(250 mA/cm2, 3 s period). The detached multilayer
pSi films were then thermally hydrocarbonized
under N2/acetylene (1:1, vol.) flow at 500 °C for
15 min, and cooled down to room temperature
under a stream N2 gas. Subsequently, THCpSiNPs
were produced by wet ball-milling (ZrO2 grinding
jar, Pulverisette 7, Fritsch GmbH, Idar-Oberstein,
Germany) of the thermally hydrocarbonized pSi
films in 1-decene. THCpSiNPs were harvested by
centrifugation (1500 × g, 5 min). THCpSiNP stock
solutions in EtOH of concentration 0.05 mg/mL and
0.1 mg/mL were prepared prior to oligonucleotide
loading and chitosan capping.
2.3 Nitrogen sorption measurements
Nitrogen adsorption/desorption measurements
(Tristar 3000 porosimeter, Micromeritics Inc.,
Norcross, GA) were used to calculate the pore
volume, average pore diameter, and specific surface
area of THCpSiNPs.
2.4 Oligonucleotide loading
2 µL of the oligonucleotide solution (950 µg/mL in
MilliQ water) was added to 0.1 mg/mL THCpSiNPs
suspension in EtOH (48 µL). The mixture was well
dispersed by sonication for 30 s, then continuously
shaken at 100 rpm at room temperature for 5 h.
After incubation, the supernatant was separated by
centrifugation of the THCpSiNPs from the
oligonucleotide solution (5000 rpm, 5 min). These
particles are referred to as oligo/THCpSiNPs. The
amount of the absorbed oligonucleotide by the
particles (loading efficiency %) was calculated by
UV-Vis spectrophotometry measurements at
260 nm from three replicates. The amount of
oligonucleotide loaded into the THCpSiNPs was
calculated by subtracting the amount of
oligonucleotide in the supernatant from the initial
amount of oligonucleotide present in the loading
solution (38 µg/mL).
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
5 Nano Res.
2.5 Chitosan coating on oligo/THCpSiNPs
To prepare chitosan-coated particles, referred to as
CS/oligo/THCpSiNPs, the oligo/THCpSiNPs were
added to chitosan solutions of concentrations 0.05
and 0.1% w/v. Coating was performed at pH 5.6,
above the isoelectric point (IEP) of
oligo/THCpSiNPs (see Fig. 1a) but below the pKa of
chitosan. This both allowed electrostatic interaction
between the oligo/THCpSiNPs and chitosan to be
harnessed for coating and avoided gelation of
chitosan, which occurs above the pKa. The
CS/oligo/THCpSiNPs were then dispersed by
sonication for 1 min. The pSiNP suspension was
incubated at 25 °C for 20 min and then centrifuged
at 7000 rpm at 25 °C for 10 min. After removing the
supernatant, which contains the remaining chitosan
and any oligonucleotide released during the coating
process, the final oligonucleotide loading (LE) after
chitosan coating was calculated as above (section
2.5). Then, in order to prevent degradation and
preservation of the loaded oligonucleotide, sterile
CS/oligo/THCpSiNPs were kept at 4 °C until use in
oligonucleotide release, in vitro and in vivo studies
[36].
To determine the amount of chitosan coated on the
THCpSiNPs, the chitosan concentration in acetic
acid solution (pH 5.6, as per conditions used for
coating) was determined using a standard curve,
which was plotted by measuring the conductivity
(Zetasizer Nano ZS, Malvern). The amount of
coated chitosan was calculated from the difference
in chitosan concentration in the solution before and
after chitosan coating process. After chitosan
coating, the mean particle size and size distribution
of the prepared NPs were determined by DLS and
SEM.
2.6 Scanning electron microscopy (SEM)
Morphological studies of THCpSiNPs and chitosan-
coated THCpSiNPs were carried out by means of
SEM (Quanta™ 450 FEG; FEI, Hillsboro, OR)
collecting the back-scattered electrons (30 kV beam
energy under high vacuum 6×10-4 Pa). The samples
were prepared by allowing a single drop of
nanoparticle suspension to dry overnight at room
temperature on a homemade graphite slice stacked
by a double-stick carbon tape to the standard SEM
holder.
2.7 Transmittance electron microscopy (TEM)
TEM images of THCpSiNPs, oligo/THCpSiNPs and
CS/oligo/THCpSiNPs were acquired on a TEM
(JEM-2100F TEM, JEOL USA, Inc., MA, USA) with
20–120 kV beam energy under high vacuum 1×10–5
Pa. The samples were prepared by allowing a single
drop of nanoparticle suspension to dry overnight at
room temperature on a 200-mesh copper grid
(ProSciTech Co., Thuringowa, Qld, Australia).
2.8 Dynamic light scattering (DLS)
Mean particle size and size distribution along with
the polydispersity index (PDI) and surface zeta (ζ)-
potential of NPs were determined by dynamic light
scattering using a Zetasizer Nano ZS (Malvern,
Worcestershire, UK). The analysis was carried out
at a scattering angle of 90° at a temperature of 25 °C
using NPs dispersed in Milli Q water.
2.9 ζ-Potential measurements
To optimize the oligonucleotide loading and
chitosan coating conditions for THCpSiNPs, we
measured the ζ-potential with the Zetasizer Nano
ZS [42]. THCpSiNPs were suspended in de-ionized
water at a concentration of 0.1 mg/mL. Titration of
ζ-potential against pH was used to determine the
IEP of THCpSiNPs before and after oligonucleotide
loading and chitosan coating. HCl and NaOH were
used as titrants, and the addition of new ions to the
solution was taken into account using Henry's
function [43]. In each case, IEP was determined by
interpolating the titration curve in a linear fashion
to calculate the pH at which ζ-potential would
reach a value of zero.
To assess the stability of the chitosan coating on the
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
6 Nano Res.
NPs, a 0.1 mg/mL CS/oligo/THCpSiNP suspension
was prepared in de-ionized water and adjusted to
pH 7.4 with HCl (0.01 M). At this pH, the ζ-
potential of CS/oligo/THCpSiNPs is positive and
that of oligo/THCpSiNPs negative. The ζ-potential
of the solution was measured over several days.
Each data point is the average of at least three
individual measurements.
2.10 Oligonucleotide release experiments
After preparation of oligo/THCpSiNPs and
CS/oligo/THCpSiNPs, oligonucleotide release
kinetic profiles were established. Oligo/THCpSiNPs
and CS/oligo/THCpSiNPs coated with chitosan
solutions of concentration 0.05 and 0.1% w/v were
suspended at 0.1 mg/mL in PBS. To avoid NP
interference in UV absorbance measurements,
100 µL sample of each solution was then poured
into a dialysis “bag” (Mw cut-off: 50000 Da) fitted
inside of a quartz cuvette (3 mL) filled with PBS and
maintained at 37 ± 0.5 °C. The amount of
oligonucleotide released was measured using
UV/Vis spectrophotometry (HP8453, Agilent
Technologies, Santa Clara, CA) every 5 min for 35 h.
All release experiments were conducted in
triplicate.
2.11 Cell culture and cell-based assays
BSR cells were seeded onto flat-bottomed 96-well
tissue culture plates at a density of 3×104 cells/cm2 in
DMEM supplemented with 10% v/v FBS, 2 mM L-
glutamine, 100 U/mL penicillin, 100 µg/mL
streptomycin and cultured at 37 °C, 5% CO2
atmosphere, and 9% relative humidity for 24 h
before incubation with NPs. Cells were grown to
80% confluence before exposure to NPs.
After 24 h, the medium was removed and cells were
exposed to Opti-MEM culture medium
supplemented with 5% (v/v) FBS containing
0.1 mg/mL of oligo/THCpSiNPs and
CS/oligo/THCpSiNPs at 37 °C, 5% CO2. During
cellular uptake of NPs, culture medium was used
without antibiotics. FAM-labeled oligonucleotide
was used to load the NPs in order to investigate
cellular uptake. Controls were generated by
incubating BSR cells in Opti-MEM without NPs for
an identical period. Following set incubation
periods (1, 3, 5, 8, 16 and 24 h), cells were washed
with PBS to remove the non-internalized NPs. The
cells were fixed in 4% paraformaldehyde solution
for 30 min, and then permeablized with 0.25%
Triton X100 for 5 min at room temperature. The
nuclei of cells were stained with 2 µg/mL Hoechst
33342 for 15 min at room temperature. Cells were
also stained with 100 µM phalloidin-TRITC for
45 min. After washing with PBS, cells were
mounted with Fluoro-gel mounting reagent. Cells
were imaged using the inverted fluorescence
microscope Eclipse Ti-S and a Nikon A1 laser
scanning confocal microscope. The efficiency of
cellular uptake of NPs was assessed by counting the
number of cells that exhibited green fluorescence
(from the FAM label) and the total number of cells
present. Cellular uptake efficiency was calculated as
the average of seven replicate fields of view selected
at random across the culture well.
In vitro cellular toxicity of oligo/THCpSiNPs and
CS/oligo/THCpSiNPs was evaluated using BSR
cells. The cells were seeded onto the 96-well plates
at a density of 3×104 cells/cm2 and maintained in
DMEM supplemented as above in 5% CO2 at 37 °C
for 24 h. The cultured cells were incubated with
prepared sterile CS/oligo/THCpSiNPs and
oligo/THCpSiNPs at a concentration 0.1 mg/mL
(50 µL/well) for 48 h to determine the effect of the
NPs treatment on cell viability by means of the
lactate dehydrogenase (LDH) assay and Live/Dead
assay. After incubation, the LDH assay was
performed following manufacturer’s instructions in
order to identify the percentage of live and dead
cells. The Live/Dead assay was performed using
final concentration of 15 µg/mL FDA and 5 µM PI
for 3 min at 37 °C, to count the live and dead cells,
respectively. All experiments were repeated at least
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
7 Nano Res.
three times.
For TEM imaging, BSR cells were seeded on
cellulose membrane dialysis tube in a 24 well plate
at a density of 3×104 cells/cm2 for 24 h in DMEM
supplemented as above at 37 °C, 5% CO2. After
incubation, the medium was removed and cells were
exposed to Opti-MEM culture medium
supplemented with 5% v/v FBS containing
0.1 mg/mL of CS/oligo/THCpSiNPs for 24 h at 37 °C,
5% CO2. For control experiments, medium without
the NPs was used. After incubation, BSR cells
cultured on the dialysis tubing were fixed using 4%
paraformaldehyde with 4% sucrose in 0.1 M PBS
(pH 7.2) overnight. Aqueous osmium tetroxide
solution (2.0% w/v) was added to the fixed cells and
incubated for 1 h. The cell sample was dehydrated
through an ethanol series (70% to 100% with 5% step
increases). In order to embed the cells, the sample
was incubated in absolute ethanol and resin mixture
(Araldite 502, procure 812, D.D.S.A., DMP-30) (1:1),
then incubated in pure resin mixture. The cells were
transferred to embedding moulds containing fresh
pure resin mixture, which was then polymerized for
24 h at 70 °C. Sample sections of 60 nm thickness
were cut with a diamond knife and transferred to a
regular copper mesh grid for imaging. The prepared
copper grids were stained with uranyl acetate for
15 min, and rinsed with distilled water and then
stained with lead citrate for 3-5 min, and then rinsed
with de-ionized water. The samples were then
imaged on a Tecnai™ Spirit Philips TEM.
2.12 In vivo histopathological experiments
Three adult male skh:hr mice, 8-10 weeks old,
weighing 30 ± 2 g, were housed and handled
according to guidelines and protocols approved by
the Animal Ethics Committee of the University of
South Australia. One week before the administration
of CS/oligo/THCpSiNPs, the mice were housed in
standard polycarbonate stainless steel wire-topped
cages (ventilated temperature-controlled animal
room (20 ± 2 °C), relative humidity of 60 ± 10%, and
a 12 h light/dark daily cycle) with free access to
mouse chow and water. Mice were randomly
allocated to receive either intravenous (IV) injection
of CS/oligo/THCpSiNPs at a dose of 700 µg/kg, or an
equal volume of saline as control. To investigate the
localized effect imposed to the injection site, the
same dose of NPs was injected subcutaneously (SC)
at the right flank of the third mouse. To enable
internally controlled comparison, saline was injected
SC at the left flank of the same mouse. After 24 h, all
mice were euthanized by cervical dislocation under
anesthesia, and tissue specimens from the skin (the
tissue of the SC injection area), liver, kidney and
spleen were collected and immersion fixed in 10%
neutral buffered formalin for 48 h at 4 °C. The fixed
specimens were rinsed, dehydrated through an
incremental concentration series, and finally
dehydrated in xylene. Subsequently all tissues were
embedded in paraffin, and sectioned by microtome.
Histological sections (thickness: 5 µm) were stained
with hematoxylin/eosin stain, followed by mounting
and imaging with a light microscope (Olympus BH-
2, Tokyo, Japan). To observe NP fluorescence at the
site of SC injection histological skin sections (SC
injection area) were stained with 2 µg/mL Hoechst
33342 for 15 min at room temperature and observed
with a Nikon Eclipse Ti-S fluorescence microscope.
3. Results and discussion
In this work, we studied THCpSiNPs as vehicles for
therapeutic oligonucleotide delivery. Firstly, we
studied the physico-chemical properties of
unloaded THCpSiNPs, including chemical
composition, nanostructure, porosity, size
distribution, and ζ-potential. Subsequently, we
systematically characterized the capacity of both
native and chitosan-coated THCpSiNPs to load
short oligonucleotides (21 nucleobases in length).
The stability of chitosan coating on the surface of
THCpSiNPs was scrutinized by electrophoretic
light scattering. Release of oligonucleotide from
THCpSiNPs and CS/oligo/THCpSiNPs was
compared. Finally, cellular uptake of FAM-labeled
oligonucleotides released from chitosan coated and
uncoated THCpSiNPs by BSR cells was investigated
using fluorescence microscopy, confocal
microscopy and TEM. Finally, the toxicity of
THCpSiNPs was assessed in vitro and in vivo.
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
8 Nano Res.
3.1 Characterization of the THCpSiNPs
Previously, Salonen and co-workers investigated
the size distribution and optimum average diameter
of THCpSiNPs for drug and peptide delivery [29,
30, 33]. This previous characterization has allowed
us to tailor the properties of our THCpSiNPs to
feature an average particle size of 137 nm (PDI:
0.149) according to DLS and a ζ-potential of -43 mV
at pH 7.4 (Fig. S1, ESM) with an average pore size of
9 nm.
Chitosan was subsequently coated onto the surface
of the THCpSiNPs. The amino group in chitosan
has a pKa value of ~6.5, and is protonated in acidic
solutions, with charge density dependent on pH
and the degree of deacetylation [44, 45]. Hence, the
coating procedure was performed at pH 5.6 in order
to harness the electrostatic interaction between
positively charged chitosan and negatively charged
THCpSiNPs. The diameter of the particles coated
using 0.1% chitosan solution increased to 229 nm
(PDI: 0.085) according to DLS. An increase in size
(form 193 nm to 249 nm) was observed when the
chitosan coating was applied to THCpSiNPs loaded
with a short oligonucleotide (21 nucleobases in
length) from a EtOH/water solution. SEM and TEM
images of THCpSiNPs, oligo/THCpSiNPs and
CS/oligo/THCpSiNPs showed particles with
asymmetric shape and with sizes in agreement with
the DLS results (see Fig. S4, S5 and S6, ESM).
CS/oligo/THCpSiNPs showed a positive of 19 mV at
pH 7.4, whilst oligo/THCpSiNPs had a negative ζ-
potential of -21 mV (Fig. 1a). Chitosan coating of
THCpSiNPs without oligonucleotide loading also
increased the ζ-potential (by 19 mV) at pH 7.4 (see
Fig. S7, ESM).
Furthermore, ζ-potential studies showed an IEP of
5.2 and 9.2 for oligo/THCpSiNPs and
CS/oligo/THCpSiNPs, respectively (Fig. 1a). In
contrast, the IEP for THCpSiNPs is 4.6 [42]. The
observed increase in IEP is consistent with the
loading of oligonucleotides into NPs and
subsequent coating with chitosan because of the
presence of the positive amine groups on the
surface of the NPs [17, 44].
The stability of the chitosan coating was assessed by
monitoring changes in ζ-potential over time at
pH 7.4 (Fig. 1b). Judging from the reduction in ζ-
potential, it appears that the majority of the
chitosan coating was slowly lost over the course of 2
d from the oligo/THCpSiNPs. The gradual
shedding of the chitosan coating was deemed
beneficial for gene delivery applications.
Figure 1. (a) Measurement of IEP by pH titration for
THCpSiNPs (□), oligo/THCpSiNPs (∆), CS/oligo/THCpSiNPs
(◊) and (b) stability of chitosan coating on oligo/THCpSiNPs
over 5 d as measured by reduction in ζ-potential (analysis
performed at pH 7.4). Concentration of chitosan coating
solution 0.1% w/v. (n = 3; mean ± standard deviation shown).
A conductometric method was used to determine
the amount of loaded chitosan on the surface of
THCpSiNPs. The amount of chitosan present on the
NPs was dependent on the chitosan solution
concentration during coating (pH 5.6). Increasing
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
9 Nano Res.
the chitosan concentration from 0.05 to 0.1% w/v
marginally increased the amount of chitosan coated
on the surface of THCpSiNPs from 0.92 to 1.4 µg of
chitosan per µg of NPs. We expected little
penetration of chitosan into the pores of
THCpSiNPs, due to the large gyration radius of
chitosan (∼46 nm, Fig. S3, ESM) compared to the
average pore size of THCpSiNPs (∼9 nm). Indeed,
we intended the chitosan to cap the pores rather
than penetrate into them. In addition, after chitosan
coating, morphology and roughness of THCpSiNPs
changed to exhibit more soft and edgeless surfaces
(see ESM, Fig. S5).
3.2 Oligonucleotide loading efficiency
Next, we studied the capacity of THCpSiNPs to
load oligonucleotide. Considering the average pore
diameter of 9 nm, specific surface area of 202 m2/g
and pore volume 0.51 cm3/g of THCpSiNPs, these
nanostructured nanocarriers are expected to be a
high performing vehicle for oligonucleotide
delivery [29, 33]. The surface properties and the
molecular structure of the THCpSi have in the past
been reported to greatly impact the adsorption of
biomolecules into such nanocarriers [34].
Therapeutic agents are generally physisorbed onto
the pSi and are released from the surface and the
pores via diffusion and pore degradation [19, 33].
Table 1 shows the efficiency and capacity of
oligonucleotide loading into THCpSiNPs. Loading
efficiency was compared before and after chitosan
coating by UV-Vis spectroscopic analysis of the
amount of oligonucleotides remaining in the
supernatant.
The highest oligonucleotide loading efficiency was
observed for uncoated oligo/THCpSiNPs. The
loading efficiency progressively decreased for
CS/oligo/THCpSiNPs coated with 0.05 % w/v
chitosan solution and with 0.1 % w/v chitosan
solution. Egress of the oligonucleotide from the
pore structure into the surrounding aqueous
environment may increase with the concentration of
the chitosan coating solution because of the
attractive positive charge of the chitosan still in
solution [17]. Nevertheless, the oligonucleotide
loading efficiency of CS/oligo/THCpSiNPs coated
using 0.1 % w/v chitosan solution still exceeded
68%. Hence, both chitosan coated and uncoated
THCpSiNPs were considered to have demonstrated
suitable loading capacity for oligonucleotides.
Table 1. Loading efficiency of oligo/THCpSiNPs and
CS/oligo/THCpSINPs, measured by UV-Vis spectroscopy. NP
concentrations of 0.1 mg/mL were used for all tests. (n ≥ 5;
mean ± standard deviation shown).
Concentration of
chitosan coating
solution
(% w/v)
Loading capacity
(μg oligos/mg
NPs)
Loading
efficiency
(%)
0.00 16.7 ± 0.4 81 ± 4
0.05 14.8 ± 0.8 74 ± 8
0.1 14.2 ± 0.5 68 ± 5
3.3 Sustained oligonucleotide release from
CS/oligo/THCpSiNPs
The amount of oligonucleotide released from
Oligo/THCpSiNPs and CS/oligo/THCpSiNPs was
quantified by measuring the absorbance of the PBS
solution containing the released oligonucleotide at
260 nm (37 oC, pH 7.4). These data are shown as a
function of time in Fig. 2. Release kinetics from all
THCpSiNPs showed an initial burst occurring for
the first few hours, followed by a slow release phase
that approximates linear release up to 35 h (0.93 ≤ R2
≤ 0.99). The difference in the release kinetics
between CS/oligo/THCpSiNPs coated using
chitosan concentrations of 0.05 or 0.1 % w/v was
insignificant. However, the initial burst release for
the CS/oligo/THCpSiNPs was significantly reduced
in comparison to oligo/THCpSiNPs. Modification of
THCpSiNPs through a chitosan-coating slows
down oligonucleotide release and limits the extent
of burst release below 8 %.
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
10 Nano Res.
Figure 2. Effect of chitosan coating and concentration on
oligonucleotide release profile from samples:
oligo/THCpSiNPs (red), CS/oligo/THCpSiNPs (0.05% w/v,
green), CS/oligo/THCpSiNPs (0.1% w/v, yellow) and dialysis
tubing 50 kDa (DNA 38 μg/mL; control; blue). Release
medium: PBS, pH 7.4, T = 37 °C ± 0.2 (representative data, n =
3).
There are several mechanisms at play in our system
that may assist in sustaining release of
oligonucleotide from the NP. Diffusion of
oligonucleotide from the pores is dependent on the
disintegration and dissolution of the chitosan cap.
Whilst the chitosan coat remains at least partly
intact, the positively charged polymer continues to
sterically trap or electrostatically bind
oligonucleotide to the NP construct [40].
Additionally, the hydrophobicity of the underlying
THCpSiNPs retards surface wetting, and thus slows
down the release of oligonucleotide [33].
Degradation of the THCpSiNPs themselves is likely
to be negligible (ESM, Fig. S8). To rule out any
confounding effect by the presence of NPs on the
release kinetics, release of the initial oligonucleotide
loading concentration (38 µg/mL) from a dialysis
tube bag was monitored by UV absorbance at
260 nm. The control showed strong burst release of
oligonucleotide accounting for approximately 70%
of the initial amount.
3.4 Viability of BSR cells incubated with
THCpSiNPs
In vitro cytotoxicity has been reported for other
nanosized carriers [46], but pSi and its degradation
product, silicic acid (see ESM, Fig. S8), are usually
considered non-toxic [16, 28]. For gene therapy
applications, THCpSiNPs must be trafficked into
cells without inducing damage during the process.
In vitro biocompatibility of THCpSiNPs has been
demonstrated previously by Salonen and co-
workers using Caco-2 and RAW 264.7 macrophage
cells [29, 47].
Since the cytotoxicity of CS/oligo/THCpSiNPs has
not yet been assessed we evaluated the response of
BSR fibroblast cells, commonly used for cell
transfection with expression vectors [48], towards
THCpSiNPs. Cells were treated with
oligo/THCpSiNPs and CS/oligo/THCpSiNPs at a
concentration of 0.1 mg/mL for 48 h. Both LDH and
Live/Dead assays were used to analyze viability
following incubation with THCpSiNPs. Cell
viability was greater than 94% for cells treated with
CS/oligo/THCpSiNPs and oligo/THCpSiNPs, and
BSR cells cultured without the NPs (control) using
the LDH assay (see ESM, Fig. S9). The high viability
observed after NP exposure by the LDH assay was
confirmed using the Live/Dead assay (see ESM, Fig.
S10). `
3.5 Cellular uptake
The intracellular uptake of CS/THCpSiNPs
preloaded with FAM-labeled oligonucleotide
(CS/FAM-oligo/THCpSiNPs) was studied in BSR
cells using laser scanning confocal microscopy to
determine the efficiency of THCpSiNPs cellular
uptake. Fig. 3a shows the BSR control cells, not
exposed to NPs. These control cells were well-
spread, displayed lamellipodia, and maintained the
typical shape and morphology of fibroblasts. There
was no change in cell morphology after 24 h of
incubation with the NPs (Fig. 3b).
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
11 Nano Res.
Figure 3. Uptake of CS/FAM-oligo/THCpSiNPs by BSR fibroblast cells 24 h after first NP exposure; (a) Control BSR cells without
the NPs and (b) BSR cells incubated with CS/FAM-oligo/THCpSiNPs. The cell nucleus was stained with Hoechst 33342 (blue),
CS/FAM-oligo/THCpSiNPs appeared green and the cell cytoskeleton was stained with phalloidin-TRITC (red). (representative data,
n = 7).
CS/FAM-oligo/THCpSiNPs were observed to begin
to cross the cell plasma membranes (indicated by
green fluorescence) within 1 h of incubation.
CS/FAM-oligo/THCpSiNPs were present in
approximately 40% of the cells at 2 h. Uptake of
CS/FAM-oligo/THCpSiNPs continued over the 24 h
period following NP application (Fig. 4). Large
CS/FAM-oligo/THCpSiNPs aggregates were present
in the cells following overnight treatment, with the
NP aggregates accumulating around the nucleus. Z-
stack confocal microscopy confirmed that CS/FAM-
oligo/THCpSiNPs were located inside of the cell
(see ESM, Fig. S11).
Figure 4. Percentage of cells showing green fluorescence
indicating NP uptake calculated from fluorescence microscopy
data (see ESM, Fig. S12). The experiment was carried out with
CS/FAM-oligo/THCpSiNPs (0.1 mg/mL) and BSR cells. The
first 24 h of incubation are shown. (n = 7; mean ± standard
deviation shown)
The observed punctate fluorescence pattern
suggests that FAM-labeled oligonucleotide still
resided within the NPs at this time point. It should
be noted that the THC process removes the
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
12 Nano Res.
instrinsic luminescence of pSi and that the green
fluorescence was solely due to the FAM label [29,
30]. Time lapse microscopy indicates a quenching of
green fluorescence is released into solution (see
ESM, Fig. S13). In stark contrast, cells treated with
FAM-oligo/THCpSiNPs lacking the chitosan coating
did not show an equivalent increase in green
fluorescence intensity over the same time period.
Given the similar oligonucleotide release profiles
from coated and uncoated FAM-oligo/THCpSiNPs
(Fig. 2), this dearth of fluorescence would suggest
that uptake of THCpSiNPs into the cell interior is
negligible. This is consistent with previous reports
[29, 33] demonstrating poor internalization (less
than 2%) of THCpSiNPs into cells.
Figure 5. TEM images of BSR cells after 24 h exposure to CS/FAM-oligo/THCpSiNPs (0.1 mg/mL). (a) BSR cell without treatment
(control), (b) treated cells showing ingested NPs and (c) cell showing degraded NPs.
TEM was employed to investigate the distribution
of intracellular CS/FAM-oligo/THCpSiNPs in more
detail than possible by means of confocal
microscopy. There were no visible abnormalities in
cells without incubation with the NPs after 24 h
(Fig. 5a), and the nucleoplasm was surrounded by a
complete nuclear membrane (see ESM, Fig. S14). As
shown in Fig. 5b and 5c, both intact and partially
degraded shapes of CS/FAM-oligo/THCpSiNPs
were observed inside BSR cells. Intact CS/FAM-
oligo/THCpSiNPs were noted in the cytoplasm and
in the vicinity of the nucleus after 24 h incubation
(Fig. 5b and c). Secondary lysosomes were noted in
greater frequency in NP-treated cells compared to
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
13 Nano Res.
controls (see ESM, Fig. S14). Accumulation of excess
proteins in lysosomes can cause the formation of
secondary lysosomes [49]. No particles were
observed within the cell nucleus, nor were there any
visible signs of nuclear membrane damage. Given
that the average size of the NPs (228.1 nm) is much
larger than diameter of the central pore of the
nuclear complex (50 nm [50]), it is unlikely that the
NPs are able to gain direct access to the cell nucleus.
3.6 In vivo histopathological studies
The literature suggests that intravenously injected
THCpSiNPs induced inflammations in the rat
kidney but not in the major mononuclear phagocyte
system organs such as liver and spleen [51]. Here,
local tissue uptake and biocompatibility of
CS/FAM-oligo/THCpSiNPs were evaluated in vivo
using a mouse model. Mice were treated with
CS/FAM-oligo/THCpSiNPs at a dose of 700 µg/kg
in saline (150 µL) administered IV or with a saline
control of equivalent volume. As others have noted,
NPs, including pSiNPs, are likely to be accumulated
in the major mononuclear phagocyte system organs
[29, 52, 53]. Hence, we harvested the spleen and
liver 24 h after the IV injection to study histological
changes (see Fig. 6).
No tissue necrosis or inflammatory cell infiltration
were observed in either organ. In addition, the
cellularity in the liver and spleen was similar for NP
and saline treated animals. The histological
structure of the kidney in both NP and saline
treated animals were normal. No damage to the
renal system was noted. In particular, no reduction
in the glomerular Bowman's space was induced by
CS/FAM-oligo/THCpSiNPs, in contrast to a
previous study using THCpSiNPs [51]. Finally, no
evidence of systemic inflammation was detected
after administration of the NPs.
Figure 6. Histological comparison of tissues harvested from mice receiving IV or SC injection of CS/FAM-oligo/THCpSiNPs to
saline treated controls. No toxicity and inflammation were observed following the IV administration of the CS/FAM-
oligo/THCpSiNPs in kidney, liver and spleen. Similarly, no histological changes were observed in skin tissues after SC injection of
CS/FAM-oligo/THCpSiNPs. The tissues were stained with hematoxylin/eosin. Scale bars for images of kidney, liver and spleen
represent 50 µm, and for the images of skin tissue 200 µm.
Subcutaneous injection of CS/FAM-
oligo/THCpSiNPs was performed to investigate
localized inflammation that may be induced
following NP delivery. No obvious differences in
histochemically stained skin tissue were observed
between the NP treated site and saline injected site
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
Nano Res.
(see Fig. 6). Although accumulation of the injected
NPs was observed at the injection site via green
FAM fluorescence (see ESM, Fig. S15), no
corresponding tissue necrosis or lesions were
observed.
4 Conclusions
We describe a promising nanocarrier for controlled
oligonucleotide delivery, based on mesoporous
silicon NPs prepared and modified by the pulsed
electrochemical etching and subsequent
functionalization by THC. These NPs were loaded
with oligonucleotide and coated with the
biodegradable polysaccharide chitosan to modify
the oligonucleotide in vitro release profile and
enhance permeation of the NPs into the cell interior.
The chitosan coating of THCpSiNPs remained on
the THCpSiNP surface for 2 days. Studies of
oligonucleotide release kinetics from the NPs
demonstrated sustained release over 35 h.
Modification of THCpSiNPs through a chitosan
coating slowed down oligonucleotide release and
limited the extent of burst release to below 8%.
Successful uptake of CS/FAM-oligo/THCpSiNPs
into BSR cells was evident from TEM and confocal
microscopy. Treated cells remained highly viable
after 48 h incubation with the NPs. For both gene
delivery and also for bioimaging applications, the
ability to direct the chitosan capped THCpSiNPs
toward targets inside the cell is of great interest. In
vivo, histological analysis confirmed that no acute
systemic inflammatory responses nor local tissue
damage were induced upon the administration of
CS/oligo/THCpSiNPs. Admittedly, further studies
are needed to optimize particle delivery and
demonstrate gene knockdown. Nevertheless, our
proof-of-principle study shows that chitosan-coated
THCpSiNPs are promising nanocarriers for
antisense oligonucleotides and siRNAs into target
cells.
Acknowledgements
This research was conducted and funded by the
Australian Research Council Centre of Excellence in
Convergent Bio-Nano Science and Technology
(project number CE140100036). MHK thanks the
Australian Nanotechnology Network and the
Finnish Centre for International Mobility (CIMO
Fellowship Programme) for awarding him an
Overseas Travel Fellowships.
Electronic Supplementary Material:
Supplementary material (characterization of
chitosan, SEM and TEM analysis of THCpSiNP,
calculation of THCpSiNP IEP and degradation rate,
further investigation of THCpSiNP biocompatibility,
cellular uptake and oligonucleotide release) is
available in the online version of this article at
http://dx.doi.org/10.1007/s12274-***-****-*
References
[1] Patil, S. D.; Rhodes, D. G.; Burgess, D. J. DNA-based
therapeutics and DNA delivery systems: A comprehensive
review. AAPS J. 2005, 7, E61–E77.
[2] Helleday, T.; Petermann, E.; Lundin, C.; Hodgson, B.;
Sharma, R. A. DNA repair pathways as targets for cancer
therapy. Nat. Rev. Cancer 2008, 8, 193–204.
[3] Blechinger, J.; Bauer, A. T.; Torrano, A. A.; Gorzelanny,
C.; Bräuchle, C.; Schneider, S. W. Uptake kinetics and
nanotoxicity of silica nanoparticles are cell type
dependent. Small 2013, 9, 3906–3906.
[4] Pendergrast, P. S.; Marsh, H. N.; Grate, D.; Healy, J. M.;
Stanton, M. Nucleic acid aptamers for target validation
and therapeutic applications. J. Biomol. Tech. 2005, 16,
224–234.
[5] Niidome, T.; Huang, L. Gene therapy progress and
prospects: Nonviral vectors. Gene Ther. 2002, 9, 1647–
1652.
[6] Herweijer, H.; Wolff, J. A. Progress and prospects: Naked
DNA gene transfer and therapy. Gene Ther. 2003, 10,
453–458.
[7] El-Aneed, A. An overview of current delivery systems in
cancer gene therapy. J. Control. Release 2004, 94, 1–14.
[8] Wong, S. Y.; Pelet, J. M.; Putnam, D. Polymer systems
for gene delivery–past, present, and future. Prog. Polym.
Sci. 2007, 32, 799–837.
[9] Thomas, C. E.; Ehrhardt, A.; Kay, M. A. Progress and
problems with the use of viral vectors for gene therapy.
Nat. Rev. Genet. 2003, 4, 346–358.
[10] Marshall, E. Gene therapy death prompts review of
adenovirus vector. Science 1999, 286, 2244–2245.
[11] Cross, D.; Burmester, J. K. Gene therapy for cancer
treatment: Past, present and future. Clin. Med. Res. 2006,
4, 218–227
[12] Ogris, M.; Wagner, E. Targeting tumors with non-viral
gene delivery systems. Drug Discov. Today 2002, 7, 479–
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
Nano Res.
485.
[13] Son, S.; Namgung, R.; Kim, J.; Singha, K.; Kim, W.
Bioreducible polymers for gene silencing and delivery.
Acc. Chem. Res. 2012, 45, 1100–1012.
[14] Saranya, N.; Moorthi, A.; Saravanan, S.; Devi, M. P.;
Selvamurugan, N. Chitosan and its derivatives for gene
delivery. Int. J. Biol. Macromol. 2011, 48, 234–238.
[15] Dass, C. R.; Choong, P. F. M. Selective gene delivery for
cancer therapy using cationic liposomes: In vivo proof of
applicability. J. Control. Release 2006, 113, 155–163.
[16] Anglin, E. J.; Cheng, L.; Freeman, W. R.; Sailor, M. J.
Porous silicon in drug delivery devices and materials. Adv.
Drug Deliv. Rev. 2008, 60, 1266–1277.
[17] Pastor, E.; Matveeva, E.; Valle-Gallego, A.; Goycoolea, F.
M.; Garcia-Fuentes, M. Protein delivery based on
uncoated and chitosan-coated mesoporous silicon
microparticles. Colloids Surf. B 2011, 88, 601–609.
[18] Simion, M.; Ruta, L.; Mihailescu, C.; Kleps, I.; Bragaru,
A.; Miu, M.; Ignat, T.; Baciu, I. Porous silicon used as
support for protein microarray. Superlattices Microstruct.
2009, 46, 69–76.
[19] Vale, N.; Mäkilä, E.; Salonen, J.; Gomes, P.; Hirvonen, J.;
Santos, H. A. New times, new trends for ethionamide: In
vitro evaluation of drug-loaded thermally carbonized
porous silicon microparticles. Eur. J. Pharm. Biopharm.
2012, 81, 314–323.
[20] DeLouise, L. A.; Miller, B. L. Quantatitive assessment of
enzyme immobilization capacity in porous silicon. Anal.
Chem. 2004, 76, 6915–6920.
[21] Kafshgari, M. H.; Cavallaro, A.; Delalat, B.; Harding, F.;
McInnes, S.; Mäkilä, E.; Salonen, J.; Vasilev, K.;
Voelcker, N. Nitric oxide-releasing porous silicon
nanoparticles. Nanoscale Res. Lett. 2014, 9, 333.
[22] Hochbaum, A. I.; Gargas, D.; Hwang, Y. J.; Yang, P.
Single crystalline mesoporous silicon nanowires. Nano
Lett. 2009, 9, 3550–3554.
[23] Jarvis, K. L.; Barnes, T. J.; Prestidge, C. A. Surface
chemistry of porous silicon and implications for drug
encapsulation and delivery applications. Adv. Colloid
Interface Sci. 2012, 175, 25–38.
[24] Wu, E. C.; Andrew, J. S.; Cheng, L.; Freeman, W. R.;
Pearson, L.; Sailor, M. J. Real-time monitoring of
sustained drug release using the optical properties of
porous silicon photonic crystal particles. Biomaterials
2011, 32, 1957–1966.
[25] Tanaka, T.; Lingegowda; Mangala; Vivas-Mejia, P. E.;
Nieves-Alicea, R.; Mann, A. P.; Mora, E.; Han, H.-D.;
Shahzad, M. M. K.; Liu, X. et al. Sustained small
interfering rna delivery by mesoporous silicon particles.
Cancer Res. 2010, 70, 3687–3696.
[26] Leigh, C. Properties of porous silicon. Institution of
Engineering and Technology: Malvern, UK, 1996.
[27] Low, S. P.; Williams, K. A.; Canham, L. T.; Voelcker, N.
H. Evaluation of mammalian cell adhesion on surface-
modified porous silicon. Biomaterials 2006, 27, 4538–
4546.
[28] McInnes, S. J.; Voelcker, N. H. Silicon–polymer hybrid
materials for drug delivery. Future Med. Chem. 2009, 1,
1051–1074.
[29] Bimbo, L. M.; Sarparanta, M.; Santos, H. A.; Airaksinen,
A. J.; Makila, E.; Laaksonen, T.; Peltonen, L.; Lehto, V.-
P.; Hirvonen, J.; Salonen, J. Biocompatibility of thermally
hydrocarbonized porous silicon nanoparticles and their
biodistribution in rats. ACS Nano 2010, 4, 3023–3032.
[30] Sarparanta, M.; Bimbo, L. M.; Rytkonen, J.; Makila, E.;
Laaksonen, T. J.; Laaksonen, P. i.; Nyman, M.; Salonen,
J.; Linder, M. B.; Hirvonen, J. et al. Intravenous delivery
of hydrophobin-functionalized porous silicon
nanoparticles: Stability, plasma protein adsorption and
biodistribution. Mol. Pharmaceutics 2012, 9, 654–663.
[31] Jalkanen, T.; Mäkilä, E.; Sakka, T.; Salonen, J.; Ogata, Y.
H. Thermally promoted addition of undecylenic acid on
thermally hydrocarbonized porous silicon optical
reflectors. Nanoscale Res Lett. 2012, 7, 311.
[32] Jiang, X.; Chen, L.; Zhong, W. A new linear
potentiometric titration method for the determination of
deacetylation degree of chitosan. Carbohydr. Polym. 2003,
54, 457–463.
[33] Liu, D.; Bimbo, L. M.; Mäkilä, E.; Villanova, F.;
Kaasalainen, M.; Herranz-Blanco, B.; Caramella, C. M.;
Lehto, V.-P.; Salonen, J.; Herzig, K.-H. et al. Co-delivery
of a hydrophobic small molecule and a hydrophilic
peptide by porous silicon nanoparticles. J. Control.
Release 2013, 170, 268–278.
[34] Kovalainen, M.; Mönkäre, J.; Kaasalainen, M.; Riikonen,
J.; Lehto, V.-P.; Salonen, J.; Herzig, K.-H.; Järvinen, K.
Development of porous silicon nanocarriers for parenteral
peptide delivery. Mol. Pharmaceutics 2013, 10, 353–359.
[35] Soppimath, K. S.; Aminabhavi, T. M.; Kulkarni, A. R.;
Rudzinski, W. E. Biodegradable polymeric nanoparticles
as drug delivery devices. J. Control. Release 2001, 70, 1–
20.
[36] Li, X.; Xie, Q. R.; Zhang, J.; Xia, W.; Gu, H. The
packaging of sirna within the mesoporous structure of
silica nanoparticles. Biomaterials 2011, 32, 9546–9556.
[37] Jayakumar, R.; Chennazhi, K. P.; Muzzarelli, R. A. A.;
Tamura, H.; Nair, S. V.; Selvamurugan, N. Chitosan
conjugated DNA nanoparticles in gene therapy.
Carbohydr. Polym. 2010, 79, 1–8.
[38] Kafshgari, M. H. ; Harding, F. J.; Voelcker, N. H. Insights
into cellular uptake of nanoparticles. Curr. Drug Deliv., in
press, DOI: 10.2174/1567201811666140821110631.
[39] Katas, H.; Alpar, H. O. Development and characterisation
of chitosan nanoparticles for sirna delivery. J. Control.
Release 2006, 115, 216–225.
[40] Mao, S.; Sun, W.; Kissel, T. Chitosan-based formulations
for delivery of DNA and siRNA. Adv. Drug Deliv. Rev.
2010, 62, 12–27.
[41] Wu, J.; Sailor, M. J. Chitosan hydrogel-capped porous
sio2 as a ph responsive nano-valve for triggered release of
insulin. Adv. Funct. Mater. 2009, 19, 733–741.
[42] Kaasalainen, M.; Mäkilä, E.; Riikonen, J.; Kovalainen, M.;
Järvinen, K.; Herzig, K.-H.; Lehto, V.-P.; Salonen, J.
Effect of isotonic solutions and peptide adsorption on zeta
potential of porous silicon nanoparticle drug delivery
formulations. Int. J. Pharm. 2012, 431, 230–236.
[43] Henry, D. C. The cataphoresis of suspended particles. Part
i–the equation of cataphoresis. Proc. R. Soc. London, A
Math. Phys. Sci 1931, 133, 106–129.
[44] Jiang, X.; Chen, L.; Zhong, W. A new linear
potentiometric titration method for the determination of
deacetylation degree of chitosan. Carbohydr. Polym. 2003,
54, 457–463.
[45] Kafshgari, M. H.; Mansouri, M.; Khorram, M.; Samimi,
A.; Osfouri, S. Bovine serum albumin-loaded chitosan
particles: An evaluation of effective parameters on
www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research
Nano Res.
fabrication, characteristics, and in vitro release in the
presence of non-covalent interactions. Int. J. Polym.
Mater. Polym. Biomater. 2012, 61, 1079–1090.
[46] Fadeel, B.; Garcia-Bennett, A. E. Better safe than sorry:
Understanding the toxicological properties of inorganic
nanoparticles manufactured for biomedical applications.
Adv. Drug Deliv. Rev. 2010, 62, 362–374.
[47] Santos, H. A.; Riikonen, J.; Salonen, J.; Mäkilä, E.;
Heikkilä, T.; Laaksonen, T.; Peltonen, L.; Lehto, V.-P.;
Hirvonen, J. In vitro cytotoxicity of porous silicon
microparticles: Effect of the particle concentration,
surface chemistry and size. Acta Biomater. 2010, 6, 2721–
2731.
[48] Pollak, R. d.; Rosenkranz, H. s. Metabolic effects of
hydroxyurea on BHK-21 cells transformed with polyoma
virus1. Cancer Res. 1967, 27, 1214–1224.
[49] Wang, Z.; Li, N.; Zhao, J.; White, J. C.; Qu, P.; Xing, B.
CuO nanoparticle interaction with human epithelial cells:
Cellular uptake, location, export, and genotoxicity. Chem.
Res. Toxicol. 2012, 25, 1512–1521.
[50] Vasu, S. K.; Forbes, D. J. Nuclear pores and nuclear
assembly. Curr. Opin. Cell Biol. 2001, 13, 363–375.
[51] Shahbazi, M.-A.; Hamidi, M.; Mäkilä, E. M.; Zhang, H.;
Almeida, P. V.; Kaasalainen, M.; Salonen, J. J.; Hirvonen,
J. T.; Santos, H. A. The mechanisms of surface chemistry
effects of mesoporous silicon nanoparticles on
immunotoxicity and biocompatibility. Biomaterials 2013,
34, 7776–7789.
[52] Zhu, M.; Zhu, Y.; Zhang, L.; Shi, J. Preparation of
chitosan/mesoporous silica nanoparticle composite
hydrogels for sustained co-delivery of biomacromolecules
and small chemical drugs. Sci. Technol. Adv. Mater. 2013,
14, 045005.
[53] Park, J.-H.; Gu, L.; von Maltzahn, G.; Ruoslahti, E.;
Bhatia, S. N.; Sailor, M. J. Biodegradable luminescent
porous silicon nanoparticles for in vivo applications. Nat.
Mater. 2009, 8, 331–336.