Oligonucleotide delivery by chitosan-functionalized porous silicon … · 2015. 1. 13. · Oligonucleotide delivery by chitosan-functionalized porous silicon nanoparticles Morteza

Nano Res

1

Oligonucleotide delivery by chitosan-functionalized

porous silicon nanoparticles

Morteza Hasanzadeh Kafshgari1, §, Bahman Delalat1, §, Wing Yin Tong1, Frances J. Harding1, Martti

Kaasalainen2, Jarno Salonen2, Nicolas H. Voelcker1 ()

Nano Res., Just Accepted Manuscript • DOI 10.1007/s12274-015-0715-0

http://www.thenanoresearch.com on January 8, 2015

© Tsinghua University Press 2014

Just Accepted

This is a “Just Accepted” manuscript, which has been examined by the peer-review process and has been

accepted for publication. A “Just Accepted” manuscript is published online shortly after its acceptance,

which is prior to technical editing and formatting and author proofing. Tsinghua University Press (TUP)

provides “Just Accepted” as an optional and free service which allows authors to make their results available

to the research community as soon as possible after acceptance. After a manuscript has been technically

edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP

article. Please note that technical editing may introduce minor changes to the manuscript text and/or

graphics which may affect the content, and all legal disclaimers that apply to the journal pertain. In no event

shall TUP be held responsible for errors or consequences arising from the use of any information contained

in these “Just Accepted” manuscripts. To cite this manuscript please use its Digital Object Identifier (DOI® ),

which is identical for all formats of publication.

Nano Research

DOI 10.1007/s12274-015-0715-0

Oligonucleotide delivery by chitosan-

functionalized porous silicon

nanoparticles

Morteza Hasanzadeh Kafshgari1, §,

Bahman Delalat1, §, Wing Yin Tong1,

Frances J. Harding1, Martti Kaasalainen2,

Jarno Salonen2, Nicolas H. Voelcker1*

1ARC Centre of Excellence in

Convergent Bio-Nano Science and

Technology, Mawson Institute,

University of South Australia, GPO Box

2471, Adelaide SA 5001, Australia 2 Department of Physics and Astronomy,

University of Turku, FI-20014 Turku,

Finland

§ These authors contributed equally to

this work

Chitosan coating of oligonucleotide-loaded porous silicon

nanoparticles afforded sustained oligonucleotide release in vitro and

enhanced nanoparticle permeation across the cell membrane.

Prof. Nicolas H. Voelcker, https://bionanotech.unisa.edu.au/

Oligonucleotide delivery by chitosan-functionalized porous silicon nanoparticles

Morteza Hasanzadeh Kafshgari1, §, Bahman Delalat1, §, Wing Yin Tong1, Frances J. Harding1, Martti

Kaasalainen2, Jarno Salonen2, Nicolas H. Voelcker1 ()

§

Received: day month year

Revised: day month year

Accepted: day month year

(automatically inserted by

the publisher)

© Tsinghua University Press

and Springer-Verlag Berlin

Heidelberg 2014

KEYWORDS

Nanoparticles

Porous silicon

Chitosan

Gene delivery

ABSTRACT

Porous silicon nanoparticles (pSiNPs) are a promising nanocarrier system for

drug delivery owing to their biocompatibility, biodegradability and non-

inflammatory nature. Here, we investigate the fabrication and characterization

of thermally hydrocarbonized pSiNPs (THCpSiNPs) and chitosan-coated

THCpSiNPs for therapeutic oligonucleotide delivery. Chitosan coating after

oligonucleotide loading significantly improves sustained oligonucleotide

release and suppressed burst release effects. Moreover, cellular uptake,

endocytosis and cytotoxicity of oligonucleotide-loaded THCpSiNPs are

evaluated in vitro. Standard cell viability assays demonstrate that cells

incubated with the NPs at a concentration of 0.1 mg/mL are 95% viable. In

addition, chitosan coating significantly enhances the uptake of oligonucleotide-

loaded THCpSiNPs across the cell membrane. Moreover, histopathological

analysis of liver, kidney, spleen and skin tissue collected from mice receiving

NPs further demonstrates the biocompatible and non-inflammatory property

of the NPs as a gene delivery vehicle for intravenous and subcutaneous

administration in vivo. Taken together, these results suggest that THCpSiNPs

provide a versatile platform that could be used as efficient vehicles for the

intracellular delivery of oligonucleotides for gene therapy.

Address correspondence to Nicolas H. Voelcker, [email protected]

Nano Research

DOI (automatically inserted by the publisher)

Research Article

www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research

2 Nano Res.

1 Introduction

In recent years, oligonucleotide drugs have

emerged to yield promising results in the treatment

of a wide range of diseases, including cancer, AIDS,

neurological and cardiovascular disorders [1-3]. For

example, aptamers have become legitimate

alternatives to therapeutic antibodies [4]. Likewise,

antisense RNA and small interfering RNA (siRNA)

can be used to modulate gene expression and

activity [5, 6]. In contrast to small molecule drugs,

which suffer from poor specificity, selectivity and

off-target effects, oligonucleotides can be targeted at

specific molecular pathways (via aptamers) and

genes (via antisense RNA and siRNA). Many

functional therapeutic oligonucleotides have been

uptaken by cells in vitro and the expression of these

oligonucleotides in different tissues has been

demonstrated in vivo, however, human clinical trials

of gene therapies have been not satisfactory except

a couple of individual cases of success against a

background of unexpectedly high morbidity and

mortality rates [7-10].

Viral vectors possess certain advantages for

transfection, including high efficiency and stable

integration of exogenous oligonucleotide into the

host genome, however, they are subjected to several

problems such as immunogenicity, toxicity, large-

scale production challenges and limitations in the

size of the DNA insert. In case of lentiviruses,

random integration into the host genome risks

inducing tumorigenic mutations and generating

active viral particles through recombination [7, 8,

11]. Therefore, in order to minimize potential side

effects, and to improve methods of gene delivery,

non-viral vectors are a promising alternative,

offering a higher degree of safety and ease of

manufacture [8, 12]. In this context, emphasis has

been placed on cationic lipids and polymers, which

can trap nucleic acids via electrostatic interactions

[5]. Moreover, certain cationic polymers

disintegrate into low molecular weight fragments

under physiological conditions, which can be

excreted from the body without inducing

significant cytotoxicity [13]. However, cationic

polymers still possess significant drawbacks when

applied to nucleic acid delivery: limited delivery

efficiency, toxicity at higher concentrations,

potential induction of adverse interactions with the

biological cellular fluid environment contains

negatively charged macromolecules, and a

disability to reach target cells beyond the

vasculature [12, 14, 15].

Porous silicon (pSi), which is available in the form

of membranes, micro- and nanoparticles is a high

surface area, biocompatible and bioresorbable form

of silicon [16], widely employed in biomedical

applications including drug delivery of proteins [17,

18], enzymes [19, 20], nitric oxide [21], small

molecular drugs [22-24] and nucleic acids [16, 25].

Oligonucleotide delivery from pSi based vectors has

been successfully demonstrated recently using

mesoporous silicon microparticles loaded with

nanoliposomes that contained siRNA [25]. The pore

size of pSi can be tuned from a few nm to hundreds

of nm by adjusting the current density as well as the

type and concentration of dopant during the

electrochemical anodization of single crystal silicon

[16, 23]. Similarly, pSi porosity can be adjusted

between 40 and 80% [16, 26]. Pore size and porosity

are important parameters for determining the drug

loading and the degradation rates of the pSi

excipient [16, 23]. In contrast to mesoporous silica,

pSi degrades in physiological environments.

Furthermore, pSi is well tolerated in vitro and in

vivo and its degradation product, silicic acid, is non-

toxic and is rapidly cleared by the body [16, 27].

However, freshly prepared pSi degrades rapidly in

aqueous medium, and needs to be modified

chemically using processes such as oxidation,

silanization, hydrosilylation [16, 28] or coating with

polymers [16, 28] to improve its stability to a level

that is useful for drug delivery. Doing so affords a

biodegradable material with a wide stability


3 Nano Res.

window, ranging from minutes to months [16].

A method to produce a very stable Si-C layer on the

pSi surface, thermal hydrocarbonization (THC), has

been recently developed by Salonen and co-workers

[29, 30] THC involves adsorption of acetylene at

room temperature to the pSi surface, followed by

formation of carbon-silicon bonds at around 500 °C.

In contrast to freshly etched pSi, THCpSi surfaces

are resistant to degradation in the short term, even

in harsh chemical environments. Nevertheless, they

do degrade over longer timeframes [29, 31, 32].

Models of oral drug delivery suggest that

THCpSiNPs can deliver a therapeutic drug payload

to the surface of the intestine, which results in drug

permeation across the intestinal epithelial layer

without loss of activity [33]. In vivo, THCpSiNPs

have been reported to sustain release of a peptide

model drug for several days when implanted

subcutaneously [34].

Owing to the hydrophobicity of THCpSiNPs, it is

important to further functionalize the surface of

THCpSiNPs to avoid particle aggregation under

physiological conditions. One method by which this

can be achieved is by coating THCpSiNPs with

polymers, including polyelectrolytes and

polysaccharides [28, 35, 36]. Chitosan is a

biodegradable, biocompatible polysaccharide that is

particularly suitable to employ for this purpose [14,

37]. Its positive charge promotes electrostatic

interactions between the pSiNP and negatively

charged oligonucleotides and cell membranes,

facilitating both the loading of particles and uptake

of the nanocarrier into the cell interior [38].

Chitosan has several interesting features relevant to

drug delivery applications [14, 37, 39, 40], including

its mucoadhesive properties which enhance

mucosal penetration. Previously, Wu and Sailor

used chitosan hydrogel to cap porous silicon

dioxide films to provide a pH-responsive insulin

release [41].

To the best of our knowledge, the combination of

chitosan and pSiNPs has not been reported yet.

Here, we investigated the loading of

oligonucleotides into and release from THCpSiNPs

with and without chitosan coating. Our hypothesis

was that chitosan coating of oligonucleotide-loaded

pSi would enable better control over the

oligonucleotide release kinetics. We also studied

and compared THCpSiNP cytotoxicity and cellular

uptake in vitro using laser scanning confocal

microscopy and transmission electron microscopy.

In order to further evaluate the biocompatibility, we

investigated the histological changes of organs in

mice receiving intravenous and subcutaneous

administration of the CS/oligo/THCpSiNPs.

2 Experimental 2.1 Materials

Silicon wafers (p+ type, 0.01–0.02 Ωcm) were

obtained from Siegert Consulting Co., Aachen,

Germany. A low molecular weight chitosan with an

average degree of deacetylation 71% and molecular

weight 119 kDa (see Electronic Supplementary

Material (ESM), Fig. S1, S2 and S3, Table S1) was

obtained from Sigma-Aldrich (St. Louis, MO).

Ethanol (EtOH), glacial acetic acid, phosphate

buffered saline (PBS), human serum male AB

plasma (HSP), ethylenediaminetetraacetic acid

(EDTA), hydrogen chloride (HCl), sodium sulphite,

sodium metasilicate pentahydrate, Trizma®

hydrochloride (Tris–HCl), ammonium molybdate,

sodium hydroxide (NaOH), 1-decene, tris-2,3,6-

(dimethylaminomethyl)phenol (DMP-30),

dodecenylsuccinic anhydride (DDSA), Embed812

resin (procure 812), Araldite® 502 epoxy resin,

osmium tetroxide solution (for electron microscopy,

4% in H2O), sucrose, uranyl acetate were purchased

from Sigma-Aldrich and used as received.

Hydrofluoric acid (HF, 38-40%) was obtained from

Merck Millipore (Darmstadt, Germany). Cellulose

membrane dialysis tube (Mw cut-off 50000 Da;

Spectra/Por Biotech-Grade) was obtained from

Cole-Parmer (Chicago, IL).

5’→GAGGCTTTGATCGTCAAGTTT→3’ (short


4 Nano Res.

single strand oligonucleotide) and 5’→FAM-

GAGGCTTTGATCGTCAAGTTT→3’ (FAM-labeled

oligo, single short oligonucleotide strand) were

synthesized by GeneWorks (Thebarton, SA,

Australia).

For mammalian cell culture, the following reagents

were used: paraformaldehyde solution (4%,

Electron Microscopy Sciences, Ft Washington, MD).

DMEM culture medium, Opti-MEM culture

medium, fetal bovine serum (FBS), L-glutamine,

penicillin, streptomycin, amphotericin B, Hoechst

33342 (all from Invitrogen, Carlsbad, CA), sterile

0.01 M PBS, pH 7.4 (PBS), Triton X100, propidium

iodide (PI), fluorescein diacetate (FDA), phalloidin-

TRITC (all from Sigma-Aldrich), lactate

dehydrogenase cytotoxicity assay kit II (LDH,

Abcam, Cambridge, UK), fluoro-gel mounting

medium (ProSciTech, Kirwan, Qld, Australia) and

trypsin (0.05%, EDTA 0.53 mM, Invitrogen) were all

used as received. Incubation of cells with

THCpSiNPs took place at 37 oC unless otherwise

stated. All solutions were prepared using

ultrapurified water supplied by a Milli-Q system

(Millipore, Billerica, MA). BSR cells, a clone of

immortalized baby hamster kidney fibroblast cells

(ATCC CCL-10) from American Type Culture

Collection (Manassas, VA), were used in the in vitro

experiments.

For histopathological studies, the following

reagents were used: neutral buffered formalin was

purchased from Chem-Supply (Gillman, SA,

Australia). Staining reagents, Lillie-Mayer’s

hematoxylin and eosin (H&E) were obtained from

Australian Biostain P/L (Traralgon, VIC, Australia).

2.2 Fabrication of THCpSiNPs

THCpSiNPs were fabricated according to the

previously reported procedure [21, 29] from p+ type

(0.01–0.02 Ωcm) silicon wafers by periodically

etching at 50 (2.2 s period) and 200 (0.35 s period)

mA/cm2 in a solution of 1:1 HF(38%):EtOH for 20

min. Afterwards, the THCpSi films were detached

from the substrate by abruptly increasing the

current density to electropolishing conditions

(250 mA/cm2, 3 s period). The detached multilayer

pSi films were then thermally hydrocarbonized

under N2/acetylene (1:1, vol.) flow at 500 °C for

15 min, and cooled down to room temperature

under a stream N2 gas. Subsequently, THCpSiNPs

were produced by wet ball-milling (ZrO2 grinding

jar, Pulverisette 7, Fritsch GmbH, Idar-Oberstein,

Germany) of the thermally hydrocarbonized pSi

films in 1-decene. THCpSiNPs were harvested by

centrifugation (1500 × g, 5 min). THCpSiNP stock

solutions in EtOH of concentration 0.05 mg/mL and

0.1 mg/mL were prepared prior to oligonucleotide

loading and chitosan capping.

2.3 Nitrogen sorption measurements

Nitrogen adsorption/desorption measurements

(Tristar 3000 porosimeter, Micromeritics Inc.,

Norcross, GA) were used to calculate the pore

volume, average pore diameter, and specific surface

area of THCpSiNPs.

2.4 Oligonucleotide loading

2 µL of the oligonucleotide solution (950 µg/mL in

MilliQ water) was added to 0.1 mg/mL THCpSiNPs

suspension in EtOH (48 µL). The mixture was well

dispersed by sonication for 30 s, then continuously

shaken at 100 rpm at room temperature for 5 h.

After incubation, the supernatant was separated by

centrifugation of the THCpSiNPs from the

oligonucleotide solution (5000 rpm, 5 min). These

particles are referred to as oligo/THCpSiNPs. The

amount of the absorbed oligonucleotide by the

particles (loading efficiency %) was calculated by

UV-Vis spectrophotometry measurements at

260 nm from three replicates. The amount of

oligonucleotide loaded into the THCpSiNPs was

calculated by subtracting the amount of

oligonucleotide in the supernatant from the initial

amount of oligonucleotide present in the loading

solution (38 µg/mL).


5 Nano Res.

2.5 Chitosan coating on oligo/THCpSiNPs

To prepare chitosan-coated particles, referred to as

CS/oligo/THCpSiNPs, the oligo/THCpSiNPs were

added to chitosan solutions of concentrations 0.05

and 0.1% w/v. Coating was performed at pH 5.6,

above the isoelectric point (IEP) of

oligo/THCpSiNPs (see Fig. 1a) but below the pKa of

chitosan. This both allowed electrostatic interaction

between the oligo/THCpSiNPs and chitosan to be

harnessed for coating and avoided gelation of

chitosan, which occurs above the pKa. The

CS/oligo/THCpSiNPs were then dispersed by

sonication for 1 min. The pSiNP suspension was

incubated at 25 °C for 20 min and then centrifuged

at 7000 rpm at 25 °C for 10 min. After removing the

supernatant, which contains the remaining chitosan

and any oligonucleotide released during the coating

process, the final oligonucleotide loading (LE) after

chitosan coating was calculated as above (section

2.5). Then, in order to prevent degradation and

preservation of the loaded oligonucleotide, sterile

CS/oligo/THCpSiNPs were kept at 4 °C until use in

oligonucleotide release, in vitro and in vivo studies

[36].

To determine the amount of chitosan coated on the

THCpSiNPs, the chitosan concentration in acetic

acid solution (pH 5.6, as per conditions used for

coating) was determined using a standard curve,

which was plotted by measuring the conductivity

(Zetasizer Nano ZS, Malvern). The amount of

coated chitosan was calculated from the difference

in chitosan concentration in the solution before and

after chitosan coating process. After chitosan

coating, the mean particle size and size distribution

of the prepared NPs were determined by DLS and

SEM.

2.6 Scanning electron microscopy (SEM)

Morphological studies of THCpSiNPs and chitosan-

coated THCpSiNPs were carried out by means of

SEM (Quanta™ 450 FEG; FEI, Hillsboro, OR)

collecting the back-scattered electrons (30 kV beam

energy under high vacuum 6×10-4 Pa). The samples

were prepared by allowing a single drop of

nanoparticle suspension to dry overnight at room

temperature on a homemade graphite slice stacked

by a double-stick carbon tape to the standard SEM

holder.

2.7 Transmittance electron microscopy (TEM)

TEM images of THCpSiNPs, oligo/THCpSiNPs and

CS/oligo/THCpSiNPs were acquired on a TEM

(JEM-2100F TEM, JEOL USA, Inc., MA, USA) with

20–120 kV beam energy under high vacuum 1×10–5

Pa. The samples were prepared by allowing a single

drop of nanoparticle suspension to dry overnight at

room temperature on a 200-mesh copper grid

(ProSciTech Co., Thuringowa, Qld, Australia).

2.8 Dynamic light scattering (DLS)

Mean particle size and size distribution along with

the polydispersity index (PDI) and surface zeta (ζ)-

potential of NPs were determined by dynamic light

scattering using a Zetasizer Nano ZS (Malvern,

Worcestershire, UK). The analysis was carried out

at a scattering angle of 90° at a temperature of 25 °C

using NPs dispersed in Milli Q water.

2.9 ζ-Potential measurements

To optimize the oligonucleotide loading and

chitosan coating conditions for THCpSiNPs, we

measured the ζ-potential with the Zetasizer Nano

ZS [42]. THCpSiNPs were suspended in de-ionized

water at a concentration of 0.1 mg/mL. Titration of

ζ-potential against pH was used to determine the

IEP of THCpSiNPs before and after oligonucleotide

loading and chitosan coating. HCl and NaOH were

used as titrants, and the addition of new ions to the

solution was taken into account using Henry's

function [43]. In each case, IEP was determined by

interpolating the titration curve in a linear fashion

to calculate the pH at which ζ-potential would

reach a value of zero.

To assess the stability of the chitosan coating on the


6 Nano Res.

NPs, a 0.1 mg/mL CS/oligo/THCpSiNP suspension

was prepared in de-ionized water and adjusted to

pH 7.4 with HCl (0.01 M). At this pH, the ζ-

potential of CS/oligo/THCpSiNPs is positive and

that of oligo/THCpSiNPs negative. The ζ-potential

of the solution was measured over several days.

Each data point is the average of at least three

individual measurements.

2.10 Oligonucleotide release experiments

After preparation of oligo/THCpSiNPs and

CS/oligo/THCpSiNPs, oligonucleotide release

kinetic profiles were established. Oligo/THCpSiNPs

and CS/oligo/THCpSiNPs coated with chitosan

solutions of concentration 0.05 and 0.1% w/v were

suspended at 0.1 mg/mL in PBS. To avoid NP

interference in UV absorbance measurements,

100 µL sample of each solution was then poured

into a dialysis “bag” (Mw cut-off: 50000 Da) fitted

inside of a quartz cuvette (3 mL) filled with PBS and

maintained at 37 ± 0.5 °C. The amount of

oligonucleotide released was measured using

UV/Vis spectrophotometry (HP8453, Agilent

Technologies, Santa Clara, CA) every 5 min for 35 h.

All release experiments were conducted in

triplicate.

2.11 Cell culture and cell-based assays

BSR cells were seeded onto flat-bottomed 96-well

tissue culture plates at a density of 3×104 cells/cm2 in

DMEM supplemented with 10% v/v FBS, 2 mM L-

glutamine, 100 U/mL penicillin, 100 µg/mL

streptomycin and cultured at 37 °C, 5% CO2

atmosphere, and 9% relative humidity for 24 h

before incubation with NPs. Cells were grown to

80% confluence before exposure to NPs.

After 24 h, the medium was removed and cells were

exposed to Opti-MEM culture medium

supplemented with 5% (v/v) FBS containing

0.1 mg/mL of oligo/THCpSiNPs and

CS/oligo/THCpSiNPs at 37 °C, 5% CO2. During

cellular uptake of NPs, culture medium was used

without antibiotics. FAM-labeled oligonucleotide

was used to load the NPs in order to investigate

cellular uptake. Controls were generated by

incubating BSR cells in Opti-MEM without NPs for

an identical period. Following set incubation

periods (1, 3, 5, 8, 16 and 24 h), cells were washed

with PBS to remove the non-internalized NPs. The

cells were fixed in 4% paraformaldehyde solution

for 30 min, and then permeablized with 0.25%

Triton X100 for 5 min at room temperature. The

nuclei of cells were stained with 2 µg/mL Hoechst

33342 for 15 min at room temperature. Cells were

also stained with 100 µM phalloidin-TRITC for

45 min. After washing with PBS, cells were

mounted with Fluoro-gel mounting reagent. Cells

were imaged using the inverted fluorescence

microscope Eclipse Ti-S and a Nikon A1 laser

scanning confocal microscope. The efficiency of

cellular uptake of NPs was assessed by counting the

number of cells that exhibited green fluorescence

(from the FAM label) and the total number of cells

present. Cellular uptake efficiency was calculated as

the average of seven replicate fields of view selected

at random across the culture well.

In vitro cellular toxicity of oligo/THCpSiNPs and

CS/oligo/THCpSiNPs was evaluated using BSR

cells. The cells were seeded onto the 96-well plates

at a density of 3×104 cells/cm2 and maintained in

DMEM supplemented as above in 5% CO2 at 37 °C

for 24 h. The cultured cells were incubated with

prepared sterile CS/oligo/THCpSiNPs and

oligo/THCpSiNPs at a concentration 0.1 mg/mL

(50 µL/well) for 48 h to determine the effect of the

NPs treatment on cell viability by means of the

lactate dehydrogenase (LDH) assay and Live/Dead

assay. After incubation, the LDH assay was

performed following manufacturer’s instructions in

order to identify the percentage of live and dead

cells. The Live/Dead assay was performed using

final concentration of 15 µg/mL FDA and 5 µM PI

for 3 min at 37 °C, to count the live and dead cells,

respectively. All experiments were repeated at least


7 Nano Res.

three times.

For TEM imaging, BSR cells were seeded on

cellulose membrane dialysis tube in a 24 well plate

at a density of 3×104 cells/cm2 for 24 h in DMEM

supplemented as above at 37 °C, 5% CO2. After

incubation, the medium was removed and cells were

exposed to Opti-MEM culture medium

supplemented with 5% v/v FBS containing

0.1 mg/mL of CS/oligo/THCpSiNPs for 24 h at 37 °C,

5% CO2. For control experiments, medium without

the NPs was used. After incubation, BSR cells

cultured on the dialysis tubing were fixed using 4%

paraformaldehyde with 4% sucrose in 0.1 M PBS

(pH 7.2) overnight. Aqueous osmium tetroxide

solution (2.0% w/v) was added to the fixed cells and

incubated for 1 h. The cell sample was dehydrated

through an ethanol series (70% to 100% with 5% step

increases). In order to embed the cells, the sample

was incubated in absolute ethanol and resin mixture

(Araldite 502, procure 812, D.D.S.A., DMP-30) (1:1),

then incubated in pure resin mixture. The cells were

transferred to embedding moulds containing fresh

pure resin mixture, which was then polymerized for

24 h at 70 °C. Sample sections of 60 nm thickness

were cut with a diamond knife and transferred to a

regular copper mesh grid for imaging. The prepared

copper grids were stained with uranyl acetate for

15 min, and rinsed with distilled water and then

stained with lead citrate for 3-5 min, and then rinsed

with de-ionized water. The samples were then

imaged on a Tecnai™ Spirit Philips TEM.

2.12 In vivo histopathological experiments

Three adult male skh:hr mice, 8-10 weeks old,

weighing 30 ± 2 g, were housed and handled

according to guidelines and protocols approved by

the Animal Ethics Committee of the University of

South Australia. One week before the administration

of CS/oligo/THCpSiNPs, the mice were housed in

standard polycarbonate stainless steel wire-topped

cages (ventilated temperature-controlled animal

room (20 ± 2 °C), relative humidity of 60 ± 10%, and

a 12 h light/dark daily cycle) with free access to

mouse chow and water. Mice were randomly

allocated to receive either intravenous (IV) injection

of CS/oligo/THCpSiNPs at a dose of 700 µg/kg, or an

equal volume of saline as control. To investigate the

localized effect imposed to the injection site, the

same dose of NPs was injected subcutaneously (SC)

at the right flank of the third mouse. To enable

internally controlled comparison, saline was injected

SC at the left flank of the same mouse. After 24 h, all

mice were euthanized by cervical dislocation under

anesthesia, and tissue specimens from the skin (the

tissue of the SC injection area), liver, kidney and

spleen were collected and immersion fixed in 10%

neutral buffered formalin for 48 h at 4 °C. The fixed

specimens were rinsed, dehydrated through an

incremental concentration series, and finally

dehydrated in xylene. Subsequently all tissues were

embedded in paraffin, and sectioned by microtome.

Histological sections (thickness: 5 µm) were stained

with hematoxylin/eosin stain, followed by mounting

and imaging with a light microscope (Olympus BH-

2, Tokyo, Japan). To observe NP fluorescence at the

site of SC injection histological skin sections (SC

injection area) were stained with 2 µg/mL Hoechst

33342 for 15 min at room temperature and observed

with a Nikon Eclipse Ti-S fluorescence microscope.

3. Results and discussion

In this work, we studied THCpSiNPs as vehicles for

therapeutic oligonucleotide delivery. Firstly, we

studied the physico-chemical properties of

unloaded THCpSiNPs, including chemical

composition, nanostructure, porosity, size

distribution, and ζ-potential. Subsequently, we

systematically characterized the capacity of both

native and chitosan-coated THCpSiNPs to load

short oligonucleotides (21 nucleobases in length).

The stability of chitosan coating on the surface of

THCpSiNPs was scrutinized by electrophoretic

light scattering. Release of oligonucleotide from

THCpSiNPs and CS/oligo/THCpSiNPs was

compared. Finally, cellular uptake of FAM-labeled

oligonucleotides released from chitosan coated and

uncoated THCpSiNPs by BSR cells was investigated

using fluorescence microscopy, confocal

microscopy and TEM. Finally, the toxicity of

THCpSiNPs was assessed in vitro and in vivo.


8 Nano Res.

3.1 Characterization of the THCpSiNPs

Previously, Salonen and co-workers investigated

the size distribution and optimum average diameter

of THCpSiNPs for drug and peptide delivery [29,

30, 33]. This previous characterization has allowed

us to tailor the properties of our THCpSiNPs to

feature an average particle size of 137 nm (PDI:

0.149) according to DLS and a ζ-potential of -43 mV

at pH 7.4 (Fig. S1, ESM) with an average pore size of

9 nm.

Chitosan was subsequently coated onto the surface

of the THCpSiNPs. The amino group in chitosan

has a pKa value of ~6.5, and is protonated in acidic

solutions, with charge density dependent on pH

and the degree of deacetylation [44, 45]. Hence, the

coating procedure was performed at pH 5.6 in order

to harness the electrostatic interaction between

positively charged chitosan and negatively charged

THCpSiNPs. The diameter of the particles coated

using 0.1% chitosan solution increased to 229 nm

(PDI: 0.085) according to DLS. An increase in size

(form 193 nm to 249 nm) was observed when the

chitosan coating was applied to THCpSiNPs loaded

with a short oligonucleotide (21 nucleobases in

length) from a EtOH/water solution. SEM and TEM

images of THCpSiNPs, oligo/THCpSiNPs and

CS/oligo/THCpSiNPs showed particles with

asymmetric shape and with sizes in agreement with

the DLS results (see Fig. S4, S5 and S6, ESM).

CS/oligo/THCpSiNPs showed a positive of 19 mV at

pH 7.4, whilst oligo/THCpSiNPs had a negative ζ-

potential of -21 mV (Fig. 1a). Chitosan coating of

THCpSiNPs without oligonucleotide loading also

increased the ζ-potential (by 19 mV) at pH 7.4 (see

Fig. S7, ESM).

Furthermore, ζ-potential studies showed an IEP of

5.2 and 9.2 for oligo/THCpSiNPs and

CS/oligo/THCpSiNPs, respectively (Fig. 1a). In

contrast, the IEP for THCpSiNPs is 4.6 [42]. The

observed increase in IEP is consistent with the

loading of oligonucleotides into NPs and

subsequent coating with chitosan because of the

presence of the positive amine groups on the

surface of the NPs [17, 44].

The stability of the chitosan coating was assessed by

monitoring changes in ζ-potential over time at

pH 7.4 (Fig. 1b). Judging from the reduction in ζ-

potential, it appears that the majority of the

chitosan coating was slowly lost over the course of 2

d from the oligo/THCpSiNPs. The gradual

shedding of the chitosan coating was deemed

beneficial for gene delivery applications.

Figure 1. (a) Measurement of IEP by pH titration for

THCpSiNPs (□), oligo/THCpSiNPs (∆), CS/oligo/THCpSiNPs

(◊) and (b) stability of chitosan coating on oligo/THCpSiNPs

over 5 d as measured by reduction in ζ-potential (analysis

performed at pH 7.4). Concentration of chitosan coating

solution 0.1% w/v. (n = 3; mean ± standard deviation shown).

A conductometric method was used to determine

the amount of loaded chitosan on the surface of

THCpSiNPs. The amount of chitosan present on the

NPs was dependent on the chitosan solution

concentration during coating (pH 5.6). Increasing


9 Nano Res.

the chitosan concentration from 0.05 to 0.1% w/v

marginally increased the amount of chitosan coated

on the surface of THCpSiNPs from 0.92 to 1.4 µg of

chitosan per µg of NPs. We expected little

penetration of chitosan into the pores of

THCpSiNPs, due to the large gyration radius of

chitosan (∼46 nm, Fig. S3, ESM) compared to the

average pore size of THCpSiNPs (∼9 nm). Indeed,

we intended the chitosan to cap the pores rather

than penetrate into them. In addition, after chitosan

coating, morphology and roughness of THCpSiNPs

changed to exhibit more soft and edgeless surfaces

(see ESM, Fig. S5).

3.2 Oligonucleotide loading efficiency

Next, we studied the capacity of THCpSiNPs to

load oligonucleotide. Considering the average pore

diameter of 9 nm, specific surface area of 202 m2/g

and pore volume 0.51 cm3/g of THCpSiNPs, these

nanostructured nanocarriers are expected to be a

high performing vehicle for oligonucleotide

delivery [29, 33]. The surface properties and the

molecular structure of the THCpSi have in the past

been reported to greatly impact the adsorption of

biomolecules into such nanocarriers [34].

Therapeutic agents are generally physisorbed onto

the pSi and are released from the surface and the

pores via diffusion and pore degradation [19, 33].

Table 1 shows the efficiency and capacity of

oligonucleotide loading into THCpSiNPs. Loading

efficiency was compared before and after chitosan

coating by UV-Vis spectroscopic analysis of the

amount of oligonucleotides remaining in the

supernatant.

The highest oligonucleotide loading efficiency was

observed for uncoated oligo/THCpSiNPs. The

loading efficiency progressively decreased for

CS/oligo/THCpSiNPs coated with 0.05 % w/v

chitosan solution and with 0.1 % w/v chitosan

solution. Egress of the oligonucleotide from the

pore structure into the surrounding aqueous

environment may increase with the concentration of

the chitosan coating solution because of the

attractive positive charge of the chitosan still in

solution [17]. Nevertheless, the oligonucleotide

loading efficiency of CS/oligo/THCpSiNPs coated

using 0.1 % w/v chitosan solution still exceeded

68%. Hence, both chitosan coated and uncoated

THCpSiNPs were considered to have demonstrated

suitable loading capacity for oligonucleotides.

Table 1. Loading efficiency of oligo/THCpSiNPs and

CS/oligo/THCpSINPs, measured by UV-Vis spectroscopy. NP

concentrations of 0.1 mg/mL were used for all tests. (n ≥ 5;

mean ± standard deviation shown).

Concentration of

chitosan coating

solution

(% w/v)

Loading capacity

(μg oligos/mg

NPs)

Loading

efficiency

(%)

0.00 16.7 ± 0.4 81 ± 4

0.05 14.8 ± 0.8 74 ± 8

0.1 14.2 ± 0.5 68 ± 5

3.3 Sustained oligonucleotide release from

CS/oligo/THCpSiNPs

The amount of oligonucleotide released from

Oligo/THCpSiNPs and CS/oligo/THCpSiNPs was

quantified by measuring the absorbance of the PBS

solution containing the released oligonucleotide at

260 nm (37 oC, pH 7.4). These data are shown as a

function of time in Fig. 2. Release kinetics from all

THCpSiNPs showed an initial burst occurring for

the first few hours, followed by a slow release phase

that approximates linear release up to 35 h (0.93 ≤ R2

≤ 0.99). The difference in the release kinetics

between CS/oligo/THCpSiNPs coated using

chitosan concentrations of 0.05 or 0.1 % w/v was

insignificant. However, the initial burst release for

the CS/oligo/THCpSiNPs was significantly reduced

in comparison to oligo/THCpSiNPs. Modification of

THCpSiNPs through a chitosan-coating slows

down oligonucleotide release and limits the extent

of burst release below 8 %.


10 Nano Res.

Figure 2. Effect of chitosan coating and concentration on

oligonucleotide release profile from samples:

oligo/THCpSiNPs (red), CS/oligo/THCpSiNPs (0.05% w/v,

green), CS/oligo/THCpSiNPs (0.1% w/v, yellow) and dialysis

tubing 50 kDa (DNA 38 μg/mL; control; blue). Release

medium: PBS, pH 7.4, T = 37 °C ± 0.2 (representative data, n =

3).

There are several mechanisms at play in our system

that may assist in sustaining release of

oligonucleotide from the NP. Diffusion of

oligonucleotide from the pores is dependent on the

disintegration and dissolution of the chitosan cap.

Whilst the chitosan coat remains at least partly

intact, the positively charged polymer continues to

sterically trap or electrostatically bind

oligonucleotide to the NP construct [40].

Additionally, the hydrophobicity of the underlying

THCpSiNPs retards surface wetting, and thus slows

down the release of oligonucleotide [33].

Degradation of the THCpSiNPs themselves is likely

to be negligible (ESM, Fig. S8). To rule out any

confounding effect by the presence of NPs on the

release kinetics, release of the initial oligonucleotide

loading concentration (38 µg/mL) from a dialysis

tube bag was monitored by UV absorbance at

260 nm. The control showed strong burst release of

oligonucleotide accounting for approximately 70%

of the initial amount.

3.4 Viability of BSR cells incubated with

THCpSiNPs

In vitro cytotoxicity has been reported for other

nanosized carriers [46], but pSi and its degradation

product, silicic acid (see ESM, Fig. S8), are usually

considered non-toxic [16, 28]. For gene therapy

applications, THCpSiNPs must be trafficked into

cells without inducing damage during the process.

In vitro biocompatibility of THCpSiNPs has been

demonstrated previously by Salonen and co-

workers using Caco-2 and RAW 264.7 macrophage

cells [29, 47].

Since the cytotoxicity of CS/oligo/THCpSiNPs has

not yet been assessed we evaluated the response of

BSR fibroblast cells, commonly used for cell

transfection with expression vectors [48], towards

THCpSiNPs. Cells were treated with

oligo/THCpSiNPs and CS/oligo/THCpSiNPs at a

concentration of 0.1 mg/mL for 48 h. Both LDH and

Live/Dead assays were used to analyze viability

following incubation with THCpSiNPs. Cell

viability was greater than 94% for cells treated with

CS/oligo/THCpSiNPs and oligo/THCpSiNPs, and

BSR cells cultured without the NPs (control) using

the LDH assay (see ESM, Fig. S9). The high viability

observed after NP exposure by the LDH assay was

confirmed using the Live/Dead assay (see ESM, Fig.

S10). `

3.5 Cellular uptake

The intracellular uptake of CS/THCpSiNPs

preloaded with FAM-labeled oligonucleotide

(CS/FAM-oligo/THCpSiNPs) was studied in BSR

cells using laser scanning confocal microscopy to

determine the efficiency of THCpSiNPs cellular

uptake. Fig. 3a shows the BSR control cells, not

exposed to NPs. These control cells were well-

spread, displayed lamellipodia, and maintained the

typical shape and morphology of fibroblasts. There

was no change in cell morphology after 24 h of

incubation with the NPs (Fig. 3b).


11 Nano Res.

Figure 3. Uptake of CS/FAM-oligo/THCpSiNPs by BSR fibroblast cells 24 h after first NP exposure; (a) Control BSR cells without

the NPs and (b) BSR cells incubated with CS/FAM-oligo/THCpSiNPs. The cell nucleus was stained with Hoechst 33342 (blue),

CS/FAM-oligo/THCpSiNPs appeared green and the cell cytoskeleton was stained with phalloidin-TRITC (red). (representative data,

n = 7).

CS/FAM-oligo/THCpSiNPs were observed to begin

to cross the cell plasma membranes (indicated by

green fluorescence) within 1 h of incubation.

CS/FAM-oligo/THCpSiNPs were present in

approximately 40% of the cells at 2 h. Uptake of

CS/FAM-oligo/THCpSiNPs continued over the 24 h

period following NP application (Fig. 4). Large

CS/FAM-oligo/THCpSiNPs aggregates were present

in the cells following overnight treatment, with the

NP aggregates accumulating around the nucleus. Z-

stack confocal microscopy confirmed that CS/FAM-

oligo/THCpSiNPs were located inside of the cell

(see ESM, Fig. S11).

Figure 4. Percentage of cells showing green fluorescence

indicating NP uptake calculated from fluorescence microscopy

data (see ESM, Fig. S12). The experiment was carried out with

CS/FAM-oligo/THCpSiNPs (0.1 mg/mL) and BSR cells. The

first 24 h of incubation are shown. (n = 7; mean ± standard

deviation shown)

The observed punctate fluorescence pattern

suggests that FAM-labeled oligonucleotide still

resided within the NPs at this time point. It should

be noted that the THC process removes the


12 Nano Res.

instrinsic luminescence of pSi and that the green

fluorescence was solely due to the FAM label [29,

30]. Time lapse microscopy indicates a quenching of

green fluorescence is released into solution (see

ESM, Fig. S13). In stark contrast, cells treated with

FAM-oligo/THCpSiNPs lacking the chitosan coating

did not show an equivalent increase in green

fluorescence intensity over the same time period.

Given the similar oligonucleotide release profiles

from coated and uncoated FAM-oligo/THCpSiNPs

(Fig. 2), this dearth of fluorescence would suggest

that uptake of THCpSiNPs into the cell interior is

negligible. This is consistent with previous reports

[29, 33] demonstrating poor internalization (less

than 2%) of THCpSiNPs into cells.

Figure 5. TEM images of BSR cells after 24 h exposure to CS/FAM-oligo/THCpSiNPs (0.1 mg/mL). (a) BSR cell without treatment

(control), (b) treated cells showing ingested NPs and (c) cell showing degraded NPs.

TEM was employed to investigate the distribution

of intracellular CS/FAM-oligo/THCpSiNPs in more

detail than possible by means of confocal

microscopy. There were no visible abnormalities in

cells without incubation with the NPs after 24 h

(Fig. 5a), and the nucleoplasm was surrounded by a

complete nuclear membrane (see ESM, Fig. S14). As

shown in Fig. 5b and 5c, both intact and partially

degraded shapes of CS/FAM-oligo/THCpSiNPs

were observed inside BSR cells. Intact CS/FAM-

oligo/THCpSiNPs were noted in the cytoplasm and

in the vicinity of the nucleus after 24 h incubation

(Fig. 5b and c). Secondary lysosomes were noted in

greater frequency in NP-treated cells compared to


13 Nano Res.

controls (see ESM, Fig. S14). Accumulation of excess

proteins in lysosomes can cause the formation of

secondary lysosomes [49]. No particles were

observed within the cell nucleus, nor were there any

visible signs of nuclear membrane damage. Given

that the average size of the NPs (228.1 nm) is much

larger than diameter of the central pore of the

nuclear complex (50 nm [50]), it is unlikely that the

NPs are able to gain direct access to the cell nucleus.

3.6 In vivo histopathological studies

The literature suggests that intravenously injected

THCpSiNPs induced inflammations in the rat

kidney but not in the major mononuclear phagocyte

system organs such as liver and spleen [51]. Here,

local tissue uptake and biocompatibility of

CS/FAM-oligo/THCpSiNPs were evaluated in vivo

using a mouse model. Mice were treated with

CS/FAM-oligo/THCpSiNPs at a dose of 700 µg/kg

in saline (150 µL) administered IV or with a saline

control of equivalent volume. As others have noted,

NPs, including pSiNPs, are likely to be accumulated

in the major mononuclear phagocyte system organs

[29, 52, 53]. Hence, we harvested the spleen and

liver 24 h after the IV injection to study histological

changes (see Fig. 6).

No tissue necrosis or inflammatory cell infiltration

were observed in either organ. In addition, the

cellularity in the liver and spleen was similar for NP

and saline treated animals. The histological

structure of the kidney in both NP and saline

treated animals were normal. No damage to the

renal system was noted. In particular, no reduction

in the glomerular Bowman's space was induced by

CS/FAM-oligo/THCpSiNPs, in contrast to a

previous study using THCpSiNPs [51]. Finally, no

evidence of systemic inflammation was detected

after administration of the NPs.

Figure 6. Histological comparison of tissues harvested from mice receiving IV or SC injection of CS/FAM-oligo/THCpSiNPs to

saline treated controls. No toxicity and inflammation were observed following the IV administration of the CS/FAM-

oligo/THCpSiNPs in kidney, liver and spleen. Similarly, no histological changes were observed in skin tissues after SC injection of

CS/FAM-oligo/THCpSiNPs. The tissues were stained with hematoxylin/eosin. Scale bars for images of kidney, liver and spleen

represent 50 µm, and for the images of skin tissue 200 µm.

Subcutaneous injection of CS/FAM-

oligo/THCpSiNPs was performed to investigate

localized inflammation that may be induced

following NP delivery. No obvious differences in

histochemically stained skin tissue were observed

between the NP treated site and saline injected site


Nano Res.

(see Fig. 6). Although accumulation of the injected

NPs was observed at the injection site via green

FAM fluorescence (see ESM, Fig. S15), no

corresponding tissue necrosis or lesions were

observed.

4 Conclusions

We describe a promising nanocarrier for controlled

oligonucleotide delivery, based on mesoporous

silicon NPs prepared and modified by the pulsed

electrochemical etching and subsequent

functionalization by THC. These NPs were loaded

with oligonucleotide and coated with the

biodegradable polysaccharide chitosan to modify

the oligonucleotide in vitro release profile and

enhance permeation of the NPs into the cell interior.

The chitosan coating of THCpSiNPs remained on

the THCpSiNP surface for 2 days. Studies of

oligonucleotide release kinetics from the NPs

demonstrated sustained release over 35 h.

Modification of THCpSiNPs through a chitosan

coating slowed down oligonucleotide release and

limited the extent of burst release to below 8%.

Successful uptake of CS/FAM-oligo/THCpSiNPs

into BSR cells was evident from TEM and confocal

microscopy. Treated cells remained highly viable

after 48 h incubation with the NPs. For both gene

delivery and also for bioimaging applications, the

ability to direct the chitosan capped THCpSiNPs

toward targets inside the cell is of great interest. In

vivo, histological analysis confirmed that no acute

systemic inflammatory responses nor local tissue

damage were induced upon the administration of

CS/oligo/THCpSiNPs. Admittedly, further studies

are needed to optimize particle delivery and

demonstrate gene knockdown. Nevertheless, our

proof-of-principle study shows that chitosan-coated

THCpSiNPs are promising nanocarriers for

antisense oligonucleotides and siRNAs into target

cells.

Acknowledgements

This research was conducted and funded by the

Australian Research Council Centre of Excellence in

Convergent Bio-Nano Science and Technology

(project number CE140100036). MHK thanks the

Australian Nanotechnology Network and the

Finnish Centre for International Mobility (CIMO

Fellowship Programme) for awarding him an

Overseas Travel Fellowships.

Electronic Supplementary Material:

Supplementary material (characterization of

chitosan, SEM and TEM analysis of THCpSiNP,

calculation of THCpSiNP IEP and degradation rate,

further investigation of THCpSiNP biocompatibility,

cellular uptake and oligonucleotide release) is

available in the online version of this article at

http://dx.doi.org/10.1007/s12274-***-****-*

References

[1] Patil, S. D.; Rhodes, D. G.; Burgess, D. J. DNA-based

therapeutics and DNA delivery systems: A comprehensive

review. AAPS J. 2005, 7, E61–E77.

[2] Helleday, T.; Petermann, E.; Lundin, C.; Hodgson, B.;

Sharma, R. A. DNA repair pathways as targets for cancer

therapy. Nat. Rev. Cancer 2008, 8, 193–204.

[3] Blechinger, J.; Bauer, A. T.; Torrano, A. A.; Gorzelanny,

C.; Bräuchle, C.; Schneider, S. W. Uptake kinetics and

nanotoxicity of silica nanoparticles are cell type

dependent. Small 2013, 9, 3906–3906.

[4] Pendergrast, P. S.; Marsh, H. N.; Grate, D.; Healy, J. M.;

Stanton, M. Nucleic acid aptamers for target validation

and therapeutic applications. J. Biomol. Tech. 2005, 16,

224–234.

[5] Niidome, T.; Huang, L. Gene therapy progress and

prospects: Nonviral vectors. Gene Ther. 2002, 9, 1647–

1652.

[6] Herweijer, H.; Wolff, J. A. Progress and prospects: Naked

DNA gene transfer and therapy. Gene Ther. 2003, 10,

453–458.

[7] El-Aneed, A. An overview of current delivery systems in

cancer gene therapy. J. Control. Release 2004, 94, 1–14.

[8] Wong, S. Y.; Pelet, J. M.; Putnam, D. Polymer systems

for gene delivery–past, present, and future. Prog. Polym.

Sci. 2007, 32, 799–837.

[9] Thomas, C. E.; Ehrhardt, A.; Kay, M. A. Progress and

problems with the use of viral vectors for gene therapy.

Nat. Rev. Genet. 2003, 4, 346–358.

[10] Marshall, E. Gene therapy death prompts review of

adenovirus vector. Science 1999, 286, 2244–2245.

[11] Cross, D.; Burmester, J. K. Gene therapy for cancer

treatment: Past, present and future. Clin. Med. Res. 2006,

4, 218–227

[12] Ogris, M.; Wagner, E. Targeting tumors with non-viral

gene delivery systems. Drug Discov. Today 2002, 7, 479–

http://dx.doi.org/10.1007/s12274-***-****-*


Nano Res.

485.

[13] Son, S.; Namgung, R.; Kim, J.; Singha, K.; Kim, W.

Bioreducible polymers for gene silencing and delivery.

Acc. Chem. Res. 2012, 45, 1100–1012.

[14] Saranya, N.; Moorthi, A.; Saravanan, S.; Devi, M. P.;

Selvamurugan, N. Chitosan and its derivatives for gene

delivery. Int. J. Biol. Macromol. 2011, 48, 234–238.

[15] Dass, C. R.; Choong, P. F. M. Selective gene delivery for

cancer therapy using cationic liposomes: In vivo proof of

applicability. J. Control. Release 2006, 113, 155–163.

[16] Anglin, E. J.; Cheng, L.; Freeman, W. R.; Sailor, M. J.

Porous silicon in drug delivery devices and materials. Adv.

Drug Deliv. Rev. 2008, 60, 1266–1277.

[17] Pastor, E.; Matveeva, E.; Valle-Gallego, A.; Goycoolea, F.

M.; Garcia-Fuentes, M. Protein delivery based on

uncoated and chitosan-coated mesoporous silicon

microparticles. Colloids Surf. B 2011, 88, 601–609.

[18] Simion, M.; Ruta, L.; Mihailescu, C.; Kleps, I.; Bragaru,

A.; Miu, M.; Ignat, T.; Baciu, I. Porous silicon used as

support for protein microarray. Superlattices Microstruct.

2009, 46, 69–76.

[19] Vale, N.; Mäkilä, E.; Salonen, J.; Gomes, P.; Hirvonen, J.;

Santos, H. A. New times, new trends for ethionamide: In

vitro evaluation of drug-loaded thermally carbonized

porous silicon microparticles. Eur. J. Pharm. Biopharm.

2012, 81, 314–323.

[20] DeLouise, L. A.; Miller, B. L. Quantatitive assessment of

enzyme immobilization capacity in porous silicon. Anal.

Chem. 2004, 76, 6915–6920.

[21] Kafshgari, M. H.; Cavallaro, A.; Delalat, B.; Harding, F.;

McInnes, S.; Mäkilä, E.; Salonen, J.; Vasilev, K.;

Voelcker, N. Nitric oxide-releasing porous silicon

nanoparticles. Nanoscale Res. Lett. 2014, 9, 333.

[22] Hochbaum, A. I.; Gargas, D.; Hwang, Y. J.; Yang, P.

Single crystalline mesoporous silicon nanowires. Nano

Lett. 2009, 9, 3550–3554.

[23] Jarvis, K. L.; Barnes, T. J.; Prestidge, C. A. Surface

chemistry of porous silicon and implications for drug

encapsulation and delivery applications. Adv. Colloid

Interface Sci. 2012, 175, 25–38.

[24] Wu, E. C.; Andrew, J. S.; Cheng, L.; Freeman, W. R.;

Pearson, L.; Sailor, M. J. Real-time monitoring of

sustained drug release using the optical properties of

porous silicon photonic crystal particles. Biomaterials

2011, 32, 1957–1966.

[25] Tanaka, T.; Lingegowda; Mangala; Vivas-Mejia, P. E.;

Nieves-Alicea, R.; Mann, A. P.; Mora, E.; Han, H.-D.;

Shahzad, M. M. K.; Liu, X. et al. Sustained small

interfering rna delivery by mesoporous silicon particles.

Cancer Res. 2010, 70, 3687–3696.

[26] Leigh, C. Properties of porous silicon. Institution of

Engineering and Technology: Malvern, UK, 1996.

[27] Low, S. P.; Williams, K. A.; Canham, L. T.; Voelcker, N.

H. Evaluation of mammalian cell adhesion on surface-

modified porous silicon. Biomaterials 2006, 27, 4538–

4546.

[28] McInnes, S. J.; Voelcker, N. H. Silicon–polymer hybrid

materials for drug delivery. Future Med. Chem. 2009, 1,

1051–1074.

[29] Bimbo, L. M.; Sarparanta, M.; Santos, H. A.; Airaksinen,

A. J.; Makila, E.; Laaksonen, T.; Peltonen, L.; Lehto, V.-

P.; Hirvonen, J.; Salonen, J. Biocompatibility of thermally

hydrocarbonized porous silicon nanoparticles and their

biodistribution in rats. ACS Nano 2010, 4, 3023–3032.

[30] Sarparanta, M.; Bimbo, L. M.; Rytkonen, J.; Makila, E.;

Laaksonen, T. J.; Laaksonen, P. i.; Nyman, M.; Salonen,

J.; Linder, M. B.; Hirvonen, J. et al. Intravenous delivery

of hydrophobin-functionalized porous silicon

nanoparticles: Stability, plasma protein adsorption and

biodistribution. Mol. Pharmaceutics 2012, 9, 654–663.

[31] Jalkanen, T.; Mäkilä, E.; Sakka, T.; Salonen, J.; Ogata, Y.

H. Thermally promoted addition of undecylenic acid on

thermally hydrocarbonized porous silicon optical

reflectors. Nanoscale Res Lett. 2012, 7, 311.

[32] Jiang, X.; Chen, L.; Zhong, W. A new linear

potentiometric titration method for the determination of

deacetylation degree of chitosan. Carbohydr. Polym. 2003,

54, 457–463.

[33] Liu, D.; Bimbo, L. M.; Mäkilä, E.; Villanova, F.;

Kaasalainen, M.; Herranz-Blanco, B.; Caramella, C. M.;

Lehto, V.-P.; Salonen, J.; Herzig, K.-H. et al. Co-delivery

of a hydrophobic small molecule and a hydrophilic

peptide by porous silicon nanoparticles. J. Control.

Release 2013, 170, 268–278.

[34] Kovalainen, M.; Mönkäre, J.; Kaasalainen, M.; Riikonen,

J.; Lehto, V.-P.; Salonen, J.; Herzig, K.-H.; Järvinen, K.

Development of porous silicon nanocarriers for parenteral

peptide delivery. Mol. Pharmaceutics 2013, 10, 353–359.

[35] Soppimath, K. S.; Aminabhavi, T. M.; Kulkarni, A. R.;

Rudzinski, W. E. Biodegradable polymeric nanoparticles

as drug delivery devices. J. Control. Release 2001, 70, 1–

20.

[36] Li, X.; Xie, Q. R.; Zhang, J.; Xia, W.; Gu, H. The

packaging of sirna within the mesoporous structure of

silica nanoparticles. Biomaterials 2011, 32, 9546–9556.

[37] Jayakumar, R.; Chennazhi, K. P.; Muzzarelli, R. A. A.;

Tamura, H.; Nair, S. V.; Selvamurugan, N. Chitosan

conjugated DNA nanoparticles in gene therapy.

Carbohydr. Polym. 2010, 79, 1–8.

[38] Kafshgari, M. H. ; Harding, F. J.; Voelcker, N. H. Insights

into cellular uptake of nanoparticles. Curr. Drug Deliv., in

press, DOI: 10.2174/1567201811666140821110631.

[39] Katas, H.; Alpar, H. O. Development and characterisation

of chitosan nanoparticles for sirna delivery. J. Control.

Release 2006, 115, 216–225.

[40] Mao, S.; Sun, W.; Kissel, T. Chitosan-based formulations

for delivery of DNA and siRNA. Adv. Drug Deliv. Rev.

2010, 62, 12–27.

[41] Wu, J.; Sailor, M. J. Chitosan hydrogel-capped porous

sio2 as a ph responsive nano-valve for triggered release of

insulin. Adv. Funct. Mater. 2009, 19, 733–741.

[42] Kaasalainen, M.; Mäkilä, E.; Riikonen, J.; Kovalainen, M.;

Järvinen, K.; Herzig, K.-H.; Lehto, V.-P.; Salonen, J.

Effect of isotonic solutions and peptide adsorption on zeta

potential of porous silicon nanoparticle drug delivery

formulations. Int. J. Pharm. 2012, 431, 230–236.

[43] Henry, D. C. The cataphoresis of suspended particles. Part

i–the equation of cataphoresis. Proc. R. Soc. London, A

Math. Phys. Sci 1931, 133, 106–129.

[44] Jiang, X.; Chen, L.; Zhong, W. A new linear

potentiometric titration method for the determination of

deacetylation degree of chitosan. Carbohydr. Polym. 2003,

54, 457–463.

[45] Kafshgari, M. H.; Mansouri, M.; Khorram, M.; Samimi,

A.; Osfouri, S. Bovine serum albumin-loaded chitosan

particles: An evaluation of effective parameters on


Nano Res.

fabrication, characteristics, and in vitro release in the

presence of non-covalent interactions. Int. J. Polym.

Mater. Polym. Biomater. 2012, 61, 1079–1090.

[46] Fadeel, B.; Garcia-Bennett, A. E. Better safe than sorry:

Understanding the toxicological properties of inorganic

nanoparticles manufactured for biomedical applications.

Adv. Drug Deliv. Rev. 2010, 62, 362–374.

[47] Santos, H. A.; Riikonen, J.; Salonen, J.; Mäkilä, E.;

Heikkilä, T.; Laaksonen, T.; Peltonen, L.; Lehto, V.-P.;

Hirvonen, J. In vitro cytotoxicity of porous silicon

microparticles: Effect of the particle concentration,

surface chemistry and size. Acta Biomater. 2010, 6, 2721–

2731.

[48] Pollak, R. d.; Rosenkranz, H. s. Metabolic effects of

hydroxyurea on BHK-21 cells transformed with polyoma

virus1. Cancer Res. 1967, 27, 1214–1224.

[49] Wang, Z.; Li, N.; Zhao, J.; White, J. C.; Qu, P.; Xing, B.

CuO nanoparticle interaction with human epithelial cells:

Cellular uptake, location, export, and genotoxicity. Chem.

Res. Toxicol. 2012, 25, 1512–1521.

[50] Vasu, S. K.; Forbes, D. J. Nuclear pores and nuclear

assembly. Curr. Opin. Cell Biol. 2001, 13, 363–375.

[51] Shahbazi, M.-A.; Hamidi, M.; Mäkilä, E. M.; Zhang, H.;

Almeida, P. V.; Kaasalainen, M.; Salonen, J. J.; Hirvonen,

J. T.; Santos, H. A. The mechanisms of surface chemistry

effects of mesoporous silicon nanoparticles on

immunotoxicity and biocompatibility. Biomaterials 2013,

34, 7776–7789.

[52] Zhu, M.; Zhu, Y.; Zhang, L.; Shi, J. Preparation of

chitosan/mesoporous silica nanoparticle composite

hydrogels for sustained co-delivery of biomacromolecules

and small chemical drugs. Sci. Technol. Adv. Mater. 2013,

14, 045005.

[53] Park, J.-H.; Gu, L.; von Maltzahn, G.; Ruoslahti, E.;

Bhatia, S. N.; Sailor, M. J. Biodegradable luminescent

porous silicon nanoparticles for in vivo applications. Nat.

Mater. 2009, 8, 331–336.

Documents

Oligonucleotide delivery by chitosan-functionalized porous silicon … · 2015. 1. 13. · Oligonucleotide delivery by chitosan-functionalized porous silicon nanoparticles Morteza