43
Neil Chue Hong Project Manager, EPCC [email protected] +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre [email protected] +44 131 651 4040 OGSA-DAI Introduction and Overview OGSA-DAI Tutorial GGF15, Boston, USA 6 October 2005

OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC [email protected] +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

  • Upload
    others

  • View
    4

  • Download
    0

Embed Size (px)

Citation preview

Page 1: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

Neil Chue HongProject Manager, EPCC

[email protected]+44 131 650 5957

Malcolm AtkinsonDirector, National e-Science Centre

[email protected]+44 131 651 4040

OGSA-DAIIntroduction and

OverviewOGSA-DAI Tutorial

GGF15, Boston, USA6 October 2005

Page 2: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 2

OGSA-DAI

Data, Data Everywhere & …

• Growing volumes

• Growing diversity

• Growing complexity

• How do we mine its riches for nuggets of information?

• Find & Access

• Understand

• Extract, Combine & Digest

• Test hypotheses

• Bingo!

⇒ Rich resource

⇒ Use OGSA-DAI

Page 3: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 3

OGSA-DAI

Composing Observations in Astronomy

Data and images courtesy Alex Szalay, John Hopkins

No. & sizes of data sets as of mid-2002,grouped by wavelength

• 12 waveband coverage of large areas of the sky

• Total about 200 TB data• Doubling every 12 months• Largest catalogues near 1B objects

Page 4: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15

Tutorial 6th

4

Biomedical data – making connections

12181 acatttctac caacagtgga tgaggttgtt ggtctatgtt ctcaccaaat ttggtgttgt 12241 cagtctttta aattttaacc tttagagaag agtcatacag tcaatagcct tttttagctt 12301 gaccatccta atagatacac agtggtgtct cactgtgatt ttaatttgca ttttcctgct 12361 gactaattat gttgagcttgttaccattta gacaacttca ttagagaagt gtctaatatt 12421 taggtgacttgcctgttttt ttttaattgg

Slide provided by Carole Goble: University of Manchester

Page 5: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

Database GrowthPDB Content Growth

Slide provided by Richard Baldock: MRC HGU Edinburgh

Page 6: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

BRIDGES

G lasgowEd inburgh

Le icester Oxford

London

Netherlands

Pub lica lly Curated D ata

P rivate data

Private data

Private data

Private data

Private data

Private data

CFG V irtual O rgan isation Ensem bl

M G I

H UG O

OM IM

SW ISS-PROT

… D A TA H U B

RG D

SyntenyGrid

Service

blast

+

VO Authorisation

Information Integrator

OGSA-DAI

Slide provided by Richard Sinnott: University of Glasgow

Page 7: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

eDiaMoND: Screening for Breast Cancer

1 Trust Many TrustsCollaborative WorkingAudit capabilityEpidemiology

Other Modalities-MRI-PET-Ultrasound

Better access toCase informationAnd digital tools

Supplement MentoringWith access to digitalTraining cases and sharingOf information acrossclinics

LettersRadiology reportingsystems

eDiaMoNDGrid

2ndary CaptureOr FFD

Case Information

X-Rays andCase Information

DigitalReading

SMF

Case andReading Information

CAD Temporal Comparison

Screening

ElectronicPatient Records

Assessment/ SymptomaticBiopsy

Case andReading Information

Symptomatic/AssessmentInformation

Training

Manage Training Cases

Perform Training

SMF CAD 3D Images

Patients

Provided by eDiamond project: Prof. Sir Mike Brady et al.

Page 8: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 8

OGSA-DAI

Data Grid

CustomerSupport

Web-basedDashboard

Customer Data Customer Order Information

Marketing department identifies likely buyers of new product

• Company wants real-time integrated view of customer buying behavior

• Data resides in various distributed CRM & ERP systems

• Grid allows developers and apps to access and integrate customer data sources together in real time--across many distributed databases

SAPOracle SiebelDB2

Business Intelligence and Customer Data

Slide from: Dave Berry, Andrew Grimshaw – OGSA-WG

Page 9: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 9

OGSA-DAI

Providing Data to Cluster-Based Analytical Application

Forward Proxy Data Caches of

Remote Data

CentralizedCompute Cluster

HeadquartersIllinois

• Company has centralized HPC cluster running compute-intensive applications

• Source data for analysis distributed among 3 global sites, one of them an external partner

• Manual data-sharing processes increase costs/errors, and hinder time-to-results

• Grid enables secure, automatic provisioning of remote data to HPC cluster—feeding CPUs more data faster

Data Grid

DataGrid

DataGrid

DataGrid

R&DWest Coast

TestingIndia

Engineering East Coast

AnalyticalApplications

Slide from: Dave Berry, Andrew Grimshaw – OGSA-WG

Page 10: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 10

OGSA-DAI

Story so far

• There is a lot of data– growing in every dimension– Distributed– Many different producers & owners– Heterogeneous– High value resource – Combined it is more valuable

• There are many requirements for data integration– Takes many forms– Driven by insights– Enable conversion of insight into tested hypothesis

• There are many data owners– Their autonomy and policies must be respectedGeneri

c Repeatable S

olutions R

equired

Page 11: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

Neil Chue HongProject Manager, EPCC

[email protected]+44 131 650 5957

Malcolm AtkinsonDirector, National e-Science Centre

[email protected]+44 131 651 4040

Changing theway we manage

Data

Page 12: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 12

OGSA-DAI

Terabyte → Petabyte

60 m2Inside machineDisk footprint

33 Tonnes5.6 KgDisk weight

100 Kilowatts100 WattsDisk power

6800 Disks + 490 units + 32 racks = $7 million

7 disks =

$5000 (SCSI)

Disk cost

14 months ($1 million)10 hours ($1000)1GB WAN move time

2 months15 minutesRAM time to move

PetabyteTerabyte

Approximately Correct in May 2003 Distributed Computing EconomicsJim Gray, Microsoft Research, MSR-TR-2003-24

Page 13: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 13

OGSA-DAI

Mohammed & Mountains

• Petabytes of Data cannot be moved– It stays where it is produced or curated

– Hospitals, observatories, European Bioinformatics Institute

– A few caches and a small proportion cached

• Distributed collaborating communities– Expertise in curation, simulation & analysis

• Diverse data collections– Discovery depends on insights– Unpredictable or unexpected use of data

Page 14: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 14

OGSA-DAI

Move computation to the data

• Assumption: code size << data size– Minimise data transport

• Provision combined storage & compute resources • Develop the database philosophy for this?• Develop the storage architecture for this?• Develop experiment, sensor & simulation architectures

– That take code to select and digest data as an output control– That attach the provenance & metadata

• Data Cutter a step in this direction– Sub-setting and aggregation of datasets using filters executed

close to data– http://www.cs.umd.edu/projects/hpsl/ResearchAreas/DataCutter.htm

Page 15: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 15

OGSA-DAI

Meta-data: describing data

• Choosing data sources– How do you find them?– How are they described and advertised?– Is the equivalent of Google possible?

• Meta-data is required describing– Content– Provenance– Structure– Types, Formats & Ontologies– Operations available– Access requirements– Quality of service

• No established standards for heterogeneous data sources

Page 16: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 16

OGSA-DAI

Cultural Challenges

• Changing the way we work?• Publication and sharing of result data

– Increased volume and diversity = increased opportunity?– Allows independent validation of methods and derivatives– Responsibility, ownership, credit, citation

• Many distributed data resources– Data collected from observation, simulation & experiment– Independently owned & managed

– No common goals or design– Work hard for agreements on foundation types and ontologies– Autonomous decisions change data, structure, policy, etc

– Requires negotiations and patience!• Diversity

– No “one size fits all” solutions will work

Page 17: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 17

OGSA-DAI

Economic Challenges

• Data production, publication & management– Many researchers contributing increments of data – Who pays for storage, transport, management and curation?

• Data longevity– Research requirements may outlive technical decisions– Data does not preserve itself indefinitely!

• When a community is dependent on a data resource– Who pays or decides to switch it off?

Page 18: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 18

OGSA-DAI

Summary: Scientific Discovery

• Obtaining access to that data– Overcoming administrative barriers– Overcoming technical barriers

• Understanding that data– The parts you care about for your research

• Combing them using sophisticated models– The picture of reality in your head

• Analysis on scales required by statistics– Coupling data access with computation

• Repeated Processes– Examining variations, covering a set of candidates– Monitoring the emerging details– Coupling with scientific workflows

Page 19: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 19

OGSA-DAI

Three communities

Users: Individual & Organisations

Data,Informa-tion &KnowledgeProviders

Comp-ute

Storage &Communicat

ionsProviders

Page 20: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 20

OGSA-DAI

Three communities

Users: Individual & Organisations

Data,Informa-tion &KnowledgeProviders

Comp-ute

Storage &Communicat

ionsProviders

Initiate & Steer workProvide Requirements

Use knowledge & insightWant easy & reliable facility

Expect agility, reliability, stability&

latest techniquesPay the bills

Page 21: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 21

OGSA-DAI

Three communities

Users: Individual & Organisations

Data,Informa-tion &KnowledgeProviders

Comp-ute

Storage &Communicat

ionsProviders

Provide & operate resourcesStorage centres, Data centres,

DBMS & File SystemsComputation environment,

Processing & CommunicationsNeed to change facilities & policiesPrefer consolidated requirements

Must be paid

Page 22: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 22

OGSA-DAI

Three communities

Users: Individual & Organisations

Data,Informa-tion &KnowledgeProviders

Comp-ute

Storage &Communicat

ionsProviders

Create & Collect dataOrganise & Structure data

Provide, organise & maintain metadataOffer access and domain specific services

Establish use policiesWill change structure, services & policies

May pay or be paid

Page 23: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 23

OGSA-DAI

Three communities

Users: Individual & Organisations

Data,Informa-tion &KnowledgeProviders

Comp-ute

Storage &Communicat

ionsProviders

OGSA-DAI a

framework for a lasting& productive relationship

Page 24: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

Neil Chue HongProject Manager, EPCC

[email protected]+44 131 650 5957

Malcolm AtkinsonDirector, National e-Science Centre

[email protected]+44 131 651 4040

An Architecture

Page 25: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 25

OGSA-DAI

Three communities

Users: Individual & Organisations

Data,Informa-tion &KnowledgeProviders

Comp-ute

Storage &Communicat

ionsProviders

OGSA-DAI

Client Library

Portals & Applications

Adapt

ive In

terfac

esAdaptive &

Extensible Interfaces

Provided Interfaces & Services

Page 26: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

Neil Chue HongProject Manager, EPCC

[email protected]+44 131 650 5957

Malcolm AtkinsonDirector, National e-Science Centre

[email protected]+44 131 651 4040

DAIS Working Group

Page 27: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 27

OGSA-DAI

DAIS WG Goals

• Provide service-based access to structured data resources as part of OGSA architecture

• Specify a selection of interfaces tailored to various styles of data access starting with relational and XML

• Interact well with other GGF OGSA specs

Page 28: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 28

OGSA-DAI

DAIS WG Non-Goals

• No new common query language

• No schema integration or common data model

• No common namespace or naming scheme

• No data resource management– e.g. starting/stopping database managers

• No push based delivery – Information Dissemination WG?

Page 29: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 29

OGSA-DAI

DAIS View Of Data Services Model

0-* 0-*Consumer Data Service Data Resource

0- * 0-* 0-*

0-*

This structure is not exposed through the Data Service interface to the Consumer.

• A Data Service presents a Consumer with an interface to a Data Resource.

• A Data Resource can have arbitrary complexity, for example, a file on an NFS mounted file system or a federation of relational databases.

• A Consumer is not typically exposed to this complexity and operates within the bounds and semantics of the interface provided by the Data Service

Page 30: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 30

OGSA-DAI

DAIS Specification Landscape

OGSA Data Services

WS-DAI

WS-DAIXWS-DAIR

Scenarios for MappingDAIS Concepts

Is Informed By

Extend

GWD-I

GWD-R

Page 31: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 31

OGSA-DAI

INFOD

GridFTP

DT

TMBoFADFBoF

GGF

Arch Data ISP SRM

OGSA

CMM GIR

GSM

GFS DAIS

CGS GRAAP

Policy

IETF

SNMP

Other Standards Bodies

????W3CXQuery

ANSI

SQL

DMTF

CIM

OASIS

WS-DM

WS-RF

WS-N

WSPolicy

WSAddress

OREP

JDBC

JCP

DFDL

DAIS and Other Standards/Specifications

Page 32: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 32

OGSA-DAI

DAIS Data Access

DatabaseData Service

Relational Database

SQLResponse

SQLDescription: Readable Writeable ConcurrentAccess TransactionInitiation TransactionIsolation Etc.

SQLAccess

Consumer

SQLExecute ( SQLExpression )

Page 33: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 33

OGSA-DAI

DAIS Derived Data Access Database

Data Service

SQ L ResponseData Service

Relational Database

Row Set

SQLExecuteFactory ( SQLExpression BehaviouralProperties )

RDBM S specific m echanism for generating result set

SQ LFactory

SQ LResponseD escription

SQ LResponseA ccess

Consum er

GetRowset ( rowsetnumber )

Reference to SQLResponse Data Service

Rowset

SQ LD escription: Readable W riteable ConcurrentA ccess TransactionInitiation TransactionIsolation Etc.

Page 34: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 34

OGSA-DAI

Terminology - Data

• Data Resource– Any object that can source/sink data– Currently databases in scope

• Data Service– Common interface to a data resource– Exposes capabilities of data resource

– SQL Queries, X-Path Queries– May provide additional capabilities

– Data transformations, 3rd party data delivery

• OGSA-DAI– Open Grid Services Architecture Data Access and Integration

Page 35: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

Neil Chue HongProject Manager, EPCC

[email protected]+44 131 650 5957

Malcolm AtkinsonDirector, National e-Science Centre

[email protected]+44 131 651 4040

And nowOGSA-DAI

Page 36: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 36

OGSA-DAI

OGSA-DAI Projects• Develop a component library

– Access and manipulate data in a grid– Serve UK and International e-Science communities

• Provide an extensible framework

• Provide– Common interface to data resources– Simple integration of distributed queries to multiple data resources

• Contribute to standardisation efforts– Input into GGF DAIS WG and other groups– Provide a reference implementation of DAIS spec

• Based on Open Grid Services Architecture (OGSA)– WSRF (GT4) & WS-I (OMII_2) versions

• Support Application Developers & Contributors

Page 37: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 37

Data Services: challenges

• Scale– Many sites, large collections, many uses

• Longevity– Research requirements outlive technical decisions

• Diversity– No “one size fits all” solutions will work

– Primary Data, Data Products, Meta Data, Administrative data, …• Many Data Resources

– Independently owned & managed– No common goals– No common design– Work hard for agreements on foundation types and ontologies– Autonomous decisions change data, structure, policy, …

– Geographically distributed

• and I haven’t even mentioned security yet!Slide from Neil Chue Hong

Page 38: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 38

OGSA-DAI In One Slide

• An extensible framework for data access and integration.

• Expose heterogeneous data resources to a grid through web services.

• Interact with data resources:– Queries and updates.– Data transformation / compression– Data delivery.

• Customise for you project using– Additional Activities– Client Toolkit APIs– Data Resource handlers

• A base for higher-level services– federation, mining, visualisation,…Slide from Neil Chue Hong

Page 39: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 39

OGSA-DAI

OGSA-DAI team

IBM Development Team, Hursley

NEReSC, Newcastle

NeSC, EdinburghEPCC Team, Edinburgh

ESNW, Manchester

IBM Dissemination Team

Page 40: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

International Collaboration & Use

USA:o Globus Allianceo IBM Corporationo caBIGo BIRNo Indiana University o GridSphereo GEONo LEADo MCSo NCSAo Secure Data Grido UNC

Japan:o AISTo BioGrido NAREGI

Europe:o CERNo DataMiningGrido GridMinero GridSphereo inteligrido N2Grido OntoGrido Provenanceo SIMDATo OMII-EU

UK:o OMIIo OMII-UKo NGSo NCeSSo NIeeSo AstroGrido BioSimGrido BRIDGESo CancerGrido ConvertGrido eDiaMonDo EDINAo First Group plco Fujitsu Labs Europeo GEDDMo GeneGrido Genomic Technology and Informaticso GOLDo Human Genetics Unito IBM UKo myGrido Oracle UK

China:o CASo ChinaGrido cnGrido INWAo OMII-China

Australia:o Curtin Business Schoolo INWA

TutorialsBoston CambridgeCERN ChicagoEdinburgh LondonSan Francisco SeattleSeoul SingaporeTokyo ISSGC 03 to 05

DIALOGUE workshopsColumbus, Edinburgh, Indiana, Vienna

Chicago, Manchester, San Diego

South Korea:o KISTI

China40%

United Kingdom15%

United States11%

Germany3%

Japan5%

Italy2%

France3%

Austria1%

Others20%

1485 registered users5250+ downloads

Page 41: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

LEAD

GeneGrid

caBIG

BRIDGES

OGSA WebDB

FirstDIG ConvertGrid eDiaMoND

OGSA-DQP

Grid Miner

Meeting User Requirements

Page 42: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

GGF15 Tutorial 6th October 2005 42

OGSA-DAI

Project Partners

Powered by ….

Funded by the Grid Core ProgrammeOGSA-DAI£3 million, 18 months, from Feb 2002

Three major releases, three interim releases

DAIT (DAI-Two)Keep the OGSA-DAI brand name£1.5 million, 24 months, from Oct 2003Four major releases

OMII-UKTo October 2008

Page 43: OGSA-DAI Introduction and Overview · 2006-08-04 · Neil Chue Hong Project Manager, EPCC N.ChueHong@epcc.ed.ac.uk +44 131 650 5957 Malcolm Atkinson Director, National e-Science Centre

Neil Chue HongProject Manager, EPCC

[email protected]+44 131 650 5957

Malcolm AtkinsonDirector, National e-Science Centre

[email protected]+44 131 651 4040

Thanks for attending!