THE JOURNN. OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 269, No. 45, Issue of November 11, pp. 28450-28459, 1994 Printed in U S A .

Functional Importance of an Spl- and an NFkB-related Nuclear Protein in a Keratinocyte-specific Promoter of Rabbit K3 Keratin Gene*

(Received for publication, May 27, 1994, and in revised form, August 17, 1994)

Ren-Long Wu, Tung-Ti Chen, and TungTien Sun$ From the Epithelial Biology Unit, The Ronald 0. Perelman Department of Dermatology and Department of Pharmacology, Kaplan Comprehensive Cancer Center; New York University School of Medicine, New York, New York 10016

We have shown previously that a 300-base pair (bp) 5‘ upstream sequence of rabbit keratin K3 gene ( R E I ) can function as a keratinocyte-specific promoter in tran- sient transfection assays. Electrophoretic mobility shift assays using various overlapping and mutated oligonu- cleotides established that corneal keratinocyte nuclear proteins bound in vitro to two sites (B and E). Immuno- supershift and UV cross-linking established that the keratinocyte nuclear binding protein of site B (5‘- GGGGCTTTCC-3’, -262 to -253 bp) was NFkB consisting of the p65 and p50 subunits. The E site contained an unusual GC-rich motif (B’-CCGCCCCCTG-3’, -203 to -194 bp) whose sequence deviated from the Spl consen- sus in 4 out of 10 positions; this site bound an Spl-re- lated keratinocyte nuclear protein. Mutagenesis of the NFkB, GC motif, and both sites abolished 20,50, and 75%, respectively, of the promoter activity in transfected keratinocytes. The NFkB-like keratinocyte nuclear pro- tein was barely detectable in kidney epithelial cells, HeLa, and fibroblasts. The Spl-related nuclear protein was abundant in keratinocytes and simple epithelial cells, but was much less abundant in fibroblasts. These results indicate that NFkB is present in significant quantities in keratinocyte nuclei and that the tissue restriction of the NFkB- and Spl-related proteins, in combination with other factors, may contribute to the keratinocyte specificity of RK3 promoter.

The tissue-specific expression of genes is exquisitely con- trolled by multistep and complex regulation, primarily at the transcription level. The mechanism of this is not clear but may involve the combinatorial interactions of DNA sequence-spe- cific transcription factors and non-DNA binding regulatory pro- teins with the transcription machinery (McKnight and Yamamoto, 1992). A gene family suitable for dissecting some of these aspects of gene regulation encodes about 30 keratin pro- teins, which are hallmarks of epithelial differentiation (Moll et al . , 1982). These keratins can be divided into an acidic (Type I) and a basic (Type 11) subfamily. By studying the changes in keratin pattern as a function of tissue variation, development, disease, or cell culture conditions, and stages of stratified squa- mous epithelial differentiation, we noted earlier that many “pairs” of specific acidic and basic keratins tend to express in a

EY04722 andAR7190-20. The computation was supported by National * This work was supported by National Institutes of Health grants

Science Foundation Grant DIR-8908095. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed: Dept. of Dermatol- ogy, New York University School of Medicine, 566 First Ave., New York, NY 10016.

tissue-restricted, development- and differentiation-dependent fashion (Eichner et al., 1984; Sun et al., 1984). These include keratins expressed in the suprabasal cells of normal stratified squamous epithelia, e.g. the Kl/K10 pair of keratinized epider- mis, the K3/K12 pair of corneal epithelium, and the K4/K13 pair of esophageal epithelium. This group of keratins can be considered as the markers for an advanced stage of keratino- cyte differentiation (Albers and Fuche, 1992; O’Guin et al., 1990; Oshima, 1992; Quinlan et al . , 1985; Steinert and Roop, 1988; Sun et al., 1984).

The molecular mechanisms underlying the cell-specific and differentiation-dependent expression of several keratin genes in keratinocytes have been analyzed. Blessing et al. (1989) showed that the 5’ upstream sequence of K6 gene can serve as a keratinocyte-specific promoter in transfection assays. Leask et al. (1991) analyzed the promoter of human K14 gene by transfection and mutagenesis assays. They identified a proxi- mal element (5’-GCCTGCAGGC-3’, -183 to -175 bp)’ which, in combination with a distal region located around -2100 bp, can drive a reporter gene to express in keratinocytes. This expres- sion was not keratinocyte-specific, as it also occurs at a high level in HeLa cells (Jiang et al . , 1990; Leask et al., 1990). The protein factor, Ker 1, that binds to the proximal element of K14 gene was later identified as AP2, an ubiquitous transcription factor present not only in keratinocytes, but also in HeLa and mammary adenocarcinoma cells (simple epithelial cells), as well as lymphoma cells (Leask et al., 1990). In transgenic mice, however, a 2.1-kb K14 promoter can direct the expression of a reporter gene in the basal cells of stratified epithelia (Vassar et al . , 1989). These results indicate that the Ker 1 proximal ele- ment and its associated proteids) may function as a part of a general transcription machinery, but its role in the keratino- cyte-specific expression of K14 gene remains unclear. Recent studies on human K5 promoter reveal that its 6 kb of 5’ up- stream sequence can direct proper, basal cell-specific expres- sion in many stratified epithelia in transgenic mice (Byme and Fuchs, 1993). This 6-kb promoter sequence can drive a reporter gene to express in a squamous cell carcinoma line (SCC13) but not in hepatocytes (G2) or in NIH 3T3 cells. This study also showed that a shorter -120 bp (-90 to +32 bp) of K5 gene upstream sequence still retains about 30% of the promoter activity and still exhibits to some extent keratinocyte specific- ity. Huff et al. (1993) identified a 3’ element of human K1 gene that is keratinocyte-specific and calcium-dependent. Finally, Jiang et al. (1993) established the existence of epidermal growth factor-response elements in the 5’ upstream sequences of K6 and K16 genes, which are frequently coexpressed in

The abbreviations used are: bp, base pair@); kb, kilobase(s); CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis.

28450

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

Spl and NFkB Involvement in a Keratinocyte-specific Promoter 28451

hyperproliferative keratinocytes (Weiss et al., 1984). These re- sults have amply demonstrated the importance of certain cis- elements in regulating the expression of keratin genes. How- ever, relatively little is known about how these elements and their cognate binding proteins contribute to the keratinocyte specificity of these genes.

Of all the differentiation-related keratins, we have paid par- ticular attention to K3 keratin. Not only it is expressed in a tissue-restricted and differentiation-dependent fashion, but also its expression responds quickly to changes in cellular pro- liferation and to environmental factors including basement membrane heterogeneity (Kolega et al., 1989; Kurpakus et al., 1992). Another advantage of studying K3 expression is that cultured rabbit corneal epithelial cells undergo stage-specific expression of keratins, progressing from the expression of basal cell-associated K5/K14 pair, to hyperproliferation-related K6/ K16, finally to differentiation-related K3/K12 (Schermer et al., 1986, 1989). Such a culture system offers a unique opportunity for studying stage-specific and extracellular matrix-regulated gene expression as well as the mutually exclusive expression of the hyperproliferation-related (K6K16) uersus differentiation- related (K3K12) keratin pairs.

We have shown previously that a 300-bp 5' upstream se- quence of rabbit K3 keratin (RK3) gene can drive a reporter gene (the chloramphenicol acetyltransferase or CAT gene) to express, in transient transfection assays, in cultured corneal and esophageal keratinocytes, but not in mesothelial, kidney epithelial cells, or fibroblasts (Wu et al., 1993). Thus this 300-bp sequence of RK3 keratin gene can function in cultured cells as a keratinocyte-specific promoter. While this 300-bp promoter contains several known transcription factor binding motifs, it was not known whether any of these binding motifs were func- tionally important (Wu et al., 1993). Using electrophoretic mo- bility shift assay, immunosupershift and UV cross-linking tech- niques, we demonstrate here that rabbit corneal keratinocytes contain an Spl-related nuclear protein that binds to a GC-rich motif (5'-CCGCCCCCTG-3'; -203 to -194 bp) and an NFkB- like nuclear protein that binds to a typical NFkB motif (5'- GGGGCTTTCC-3'; -262 to -253 bp) of this promoter. Muta- tions in these two binding motifs abolished about 75% of the promoter activity in transfection assay, thus demonstrating their functional importance. The Spl-like protein was detected in the nuclear extracts of corneal keratinocytes, kidney epithe- lial cells, and HeLa cells, but it was much less abundant in rabbit fibroblasts and 3T3 cells. The NFkB-like protein, that was abundant in the nuclear extract of corneal keratinocytes, was barely detectable in nuclear extracts of kidney epithelial cells, HeLa cells, fibroblasts, and mouse 3T3 cells. These re- sults demonstrate the functional importance of an Spl-related and an NFkB-related factor in the RK3 promoter. Our results also raise the possibility that the tissue restriction of these two nuclear proteins, in conjunction with other factors, may contribute to the keratinocyte specificity of this promoter.

MATERIALS AND METHODS Preparation of Nuclear Extracts-Rabbit corneal and esophageal epi-

thelial cells were grown in the presence of 3T3 feeder cells (Doran et al., 1980; Rheinwald and Green, 1975; Schermer et al., 1986). The cultiva- tion of other cell types including a rabbit kidney epithelial cell line (American Type Culture Collection No. CCL37) and fibroblasts was done as described in Wu et al. (1993). Nuclear extracts from these cultured cells were prepared essentially as described by Dignam et al. (1983) and Lee et al. (1988). The extracts were dialyzed against 20 m HEPES, pH 7.9, 25% glycerol, 0.42 M NaCl, 1.5 m MgCl,, 0.2 mM EDTA, 0.5 m phenyImethyIsuIfony1 fluoride, and 0.5 m dithiothreitol, and then aliquoted, and stored at -70 "C. Protein concentration was determined according to Bradford (1976).

Electrophoretic Mobility Shift and Immunosupershift Assays- Electrophoretic mobility shift assay (EMSA) was performed using

restriction fragments or annealed synthetic oligodeoxynucleotides as the probes (Ausubel et al., 1989). They were 32P-end-labeled using Kle- now fragment or polynucleotide kinase and purified electrophoretically (specific activity, 1-5 x lo4 countdmidng). A typical binding reaction mixture (20 pl) contains: 20 m HEPES, pH 7.9, 2.5 mM MgCl,, 1 mM dithiothreitol, 12% glycerol, 1 m EDTA, 60 mM KC1,3.48 pg of poly(d1- dC).poly(dI-dC) (Pharmacia LKB Biotechnology Inc.), 0.5 ng of 32P-la- beled probe, and 10 pg of nuclear proteins. The mixture was incubated at 30 "C for 15 min and at 0 "C for 2 min, and was then loaded onto a 4% non-denaturing polyacrylamide gel. Electrophoresis was carried out in room temperature at 10 v/cm for 2 h. The gel was dried and exposed to an x-ray film overnight. The immunosupershift assay was performed the same way as the electrophoretic mobility shift assay except that an antibody was included in the reaction mixture. AfEnity-purified rabbit antibodies to Spl (Jackson et al., 1990) and the p65 subunit of NFkB (Ballard et al., 1992) were obtained from Santa Cruz Biotech (Santa Cruz, CAI. Recombinant human Spl was obtained from Promega (Madison, WI).

Construction of Expression Vectors with Mutated RK3 Promoters-A set of expression vectors, in which a CAT reporter gene was driven by a 300-bp RK3 promoter containing various mutations, was constructed according to Vallette et al. (1989). Briefly, a 300-bp 5' upstream se- quence of RK3 gene was inserted into the polylinker region of a CAT reporter vector, pCAT-basic (Promega, Madison, WI) (Wu et al., 1993). Appropriate oligodeoxynucleotide primers (25-28-mers) containing new restriction sites were made using a Pharmacia Gene-Plus Synthesizer. Polymerase chain reactions (PCR) were performed using a plasmid, the pCAT 0.4 (Wu et al., 1993), as the template using a PCR instrument (Perkins-Elmer). By joining two PCR fragments containing complemen- tary restriction sites, various 300-bp promoters with specific mutations were made. They were inserted into the polylinker site of the pCAT- basic vector (Sambrook et al., 1989), and all the mutations were confirmed by DNA sequencing (Sanger et al., 1977).

Cell Tkansfection and CAT Activity Assays-Cultured cells were transfected with various expression vectors using a calcium phosphate procedure (Gorman et al., 19821, with modifications as described previ- ously (Wu et al., 1993).

W Cross-linking-A probe for W cross-linking was prepared by annealing 33 ng of B'-GTTCCGGGGC-3', with 100 ng of 5'-TTC- CCAGCT"GTCTGGAA4GCCCC GGAAC-3' (NFkB site underlined), followed by filling-in the single-stranded regions by the action of Kle- now enzyme in the presence of 100 pCi of t3'P1dCTP and 0.2 mM each of d'ITF', dATF', and dGTP. One ng of electrophoretically purified 32P-la- beled probe (containing -1 x lo5 counts/min) was used in electro- phoretic mobility shift assay. After electrophoresis, the gel was W irradiated (254 nm; 750 pw/cm2 ) at 4 "C for 20 min and subsequently exposed to x-ray film for 5 h at 4 "C (Chodosh et al., 1986). Selected protein.DNA complexes were excised from the gel and analyzed by 10% SDS-PAGE using 14C-labeled proteins (Life Technologies Inc.) as molecular weight markers.

RESULTS

Multiple Nuclear Proteins of Rabbit Corneal Keratinocytes Interact with the 300-bp Keratinocyte-specific Promoter of RK3 Gene-In order to identify the cis-elements and their binding proteins that may be functionally important in the 300-bp 5' upstream sequence of RK3 gene, we performed gel EMSA. Three partially overlapping restriction fragments which to- gether covered the entire 300-bp promoter region were isolated and used as the probes. These three probes were: fl (HindIII- PstI, -348 to -192 bp), f2 (EcoNI-EcoRI, -282 to -88 bp), and f3 (PstI-KpnI, -191 to +76 bp; Fig. 1). We first studied the f2 fragment, which according to our earlier serial deletion experi- ments covered a functionally important region of the promoter (Wu et al., 1993). Incubation of the 32P-labeled f2 probe with a nuclear extract of rabbit corneal keratinocytes resulted in the formation of several slow migrating DNA.protein complexes (Fig. 2). The formation of these complexes was completely in- hibited by 50-fold molar excess of unlabeled f2 (homologous) probe (Fig. 2a, lane 7 and Fig. 2b, lane 3), but not by poly(dI- dC), indicating that their formation was sequence-specific. In- clusion of excess, unlabeled fl-fragment (-348 to -192 bp), which overlapped with the B'-half of f2(-282 to -192), inhibited the formation of a subset of f2-protein complexes (Fig. 2b, lane

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

28452 Spl and NFkB Involvement in a Keratinocyte-specific Promoter

FIG. 1. The DNAsequence and poten- tial transcription factor binding mo- tifs of the 6' upstream sequence of rab- bit K3 keratin gene. a, the nucleotide sequence of the 5' upstream region (-348 to +79) of the rabbit K3 gene (Wu et al., 1993). The transcription initiation site is desig- nated position + I (Wu et al., 1993). The po- tential binding motifs for several known transcription factors, a TATA box, and the translation initiation codon are boxed. Ar- rows mark the boundaries of three restric- tion fragments ( f 7 , f2, and f3); the restric- tion sites include Ecoh'I, PstI, and EcoRI. The Sequences of the 10 synthetic (double- stranded) oligodeoxy-nucleotides, marked A d , are underlined. b, a schematic dia- gram summarizing the spatial relationship among the various transcription factor binding motifs (SV, AP2, hFkB, NF-1, Ker 1, CK8, and TATA box), restriction frag- ments ( f l , f2, and f 3 ) , and synthetic oligodeoxynucleotides ( A d ) .

-288

-228

EcoNl - rrcf2 N&

@\I

D E -

WAGG+AAGCCTGCCACCTTAGCAC ~ ~~~ ~

I- -

r

-168 TTTTACCATTTCAGAGTATTTTCAAGGTGTGT~TGGTAGCCTGGAAC~CGTACTGCCT

H I -

TCTTGGGGTTAATTACATCTCCTTCGTTTGAGCTCA

J

-48 GCAACCTTC;~CACAGGG~~~GGCTGTGTTCCACTAAGACATTCAGTTGCTTCCTT

13 CAACCCCTGACGCTCCGTGGCCCCTGCTTGTCTCTCAGCTTCTCCTCTGGCCAAGCTCCT

73 "74 CAC T

f l f2

-348 -300

21, indicating that at least some of the protein binding sites of f2 must reside within the region of -282 to -192 bp. Consistent with this result, incubation of 32P-labeled fl fragment with nuclear extracts of corneal keratinocytes resulted in specific complex formation (see below). On the other hand, f3 fragment, which overlapped with a 3' portion of f2 (-191 to -88), did not inhibit f2-protein complex formation. These results indicate that fl and E? share at least one, possibly more, protein-binding site(&

In order to map these binding sites more precisely, we pre- pared, by chemical synthesis and annealing, a series of 10 partially overlapping 30-mer oligodeoxynucleotides ( A 4 in Fig. lb). Together, these 10 doubled-stranded oligonucleotides covered the entire f2 sequence. The ability of these oligomers to inhibit f2-protein complex formation was tested in electro- phoretic mobility shift assays. The results indicated that of the 10 oligomers, only two, B and E, were effective inhibitors (data not shown). Since B contained an NFkB consensus sequence and E contained a GC-box resembling to some extent an Spl site (see below), we tested the ability of authentic NFkB and

-200 -1 00 -1 +77

Spl binding sequences to compete for E?-protein complex for- mation. The results indicated that these two sequences were indeed highly effective in preventing f2-protein complex f rma- tion. Thus, the Sp l consensus sequence competed for t NQ , e for- mation of most of the complexes, except one that appeared as a well-defined band on polyacrylamide gel (Fig. 3a, 2ane 4) . In- terestingly, the formation of this Spl-resistant band was com- pletely inhibited by the NFkB consensus sequence (Fig. 3u, lunes 4 and 9). As expected, Spl and NFkB consensus se- quences in combination abolished all f2-protein complex forma- tion (Fig. 3b), hence proving that under our experimental con- ditions f2 contains two major protein-binding sites, one related to Sp l and the other related to NFkB.

In order to provide independent confirmation of these sites, we repeated the electrophoretic mobility shift assays using the fl fragment (-348 to -192 bp) as the probe (Fig. 4). This frag- ment contained both the NFkB and GC-rich sites, but the Ker 1 site (5'-CCCTGCAGGG-3'), which partially overlapped with the 3'-end of the GC site, was destroyed by PstI digestion (Fig. la). Incubation of this fragment with nuclear extracts of

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

Spl and NFkB Involvement in a Keratinocyte-specific Promoter 28453

(H) NI P E 7 (K) I I

-348 -282 -192 -88 +77

f l f2

f3

a b 1 2 3 4 5 6 7 1 2 3 4

R C : - + + + + + + + + + + co: - "1 f2 - f l f2 f3

FIG. 2. Complex formation between the f2 restriction fragment

cytes. a , effects of poly(dI-dC).poly(dI-dC). The "P-labeled restriction and the nuclear proteins of cultured rabbit corneal keratino-

fragment t2 (-282 to -88 bp) was incubated with a nuclear extract of cultured rabbit corneal keratinocytes in the presence of various amounts of poly(dI-dC).poly(dI-dC). In this and all subsequent experi- ments, the cells were harvested 2 days post-confluence. The incubation mixtures were fractionated electrophoretically on a 4% polyacrylamide gel, and the 32P-labeled probe was detected by autoradiography. RC and Co denote rabbit corneal epithelial nuclear extract and competitor, re- spectively. The amounts of poly(dI-dC).poly(dI-dC) are: lanes 1 ,O; 2,348 ng; 3,870 ng; 4, 1740 ng; 5,3480 ng; and 6,8700 ng. Lane 1 contained no nuclear extract. Lane 7 was identical to lane 5 except it also con- tained 25 ng (50-fold) of unlabeled t2. Dots denote the three major species of t2-protein complexes; they migrated slightly differently in a and b because of a small change in polyacrylamide gel concentration. b, inhibition of complex formation by overlapping restriction fragments. A 32P-labeled t2 fragment was incubated with a rabbit corneal epithelial nuclear extract in the presence of 3.5 pg of poly(dI-dC).poly(dI-dC) and fractionated on a 4% polyacrylamide gel. Samples contained (lane 1) no additional competitor; lane 2, 100-fold of unlabeled fl restriction frag- ment (-348 to -192 bp); lane 3,50-fold of unlabeled PL (-282 to -88 bp); and lane 4, 100-fold of unlabeled f3 (-191 to +76 bp). Note that the formation of the E-protein complexes can be abolished by unlabeled t2 probe indicating their sequence-specific nature.

cultured rabbit corneal keratinocytes resulted in the formation of a single, well-defined complex (Fig. 4). The formation of this complex was related to the B site as it was specifically com- peted by synthetic oligomer B, but not by any other DNA oli- gomers including site E (Fig. 4b). This conclusion was sup- ported by the observation that the formation of this complex was also competed by the NFkB consensus sequence but not by the Spl sequence (Fig. 4a). The fact that the GC site of fl fragment did not form protein complexes most likely is because it is too close to the 3'-end (Fig. la). Alternatively, this may signal the importance of Ker 1 site in the formation of Spl- related complex (see "Discussion").

An NFkB-related Nuclear Protein of Rabbit Corneal Kera- tinocytes Binds to a n NFkB Motif (in Site B) of RK3 Promoter-To further define the protein binding motif in site B, we repeated gel mobility shift assays using a 32P-labeled B oligomer as the probe. Incubation of this probe with a nuclear extract of cultured rabbit corneal keratinocytes resulted in the formation of a DNA.protein complex that appeared as a sharp band on polyacrylamide gel (Fig. 5). Like the fl-protein com- plex (Fig. 41, the formation of this B-protein complex was in- hibited not only by B oligomer itself (Fig. 5a, lane 21, but also by NFkB consensus sequence (Fig. 5b, lane 2) . However, its formation was unaffected by neighboring oligomers A and C, or

Co: - APl AP2 Spl Oct CTFl GRECREBNF- Spl NF- SPl NF-1 kB kB +NF-kB

FIG. 3. Inhibition of f2-protein complex formation by Spl and hTkB consensus sequences. a , a "2P-labeled E? fragment was incu- bated with a nuclear extract of cultured rabbit corneal keratinocytes (2 days post-confluent) in the presence of 100 x molar excess of unlabeled competitor oligodeoxynucleotides (all purchased from Promega, Madi- son, WI) containing the binding sites of several known transcription factors as indicated (lanes 2-9). Lane 1 shows a control without a competitor. The dots and arrowhead denote the f2-protein complexes whose formation can be inhibited by Spl and NFkB sequences, respec- tively. The sequences of these consensus sequences of NFkB and Spl are shown in Figs. 6 and 9, respectively. b, an independent experiment showing that a combination of Spl and NFkB sequences completely abolished the f2-protein complex formation. The "P-labeled f2 fragment was incubated with a corneal keratinocyte nuclear extract in the presence of Sp l sequence (1 1, NFkB sequence (2), and a combination of both (3 ).

a b 1 2 3 4 1 2 3 4 5 6

CO: - f 2 Spl NF- A B C D E F kB

FIG. 4. Complex formation between the f l fragment (-348 to -192 bp) and the nuclear extract of corneal keratinocytes. A 32P-labeled fl fragment was incubated with nuclear extracts of cultured rabbit corneal keratinocytes in the presence of various competitors. The competitors in panel a are none (lane 1 ), the t2 fragment (lane 2), the Sp l sequence (lane 3), and the NFkB sequence (lane 4 ) . Arrow marks the fl-protein complex whose formation can be abrogated by the NFkB

tides A-F, as indicated. Note the inhibition of fl-protein complex sequence (panel a, lane 4) . The competitors in panel b are oligonucleo-

formation by oligomer B.

by E (Fig. 5a). To define precisely the protein binding motif in site B, we synthesized a series of mutated B oligomers (Bl-B9 and MI, Fig. 6b). The abilities of these mutants to compete for the formation of B-protein complex were tested in electro- phoretic mobility shift assays. The results indicated that mu- tations located between nucleotides -262 and -253 drastically affected the oligomers' ability to compete for B-protein complex formation; mutations outside this region had no such effects (Fig. 6a). These results clearly demonstrate that a 10-bp se- quence (5'-GGGGCnr'CC-3'), located at -262 to -253 bp of

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

28454 Spl and NFkB Involvement in a Keratinocyte-specific Promoter

a b 1 2 3 4 1 2

.

Y - NF-

kB FIG. 5. Complex formation between oligomer B (-266 to -237

bp) and the nuclear proteins of rabbit corneal keratinocytes. A 32P-labeled synthetic oligodeoxynucleotide B was incubated with a nu- clear extract of cultured rabbit corneal keratinocytes in the presence of various competitors. The competitors in panel a are oligonucleotides A 4 and E, as indicated, and those in panel b are none (lane 1 ) and the NFkB sequence (lane 2). Arrow marks the B-protein complex, whose formation can be inhibited by the NFkB sequence. A lower band (dotted) is variable in quantity and is not competed by NFkB sequence, thus representing most likely a nonspecific complex.

rabbit K3 gene, interacts in vitro with a rabbit corneal kera- tinocyte nuclear protein.

Since a large number of proteins, some unrelated to NFkB, can bind to the KB motif (Adams et al., 1991; Baldwin and Sharp, 1988; Bucher et al., 1992), the above data do not prove that an NFkB protein actually binds to this motif. We therefore performed an immunosupershift assay. We found that the ad- dition of an affinity-purified polyclonal antibody to the p65 subunit of NFkB protein to the electrophoretic mobility assay mixture resulted in the specific retardation or "supershift" of the B-protein complex (Fig. 7a, lanes 1 and 5 ) . This suggested that the B oligomer-binding protein was immunologically re- lated to the p65 subunit of NFkB. To determine the molecular weights of the B site-binding proteins, we UV cross-linked the B-protein complex. The cross-linked and thus 32P-labeled pro- tein products were then separated by SDS-PAGE. Autoradiog- raphy revealed two major cross-linked proteins that had rela- tive molecular masses of 65 and 50 kDa (Fig. 7b, lane 2 ) . A high M, protein was sometimes noted, which probably represented a heterodimer of these two subunits. Taken together, these re- sults clearly showed that the nuclear protein complex of rabbit corneal keratinocytes that bound to the NFkB motif consisted mainly of the p65 and p50 subunits of NFkB (see "Discussion").

An Spl-related Nuclear Protein of Rabbit Corneal Keratino- cytes Binds to an GC-rich Motif (in Site E) of RK3 Promoter-In order to define the protein binding motif of the E site, we used this oligonucleotide as a probe to perform electrophoretic mo- bility shift assays. Incubation of 32P-labeled E probe with nu- clear extracts of cultured rabbit corneal keratinocytes resulted in the formation of a sharp E-protein complex on polyacrylam- ide gel (Fig. 8). The formation of this DNA.protein complex could be competed not only by unlabeled E probe (Fig. 8a, lane 2 ) , but also by Spl consensus sequence (Fig. 8b, lane 2 ) . How- ever, its neighboring and partially overlapping oligomers D or F had no effect (Fig. 8a). To map precisely this binding motif, we tested the ability of a series of mutated E probes to inhibit E-protein complex formation. The results clearly defined a 10 bp motif, 5'-CCGCCCCCTG-3', located at -203 to -194 bp (Fig. 9, a and b ) of rabbit K3 keratin gene, that bound in vitro a nuclear protein of rabbit corneal keratinocytes.

The binding protein of the E oligomer was found to be

Spl-related. First, incubation of labeled E oligomer with a recombinant human Spl protein resulted in the formation of a DNAeprotein complex that comigrated electrophoretically with the E-protein complex (Fig. 10, lanes 1 and 6). Second, immu- nosupershift assay showed that an affinity-purified polyclonal antibody to Spl, when added to the reaction mixture of a mo- bility shift assay, resulted in the supershift of the E-protein complex (Fig. 10, lanes 1 and 5). Third, UV cross-linking of the E-protein complex followed by an analysis of the cross-linked proteins by SDS-PAGE revealed a major protein band of 100 kDa (data not shown), which is identical to the M, of Spl (Briggs et al., 1986). Taken together, these results clearly es- tablished that the nuclear protein of rabbit corneal keratino- cytes that binds in vitro to the GC-rich motif of RK3 gene promoter is Spl-related.

Mutations of the NFkB and GC-rich Motifs Abolished about 75% of RK3 Promoter Activity-To determine the functional significance of these NFkB and Spl binding motifs, we con- structed a set of expression vectors in which a CAT reporter gene was driven by the 300-bp RK3 promoter containing mu- tated NFkB and/or GC motif. The mutations, which according to gel retardation experiments abolished protein binding to these sites, were introduced in the form of new restriction sites using PCR techniques (see "Materials and Methods"), and were confirmed by sequencing. These expression vectors were used to transfect cultured rabbit corneal keratinocytes. The results indicated that mutations in the NFkB motif resulted in 20% loss of the promoter activity (Fig. 11, a and c, M1-M5) and that mutations in the Spl motif resulted in 50% loss (Fig. 11, a and c, M7-Mll). The effect of double mutations appeared to be additive, since mutations of both motifs resulted in a 75% loss of the RK3 promoter activity (Fig. 11, b and c, M12 and M13). In contrast, mutations near but outside of the NFkB motif had no effects on the promoter activity (Fig. llc, M6). These results strongly suggest that the NFkB and, particularly, the Spl bind- ing motifs and their cognate binding proteins are necessary for the 300-bp 5' upstream sequence of RK3 gene to function as a promoter in transfected rabbit corneal keratinocytes.

Tissue Distribution of the NFkB- and Spl-like Nuclear Proteins-To determine the tissue distribution of the NFkB- related DNA-binding protein that bound to the promoter of RK3 gene, we incubated 32P-labeled B probe with the same amounts of nuclear extracts of several cell types and performed gel electrophoretic mobility shift assays (Fig. 12). The results indicated that while the NFkB-like DNA-binding protein was easily detected in rabbit corneal keratinocytes (Fig. 12a, lane 1 ), it was barely detectable in cultured rabbit kidney epithelial cells (Fig. 12a, lane 2 ) . The nuclear extracts of human HeLa cells contained a protein factorb) that bound to probe B (Fig. 1%, lane 3, asterisk). Although the formation of this complex was inhibited by unlabeled B probe (data not show), it was not inhibited by the NFkB consensus sequence indicating that the binding was context dependent and/or was not KB sequence- specific. A protein factor(s) of cultured rabbit skin fibroblasts formed another complex with probe B (Fig. 12a, lane 4) . Al- though the formation of this complex was KB sequence specific (Fig. 12b, lane 3 ) , its distinct electrophoretic mobility indicated that it contained a protein(s) that was different from that of corneal keratinocytes.

Similar experiments showed that the Spl-like DNA-binding protein that interacted with the RK3 gene promoter was pre- sent in rabbit corneal keratinocytes (Fig. 13a, lane 11, rabbit kidney epithelial cells (lane 21, and HeLa cells (lane 3 ) . How- ever, this protein was barely detectable in rabbit fibroblasts (lane 4 ) or mouse 3T3 fibroblasts (lane 5 ) . The nuclear proteins of HeLa cells formed an additional, minor complex with probe

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

Spl and NFkB Involvement in a Keratinocyte-specific Promoter 28455

FIG. 6. Mapping of the protein bind- ing motif in site B (-266 to -237 bp). a , a "2P-labeled oligomer B was incubated with a nuclear extract of cultured rabbit corneal keratinocytes followed by gel elec- trophoresis and autoradiography. The first two lanes show controls without (lane 1) and with (lane 2) the nuclear ex- tract. Lunes 3-15 are the same as lane 2, except that the incubation was done in the presence of various competitors (100 x molar excess) which include the wild type oligomer B and various mutated B se- quences, as well as a NFkB sequence, as indicated. Arrow marks the B-protein complex. b, the nucleotide sequences of mutated B site and a summary of their abilities to compete with the wild type oli- gomer B for DNA.protein complex forma- tion. Note that mutations within a 10 bp motif (-262 to -253) greatly diminished the mutants' ability to inhibit the forma- tion of B-protein complex.

a 1 2 3 4 5

m1*

-g Y V

CO: - €3 kB 83 - a-p65: - - - - +

RCE -

b 1 2

" 5 0

. MW RCE

a 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4 1 5

-b

c o : - - B B1 82 83 84 85 B6 87 B8 I39 MISplNFkB

b COMPETITOR ACTIVITY -266

B ( WT) TTCC'GGGGCTTTC~AGACAAAGCTGGGAGG +++ B 1 TTAAGGGGCTTTCCAGACAAAGCTGG +++

FIG. 7. Characterization of the B site-binding protein by im- munosupershift and UV cross-linking. a, a 32P-labeled oligomer B was incubated with a nuclear extract of rabbit corneal keratinocytes in the presence of various competitors or an affinity-purified polyclonal antibody to the p65 subunit of NFkB (a-p65) and analyzed by EMSA using a 6% polyacrylamide gel. The sequences of the three competitors (B, KB, and B 3 ) are shown in Fig. 6b. Arrow marks the main B-protein complex; note its supershift by antibody to the p65 subunit of NFkJ3. Several lower (nonspecific) bands were not supershifted and could be competed by B3 mutant sequence. b, the B-protein complex was UV cross-linked, and the cross-linked proteins were then resolved by SDS- PAGE (lane 2). Lune 1 shows the molecular weight markers. The mo- lecular masses of the dotted standard proteins are (from the top) 200- kDa myosin (H-chain), 97 kDa (phosphorylase b), 68 kDa (bovine serum albumin), 43 kDa (ovalbumin), and 29 kDa (carbonic anhydrase). Note the two predominant UV cross-linked bands at 65 and 50 kDa.

E; the formation of this complex was, however, not Sp l sequence-specific (Fig. 13b, lane 3, arrow).

DISCUSSION

A Keratinocyte Spl-related Nuclear Protein-The Spl-re- lated factor that binds to the promoter of RK3 gene is function- ally important, since mutations of the Spl site result in a 50% loss of the RK3 promoter function in transient transfection assays (Fig. 11). This Spl-related factor of rabbit keratinocyte has two unusual features. The antisense sequence (5'- CAGGGGGCGG-3') of its binding motif is identical to the Spl

B 2 TTETGGGCTTTCCAGACAAAGCTGG B 3 TTCCmGCTTTCCAGACAAAGCTGG B 4 TTCCGGGmTTCCAGACAAAGCTGG B5 TTCCGGGGCTUCAGACAAAGCTGG B6 TTCCGGGGCTTTCACTACAGCTGG B7 TTCCGGGGCTTTCMGACAAAGCTGG B8 TTCCGGGGCTTTCCaACAAAGCTGG B 9 TTCCGGGGCTTTCCAG-AGCTGG M 1 TTCCTCTAGATTCCAGACAAAGCTGG NFkB AGTTGAGGGGACTTTCCCAGGC

I I

a b 1 2 3 1 2

** Y -

+ 1 +

+++ +++ - +++

CO: D E F - Spl FIG. 8. Complex formation between oligomer E (-211 to -182

bp) and the nuclear proteins of rabbit corneal keratinocytes. A "P-labeled synthetic oligodeoxynucleotide (site E ) was incubated with nuclear extracts of cultured rabbit corneal keratinocytes in the presence

D-F are described in Fig. l a , and that of Spl in Fig. 9b. Arrowhead of various competitors, as indicated. The sequences of the competitors

marks the E-protein complex, whose formation can be inhibited by not only the E probe but also by Sp l consensus sequence. The formation of the lower, dotted band is nonspecific because it cannot be inhibited by unlabeled E (or Spl ) probe.

consensus sequence (5'-(G/T)(G/A)GG(C/A)G((G/T)(G/A)(G/A) (C/T)-3') (Courey and Tjian, 1992) in only 6 out of 10 positions. This is exceptional because most known binding sites of Spl deviate from the consensus a t no more than one position (Courey and Tjian, 1992). One notable exception to this rule is the so-called GT box (5'-GG(T/X)G(G/X)GTTGG(A/X)G-3') present in the y enhancer of T-cell receptor gene and the globin locus control regions. However, this motif binds, in addition to Spl, another Spl-related molecule, Sp3, whose zinc finger re- gion is 90% identical to that of Sp l (Kingsley and Winoto, 1992). Another interesting feature of the Spl-related factor of the rabbit corneal keratinocyte relates to its tissue distribution. Using the E oligomer as a probe, we detected this factor not only in keratinocytes but also in cultured rabbit kidney epithe- lial cells, a simple epithelium. As expected, large amounts of Sp l were also detectable in HeLa cells (Fig. 13) in which this transcription factor was originally identified and characterized

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

28456 S p l and NFkB Involvement in a Keratinocyte-specific Promoter a 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

- m - u u w w r u r co: - - E ~1 ~2 ~3 E4 ~5 E6 0 E8 E9 E10 EllE12E13E14M7W NF

lm

b ^. . COMPETITOR ACTIVITY

'CCCCCTGCAGGGTAAGCCT + + + CAGGGTAAGCC +++

.GTAAGCC + + +

I

E5 E6 E7 E8 E9 E10 Ell

CAGCGC~AGCCCCCTGCAGGGTAAGCC CAGCGCMCCCCCTGCAGGGTAAGCC CAGCGCCCGUCCTGCAGGGTAAGCC CAGCGCCCGCCCMGCAGGGTAAGCC CAGCGCCCGCCCCCTTBC;GGGTAAGCC CAGCGCCCGCCCCCTGBAGGGTAAGCC CAGCGCCCGCCCCCTGCCGGGTAAGCC

+++ ij +++

~~~

E13 CAGCGCCCGCCCCCTGCAGGZTAAGCC +++ E12 CAGCGCCCGCCCCCTGCATAAGCC +++

M7 E14 CAGCGCCCGCCCCCTGCAGGGLXAGCC +++

CAGCGCTC32GACCTGCAGGGTAAGCC - SP1 GCTCGCCCCGCCCCGA'TCGAAT + + +

FIG. 9. Mapping of the protein binding motif in site E (-211 to -182 bp). a , a "P-labeled oligonucleotide E was incubated with a nu- clear extract of cultured rabbit corneal keratinocytes, and the com- plexes were analyzed by EMSA. The first two lanes show controls with- out ( I ) and with ( 2 ) the nuclear extract. Lunes 3-20 are the same as lane 2 except that they include various competitors. The sequences of the wild type site E and its various mutants (E14314 and M7) are listed inpanel b, which also summarizes the abilities of various competitors to inhibit E-protein complex (arrowhead) formation. Note the clear defi- nition of a 10-bp binding motif (5'-CCGCCCCCTG-3') which differs significantly from the Spl consensus sequence of Courey and Tjian (1992) (see "Discussion").

1 2 3 4 5 6 7 8 9 1 0

CO: - E Spl E6 - - E SPl E6 - +

RCE - hSpl * a-Sp,: - - - - + - - - -

FIG. 10. Characterization of the E-binding protein by EMSA and immunosupershift. A 32P-labeled oligomer E was incubated with a nuclear extract of cultured rabbit corneal keratinocytes (RCE, lanes 1 3 ) or with a recombinant human Sp l (hSpl , lanes 6-10). Some of the samples were incubated in the presence of various competitors or a polyclonal antibody to Sp l (a-Spl ) before EMSA using a 6% polyacryl- amide gel. The sequences of the three competitors (E, S p l , and E6) are shown in Fig. 96. Arrowhead and dot mark the Spl-related and a nonspecific band, respectively (cf. Fig. 8). Note that the E-protein com- plex can be reproduced using a recombinant human Spl and that it can be supershifted by anti-Spl.

(Briggs et al., 1986). Relatively little Sp l activity was detected, however, in cultured rabbit fibroblasts and mouse 3T3 cells (Fig. 13). Although on first glance this may seem surprising as it contradicts the general notion that Spl is ubiquitous, some recent data actually indicate that the Spl level may vary up to 100-fold in different cell types (Saffer et al., 1991). Another possibility that we cannot rule out at the present time is that the Spl of keratinocytes may actually be different from that of, for example, the HeLa cells. Recent results have established the existence of a family of Spl-related transcription factors.

a b' - 0 0 . 8

C WT M1 M2 M3 M4 MS M6 M7 M8 M9 M10 M11 M12 M13

"""""___""_" - - C C C G C C C C e - - 4 8I4 - - " M C C A G A C M - - --AGKGAKC'tGCAG-- 2621 - - ~ G A l T T C C A G A C A A - - --CxTAG&CC'TGCAG-- 2720

FIG. 11. Effects of mutagenesis of the B and E sites on the RK3 promoter activity. A set of expression vectors (MI-MI31 was con- structed in which a CAT reporter gene was driven by wild type or mutated RK3 promoters. Various mutations were introduced into the NFkB motif (MI -M6) , the GC-rich motif (M7-MlI ) , or both (MI2- M I 3 ). The sequences of the mutated regions, as confirmed by sequenc- ing, are shown in panel c. These vectors were transfected into cultured rabbit corneal keratinocytes, and the CAT activities were assayed 2 days later. Panels a and b show the assays of CAT reporter activities from two independent experiments. The CAT gene in the S V plasmid was driven by a SV40 promoter (a positive control). Each value listed in panel c represents the average of at least three independent measure- ments. Note that mutations of the NFkB motif and the GC-rich motif resulted in the loss of -20 and -50%, respectively, of the promoter activities, and that double mutations of both motifs abolished -75% of the promoter activity.

a b 1 2 3 4 5 1 2 3 4

NE: RC RK Hela RF 3T3 RC Hela RF 3T3 c 0 : - - - - - NF- NF- NF- NF-

kB FIG. 12. Tissue distribution of the "related rabbit corneal

keratinocyte nuclear protein. a , a 32P-labeled oligomer B was incu- bated with a nuclear extract (NE) of cultured rabbit corneal keratino- cytes (RC), rabbit kidney epithelial cells (RK, a permanent line), human exocervical epithelial cells (HeLu), rabbit fibroblasts (RF), and mouse embryonic fibroblasts (32'3). The NFkB binding motif was used as a competitor (Co) for samples in panel b. Arrow denotes the B-protein

arrow marks another NFkB-related complex whose formation can be complex, which was particularly abundant in keratinocytes. The small

blocked by unlabeled NFkB sequence, but it appears to involve a dif- ferent DNA-binding protein judging from its electrophoretic mobility. The asterisk marks a HeLa protein.DNA complex, whose formation cannot be competed by unlabeled NFkB sequence. A nonspecific band was dotted.

For example, Kingsley and Winoto (1992) cloned two ubiqui- tous Spl-related transcriptional factors, Sp2 (-80 kDa) and Sp3 (-100 kDa). As mentioned earlier, some of these Sp l iso- forms may bind to a DNA motif (the GT box) distinct from that

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

Spl and NFkB Involvement in a Keratinocyte-specific Promoter 28457

a 1 2 3 4 5

b 1 2 3 4 5

L

FIG. 13. Tissue distribution of the Spl-related rabbit corneal keratinocyte nuclear factor. The experiments were done as in Fig. 12, except for the use of :''P-labeled oligomer E. Arrowhead denotes the E-protein complex which was particularly abundant in epithelial cells. The small arrow and dot mark complexes whose formation cannot be blocked by unlabeled Sp l consensus sequence.

of Spl. Hagen et al. (1992) identified Sp4, another Spl-related protein of 81.9 kDa, which is abundant in the brain but barely detectable in other organs (Pecorino et al., 1991). Since these S p l isoforms are homologous to one another and are of approxi- mately the same size, their DNA complexes are sometimes difficult to resolve electrophoretically (Hagen et al., 1992; Kingsley and Winoto, 1992). Taken together, these consider- ations raise the possibility that the keratinocyte nuclear pro- tein that binds to the unusual GC box of the RK3 promoter may be related to, but distinct from, the conventional Spl. Molecu- lar cloning of the Spl-related molecule in keratinocytes is needed to test this possibility.

Possible Interactions between Spl and Other Factors-While S p l per se has been shown to be a strong activator of many genes, its activity can be modulated significantly by factors that bind to motifs that are adjacent to, or overlapping with, tha t of Spl (Ackerman et al., 1991; Bessereau et al., 1993; Nehls et al., 1992; Roman et al., 1990; Schaufele et al., 1990; Yu et al., 1990). In this regard, i t i s in terest ing that the Spl s i te of the rabbit K3 gene is flanked on the 5' side by an NF1 andAP2 site and on the 3' side by an overlapping "Ker 1" motif (Wu et al., 1993), which h a s been shown to also bind AP2 (Leask et al., 1990; Snape et al., 1991). This raises the question as to whether the occupance of one or both of the two flanking AP2 motifs is involved in regulating the Spl activity. Although data pre- sented in this paper did not reveal binding of keratinocyte proteins to the AP2 sites, we have preliminary data indicating that such binding can occur under certain in vitro conditions.' Additional experiments are needed to determine whether such a binding is functional important and whether and how AP2/ Ker 1 and other factors may regulate Spl function in the RK3 promoter.

When the f2 fragment was incubated with the keratinocyte nuclear proteins, it formed at least four protein.DNAcomplexes that can be resolved by polyacrylamide gel electrophoresis (Fig. 2b, lane I, and Fig. 3). Only one of them is NFkB-related (Fig. 3b); all the other three bands can be competed off by S p l con- sensus sequence (Fig. 3h) and are thus Spl-related. The for- mation of multiple complexes between S p l a n d a single DNA probe has also been reported by Chavrier et al. (1990), Robid- oux et al. (19921, and Hagen et al. (1992). In some of these cases, the lower bands were thought to contain degraded Spl frag- ments (Robidoux et al., 1992). We do not believe, however, that

T.-T. Chen, unpublished observation.

the multiple bands we observed are due to proteolysis of S p l because the use of E oligomer (30 bp), instead of the longer 12 fragment (195 bp), resulted in the formation of a single and sharply resolved DNA.protein complex (Fig. 8 ) . Instead, we favor the possibility that direct or indirect interactions between Spl and proteins binding to other DNA motifs of the f2 frag- ment (Pugh and Tjian, 1990) and/or the oligomerization of S p l (Mastrangelo et al., 1991) may play a role in the formation of multiple DNA.protein complexes.

Keratinocytes Contain Constitutiue NuclPar NFkR Actitlit-v- Our data showed that an NFkB-related corneal keratinoc-yte nuclear protein binds to the B site of the RK3 promoter (Fig. 5 ). This site, 5'-GGGGCTTTCC-3', located a t -262 to -253 (Fig. 6), fits perfectly the NFkR consensus sequence (5'-GGG(A/CrHA/ C)T(T/C)fT/C)CC-3') (Grilli et al. , 1993). The keratinocyte nu- clear protein that binds to this motif is clearly NFkR-related because: 1) W cross-linking experiments revealed a 65- and a 50-kDa protein subunit (Fig. 7b ), and 2) the protein.DNA com- plex can be supershifted by an antiserum to the p65 subunit of NFkB (Fig. 7a ). These data strongly suggest that the KR-bind- ing keratinocyte nuclear protein contains the p65 (Re1 A) and p50 (or its closely related p50b) (Schmid et al . , 1991) subunits. Mutagenesis of this NFkB motif resulted in a 20'7 loss of the RK3 promoter activity as assayed by transient transfection (Fig. 11).

Using the B oligomer as a probe, we have surveyed the nu- clear NFkB activities of several cultured cell t-ypes. Control experiments confirmed that large amounts of nuclear NFkB activity was present in a R cell line (data not shown) (Sen and Baltimore, 1986). We could not detect any nuclear NFkR activ- ity in cultured rabbit kidney epithelial cells, HeLa cells, or rabbit fibroblasts (Fig. 12), although strong cytoplasmic NFkR binding activities could be detected in all these cells after de- tergent activation (data not shown) (Raeuerle and Raltimore, 1988a). Our results are therefore consistent with the earlier reports by Baltimore and co-workers (Raeuerle and Baltimore, 1988b; Fujita et al., 1992; Robidoux et af . , 1992). who showed that in nonlymphoid cells, including 3T3 and HeLa cells, most NFkB activity is in an inactive c-ytoplasmic form. Kawakami et al. (1988) also failed to detect NFkB activity in the nuclear fraction of HeLa cells. Our results differ from some other re- ports (Lattion et al., 1992; Macchi et al . , 1989) indicating con- stitutive NFkB activities in the HeLa nuclei. While in our ex- periments we have detected a major complex between certain HeLa nuclear proteins and the R oligomer (Fig. 12, lane ,?I, this complex cannot be competed off by NFkR consensus se- quence (Fig. 12b, lane 2 ) and is therefore distinct from the nuclear NFkB activity of keratinocytes. We have also detected in cultured fibroblasts a major nuclear protein forming complex with oligomer B (Fig. 12a, lane 4 ). The formation of this com- plex can be inhibited by NFkB consensus sequence (Fig. 12b, lane 3) and is therefore KR-specific. This band migrates much faster, however, than the keratinocyte complex that contains the p65/p50 heterodimer (Fig. 12). Whether this fihroblast band is composed of p50 dimer (which is a supprpssor of the KR site due to the fact that p50 lacks an activation domain) (Kang et al., 1992; Schmid et al., 1991) or some other rel-related subunits needs to be examined in more detail.

We have therefore provided the first evidence that NFkB activity, previously thought to be present constitutively in the nuclei of only certain lymphoid cells and monocytes (Jameison et al., 1989; Lenardo et al., 1987; Molitor et al . . 1990; Sen and Baltimore, 1986). is present in the nuclei of cultured keratino- cytes. This unexpected finding has several implications. Per- haps the most important relates to the fact that the NFkB-t-ype transcription factor is actually a homo- or heterodimer of a

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

28458 Sp l and NFkB Involvement in a Keratinocyte-specific Promoter

family of rel-related proteins (Blank et al., 1992; Grilli et al., 1993; Grimm and Baeuerle, 1993). These subunits, including p50, p65, and c-rel, have different DNA binding specificities and activation properties. They are also inactivated by differ- ent IkB molecules (Baeuerle and Baltimore, 1988a; Grilli et al., 1993). A change in the dimer composition can therefore result in significantly different DNA binding properties (Grimm and Baeuerle, 1993). This can also result in different or even re- pressing instead of activating, regulatory properties (Bose, 1992; Grilli et al., 1993; Grimm and Baeuerle, 1993). That such changes can occur during the course of cellular differentiation has been shown in T-cell activation (Molitor et al., 1990). In this regard, it should be noted that in the present work we have chosen to analyze the nuclear proteins of cultured rabbit cor- neal keratinocytes 2 days post-confluent. This time point was chosen because it coincides with the time when we harvest the cells for CAT assay in mutagenesis experiments (Fig. 11) and because at this time the cells have become heavily stratified and most of the suprabasal cells have become RK3-positive (Schermer et al., 1986, 1989). Our preliminary data indicate, however, that the rel-related proteins that bind to the B site of RK3 gene, as assayed by EMSA and UV cross-linking, may change during in uitro corneal epithelial differentiati~n.'.~ Additional experiments are being conducted to define these differentiation-related changes in the B element-binding pro- teins. This information is important because different proteins may interact with the KB motif when the RK3 gene is first turned on versus later when the gene transcription is maintained.

The functional role of the NFkB in regulating RK3 gene expression is not yet clear. While mutagenesis experiment in- dicate that mutations in this motif abrogate only 20% of the promoter activity (when the CAT assay was done 2 days post- confluent), this may mean that this site plays a relatively mi- nor role in maintaining a high level of RK3 gene expression. Additional experiments are needed to determine whether RK3 gene can be activated by known activators of NFkB more rap- idly than other (NFkB-negative) keratin genes such as K1 (Huff et al., 1993). Rapid and largely reversible modulation of corneal epithelial differentiation is known to be a characteris- tics of corneal epithelial cells, a feature possibly important for wound healing (Schermer et al., 1986).

Tissue restriction of RK3 Gene Expression and Concluding Remarks-We have shown here that at least two nuclear fac- tors of rabbit corneal keratinocytes, that are Spl and NFkB related, interact in vitro with a 300 bp of 5' upstream sequence of rabbit K3 keratin gene. Although our data do not rule out the possible involvement of other DNA motifs and binding factors, the fact that mutations of these two sites resulted in a 75% loss of the sequence's promoter activity suggests that these two motifs and their associated proteins play an important role in the transcriptional activity of the gene. In this regard, it is highly significant that these two binding activities were found to be somewhat tissue restricted in that the Spl- and NFkB- related factors were detected preferentially in epithelial cells and keratinocytes, respectively. This suggests that the tissue restriction of these two factors may contribute to the keratino- cyte specificity of the RK3 gene. Additional factors are most likely involved, however, in establishing the full keratinocyte specificity of the RK3 promoter, since our preliminary results indicated that the residual -25% of the (Spl-, NFkB-) pro- moter activity still retained some keratinocyte specificity (data not shown). This observation is consistent with the recent data from Byrne and Fuchs (1993) who showed that a short -120 bp of 5' upstream sequence of human K5 keratin gene was still

T. T. Chen, R. L. Wu, and T. T. Sun, unpublished observation.

somewhat keratinocyte-specific. Taken together, these data raise the possibility that other unknown factors, including keratinocyte-specific factors (Anderson et al., 1993; Tseng and Green, 1992) and chromatin structure (Neznanov and Oshima, 19931, may also contribute to the keratinocyte specificity of the RK3 promoter. Additional experiments are needed to define such factors, to determine the precise biochemical nature of some of the DNA-binding proteins described here, particularly the Spl-related molecule, and to determine how these factors are involved in regulating K3 keratin gene expression.

REFERENCES

Ackerman, S. L., Minden, A. G., Williams, G. T., Bobonis, C., and Yeung, C. Y.

Adams, B. S., Leung, K Y, Hanley, E. W., and Nabel, G. J. (1991) New Biologist 3,

Albers, K., and Fuche, E. (1992) Int. Reu. Cytol. 134,243-279 Anderson, B., Marcus, D., Schonemann, S. E., Flynn, S. E., Pearse, R. V., 11, Singh,

Baeuerle, P. A., and Baltimore, D. (1988a) Cell 63,211-217 Baeuerle, P. A,, and Baltimore, D. (1988b) Science 242, 540-546 Baldwin, A. G. J., and Sharp, P. A. (1988) Proc. Natl. Acad. Sci. U. S . A . 86,

Ballard, D. W., Dixon, E. P., Peffer, N. J., Bogerd, H., Doerre, S., Stein, B., and

Bessereau, J. L., Mendelzon, D., LePoupon, C., Fiszman, M., Changew, J. P., and

Blank, V., Kourilsky, P., and Israel, A. (1992) Dends Biochem. Sci. 17,135-140 Blessing, M., Jorcano, J. L., and Franke, W. W. (1989) EMBO J. 8, 117-126 Bose, H. R., Jr (1992) Biochim. Biophys. Acta 1114,l-17

Briggs, M. R., Kadonaga, J. T., Bell, P., and Tjian, R. (1986) Science 234, 47-52 Bradford, M. (1976) Anal. Biochem. 72,246-254

Bucher, P., Israel, A,, Baeuerle, P., Rice, N. R., and Nabholz, M. (1992) Mol. Cell.

Byrne, C., and Fuchs, E. (1993) Mol. Cell. Biol. 13,3176-3190 Chavrier, P., Vesque, C., Galliot, B., Vigneron, M., Dolle, P., Duboule, D., and

Charnay, P. (1990) EMBO J. 9,1209-1218 Chodosh, L. A. (1989) in Current Protocols in Molecular Biology (Ausubel, E M.,

Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K, eds) pp, 12.2.1-12.2.10, Greene Publishing Associates and Wiley- Interscience, New York

Chodosh, L. A., Carthew, R. W., and Sharp, P. A. (1986) Mol. Cell. Biol. 6, 4723- 4733

Courey, A. J., and TJian, R. (1992) in Danscription Regulation (McKnight, S., and Yamamoto, K., eds) PP. 743-769, Cold Spring Harbor Laboratory Press, Cold

(1991) Proc. Natl. Acad. Sci. U. S. A. 88,7523-7527

1063-1073

H., and Rosenfeld, M. G. (1993) Science 260, 78-82

723-727

Greene, W. C. (1992)Proc. Natl. Acad. Sci. U. S. A. 89, 1875-1879

Piette, J. (1993) EMBO .I. 12, 443449

B i d . 13, 3176-3190

"

Spring Harbor, NY .~

Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489

Doran, T. I., Vidrich, A., and Sun, T.-T. (1980) Cell 22, 17-25 Eichner, R., Bonitz, P., and Sun, T.-T. (1984) J. Cell Biol. 98, 1388-1396 Fujita, T., Nolan, G. P., Ghosh, S., and Baltimore, D. (1992) Genes & Deu. 6,

Gorman, C. M., Moffat, L. E, and Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-

Grilli, M., Chiu, J. J., and Lenardo, M. J. (1993) Int. Reu. Cytol. 143, 1-62

Hagen, G., Muller, S., Beato, M., and Suske, G. (1992) Nucleic Acids Res. 20, Grimm, S., and Baeuerle, P. A. (1993) Biochem. J. 290,297-308

Huff, C. A,, Yuspa, S. H., and Rosenthal, D. (1993) J. Biol. Chem. 268,377484 Jackson, S. P., MacDonald, J. J., Lees-Miller, S. , and Tjian, R. (1990) Cell 63,

Jameison, C., Mauxion, E, and Sen, R. (1989) J. Exp. Med. 170, 1737-1743 Jiang, C.-K, Epstein, H. S., Tornic, M., Freedberg, I. M., and Blumenberg, M.

Jiang, C. K., Magnaldo, T., Ohtsuki, M., Freedberg, I. M., Bernard, F., and Blu-

Kang, S. M., Dan, A. C., Grilli, M., and Lenardo, M. J. (1992) Science 256, 1452-

Kawakami. K.. Scbeidereit. C.. and Roeder, R. G. (1988) Proc. Natl. Acad. Sci.

775-787

1051

5619-5525

155-165

11990) Nucleic Acids Res. 18,247-253

menberg, M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,6786-6790

1456

Kingsley, C., and Winoto, A. (1992) Mol. Cell. Biol. 12, 42514261 Kolega, J., Manabe, M., and Sun, T.-T. (1989) Differentiation 42, 5443 Kurpakus, M. A., Stock, E. L., and Jones, J. C. (1992) Deu. Biol. 160,243-255 Lattion, A. L., Espel, E., Reichenbach, P., Fromental, C., Bucher, P., Israel, A.,

Leask, A,, Rosenberg, M., Vassar, R., and Fuchs, E. (1990) Genes & Dev. 4,1985- Baeuerle, P., Rice, N. R., and Nabholz, M. (1992) Mol. Cell. B i d . 12,5217-5227

Leask, A,, Byme, C., and Fuchs, E. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1998

Lee, K. A,, Bindereif, A,, and Green, M. R. (1988) Genet. Anal. Tech. Appl. 5,2241 7948-7952

Lenardo, M., Pierce, J. W., and Baltimore, D. (1987) Science 236, 1573-1577 Macchi, M., Bomert, J. M., Davidson, I., Kanno, M., Rosales, R., Vlgneron, M.,

Mastrangelo, I. A,, Courey, A. J., Wall, J. S., Jackson, S. P., and Hough, P. V. (1991) Xiao, J. H., Fromental, C., and Chambon, P. (1989) EMBO J . 8,42154227

McKnight, S., andyamamoto, K. R. (1992) DanscriptionalRegulution, Cold Spring Proc. Natl. Acad. Sci. U. S. A. 88,5670-5674

Molitor, J. A,, Walker, W. H., Doerre, S., Ballard, D. W., and Greene, W. C. (1990) Harbor Press, Cold Spring Harbor, NY

U. S. A. '88,'47004704

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from

S p l and NFkB Involvement in a Keratinocyte-specific Promoter 28459

Moll, R., Franke, W. W., Schiller, D. L., Geiger, B., and Krepler, R. (1982) Cell 31, Proc. Natl. Acad. Sci. U. S . A. 87, 10028-10032

11-24 Nehls,M. C., Grapilon, M. L., and Brenner, D. A. (1992)DNA Cell Biol. 11,443-452 Neznanov, N. S., and Oshima, R. G. (1993) Mol. Cell. Biol. 13,1815-1823 OGuin, W., Schermer, A,, Lynch, M., and Sun, T.-T. (1990) in Cellular and Molec-

ular Biology oflntermediate Filaments (Steinert, P., and Goldman, R., eds) pp. 301-334, Plenum Publishers, New York

Oshima, R. G. (1992) Curr Opin. Cell Biol. 4, 110-116 Pecorino, L. T., Darrow, A. L., and Strickland, S. (1991) Mol. Cell. Biol. 11,3139-

Pugh, B. F., and Tjian, R. (1990) Cell 61, 1187-1197 Quinlan, R. A., Schiller, D. L., Hatzfeld, M., Achtstatter, T., Moll, R., Jorcano, J. L.,

Rheinwald, J. G., and Green, H. (1975) Cell 6, 331-344 Magin, T. M., and Franke, W. W. (1985) Ann. N. I: Acad. Sci. 455,282-306

Robidow, S., Gosselin, P., Harvey, M., Leclerc, S., and Guerin, S. L. (1992) Mol.

Roman, D. G., lbledano, M. B., and Leonard, W. J. (1990) New Biologist 2,642-647 Saffer, J. D., Jackson, S. P., and Annarella, M. B. (1991) Mol. Cell. Biol. 11,

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: a Lubo-

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 75,

3147

Cell. Biol. 12, 3796-3806

2189-2199

ratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY

5463-5467

Schaufele, F., West, B. L., and Reudelhuber, T. L. (1990) J. B i d . Chem. 265,

Schemer, A., Galvin, S., and Sun, T.-T. (1986) J. Cell Biol. 103, 49-62 Schemer, A,, Jester, J. V., Hardy, C. , Milano, D., and Sun, T.-T. (1989) Diferen-

Schmid, R. M., Perkins, N. D., Duckett, C. S., Andrews, P. C., and Nabel, G. J.

Sen, R., and Baltimore, D. (1986) Cell 47,921-928 Snape, A. M., Winning, R. S., and Sargent, T. D. (1991) Deuelopment 113,283-293 Steinert, P., and h o p , D. (1988) Annu. Reu. Biochem. 67,593-625 Sun, T.-T., Eichner, R., Cooper, D., Schermer, A,, Nelson, W., and Weiss, R. (1984)

in The Dansformed Phenotype (Levine, A,, et al., eds) pp. 169-176, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

17189-17196

tiation 42, 103-110

(1991) Nature 352,733-736

Tseng, H., and Green, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 10311-10315 Vallette, F., Mege, E., Reiss, A,, and Adesnik, M. (1989) Nucleic Acids Res. 17,

Vassar, R., Rosenberg, M., Rose, S., Tyner, A,, and Fuchs, E. (1989) Proc. Natl.

Weiss, R., Eichner, R., and Sun, T.-T. (1984) J. Cell Biol. 98, 1397-1406 Wu, R.-L., Galvin, S., Wu, S. K., Xu, C., Blumenberg, M., and Sun, T.-T. (1993) J.

Yn, C . Y., Chen, J., Lin, L. I., Tam, M., and Shen, C. K. (1990) Mol. Cell. B i d . 10,

723-733

Acad. Sci. U. S. A. 86,1563-1567

Cell Sci. 105, 303-316

282-294

by guest, on March 19, 2010

ww

w.jbc.org

Dow

nloaded from