Embed Size (px)
Citation preview
저 시-비 리-동 조건 경허락 2.0 한민
는 아래 조건 르는 경 에 한하여 게
l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.
l 차적 저 물 성할 수 습니다.
다 과 같 조건 라야 합니다:
l 하는, 저 물 나 포 경 , 저 물에 적 허락조건 확하게 나타내어야 합니다.
l 저 터 허가를 러한 조건들 적 지 않습니다.
저 에 른 리는 내 에 하여 향 지 않습니다.
것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.
Disclaimer
저 시. 하는 원저 를 시하여야 합니다.
비 리. 하는 저 물 리 적 할 수 없습니다.
동 조건 경허락. 하가 저 물 개 , 형 또는 가공했 경에는, 저 물과 동 한 허락조건하에서만 포할 수 습니다.
i
수의학 박사 학위논문
Development of alternative control
methods using bacteriophages against
antibiotic-resistant Aeromonas salmonicida
infections in Korean salmonid fish
한 연어과 어류에 감염하는
항생제 내 Aeromonas salmonicida에
대한 박테리 파아지 제법 개발
2012 년 8 월
서울대학교 대학원
수의학과 수의공중보건학 전공
김 지 형
ii
A Dissertation for the Degree of Doctor of Philosophy
Development of alternative control
methods using bacteriophages against
antibiotic-resistant Aeromonas salmonicida
infections in Korean salmonid fish
By
Ji Hyung Kim
August, 2012
Department of Veterinary Public Health
College of Veterinary Medicine
The Graduate school of Seoul National University
iii
Development of alternative control
methods using bacteriophages against
antibiotic-resistant Aeromonas salmonicida
infections in Korean salmonid fish
By
Ji Hyung Kim
Supervisor: Professor Se Chang Park, D.V.M., Ph.D.
A dissertation submitted to the faculty of the Graduate School of
Seoul National University in partial fulfillment of the
requirements for the degree of Doctor of Philosophy in
Veterinary Public Health
August, 2012
Department of Veterinary Public Health
College of Veterinary Medicine
The Graduate school of Seoul National University
iv
Development of alternative control methods
using bacteriophages against antibiotic-
resistant Aeromonas salmonicida infections
in Korean salmonid fish
한 연어과 어류에 감염하는
항생제 내 Aeromonas salmonicida에
대한 박테리 파아지 제법 개발
지도교수: 박 세 창
이 논문을 수의학박사 학위논문으로 제출함
2012 년 5 월
서울대학교 대학원
수의학과 수의공중보건학 전공
김 지 형
김지형의 박사학위 논문을 인준함
2012 년 6 월
위 원 장 이 병 천 (인)
부위원장 박 세 창 (인)
위 원 조 성 준 (인)
위 원 신 기 욱 (인)
위 원 Mahanama De Zoysa (인)
v
Abstract
Development of alternative control methods
using bacteriophages against antibiotic-
resistant Aeromonas salmonicida infections
in Korean salmonid fish
Ji Hyung Kim
Department of Veterinary Public Health
College of Veterinary Medicine
The Graduate School of Seoul National University
Aeromonas salmonicida subsp. salmonicida is the causative agent of
furunculosis in salmonid fish and bacterial septicemia in a broad variety of
fish, and is thus responsible for significant economic losses in the global
aquaculture industry. Recently, the acquisitions of antibiotic resistance in A.
salmonicida subsp. salmonicida have been recognized as a serious concern,
owing to their potential health risks to humans and animals. However, the
acquisition and prevalence of antibiotic resistance in A. salmonicida subsp.
salmonicida have not yet been investigated in Korean aquaculture industry.
Therefore, in the first step towards, we collected a total of 16 A.
salmonicida (14 of A. salmonicida subsp. salmonicida and 1 each of A.
salmonicida subsp. achromogenes and subsp. flounderacida) strains from
diseased fish and environmental samples in Korea from 2006 to 2009, and
evaluated its antibiotic resistance against tetracycline and quinolones.
vi
Tetracycline and quinolone resistances were observed in 8 and 16 of the
isolates, respectively, based on the measurement of minimal inhibitory
concentrations. Among the tetracycline-resistant strains, 7 of the isolates
harbored tetA and one isolate harbored tetE. Additionally, quinolone-
resistance determining regions (QRDRs) consisting of the gyrA and parC
genes were amplified and sequenced. Among the quinolone-resistant A.
salmonicida strains, 15 strains showed point mutations in the gyrA codon
83, which were responsible for the corresponding amino acid substitutions
of Ser83→Arg83 or Ser83→Asn83. We detected no point mutations in other
QRDRs, such as gyrA codons 87 and 92, and parC codons 80 and 84.
Genetic similarity was assessed via pulsed field gel electrophoresis (PFGE),
and the results indicated high clonality among the Korean antibiotic-
resistant strains of A. salmonicida subsp. salmonicida.
In order to develop alternative control methods against this fish
pathogen, in the second step towards, we isolated several bacteriophages
(phages) infecting A. salmonicida subsp. salmonicida from various
environmental waters or fish in Korea. Among those phages, we fully
sequenced the two T4-like Myoviridae phages (named as phiAS4 and
phiAS5) isolated from environmental waters in Korea. The two phages
showed broad host ranges to other Aeromonadaceae as well as A.
salmonicida, and their biological properties were simultaneously
investigated. Furthermore, the complete genomes of phiAS4 and phiAS5
were sequenced, and final assembly yielded linear double-stranded DNA
genomes of 163,875-bp and 225,268-bp with G+C content of 41.3 and
vii
43.0%, respectively. Genomic analysis uncovered 271 and 343 putative
ORFs, 67 and 69 putative promoters, 25 and 33 terminator regions, and 16
and 24 tRNA-encoding genes, respectively. A high degree of similarity to
the Aeromonas phages 25 and Aeh1 were found in most ORFs of phiAS4
and phiAS5, respectively. The phages were further compared with their
relatives including enterobacter phage T4, and the results demonstrated that
they could be classified as new members of the T4-like group. Moreover,
the functional activity of the putative lysozyme murein hydrolase (orf117)
in phiAS5, which had no holin or holin-like gene, was investigated, and the
result revealed that it may use a dual lysis system during host cell lysis.
Based on these results, we confirmed that the two phages will have the
potential for controlling A. salmonicida subsp. salmonicida in Korean
aquaculture and may also advance our understanding of the biodiversity of
T4-like phages.
To search for candidate control agents and to evaluate its therapeutic
potential against A. salmonicida subsp. salmonicida in aquaculture, we
selected one novel lytic phage among those isolated Aeromonas phages in
the third step towards. The novel Aeromonas phage (designated as PAS-1)
was isolated from the environmental water and its several biological
properties were preliminarily investigated. The phage showed broad host
ranges to other subspecies of A. salmonicida as well as A. salmonicida
subsp. salmonicida including antibiotic-resistant strains. The PAS-1 was
morphologically classified as Myoviridae and possessed approximately 48
kb of double-strand genomic DNA. Moreover, partial genomic and
viii
structural proteomic analysis of PAS-1 revealed that the phage was closely
related to other Myoviridae phages infecting enterobacteria or Aeromonas
species. For the therapeutic applications of PAS-1, the phage was
preferentially co-cultured with one virulent A. salmonicida subsp.
salmonicida strain that possesses the ascV gene, and strong bacteriolytic
activity was observed against the bacteria. The administration of PAS-1 in
rainbow trout (Oncorhynchus mykiss) demonstrated that it was cleared
within 200 h post-administration, and temporal neutralizing activity against
the phage was detected in the phage-administrated fish serums. The
protective effects of the phage were verified in experimental rainbow trout
furunculosis model therapy, showing increased survival rates and mean
time to death.
Based on these results, it can be concluded that the isolated Aeromonas
phages could be considered as altervative control agents against antibiotic-
resistant A. salmonicida subsp. salmonicida as well as typical A.
salmonicida subsp. salmonicida, and will also have potential therapeutic or
prophylactic candidate against salmonid furunculosis in Korean
aquaculture.
Key words: A. salmonicida subsp. salmonicida, Aeromoans phages,
salmonid, furunculosis, altervative control agents, Korea
Student number: 2008-30469
ix
Contents
Abstract .............................................................................................................. v
Contents............................................................................................................. ix
List of figures ................................................................................................... xii
List of tables .................................................................................................... xiii
Abbreviations .................................................................................................. xiv
General Introduction ......................................................................................... 1
Literature Review
A. Aeromonas salmonicida ................................................................................. 4
A.1. Taxonomy of Aeromonadaceae................................................................... 4
A.2. A. salmonicida and its classification ............................................................ 5
A.3. A. salmonicida subsp. salmonicida and furunculosis ................................... 6
A.4. Host range and distribution ......................................................................... 7
A.5. Clinical signs .............................................................................................. 8
A.6. Transmission............................................................................................. 10
A.7. Virulence factors ....................................................................................... 11
A.8. Disease control ......................................................................................... 13
A.9. Emergence of antibiotic resistance ............................................................ 14
B. Bacteriophage (phage) ................................................................................ 16
B.1. General description ................................................................................... 16
B.2. Phages infecting Aeromonadaceae ............................................................ 20
B.3. Therapeutic applications of phages............................................................ 22
C. References .................................................................................................... 26
Chapter I
Isolation and molecular characterization of tetracycline- and quinolone-
x
resistant Aeromonas salmonicida strains from cultured fish in Korea
Abstract ............................................................................................................. 41
1.1. Introduction .............................................................................................. 42
1.2. Materials and Methods .............................................................................. 43
1.3. Results ...................................................................................................... 46
1.4. Discussion ................................................................................................ 49
1.5. References ................................................................................................ 51
Chapter II
Isolation, characterization and genomic analysis of the two T4-like
Aeromonas phages (phiAS4 and phiAS5) infecting A. salmonicida subsp.
salmonicida as potential candidates for furunculosis control
Abstract ............................................................................................................. 61
2.1. Introduction .............................................................................................. 63
2.2. Materials and methods .............................................................................. 64
2.3. Results ...................................................................................................... 72
2.4. Discussion ................................................................................................ 79
2.5. References ................................................................................................ 83
Chapter III
Isolation and characterization of a novel Aeromonas phage PAS-1 infecting A.
salmonicida subsp. salmonicida and its applications in rainbow trout
(Oncorhynchus mykiss) furunculosis model therapy
Abstract ........................................................................................................... 133
3.1. Introduction ............................................................................................ 135
3.2. Materials and Methods ............................................................................ 136
3.3. Results .................................................................................................... 143
3.4. Discussion .............................................................................................. 148
3.5. References .............................................................................................. 152
xi
General conclusion ......................................................................................... 166
Abstracts in Korean ....................................................................................... 168
List of published articles ................................................................................ 173
List of conference attendances ....................................................................... 181
Acknowledgements ........................................................................................ 189
xii
List of Figures
Literature review
Figure I. Schematic representation of major phage groups.
Chapter I
Figure 1.1. Multiplex PCR assay of tetracycline resistance genes (tetA of 211bp and tetE
of 744bp) in two reference strains and 16 isolates of Aeromonas salmonicida.
Figure 1.2. PFGE profiles of 18 Aeromonas salmonicida strains and UPGMA
dendrogram.
Chapter II
Figure 2.1. Electron microscopy of the two T4-like Myoviridae phages infecting A.
salmonicida subsp. salmonicida: phiAS4 (A) and phiAS5 (B).
Figure 2.2. One step growth curves of Aeromonas phage phiAS4 and phiAS5 in A.
salmonicida subsp. salmonicida strain AS01.
Figure 2.3. Genome map of Aeromonas phage phiAS4.
Figure 2.4. Genome map of Aeromonas phage phiAS5.
Figure 2.5. Genome comparison of Aeromonas phage phiAS4 (A) and phiAS5 (B) to
related phages using the Artemis Comparison Tool (ACT).
Figure 2.6. SDS-PAGE analysis (A) and zymogram assay (B) of recombinant phiASL5.
Chapter III
Figure 3.1. Electron micrographs of negatively stained Aeromonas phage PAS-1 virions.
Figure 3.2. One step growth of Aeromonas phage PAS-1 in A. salmonicida subsp.
salmonicida AS01 strain.
Figure 3.3. Time course of lytic activity against the host cell by Aeromonas phage PAS-1.
Figure 3.4. Fate of the Aeromonas phage PAS-1 in the rainbow trout kidney (PFU/g) and
its aquarium water (PFU/ml).
Figure 3.5. The neutralizing activities against Aeromonas phage PAS-1 in rainbow trout
serum after administration of phage.
xiii
List of Tables
Literature review
Table I. Classification and its biological properties of phage.
Table II. Phages that carries toxin genes and their gene products.
Table III. Sources and properties of the sequenced Aeromonas phages up to 2012.
Table IV. The representative use of phages to control bacterial pathogens in aquaculture.
Chapter I
Table 1.1. Aeromonas salmonicida strains used in this study.
Table 1.2. PCR primers used in this study.
Table 1.3. Minimal inhibitory concentrations (MICs), tetracycline resistance (tet) genes,
mutations in QRDRs in A. salmonicida strains.
Chapter II
Table 2.1. Host ranges and EOPs of Aeromonas phage phiAS4 and phiAS5 against all
the bacterial strains used in this study.
Table 2.2. Predicted ORFs and its products of Aeromonas phage phiAS4.
Table 2.2. Predicted ORFs and its putative functions of Aeromonas phage phiAS5.
Chapter III
Table 3.1. Bacterial strains used in this study and infectivity of Aeromonas phage PAS-1.
Table 3.2. Partial and complete ORFs of Aeromonas phage PAS-1.
Table 3.3. SDS-PAGE profile of the PAS-1 virion and their protein profiles by liquid
chromatography-tandem mass spectrometry (LC-MS/MS) analysis
xiv
Abbreviations
MIC Minimum Inhibitory Concentration
QRDR Quinolone Resistant Determining Region
PFGE Pulsed Field Gel Electrophoresis
CLSI Clinical and Laboratory Standards Institute
MDR Multi Drug Resistant
PCR Polymerase Chain Reaction
UPGMA Unweighted Pair Group Method with Arithmetic mean
CAMHB Cation Adjusted Muller Hinton Broth
NCBI National Center for Biotechnology Information
TEM Transmission Electron Microscopy
EOP Efficiency Of Plating
CFU Colony Forming Unit
PFU Plaque Forming Unit
MOI Multiplicity Of Infection
IACUC Institutional Animal Care and Use Committee
ORF Open Reading Frame
SDS-PAGE Sodium Dodecyl Sulfate-PolyAcrylamide Gel Electrophoresis
LC-MS/MS Liquid Chromatography-tandem Mass Spectrometry
IM Intra Muscular
OD Optical Density
SPSS Statistical Package for the Social Sciences
TSA Tryptic Soy Agar
TSB Tryptic Soy Broth
PEG PolyEthylene Glycol
EDTA Ethylene Diamine Tetraacetic Acid
IPTG IsoPropyl-β-d-Thio-Galactoside
PAS Phage of Aeromonas Salmonicida
TE Tris-EDTA
TBE Tris-Borate-EDTA
1
General introduction
Salmonid fish (salmonids) are the most important biological and political fish
resources in the pacific oceans due to the characteristics of transboundary
distributions and economical importances (5). In the recent decades, the scientific
interests in 3 species of salmonids such as chum salmon (Oncorhynchus keta),
masou salmon (O. masou) and rainbow trout (O. mykiss) were much increased in
Korea due to the involvement to the North Pacific Anadromous Fisheries
Commission (NPAFC). Chum salmon is the most important anadromous salmonid
species in Korea, because it is the only indigenous fish species that migrate from
Korea to north pacific oceans (3). Another salmonid fish, masou salmon, is
distributed in natural freshwaters in Korea, but its natural population is very small
(5). In the middle of 1980s, the enhancement program of anadromous salmonids
has been established in Korea since the foundation of the Cold-water Fish Research
Center (formerly Yangyang inland hatchery) of National Fisheries Research and
Development Institute, and the biological and political interests of salmonid
preservations were also increased (7). However, those two anadromous salmonid
species recently showed rapid decrease in the late return and are now in danger of
extinction in Korea, due to environmental pollutions, global warming, overfishing
and diseases. In additions, rainbow trout, which is not indigenous salmonid species
and was transplanted from Japan and USA approximately 40 years ago, is now
artificially propagated and cultured on a large scale in Korean aquaculture (1), but
it also suffered from several diseases caused by bacterial or viral pathogens (6).
Aeromonas salmonicida subsp. salmonicida is the causative agent of
2
furunculosis in salmonid fish, and is thus responsible for significant economic
losses in the global aquaculture industry as well as salmonid cultures (4). Recently,
the acquisions of antibiotic resistance in A. salmonicida subsp. salmonicida have
been recognized as a serious world-wide concern, owing to their potential health
risks to animals and human (4). Therefore, alternative control methods against this
fish pathogen are urgently needed. From the 20th century, phages have received
attention due to their potential as alternative antimicrobial agents for a variety of
bacterial pathogens. In aquaculture, phages have been used as control agents
against several fish and shellfish pathogens, and its applications showed promising
results (8).
In Korea, A. salmonicida subsp. salmonicida was first isolated from cultured
masu salmon in 1986 (2), and more recently detected from rainbow trout farm (6).
However, the prevalence of A. salmonicida subsp. salmonicida has not been
investigated in Korean aquaculture industry, and the potential acquisition or
spreadness of antibiotic-resistance in this bacterium was not also studied until yet.
Therefore, this study was planed to preferentially provide recent prevalence and
antibiotic resistance of A. salmonicida subsp. salmonicida isolated from Korean
aquaculture, and ultimately focused on development of alternative control methods
of this fish pathogen using its infectious phages to adopt it in Korean aquaculture
industry.
References
1. Baik, K. K., et al. 2007. Studies on seed production of rainbow trout, Oncorhynchus
mykiss. J. Aquaculture 20:85-89.
3
2. Fryer, J., R. Hedrick, J. Park, and Y. Hah. 1988. Isolation of Aeromonas salmonicida
from masu salmon in the Republic of Korea. J. Wildl. Dis. 24:364-365.
3. Jeon, C. H., et al. 2011. Mornitoring of viruses in chum salmon (Oncorhynchus keta)
migrating to Korea. Arch. Virol. 156:1025-1030.
4. Kim, J. H., et al. 2011. Molecular characterization of tetracycline- and quinolone-
resistant Aeromonas salmonicida isolated in Korea. J. Vet. Sci. 12:41-48.
5. Kim, S., C. S. Lee, and S. Kang. 2007. Present status and future prospect in salmon
research in Korea. J. Korean Soc. Oceanogr. 12:57-60.
6. Lee, C., J. C. Cho, S. H. Lee, D. G. Lee, and S. J. Kim. 2002. Distribution of Aeromonas
spp. as identified by 16S rDNA restriction fragment length polymorphism analysis in a
trout farm. J. Appl. Microbiol. 93:976-985.
7. Lee, C. S., K. B. Seong, and C. H. Lee. 2007. History and status of the chum salmon
enhancement program in Korea. J. Korean Soc. Oceanogr. 12:73-80.
8. Park, S. C., and T. Nakai. 2003. Bacteriophage control of Pseudomonas plecoglossicida
infection in ayu Plecoglossus altivelis. Dis. Aquat. Org. 53:33-39.
4
Literature Review
A. Aeromonas salmonicida
A.1. Taxonomy of Aeromonadaceae
The genus Aeromonas (Superkingdom, Bacteria; Phylum, Proteobacteria; Class,
γ-proteobacteria; Order, Aeromonadales; Family, Aeromonadaceae) comprise a
collection of gram-negative bacteria that are widespread in aquatic environments ,
and have been implicated as causative agents of a number of human and animal
diseases (117). The taxonomy of this genus is in a continual state of flux as new
species are identified by its phenotypic and genotypic classifications, and the
descriptions of the existing taxa are refined (117). In a broad point of view,
Aeromonas spp. could be devided as motile and non-motile species. Up to recent,
approximately 30 motile Aeromonas spp. were identified (such as A.
allosaccharophila, A. aquariorum, A. bestiarum, A. bivalvium, A. cavernicola, A.
caviae, A. diversa, A. encheleia, A. enteropelogenes, A. eucrenophila, A. fluvialis, A.
hydrophila, A. jandaei, A. media, A. molluscorum, A. piscicola, A. popoffii, A. rivuli,
A. sanarellii, A. sharmana, A. schubertii, A. simiae, A. taiwanensis, A. tecta, A.
trota, A. veronii biovar sobria and A. veronii biovar veronii), and those species
have been associated with various human infections including gastro-enteritis,
wound infections and septicaemia (43), and have also been implicated as the
causative agents of various fish diseases (77). A. hydrophila is also associated with
red leg disease in amphibians and infections in turtles (107) and birds (125). In
addition to their role as disease agents, Aeromonas species can be found in non-
5
pathogenic association with a variety of animals (82, 122, 142). Most Aeromonas
species are opportunistic pathogens, entering through wounds or affecting only
stressed or immune-compromised hosts (43). On the other hand, A. salmonicida is
known as the only a non-motile Aeromonas sp. and is the specific aetiological
agent of a bacterial septicaemia in fish, named as furunculosis (12, 61, 62, 148).
A.2. A. salmonicida and its classification
Furunculosis caused by A. salmonicida subsp. salmonicida is an important
bacterial disease in wild and cultured salmonids and other fish species, and can
have significant economical losses on worldwide aquaculture operations (62). In
the early of 20th century, this bacterium was initially referred as Bacterium or
Bacillus salmonicida (93), but it was later designated as ‘Aeromonas salmonicida’
by Griffin et al. (52). Isolates of the bacterium initially appeared to be
homogeneous, but an increasing number of studies reported several isolates with
different biological or biochemical properties from those of the typical ones from
the 1960s (127). Since then, the bacteria were classified into two groups as typical
and atypical ones (91), and divided into three subspecies: subsp. salmonicida,
subsp. achromogenes and subsp. masoucida (116). Afterwards, the fourth and fifth
subspecies, subsp. smithia and subsp. pectinolytica were proposed by Austin et al.
(8) and Pavan et al. (111), respectively. In the recent years, the Bergey's manual of
systematic bacteriology (64) recognizes five subspecies of A. salmonicida: subsp.
salmonicida, achromogenes, masoucida, smithia, and pectinolytica, and currently
classify A. salmonicida subsp. salmonicida as "typical" and any isolate deviating
phenotypically as "atypical".
6
The typical isolates form a homogeneous group (7, 36, 47, 102), while the
taxonomy of atypical strains is still ambiguous, regardless of attempts to classify
them into several subspecies (148). In general, typical strains grow well on blood
agar with large colonies, produce a brown diffusible pigment, are β-haemolytic and
do not ferment sucrose (89). Therefore, morphological and biochemical differences
(7, 35, 89, 148), such as pigment production, colony size and growth rate,
haemolysis, and sucrose fermentation, are used to distinguish typical and atypical
isolates. Recently, phylogenetic analyses based on gene sequences (90, 98) or
biochemical analyses based on carbohydrates (143) appear to be better able to sort
out the complex taxonomy and classification of several subspecies in this
bacterium and its related species.
With the recent technical advances in genome sequencing, the complete genome
sequence of A. salmonicida subsp. salmonicida strain A449 was determined (117),
and the chromosome was 4,702,402 bp and encodeed 4388 genes, while the two
large plasmids were 166,749 and 155,098 bp with 178 and 164 genes, respectively.
Notable features were a large inversion in the chromosome and the presence of a
Tn21 composite transposon containing mercury resistance genes and an In2
integronen coding genes for resistance to streptomycin-spectinomycin, quaternary
ammonia compounds, sulphonamides and chloramphenicol. Additionally, another
draft genome sequence of A. salmonicida subsp. salmonicida strain 01-B526 which
isolated from a brook trout (27), is also available in GenBank database.
A.3. A. salmonicida subsp. salmonicida and furunculosis
Furunculosis was first reported in Germany at 1894 (41). The name
7
‘furunculosis’ was given due to its symptom showed furuncle-like swellings, which
were ulcerative at a later stage of the disease. However, the discrepancy in the
taxonomy of A. salmonicida has also affected the nomenclature used for the
diseases caused by this pathogen. In pioneer days, the term ‘furunculosis’ was used
principally to cover all fish diseases caused by A. salmonicida species, even though
it was specifically used for those infections of salmonids which showed the
furuncle-like swellings (92). However, Ljungberg and Johansson (87) suggested
that it was essential from an epizootiological point of view to identify typical and
atypical A. salmonicida infections as two separate diseases. Subsequently, the
diseases caused by atypical isolates in non-salmonid fish have been variously
referred; such as carp erythrodermatitis, goldfish ulcer disease, skin ulcer disease
of flounder, A.S.A. infection in salmonid fish, ulcerative furunculosis, infectious
dermatitis, atypical A. salmonicida infection or atypical furunculosis (62).
Therefore, only infections caused by A. salmonicida subsp. salmonicida should be
called as furunculosis (109, 148). However, the taxonomy of atypical isolates is
still ambiguous and the terms used for the diseases caused by A. salmonicida vary
between geographical regions (62). Therefore in this thesis, the term furunculosis is
used for infections caused by A. salmonicida subsp. salmonicida. Other infections
caused by atypical strains are referred to as related diseases, atypical infections or
atypical A. salmonicida infections.
A.4. Host range and distribution
A. salmonicida have an extensively broad host ranges in wild and farmed fish of
all ages, and its infections occurr in fresh water, brackish and marine environment
8
(148). Furthermore, it has been indicated that almost all the fish species can serve
as a reservoir of infections caused by A. salmonicida (60), and salmonids are
considered to be the most susceptible to furunculosis, especially Atlantic salmon
(Salmo salar L.), brook trout (Salvelinus fontinalis) and brown trout (Salmo trutta
L.), whereas, rainbow trout (O. mykiss) is considered being relatively resistant to
this bacterium (92).
Typical and atypical infections have been reported in worldwide aquaculture
(148). However, atypical infections mostly occur in the temperate regions of
Canada, USA, Japan and Europe (148). In Korea, A. salmonicida subsp.
salmonicida was was first isolated from cultured masu salmon (O. masou) in 1986
(46), and more recently detected from rearing water on a rainbow trout farm (84).
The history of atypical infections in Korea is relatively not well documented as
compared to typical ones, and only one case of its infections in the black rockfish
(Sebastes schlegeli) were reported (58).
A.5. Clinical signs
In general, furunculosis is considered as a septicaemic disease which can be
considered as a peracute, acute, subacute or chronic form (62, 92). And its clinical
features were previously reviewed by McCarthy and Roberts (92) as follows:
i) The acute form cause high mortality and is common in growing and adult fish,
which show signs that are typical of an acute bacterial septicemia: darkening in
colour, lack of appetite, lethargy, tachy branchia and small hemorrhages at the base
of the fins. Furuncles may develop, but not continuously, and they may rupture to
release highly infective material. The fish usually die within two or three days.
9
ii) The peracute form of furunculosis usually occurs in fingerling fish with the
following clinical signs: darkening in colour, tachy branchia, exophthalmosis,
haemorrhages at the pectoral fin base and high mortality.
iii) Subacute and chronic forms are more common in older fish, which are lethargic
and have one or more furuncles on the flank or dorsum. There may be congestion
of the blood vessels at the base of fins, injection of the sclera, slight exophthalmia
and paleness of the gills. The furuncles may be large and when ruptured the fluid is
more viscous and contains more formed, necrotic elements than the furuncles
found in acute cases. The onset of disease is more gradual and mortality is
relatively low as compared to acute form. In addition, a latent form of infection, in
which there is no mortality and no symptoms but the bacterium still isolated, was
reported (60). The latent form of infection was further suggested to be changed to
“clinically inapparent” or “covert” infection by Hiney et al. (61).
In contrast, atypical infections in farmed salmonids also have a septicemic
disease and the bacterium is usually isolated from both skin ulcers and internal
organs (103, 108, 146). The mortalities caused by atypical infections have been
extremely varied from 10% (103) to more than 90% (87). Additionally, Wichardt et
al. (146) found differences in susceptibility among the salmonid species: Atlantic
salmon or rainbow trout was somehow resistant under normal farming conditions,
whereas brown trout or arctic char (Salvelinus alpinus L.) were highly suspectible.
Rintamäki and Valtonen (118) also reported higher mortalities among sea trout
(Salmo trutta m. trutta L.) than in other salmonids at the same farm. The clinical
signs of atypical infections in salmonids were varied; such as emaciation and
paleness of the gills (103), black discoloration, surface ulcers and lesions, ranging
10
in appearance from a small superficial wound with little necrosis to deep jagged
lesions surrounded by necrotic muscle (108), pronounced dermatitis (146),
haemorrhages and erosion at the base of the fins, skin ulcers and small furuncles in
the musculature (118), lethargy, aimless swimming, respiratory distress, fin erosion
and haemorrhagic cutaneous and muscular ulcers (53).
The clinical signs caused by atypical infection in non-salmonids have been
reviewed by Wiklund and Dalsgaard (148). In most signs of disease outbreaks
among wild or farmed non-salmonid fish, the symptoms manifested ulcerations and
lesions in a variety of locations in fish skin (62). For example, ulcerations or
lesions were found in all over the body surface except on the head (in carp), those
appeared on any part of the body and vary in size and depth (in goldfish), while the
skin ulcers were superficial (in flounder). In case of eels, atypical A. salmonicida
have been reported to cause severe necrosis, lesions in the skin and tissue swelling
on the head (62). In additions, haemorrhage and erosion of the fins, necrosis of the
tail and haemorrhage or lesions in the eyes have also been associated with atypical
infections in non-salmonid fish (62). Septicemic infections have been reported in
naturally infected cod (Gadus morhua L.) (88), and in experimentally infected
turbot (Scophthalmus maximus L.) (14). However, the mortality rates for atypical A.
salmonicida outbreaks in wild fish are not well presented (62).
A.6. Transmission
The mechanism of horizontal or vertical transmission in A. salmonicida subsp.
salmonicida is still uncertain and controversial. However, contact with infected fish
or contaminated water and fish farm materials, and trans-ovarian transmission have
11
all been speculated as possible routes of disease transmission, and carrier fish with
latent infection were also suggested as another possible route for horizontal
transmission of the disease (91). Moreover, the bacteria-contaminated water can be
a possible way of disease transmission to susceptible fish: fish species such as
brown trout easily become infected via bath challenges, but more resistant
salmonids such as rainbow trout need to be abraded before the onset of disease (91).
During infection, gills, skins and wounds were suspected as the main routes of
entry for A. salmonicida subsp. salmonicida (63, 133). Additionally, bacterial
transmissions through the gastro-intestinal tract via oral (91) or intra-gastric
challenge (120) have been investigated, but those results were contradictory.
Vertical transmission through infected ova has been investigated by several
authors. McCarthy (91) indicated that vertical transmission is not a significant
route for furunculosis, and routine disinfection of eyed eggs is unnecessary.
Bullock and Stuckey (18) investigated vertical transmission following the health
status of the progeny of carrier and artificially infected broodstock, and concluded
that it does not occur. In contrast, Wichardt et al. (146) stated that the spread of
furunculosis between Swedish fish farms occurred through the transportation of
infected fish or contaminated equipment, and also through infected ova.
A.7. Virulence factors
Many fundamental aspects of the host-pathogen relationship between A.
salmonicida subsp. salmonicida and its fish hosts were poorly understood.
Therefore in recent decades, the mechanims of bacterial virulence were extensively
investigated. To date, several proteins and systems in A. salmonicida subsp.
12
salmonicida have been implicated in its virulence including the S-layer (136)
[vapA], siderophores and their receptors (38) [fstC, fstB and hupA], superoxide
dismutase (9, 33) [soda and sodB] and extracellular toxins (121) [glycerol
phospholipid: cholesterol acetyl-transferase and the serine protease AspA].
However, the nature of its virulence is indeed complex and apparently varies
between strains, and despite the presence of multiple virulence systems, no single
system appeared to significantly contribute to its virulence as shown by the
retention of virulence by strains deficient in any given system (40, 104, 140).
A type III secretion system (TTSS) in A. salmonicida subsp. salmonicida has
been recently described (21, 23, 131). Gram-negative bacteria utilize TTSSs as a
transmembrane injection apparatus composed of integral membrane proteins and a
needle-like structure to translocate a range of effect or proteins from the cytosol
directly into host cells (34), and it is known as a major virulence factor for several
pathogenic bacteria (66) including Pseudomonas aeruginosa, Shigella flexneri,
Salmonella enterica serovar typhimurium, entero-pathogenic E. coli, as well as A.
hydrophila AH-1 (153) which belongs to Aeromonadaceae. Likewise, the TTSS in
A. salmonicida subsp. salmonicida consists of inner- and outer-membrane secretory
pores, a host-cell translocation pore and a number of effector molecules. In
addition, the various genes of the TTSS of A. salmonicida subsp. salmonicida are
carried both on plasmids and chromosome (22, 131). Moreover, the 2 laboratory-
derived TTSS-deficient strains have been described as avirulent in a rainbow trout
challenge model; One strain was deficient in the 140 kbp plasmid that carries the
TTSS system, and the other was a knockout mutant strain in ascV which forms part
of the inner bacterial membrane pore (20, 22). And ultimately, it was proved that
13
the TTSS gene in A. salmonicida subsp. salmonicida is responsible for secretion of
the ADP-ribosylating toxin, AexT, and encoded on a thermolabile plasmid, and the
absence of the TTSS gene ascV disabled the bacteria to secret AexT, even though
the strain contained the aexT gene (131). Based on these results, the TTSS is now
considered as a major virulence factors in A. salmonicida subsp. salmonicida, but
things still remains to be proved.
A.8. Disease control
Furunculosis was the first bacterial disease in fish which was treated with
antibiotics such as sulfonamides and nitrofurans (55), and the oubreaks caused by
A. salmonicida subsp. salmonicida were usually controlled with chemotherapy (29,
92). Although other antibiotics effectively control this disease (60), the U.S. Food
and Drug Administration imposes stringent requirements for the antibiotics used on
aquaculture industry, and only the use of sulfamerazine, oxytetracycline and the
potentiated sulfonamide Ro5-0037 or ROMET® (19) is approved in USA. In other
country, several antimicrobial agents have been used to control furunculosis,
including chloramphenicol, thiophenicol, furazolidone and oxytetracycline,
sulphamerazine, tetracycline and a combination of trimethoprim and sulphonamide,
flumequine, oxolinic acid, florfenicol, amoxicillin and enrofloxacin (59, 60, 70, 71,
92, 95, 130).
On the other hands, several vaccines against typical strains were recently
developed with providing long-lasting protection, and their use is promoted in
commercial aquaculture (29, 39, 86). However, the vaccines were not guaranted
further expression of furunculosis within or transmission of furunculosis from
14
covertly infected vaccinated carriers (61). Furthermore, the serologic relatedness
among A. salmonicida subsp. salmonicida strains (109) suggests that immunization
of fish against atypical infection is also a realistic possibility. However, Atlantic
salmon inoculated with a commercial vaccine against typical strain or with this
vaccine and another prepared against atypical strain of A. salmonicida subsp.
achromogenes were equally protected against A. salmonicida subsp. salmonicida
by cohabitation challenge. However, the salmonids vaccinated with A. salmonicida
subsp. achromogenes only were not protected against furunculosis (54).
A.9. Emergence of antibiotic resistance
As early as in 1967, the increased frequency of antimicrobial resistance among
A. salmonicida subsp. salmonicida was first reported in USA (151). Resistance has
also been reported to sulphonamides (60), oxytetracycline (51, 69, 137), and
combinations of sulphonamide and trimethoprim (51, 137), oxolinic acid (51, 59,
69, 137) and to amoxicillin (51). Furthermore, several typical strains showing
multi-drug resistance have been isolated in recent years (51, 69, 72, 100).
Among the antibiotics utilized in the treatment of furunculosis, both tetracycline
and quinolone resistance have been most widely documented (37, 99). Those
studies indicated that tetracycline resistance in A. salmonicida subsp. salmonicida
was plasmid-encoded, and tetA was predominant among the different classes of
tetracycline-resistant genes. Schmidt et al. (123) reported the isolation and
characterization of oxytetracycline-sulfonamide/trimethoprim-resistant Aeromonas
spp. from Danish rainbow trout farms, and the results indicate that tetE was the
predominant determinant, followed by tetA and tetD. Whereas, DePaola et al. (37)
15
had determined that 86% of Aeromonas spp. isolated from catfish contained tetA
and the rest harbored tetE. Quinolones are mainly used as drugs of choice for the
treatment of human Aeromonas infections (4, 76), and are also used for the
treatment of other bacterial fish disease as well as furunculosis (48). These drugs
can persist for a long time in the environment (57), which could cause the
emergence of resistant strains in environmental samples. Quinolone resistance in
gram-negative bacteria is mainly due to DNA mutations in the quinolone resistance
determining regions (QRDRs) which consist of DNA gyrase and topoisomerase IV
that alter the target enzymes for these drugs (3, 4). DNA gyrase and topoisomerase
IV are hetero-tetramers formed by two types of subunits: GyrA, GyrB and ParC,
ParE, respectively (114). Mutations in the gyrA and parC genes in QRDRs also
proved to be related to quinolone resistance in the motile and non-motile
Aeromonas spp. (49). Moreover, an active efflux pump belonging to the resistance
nodulation cell division family that could contribute to its quinolone resistance in A.
salmonicida subsp. salmonicida also have been presented (48). Additionally, the
plasmid-mediated qnr gene was also known to be associated with low level
quinolone resistance (128).
16
B. Bacteriophage (phage)
B.1. Genaral description
Phages are bacterial viruses that infect bacterial cells, disrupt bacterial
metabolism and cause the bacterium to lyse. Phages are the most abundant living
entities on earth, and play major roles in bacterial ecology, adaptation, evolution
and pathogenesis (1). Phages are common in soils (approximately 107 to 109
virions/g), and highly abundant in fresh water and marine waters (approximately
107 virions/ml), and its total amount on earth was estimated as 1031 virions (132).
The phages were discovered twice at the beginning of the 20th century in a short
time (25). Frederick W. Twort, an English medical bacteriologist, described a
marked antibacterial activity in Micrococcus by an unknown agent in 1915 (25).
And 2 years later, phages were “officially” discovered by Felix H. d’Herelle, a
French-Canadian microbiologist at the Institut Pasteur. He discovered the
destruction of Shigella in broth culture, and recognized the viral nature of this
phenomenon and suggested the term ‘bacteriophage’ (32). The viral nature of
phages was recognized in 1940 with the development of electron microscope, and
the basis of the present phage classification was proposed by Bradley in 1967 (17)
as six types: such as tailed phage, filamentous phages, and icosahedral phages with
single-stranded (ss) DNA or ssRNA. In 1971, the International Committee on
Taxonomy of Viruses (ICTV) classified phages into 6 genera (T4, λ, φX174, MS2,
fd and PM2) (145). From that time, new phage groups were added over time, and
the ICTV presently recognize one order, 13 families and 31 genera of phages (25).
Most phages contain dsDNA, but there are other groups with ssDNA, ssRNA and
17
dsRNA. A few phage types which have lipid-containing envelop or contain lipid as
part of its molecule were also found.
Up to recent, a total of 5500 tailed phages (96% of phages) are now classified
into the order Caudovirales and 3 large phylogenetically related families
(Myoviridae, Siphoviridae and Podoviridae). In contrast, filamentous or
pleomorphic phages comprise less than 190 viruses only (3.6% of phages), and
classified into 10 small families. These results indicated that phages are extremely
diversified by their basic properties and morphology. Therefore, there are no
available universal criteria for its genus and species delineation up to date (25). In
Figure I and Table I, the recently morphologically presented phage and its
classifications are summarized.
Figure I. Schematic representation of major phage groups (24)
18
Table I. Classification and its biological properties of phages (24)
C, circular; L, linear; S, segmented; T, superhelical; ss, single-stranded; ds, double-stranded.
Briefly, phages are known to have two possible life cycles; the ‘lytic’ (or
virulent) and ‘lysogenic’ (or temperate) cycle (152). Lytic phages rapidly multiply
and kill the host cell at the end of the replication cycle. On the other hands,
temperate phages which undergo the lysogenic cycle persist in a lysogenic state,
whereby the phage genome can exist indefinitely by being inserted in the bacterial
chromosome (known as the prophage state). The lysogenic life cycle of λ phage,
for example, ensures the replication of the integrated prophage along with the
bacterial genome for many generations. When induction occurs through damage of
the DNA (UV irradiation or exposure to mutagens), which signifies the imminent
death of the host, the phage switches to the lytic cycle which results in the release
of new phage particles. Interestingly, some prophages can change non-pathogenic
bacteria to pathogenic one by lysogenic conversion mechanism (94). Several
examples of toxin genes or pathogenic islands insertion of temperate phage to host
19
bacterium were reported and summarized in Table II.
Table II. Phages that carries toxin genes and their gene products (94).
Phage Gene Gene product/phenotype Bacterial host
933, H-19B stx Shiga toxins
Escherichia coli O157:H7 ΦFC3208 hly2 Enterohaemolysin
Λ lom Serum resistance
Λ bor Host-cell envelope protein
Sfi6 oac O-antigen acetylase Shigella flexneri
Sfll, sfV, sfX gtrll Glucosyltransferase
SopEΦ sopE Type III effector
Salmonella enterica
Gifsy-2 sodC-1 Superoxide dismutase
Gifsy-2 nanH Neuraminidase
Gifsy-1 gipA Insertion element
ε34 rfb Glucosylation
CTXΦ ctxAB Cholera toxin
Vibrio cholera K139 glo G-protein like
VPIΦ tcp Toxin co-regulated pilus
ΦCTX ctx Cytotoxin Pseudomonas aeruginosa
C1 C1 Neurotoxin Clostridium botulinum
NA see, sel Enterotoxin
Staphylococcus aureus Φ13 entA,
sak
Enterotoxin A,
Staphylokinase
TSST-1 tst Toxic shock syndrome-1
T12 speA Erythrogenic toxin Streptococcus pyogenes
β-phage tox Diptheria toxin Corynebacterium diptheriae
The prevalence of phage-mediated lytic and lysogenic infections in the aquatic
environment is still controversial; Freifelder stated that more than 90% of known
phages are temperate (6), but Cochran et al. suggested that only around 50% of
20
bacterial strains contained inducible temperate (or lysogenic) phages (30).
Although a large percentage of phages are lysogenic, they are not suitable
candidates for phage therapy since they may not immediately kill the host bacteria.
Therefore, we will only focus on lytic phages in the further section ‘Therapeutic
applications of phages’ in this review.
B.2. Phages infecting Aeromonadaceae
The first phages infecting Aeromonadaceae (Hereinafter referred as Aeromonas
phages) was studied in the electron microscope in 1965 (16). Its host, which was
identified as an Acelobacter sp., was later reclassified as Aeromonas sp. (124).
Subsequently, Paterson isolated nine Aeromonas phages infecting A. salmonicida
from trout ponds and fish hatcheries, and described the characteristics of 4 selected
isolates (110). A halophilic and psychrophilic phage, specific for a marine
Aeromonas spp., was isolated from sea water collected at a depth of 825 m (147).
In 1971, 35 Aeromonas phages infecting A. salmonicida, which isolated from
sewage, surface water, fish hatcheries and lysogenic bacteria, were characterized
by serology and various biological criteria. Sixteen of these phages were studied by
electron microscopy and were divided into three morphological groups (115). At
least 8 additional phages infecting A. salmonicida were described since 1980 (73,
74, 119), and two phages infecting A. hydrophila were recently isolated from
sewage (28). However, those isolated Aeromonas phages have not been classified
in that time. Among the phages of known morphology, all but one had contractile
tails and isometric or elongated heads. The exception is Bradley's phage, which had
a short tail and resembles Salmonella phage P22 (16). Moreover, since physico-
21
chemical properties of Aeromonas phages were almost completely unknown, their
classification depended largely on morphology and serological data (2). In addition,
many Aeromonas phages were described without accurate morphological
micrographs, until the first morphological characteristics of about 35 Aeromonas
phages, mostly infecting A. salmonicida, were thoroughly investigated by
Ackermann in 1985 (2).
In a recent review of Ackermann in 2007 (1), a total of 43 phages infecting
Aeromonadaceae (especially in A. hydrophila and A. salmonicida) have been
reported, and all of those were morphologically classified as tailed phages
belonging to Caudovirales (33 of Myoviridae, 7 of Siphoviridae and 3 of
Podoviridae). And among the Aeromonas phages belong to family Myoviridae,
most of them were classified into P1-, P2- and T4-like viruses in the VIIIth ICTV
Report (http://www.ictvdb.org/Ictv/index.htm) (42). With the technological
advances in phage research, the morphology and genetic functions of T4 phage and
T4-like phages infecting Escherichia coli or other bacteria were thoroughly
investigated (31, 112), and provided an attractive model for the study of
comparative genomics and evolution of phages. In this respect, recent studies of
Aeromonas phages have also focused on virulent (or lytic) T4-like phages and have
included extensive genomic investigations (31, 83, 101, 110, 113, 134); the
complete genome sequences of 4 T4-like phages (Aeromonas phage 25, 31,
44RR2.8t and Aeh1), and only one exception of the complete genome of P2-like
temperate Aeromonas phage (designated as φO18P) infecting A. media have
already been published in GenBank. And in 2012, we fully sequenced the two T4-
like Aeromonas phages (phiAS4 and phiAS5) infecting A. salmonicida subsp.
22
salmonicida, and one T7-like Aeromonas phage (phiAS7) which belongs to
Podoviridae and infects A. salmonicida subsp. salmonicida. The characteristics of
those previously sequenced 8 Aeromonas phages were summarized in Table III.
Table III. Sources and properties of the sequenced Aeromonas phages up to 2012
Phage Family Host Isolation
source/contry
Genome
size (bp) Reference
25 Myoviridae
(T4-like)
A. salmonicida
subsp. salmonicida Fish farm/France 161,475 (112)
31 Myoviridae
(T4-like)
A. salmonicida
subsp. salmonicida Fish farm/France 172,963 (112)
44RR2.8t Myoviridae
(T4-like)
A. salmonicida
subsp. salmonicida Fish farm/Canada 173,591 (87)
Aeh1 Myoviridae
(T4-like) A. hydrophila Sewage/USA 233,234 (28)
φO18P Myoviridae
(P2-like) A. media
A. media O18
strain/Germany 33,985 (11)
phiAS4 Myoviridae
(T4-like)
A. salmonicida
subsp. salmonicida River/Korea 163,875 (79)
phiAS5 Myoviridae
(T4-like)
A. salmonicida
subsp. salmonicida River/Korea 225,268 (80)
phiAS7 Podoviridae
(T7-like)
A. salmonicida
subsp. salmonicida Fish farm/Korea 41,572 (81)
B.3. Therapeutic application of phages
Even though phages were discovered in the early of 20th century, the research of
the past half-century is almost rare on the possible therapeutic applications against
infectious bacterial diseases (6). The poor understanding of bacterial pathogenesis
and phage-host interactions led to a succession of badly designed and executed
23
experiments. Furthermore, with the advent of antibiotic therapy, the use of phages
became underestimated after the World War II. The discovery of antibiotics
diverted research attention from phage therapy, mainly in the USA and Western
Europe in 1940s. However, the use of the phage therapy has persisted without
interruption in Eastern Europe and Soviet Union, and phages were commercialized
by a number of companies (65). With regards to human health, in the past, phage
was commercialized and administered in Poland and the Soviet Union orally,
tropically or systemically to treat a wide variety of human infections (suppurative
wound, gastro-enteritis, sepsis, osteomyelitis, dermatitis, emphysemas and
pneumonia) in both adults and children with showing promising results (5). And in
the 1970s, previous enthusiasm on the application of phages to prevent and treat
bacterial infections in human was recovered (5, 10); studies of Smith et al. using E.
coli models with mice and farm animals, showed that phages could be used for
both treatment and prophylaxis against bacterial infections (129). From then,
several other Polish and Soviet Union study groups presented successful clinical
applications of phages against drug-resistant bacterial infections in humans as well
as animal models (5). The therapeutic efficacy of phage against infectious diseases
caused by Pseudomonas aeruginosa (56, 144), Staphylococcus aureus (including
MRSA) (149), E. coli (10), Enterococcus faecium (including VRE) (13),
Streptococcus pneumoniae (75), Helicobacter pylori (26), Klebsiella pneumoniae
(6) and Salmonella enteritidis (44, 135) has been shown in experimental animal
models. However in recent decades, the emergence of antibiotic-resistant bacteria
has substancially enhanced the interesting phage therapy even by USA and Western
Europe. And nowadays, more than a dozen of companies and universities are
24
working on phage therapy for human, using current standards of clinical and
microbiological research (15).
Recent studies evaluated phages as biocontrol agents in food (50, 67, 85, 135),
in plants (45), to control cyanobacterial blooms and for wastewater treatment (150).
Additionally, bacterial diseases are a major problem in the expanding aquaculture
(6, 126, 141). The increasing problems related to worldwide emergence of
antibiotic resistance in common pathogenic bacteria, and the concerns about its
spreadings in the aquaculture environments demanded alternative methods to
control bacterial pathogens in fish and shellfish. Phage therapy has been showed a
potentially viable alternative to antibiotics used in aquaculture to control
indigenous and non-indigenous bacterial disease in farmed fish (6). In addition,
some studies of phages were concerned with identifying those phages for use in
bacterial typing schemes or for the characterization of its properties, including their
potential role in virulence. Remarkably, there have been several attempts of phages
to prevent bacterial infections in aquaculture (Table IV), and these previous
experimental applications proved that phage could be useful for controlling
bacterial infections of fish or shellfish. In the same manner, the experimental
applications of phages to control A. salmonicida subsp. salmonicida have been
attempted (68, 138), but those studies faced several difficulties with failures
regarding fish protection. Therefore, our goal of this study was to find novel
Aeromonas phages infecting A. salmonicida subsp. salmonicida, and to verify its
therapeutic efficacy in Korean salmonids against furunculosis.
25
Table IV. The representative use of phages to control bacterial pathogens in aquaculture (6).
Bacteria Phage Treated
fish/shellfish Effects References
Aeromonas
salmonicida
HER1107
HER 110
Brook trout
(Salvelinus
fontinalis)
The onset of furunculosis
in brook trout was
delayed by 7 days
(68)
Vibrio harveyi
Siphoviridae
phage isolated
from oyster tissue
and from shrimp
hatchery water
Shrimp larvae
(Penaeus monodon) Improved larval survival (78)
Lactococcus
garvieae
Siphoviridae
phage isolated
from diseased fish
and sea water in
fish culture cages.
Yellow tail (Seliora
quinqueradiata) and
Ayu (Plecoglossus
altivelis)
Protective/curative effect
(increase in the survival
rate)
(96)
Lactococcus
garvieae
Siphoviridae
phage isolated
from diseased fish
and sea water in
fish culture cages.
Yellowtail (Seliora
quinqueradiata)
Protective/curative effect
(increase in the survival
rate)
(97)
Pseudomonas
plecoglossicida
PPp-W4
(Podoviridae)
and PPpW-3
(Myoviridae)
Ayu
(Plecoglossus
altivelis)
Reduced infection and
increased fish survival (105)
Pseudomonas
plecoglossicida
Myoviridae and
Podoviridae
isolated from
diseased ayu and
the rearing pond
water
Ayu
(Plecoglossus
altivelis)
Protection against
experimental infection (106)
Aeromonas
salmonicida
subsp.
salmonicida
Aeromonas
salmonicida
phages
O, R and B
Atlantic salmon
(Salmo salar L.)
Lower rate mortality but
similar absolute
mortality. No protection
was offered by any of the
phage treatments.
(138)
Vibrio harveyi Siphoviridae
phage
Shrimp larvae
(Penaeus monodon) Improved larval survival (139)
26
C. References
1. Ackermann, H. W. 2007. 5500 Phages examined in the electron microscope. Arch. Virol.
152:227-243.
2. Ackermann, H. W., et al. 1985. Aeromonas bacteriophages: Reexamination and
classification. Ann. Inst. Pasteur Virol. 136:175-199.
3. Akasaka, T., M. Tanaka, A. Yamaguchi, and K. Sato. 2001. Type II topoisomerase
mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa
isolated in 1998 and 1999: Role of target enzyme in mechanism of fluoroquinolone
resistance. Antimicrob. Agents Chemother. 45:2263-2268.
4. Alcaide, E., M. D. Blasco, and C. Esteve. 2010. Mechanisms of quinolone resistance in
Aeromonas species isolated from humans, water and eels. Res. Microbiol. 161:40-45.
5. Alisky, J., K. Iczkowski, A. Rapoport, and N. Troitsky. 1998. Bacteriophages show
promise as antimicrobial agents. J. Infect. 36:5-15.
6. Almeida, A., et al. 2009. Phage therapy and photodynamic therapy: Low environmental
impact approaches to inactivate microorganisms in fish farming plants. Mar. Drugs
7:268-313.
7. Austin, B., et al. 1998. Characterization of atypical Aeromonas salmonicida by different
methods. Syst. Appl. Microbiol. 21:50-64.
8. Austin, D. A., D. McIntosh, and B. Austin. 1989. Taxonomy of fish associated
Aeromonas spp., with the description of Aeromonas salmonicida subsp. smithia subsp.
nov. Syst. Appl. Microbiol. 11:277-290.
9. Barnes, A. C., M. T. Horne, and A. E. Ellis. 1996. Effect of iron on expression of
superoxide dismutase by Aeromonas salmonicida and associated resistance to
superoxide anion. FEMS Microbiol. Lett. 142:19-26.
10. Barrow, P., M. Lovell, and A. Berchieri. 1998. Use of lytic bacteriophage for control of
experimental Escherichia coli septicemia and meningitis in chickens and calves. Clin.
27
Diagn. Lab. Immunol. 5:294-298.
11. Beilstein, F., and B. Dreiseikelmann. 2008. Temperate bacteriophage φO18P from an
Aeromonas media isolate: Characterization and complete genome sequence. Virology
373:25-29.
12. Bernoth, E., A. E. Ellis, P. J. Midtlyng, G. Olivier, and P. Smith. 1997. Furunculosis -
Multidisciplinary Fish Disease Research. Academic Press, London.
13. Biswas, B., et al. 2002. Bacteriophage therapy rescues mice bacteremic from a clinical
isolate of vancomycin-resistant Enterococcus faecium. Infect. Immun. 70:204-210.
14. Björnsdóttir, B., S. Gudmundsdóttir, S. H. Bambir, and B. K. Gudmundsdóttir. 2005.
Experimental infection of turbot, Scophthalmus maximus (L.), by Aeromonas
salmonicida subsp. achromogenes and evaluation of cross protection induced by a
furunculosis vaccine. J. Fish Dis. 28:181-188.
15. Brüssow, H. 2005. Phage therapy: the Escherichia coli experience. Microbiology
151:2133-2140.
16. Bradley, D. E. 1965. The isolation and morphology of some new bacteriophages
specific for Bacillus and Acetobacter species. J. Gen. Microbiol. 41:233-241.
17. Bradley, D. E. 1967. Ultrastructure of bacteriophage and bacteriocins. Bacteriol. Rev.
31:230-314.
18. Bullock, G. L., and H. M. Stuckey. 1987. Studies on vertical transmission of Aeromonas
salmonicida. Prog. Fish-Cult. 49:302-303.
19. Bullock, G. L., H. M. Stuckey, and P. K. Chen. 1974. Corynebacterial kidney disease of
salmonids: Growth and serological studies on the causative bacterium. Appl. Microbiol.
28:811-814.
20. Burr, S., D. Pugovkin, T. Wahli, H. Segner, and J. Frey. 2005. Attenuated virulence of
an Aeromonas salmonicida subsp. salmonicida type III secretion mutant in a rainbow
trout model. Microbiology 151:2111-2118.
28
21. Burr, S., K. Stuber, and J. Frey. 2003. The ADP-ribosylating toxin, AexT, from
Aeromonas salmonicida subsp. salmonicida is translocated via a type III secretion
pathway. J. Bacteriol. 185:6583-6591.
22. Burr, S., K. Stuber, T. Wahli, and J. Frey. 2002. Evidence for a type III secretion system
in Aeromonas salmonicida subsp. salmonicida. J. Bacteriol. 184:5966-5970.
23. Burr, S. E., T. Wahli, H. Segner, D. Pugovkin, and J. Frey. 2003. Association of type III
secretion genes with virulence of Aeromonas salmonicida subsp. salmonicida. Dis.
Aquat. Org. 57:167-171.
24. Calendar, R. 2005. The Bacteriophages 2nd ed. Oxford Univ. Press. New York.
25. Calendar, R. 1988. The bacteriophages. Plenum Press, New York.
26. Cao, J., et al. 2000. Helicobacter pylori-antigen-binding fragments expressed on the
filamentous M13 phage prevent bacterial growth. Biochim. Biophys. Acta. 1474:107-
113.
27. Charette, S. J., et al. 2012. Draft genome sequence of the virulent strain 01-B526 of the
fish pathogen Aeromonas salmonicida. J. Bacteriol. 194:722-723.
28. Chow, M. S., and M. A. Rouf. 1983. Isolation and partial characterization of two
Aeromonas hydrophila bacteriophages. Appl. Environ. Microbiol. 45:1670-1676.
29. Cipriano, R. C., and G. L. Bullock. 2001. Furunculosis and other diseases caused by
Aeromonas salmonicida. US Fish and Wildlife Service, USGS, Kearneysville. Fish
Disease Leaflet 66.
30. Cochran, P. K., C. A. Kellogg, and J. H. Paul. 1998. Prophage induction of indigenous
marine lysogenic bacteria by environmental pollutants. Mar. Ecol. Prog. Ser. 164:125-
133.
31. Comeau, A. M., C. Bertrand, A. Letarov, F. Tetart, and H. M. Krisch. 2007. Modular
architecture of the T4 phage superfamily: a conserved core genome and a plastic
periphery. Virology 362:384-396.
29
32. D'Hérelle, F. 1918. Technique de la recherche du microbe filtrant bactériophage
(Bacteriophagum intestinale). C. R. Soc. Biol. 81:1160-1162.
33. Dacanay, A., et al. 2003. Molecular characterization and quantitative analysis of
superoxide dismutases in virulent and avirulent strains of Aeromonas salmonicida subsp.
salmonicida. J. Bacteriol. 185:4336-4344.
34. Dacanay, A., et al. 2006. Contribution of the type III secretion system (TTSS) to
virulence of Aeromonas salmonicida subsp. salmonicida. Microbiology 152:1847-1856.
35. Dalsgaard, I., et al. 1998. Identification of atypical Aeromonas salmonicida: inter-
laboratory evaluation and harmonization of methods. J. Appl. Microbiol. 84:999-1006.
36. Dalsgaard, I., B. Nielsen, and J. Larsen. 1994. Characterization of Aeromonas
salmonicida subsp. salmonicida: a comparative study of strains of different geographic
origin. J. Appl. Bacteriol. 77:21-30.
37. DePaola, A., P. A. Flynn, R. M. McPhearson, and S. B. Levy. 1988. Phenotypic and
genotypic characterization of tetracycline- and oxytetracycline-resistant Aeromonas
hydrophila from cultured channel catfish (Ictalurus punctatus) and their environments.
Appl. Environ. Microbiol. 54:1861-1863.
38. Ebanks, R. O., A. Dacanay, M. Goguen, D. M. Pinto, and N. W. Ross. 2004. Differential
proteomic analysis of Aeromonas salmonicida outer membrane proteins in response to
low iron and in vivo growth conditions. Proteomics 4:1074-1085.
39. Ellis, A. E. 1997. Immunization with bacterial antigens: furunculosis. Dev. Biol. Stand.
90:107-116.
40. Ellis, A. E., A. S. Burrows, and K. J. Stapleton. 1988. Lack of relationship between
virulence of Aeromonas salmonicida and the putative virulence factors: A-layer,
extracellular proteases and extracellular haemolysins. J. Fish Dis. 11:309-323.
41. Emmerich, R., and E. Weibel. 1894. Ueber eine durch Bacterien erzeugte Seuche unter
den Forellen. Arch. Hyg. Bakteriol. 21:1-21.
30
42. Fauquet, C., M. Mayo, J. Maniloff, U. Desselberger, and A. Ball. 2005. Virus Taxonomy.
VIIIth Report of the International Committee on Taxonomy of Viruses:35-85.
43. Figueras, M. 2005. Clinical relevance of Aeromonas. Rev. Med. Microbiol. 16:145-153.
44. Fiorentin, L., N. Vieira, and W. Barioni. 2005. Use of lytic bacteriophages to reduce
Salmonella Enteritidis in experimentally contaminated chicken cuts. Rev. Bras. Cienc.
Avic. 7:255-260.
45. Flaherty, J. E., G. C. Somodi, J. B. Jones, B. K. Harbaugh, and L. E. Jackson. 2000.
Control of bacterial spot on tomato in the greenhouse and field with H-mutant
bacteriophages. HortScience 35:882-884.
46. Fryer, J., R. Hedrick, J. Park, and Y. Hah. 1988. Isolation of Aeromonas salmonicida
from masu salmon in the Republic of Korea. J. Wildl. Dis. 24:364-365.
47. Garcia, J., J. Larsen, I. Dalsgaard, and K. Pedersen. 2000. Pulsed-field gel
electrophoresis analysis of Aeromonas salmonicida ssp. salmonicida. FEMS Microbiol.
Lett. 190:163-166.
48. Giraud, E., G. Blanc, A. Bouju-Albert, F. X. Weill, and C. Donnay-Moreno. 2004.
Mechanisms of quinolone resistance and clonal relationship among Aeromonas
salmonicida strains isolated from reared fish with furunculosis. J. Med. Microbiol.
53:895-901.
49. Goni-Urriza, M., et al. 2002. Type II topoisomerase quinolone resistance-determining
regions of Aeromonas caviae, A. hydrophila, and A. sobria complexes and mutations
associated with quinolone resistance. Antimicrob. Agents Chemother. 46:350-359.
50. Goode, D., V. M. Allen, and P. A. Barrow. 2003. Reduction of experimental Salmonella
and Campylobacter contamination of chicken skin by application of lytic
bacteriophages. Appl. Environ. Microbiol. 69:5032-5036.
51. Grant, A., and L. Laidler. 1993. Assessment of the antimicrobial sensitivity of
Aeromonas salmonicida isolates from farmed Atlantic salmon in Scotland. Vet. Rec.
31
133:389-391.
52. Griffin, P. J., S. F. Snieszko, and S. B. Friddle. 1953. A more comprehensive description
of Bacterium salmonicida. Trans. Am. Fish. Soc. 82:129-138.
53. Groman, D., D. Tweedie, and D. Shaw. 1992. Experiences with atypical furunculosis in
Newfoundland: an overview. Bull. Aquac. Assoc. Can. 1:36-39.
54. Gudmundsdóttir, B. K., and S. Gudmundsdóttir. 1997. Evaluation of cross protection by
vaccines against atypical and typical furunculosis in Atlantic salmon, Salmo salar L. J.
Fish Dis. 20:343-350.
55. Gutsell, J. S. 1948. The value of certain drugs, especially sulfa drugs, in the treatment of
furunculosis in brook trout, Salvelinus Fontinalis. Trans. Am. Fish. Soc. 75:186-199.
56. Hagens, S., A. Habel, U. Ahsen, A. Gabain, and U. Bläsi. 2004. Therapy of
experimental Pseudomonas infections with a nonreplicating genetically modified phage.
Antimicrob. Agents Chemother. 48:3817-3822.
57. Halling-Sørensen, B., et al. 1998. Occurrence, fate and effects of pharmaceutical
substances in the environment- a review. Chemosphere 36:357-393.
58. Han, H. J., et al. 2011. Atypical Aeromonas salmonicida infection in the black rockfish,
Sebastes schlegeli Hilgendorf, in Korea. J. Fish Dis. 34:47-55.
59. Hastings, T. S., and A. McKay. 1987. Resistance of Aeromonas salmonicida to oxolinic
acid. Aquaculture 61:165-171.
60. Herman, R. L. 1968. Fish furunculosis. Trans. Am. Fish. Soc. 97:221-230.
61. Hiney, M., and G. Olivier. 1999. Furunculosis (Aeromonas salmonicida). In Fish
Diseases and Disorders, vol. 3: Viral, Bacterial and Fungal Infections. Wallingford.
CABI Publishing.
62. Hirvelä-Koski, V. 2005. Fish pathogens Aeromonas salmonicida and Renibacterium
salmoninarum: Diagnostic and epidemiological aspects. Academic Dissertation,
University of Helsinki.
32
63. Hodgkinson, J. L., D. Bucke, and B. Austin. 1987. Uptake of the fish pathogen,
Aeromonas salmonicida, by rainbow trout (Salmo gairdneri L.). FEMS Microbiol. Lett.
40:207-210.
64. Holt, J. G., N. R. Krieg, P. H. A. Sneath, J. T. Staley, and S. T. Williams. 1994. Bergey's
manual of determinative bacteriology, Ninth Edition. Williams and Wilkins, Baltimore,
USA.
65. Housby, J. N., and N. H. Mann. 2009. Phage therapy. Drug Discov. Today 14:536-540.
66. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of animals
and plants. Microbiol. Mol. Biol. Rev. 62:379-433.
67. Huff, W., G. Huff, N. Rath, J. Balog, and A. Donoghue. 2005. Alternatives to
antibiotics: utilization of bacteriophage to treat colibacillosis and prevent foodborne
pathogens. Poult. Sci. 84:655-659.
68. Imbeault, S., S. Parent, M. Lagacé, C. F. Uhland, and J. F. Blais. 2006. Using
bacteriophages to prevent furunculosis caused by Aeromonas salmonicida in farmed
brook trout. J. Aquat. Anim. Health 18:203-214.
69. Inglis, V., G. N. Frerichs, S. D. Millar, and R. H. Richards. 1991. Antibiotic resistance of
Aeromonas salmonicida isolated from Atlantic salmon, Salmo salar L., in Scotland. J.
Fish Dis. 14:353-358.
70. Inglis, V., R. H. Richards, K. J. Varma, I. H. Sutherland, and E. S. Brokken. 1991.
Florfenicol in Atlantic salmon, Salmo salar L., parr: tolerance and assessment of
efficacy against furunculosis. J. Fish Dis. 14:343-351.
71. Inglis, V., M. Soliman, I. Higuera Ciapara, and R. Richards. 1992. Amoxycillin in the
control of furunculosis in Atlantic salmon parr. Vet. Rec. 130:45-48.
72. Inglis, V., E. Yimer, E. J. Bacon, and S. Ferguson. 1993. Plasmid-mediated antibiotic
resistance in Aeromonas salmonicida isolated from Atlantic salmon, Salmo salar L., in
Scotland. J. Fish Dis. 16:593-599.
33
73. Ishiguro, E., T. Ainsworth, R. Harkness, W. Kay, and T. Trust. 1984. A temperate
bacteriophage specific for strains of Aeromonas salmonicida possessing A-layer, a cell
surface virulence factor. Curr. Microbiol. 10:199-202.
74. Ishiguro, E., W. Kay, and T. Trust. 1980. Temperate bacteriophages for Aeromonas
salmonicida. FEMS Microbiol. Lett. 8:247-250.
75. Jado, I., et al. 2003. Phage lytic enzymes as therapy for antibiotic-resistant
Streptococcus pneumoniae infection in a murine sepsis model. J. Antimicrob.
Chemother. 52:967-973.
76. Jones, B. L., and M. H. Wilcox. 1995. Aeromonas infections and their treatment. J.
Antimicrob. Chemother. 35:453-461.
77. Joseph, S., and A. Carnahan. 1994. The isolation, identification, and systematics of the
motile Aeromonas species. Ann. Rev. Fish Dis. 4:315-343.
78. Karunasagar, I., M. M. Shivu, S. K. Girisha, G. Krohne, and I. Karunasagar. 2007.
Biocontrol of pathogens in shrimp hatcheries using bacteriophages. Aquaculture
268:288-292.
79. Kim, J. H., et al. 2012. Complete genomic sequence of a T4-like bacteriophage, phiAS4,
infecting Aeromonas salmonicida subsp. salmonicida. Arch. Virol. 157:391-395.
80. Kim, J. H., et al. 2012. Complete genome sequence and characterization of a broad-host
range T4-like bacteriophage phiAS5 infecting Aeromonas salmonicida subsp.
salmonicida. Vet. Microbiol. 157:164-171.
81. Kim, J. H., et al. 2012. Complete genome sequence of bacteriophage phiAS7, a T7-like
virus that infects Aeromonas salmonicida subsp. salmonicida. J. Virol. 86:2894-2895.
82. Kueh, C., and K. Chan. 1985. Bacteria in bivalve shellfish with special reference to the
oyster. J. Appl. Bacteriol. 59:41-47.
83. Lavigne, R., et al. 2009. Classification of Myoviridae bacteriophages using protein
sequence similarity. BMC Microbiol. 9:224.
34
84. Lee, C., J. C. Cho, S. H. Lee, D. G. Lee, and S. J. Kim. 2002. Distribution of Aeromonas
spp. as identified by 16S rDNA restriction fragment length polymorphism analysis in a
trout farm. J. Appl. Microbiol. 93:976-985.
85. Leverentz, B., et al. 2001. Examination of bacteriophage as a biocontrol method for
Salmonella on fresh-cut fruit: A model study. J. Food Prot. 64:1116-1121.
86. Lillehaug, A., T. Lunder, and T. T. Poppe. 1992. Field testing of adjuvanted furunculosis
vaccines in Atlantic salmon, Salmo salar L. J. Fish Dis. 15:485-496.
87. Ljungberg, O., and N. Johansson. 1977. Epizootiological studies on atypical Aeromonas
salmonicida infections of Salmonids in Swedish fish farms, 1967-1977. Bull. Off. int.
Epiz. 87:475-478.
88. Magnadóttir, B., S. H. Bambir, B. K. Gudmundsdóttir, L. Pilström, and S. Helgason.
2002. Atypical Aeromonas salmonicida infection in naturally and experimentally
infected cod, Gadus morhua L. J. Fish Dis. 25:583-597.
89. Martin-Carnahan, A. and S. W. Joseph. 2005. Aeromonadaceae. In: Bergey's manual of
systematic bacteriology, 2nd Ed., Vol. 2. Springer. New York. USA.
90. Martinez-Murcia, A., et al. 2005. Phenotypic, genotypic, and phylogenetic
discrepancies to differentiate Aeromonas salmonicida from Aeromonas bestiarum. Int.
Microbiol. 8:259-269.
91. McCarthy, D. H. 1977. The identification and significance of atypical strains of
Aeromonas salmonicida. Bull. Off. int. Epiz. 87:459-463.
92. McCarthy, D. H., and R. J. Roberts. 1980. Furunculosis of fish - the present state of our
knowledge. In: Advances in aquatic microbiology. Academic Press, London.
93. McCraw, B. M. 1952. Furunculosis of fish. US Fish Wildl.Serv., Special scientific
report: Fisheries No 84:1-87.
94. Merril, C. R., D. Scholl, and S. L. Adhya. 2003. The prospect for bacteriophage therapy
in western medicine. Nat. Rev. Drug Discov. 2:489-497.
35
95. Michel, C., J. P. Gerald, B. Fourbet, R. Collas, and R. Chevalier. 1980. Emploi de la
fluméquine contre la furonculose des salmonidés : essais thérapeutiques et perspectives
pratiques. Bull. Fr. Piscic. 277:154-162.
96. Nakai, T., and S. C. Park. 2002. Bacteriophage therapy of infectious diseases in
aquaculture. Res. Microbiol. 153:13-18.
97. Nakai, T., et al. 1999. Protective effects of bacteriophage on experimental Lactococcus
garvieae infection in yellowtail. Dis. Aquat. Org. 37:33-41.
98. Nash, J., et al. 2006. Comparative genomics profiling of clinical isolates of Aeromonas
salmonicida using DNA microarrays. BMC Genomics 7:43.
99. Nawaz, M., K. Sung, S. A. Khan, A. A. Khan, and R. Steele. 2006. Biochemical and
molecular characterization of tetracycline-resistant Aeromonas veronii isolates from
catfish. Appl. Environ. Microbiol. 72:6461-6466.
100. Nielsen, B., I. Dalsgaard, D. J. Brown, and J. L. Larsen. 1994. Aeromonas salmonicida
subsp. salmonicida: correlation of protein patterns, antibiotic resistance, exoprotease
activity, haemolysis and pathological lesions produced in vivo. J. Fish Dis. 17:387-397.
101. Nolan, J., V. Petrov, C. Bertrand, H. Krisch, and J. Karam. 2006. Genetic diversity
among five T4-like bacteriophages. Virol. J. 3:30.
102. O'hIci, B., G. Olivier, and R. Powell. 2000. Genetic diversity of the fish pathogen
Aeromonas salmonicida demonstrated by random amplified polymorphic DNA and
pulsed-field gel electrophoresis analyses. Dis. Aquat. Org. 39:109-119.
103. Ojala, O. 1966. Isolation of an anaerogenic bacterium resembling Aeromonas
salmonicida in spawning lake trouts. Bull. Off. int. Epiz. 65:793-804.
104. Olivier, G. 1990. Virulence of Aeromonas salmonicida: Lack of relationship with
phenotypic characteristics. J. Aquat. Anim. Health 2:119-127.
105. Park, S. C., and T. Nakai. 2003. Bacteriophage control of Pseudomonas
plecoglossicida infection in ayu Plecoglossus altivelis. Dis. Aquat. Org. 53:33-39.
36
106. Park, S. C., I. Shimamura, M. Fukunaga, K. I. Mori, and T. Nakai. 2000. Isolation of
bacteriophages specific to a fish pathogen, Pseudomonas plecoglossicida, as a candidate
for disease control. Appl. Environ. Microbiol. 66:1416-1422.
107. Pasquale, V., S. Baloda, S. Dumontet, and K. Krovacek. 1994. An outbreak of
Aeromonas hydrophila infection in turtles (Pseudemis scripta). Appl. Environ.
Microbiol. 60:1678-1680.
108. Paterson, W. D., D. Douey, and D. Desautels. 1980. Isolation and identification of an
atypical Aeromonas salmonicida strain causing epizootic losses among Atlantic salmon
(Salmo salar) reared in a nova scotian hatchery. Can. J. Fish Aquat. Sci. 37:2236-2241.
109. Paterson, W. D., D. Douey, and D. Desautels. 1980. Relationships between selected
strains of typical and atypical Aeromonas salmonicida, Aeromonas hydrophila, and
Haemophilus piscium. Can. J. Microbiol. 26:588-598.
110. Paterson, W. D., R. J. Douglas, I. Grinyer, and L. A. McDermott. 1969. Isolation and
preliminary characterization of some Aeromonas salmonicida bacteriophages. J. Fish
Res. Can. 26:629-632.
111. Pavan, M., S. Abbott, J. Zorzopulos, and J. Janda. 2000. Aeromonas salmonicida subsp.
pectinolytica subsp. nov., a new pectinase-positive subspecies isolated from a heavily
polluted river. Int. J. Syst. Evol. Microbiol. 50:1119-1124.
112. Petrov, V. M., et al. 2006. Plasticity of the gene functions for DNA replication in the
T4-like phages. J. Mol. Biol. 361:46-68.
113. Petrov, V. M., S. Ratnayaka, and J. D. Karam. 2010. Genetic insertions and
diversification of the PolB-type DNA polymerase (gp43) of T4-related phages. J. Mol.
Biol. 395:457-474.
114. Piddock, L. J. 1999. Mechanisms of fluoroquinolone resistance: an update 1994-1998.
Drugs 2:11-18.
115. Popoff, M. 1971. Étude sur les Aeromonas salmonicida. II. Caractérisation des
37
bactériophages actifs sur les Aeromonas salmonicida et lysotypie. Ann. Rech. Vét. 2:33-
45.
116. Popoff, M. 1984. Genus III. Aeromonas. In: Bengey’s manual of systematic
bacteriology, Vol. 1. Williams and Wilkins, Baltimore, USA.
117. Reith, M., et al. 2008. The genome of Aeromonas salmonicida subsp. salmonicida
A449: insights into the evolution of a fish pathogen. BMC Genomics 9:427.
118. Rintamaki, P., and E. T. Valtonen. 1991. Aeromonas salmonicida in Finland:
pathological problems associated with atypical and typical strains. J. Fish Dis. 14:323-
331.
119. Rodgers, C. J., J. H. Pringle, D. H. Mccarthy, and B. Austin. 1981. Quantitative and
qualitative studies of Aeromonas salmonicida bacteriophage. J. Gen. Microbiol.
125:335-345.
120. Rose, A. S., A. E. Ellis, and A. L. S. Munro. 1989. The infectivity by different routes
of exposure and shedding rates of Aeromonas salmonicida subsp. salmonicida in
Atlantic salmon, Salmo salar L., held in sea water. J. Fish Dis. 12:573-578.
121. Salte, R., K. Norberg, J. A. Arnesen, O. R. ØDegaard, and G. Eggset. 1992. Serine
protease and glycerophospholipid: cholesterol acyltransferase of Aeromonas
salmonicida work in concert in thrombus formation; in vitro the process is counteracted
by plasma antithrombin and α2-macroglobulin. J. Fish Dis. 15:215-227.
122. Santavy, D., P. Willenz, and R. Colwell. 1990. Phenotypic study of bacteria associated
with the Caribbean sclerosponge, Ceratoporella nicholsoni. Appl. Environ. Microbiol.
56:1750-1762.
123. Schmidt, A. S., M. S. Bruun, I. Dalsgaard, and J. L. Larsen. 2001. Incidence,
distribution, and spread of tetracycline resistance determinants and integron-associated
antibiotic resistance genes among motile aeromonads from a fish farming environment.
Appl. Environ. Microbiol. 67:5675-5682.
38
124. Schwarz, H., I. Riede, I. Sonntag, and U. Henning. 1983. Degrees of relatedness of T-
even type E. coli phages using different or the same receptors and topology of
serologically cross-reacting sites. EMBO J. 2:375-380.
125. Shane, S., and D. Gifford. 1985. Prevalence and pathogenicity of Aeromonas
hydrophila. Avian Dis. 29:681-689.
126. Shao, Z. J. 2001. Aquaculture pharmaceuticals and biologicals: current perspectives
and future possibilities. Adv. Drug Deliv. Rev. 50:229-243.
127. Smith, I. W. 1963. The classification of "Bacterium salmonicida". J. Gen. Microbiol.
33:263-274.
128. Soler, L., et al. 2002. Potential virulence and antimicrobial susceptibility of
Aeromonas popoffii recovered from freshwater and seawater. FEMS Immunol. Med.
Microbiol. 32:243-247.
129. Soothill, J. S. 1992. Treatment of experimental infections of mice with bacteriophages.
J. Med. Microbiol. 37:258-261.
130. Stoffregen, D. A., A. J. Chako, S. Backman, and J. G. Babish. 1993. Successful therapy
of furunculosis in Atlantic salmon, Salmo salar L., using the fluoroquinolone
antimicrobial agent enrofloxacin. J. Fish Dis. 16:219-228.
131. Stuber, K., S. E. Burr, M. Braun, T. Wahli, and J. Frey. 2003. Type III secretion genes
in Aeromonas salmonicida subsp. salmonicida are located on a large thermolabile
virulence plasmid. J. Clin. Microbiol. 41:3854-3856.
132. Suttle, C. A. 2005. Viruses in the sea. Nature 437:356-361.
133. Svendsen, Y. S., R. A. Dalmo, and J. Bøgwald. 1999. Tissue localization of Aeromonas
salmonicida in Atlantic salmon, Salmo salar L., following experimental challenge. J.
Fish Dis. 22:125-131.
134. Tetart, F., et al. 2001. Phylogeny of the major head and tail genes of the wide-ranging
T4-type bacteriophages. J. Bacteriol. 183:358-366.
39
135. Toro, H., et al. 2005. Use of bacteriophages in combination with competitive exclusion
to reduce Salmonella from infected chickens. Avian Dis. 49:118-124.
136. Trust, T. J., E. E. Ishiguro, H. Chart, and W. W. Kay. 1983. Virulence properties of
Aeromonas salmonicida. J. World Aquac. Soc. 14:191-200.
137. Tsoumas, A., D. J. Alderman, and C. J. Rodgers. 1989. Aeromonas salmonicida:
development of resistance to 4-quinolone antimicrobials. J. Fish Dis. 12:493-507.
138. Verner-Jeffreys, D. W., et al. 2007. Furunculosis in Atlantic salmon (Salmo salar L.) is
not readily controllable by bacteriophage therapy. Aquaculture 270:475-484.
139. Vinod, M. G., et al. 2006. Isolation of Vibrio harveyi bacteriophage with a potential for
biocontrol of luminous vibriosis in hatchery environments. Aquaculture 255:117-124.
140. Vipond, R., et al. 1998. Defined deletion mutants demonstrate that the major secreted
toxins are not essential for the virulence of Aeromonas salmonicida. Infect. Immun.
66:1990-1998.
141. Wahli, T., et al. 2002. Proliferative kidney disease in Switzerland: current state of
knowledge. J. Fish Dis. 25:491-500.
142. Wang, Y., A. Brune, and M. Zimmer. 2007. Bacterial symbionts in the hepatopancreas
of isopods: diversity and environmental transmission. FEMS Microbiol. Ecol. 61:141-
152.
143. Wang, Z., et al. 2007. Carbohydrate analysis and serological classification of typical
and atypical isolates of Aeromonas salmonicida: a rationale for the lipopolysaccharide-
based classification of A. salmonicida. Fish Shellfish Immunol. 23:1095-1106.
144. Watanabe, R., et al. 2007. Efficacy of bacteriophage therapy against gut-derived sepsis
caused by Pseudomonas aeruginosa in mice. Antimicrob. Agents Chemother. 51:446-
452.
145. Wheeler, D. L., et al. 2000. Database resources of the National Center for
Biotechnology Information. Nucleic Acids Res. 28:10-14.
40
146. Wichardt, U. P., N. Johansson, and O. Ljungberg. 1989. Occurrence and distribution of
Aeromonas salmonicida infections on Swedish fish farms, 1951-1987. J. Aquat. Anim.
Health 1:187-196.
147. Wiebe, W. J., and J. Liston. 1968. Isolation and characterization of a marine
bacteriophage. Marine Biol. 1:244-249.
148. Wiklund, T., and I. Dalsgaard. 1998. Occurrence and significance of atypical
Aeromonas salmonicida in non-salmonid and salmonid fish species: a review. Dis.
Aquat. Org. 32:49-69.
149. Wills, Q. F., C. Kerrigan, and J. S. Soothill. 2005. Experimental bacteriophage
protection against Staphylococcus aureus abscesses in a rabbit model. Antimicrob.
Agents Chemother. 49:1220-1221.
150. Withey, S., E. Cartmell, L. M. Avery, and T. Stephenson. 2005. Bacteriophages-
potential for application in wastewater treatment processes. Sci. Total Environ. 339:1-18.
151. Wood, J. W. 1967. Salmon disease report. Wash. Dept. Fish. Ann. Rep. 77:111-112.
152. Young, R., I. N. Wang, and W. D. Roof. 2000. Phages will out: strategies of host cell
lysis. Trends. Microbiol. 8:120-128.
153. Yu, H., et al. 2004. A type III secretion system is required for Aeromonas hydrophila
AH-1 pathogenesis. Infect. Immun. 72:1248-1256.
41
Chapter I
Isolation and molecular characterization of
tetracycline- and quinolone-resistant Aeromonas
salmonicida strains from cultured fish in Korea
Abstract
The antibiotic resistance of 16 Aeromonas salmonicida strains which were
isolated from diseased fish and environmental samples in Korea from 2006 to 2009,
were evaluated in this study. Tetracycline and quinolone resistances were observed
in 8 and 16 of the isolates, respectively, based on the measurement of minimal
inhibitory concentrations (MICs). Among the tetracycline-resistant strains, seven of
the isolates harbored tetA and one isolate harbored tetE. Additionally, quinolone-
resistance determining regions (QRDRs) consisting of the gyrA and parC genes
were amplified and sequenced. Among the quinolone-resistant A. salmonicida
strains, 15 strains harbored point mutations in the gyrA codon 83, which were
responsible for the corresponding amino acid substitutions of Ser83→Arg83 or Ser83
→Asn83. We detected no point mutations in other QRDRs, such as gyrA codons 87
and 92, and parC codons 80 and 84. Genetic similarity was assessed via pulsed
field gel electrophoresis (PFGE), and the results indicated high clonality among the
Korean antibiotic-resistant strains of A. salmonicida subsp. salmonicida.
Keywords: Aeromonas salmonicida, antibiotic resistance, tetracycline, QRDR,
MIC, PFGE
42
1.1. Introduction
Aeromonas salmonicida is a pathogen that causes furunculosis and bacterial
septicemia in a broad variety of fish, and is thus responsible for significant
economic losses in the global aquaculture industry (35). Recently, antibiotic-
resistant A. salmonicida strains have been recognized as a serious concern, owing
to their potential health risks to humans and animals (31, 32). Among the
antibiotics utilized in the treatment of furunculosis, both tetracycline and quinolone
resistance have been widely documented (10, 30). Tetracycline-resistant strains of
A. salmonicida are suspected as the source of tet gene dissemination in the aquatic
environment because the tetracycline-resistant determinants are generally encoded
on plasmids (1, 31, 32). Quinolone resistance is a potential threat to public health,
since quinolones are also utilized for the treatment of Aeromonas infections in
humans (14, 15). Quinolone resistance in Gram-negative bacteria is primarily
attributable to mutations in the quinolone-resistance determining regions (QRDRs)
consisting of the gyrA and parC genes, which are the subunits of the target
enzymes of quinolones, DNA gyrase subunit A and topoisomerase IV, respectively
(2). The possession of qnr gene or efflux pumps was also known to be associated
with mid to low-level quinolone resistance (5, 29). Antibiotic resistance has been
previously reported in several bacteria isolated in Korean aqauculture, including
Edwardsiella tarda (16), Streptococcus iniae, and S. parauberis (28). However, the
antibiotic resistance of Aeromonas spp. has not previously been addressed.
Therefore, in this study we evaluated the antimicrobial susceptibility and clonal
relationship in A. salmonicida isolated in Korea, from both samples of cultured fish
and from the natural environment. In particular, the genetic determinants of
43
tetracycline and quinolone resistance were assessed via: (i) the detection of tetA to
tetE, (ii) the detection of plasmid-encoded qnr genes (5), and (iii) the analysis of
point mutations in QRDRs.
1.2. Materials and methods
1.2.1. Bacterial isolation and culture conditions
Sixteen strains of A. salmonicida were isolated from the kidney of various fish
samples and sewage water from two private aquariums and three salmonid culture
farms in Korea, between 2006 and 2009 (Table 1.1). Two reference strains were
purchased from the American type culture collection (ATCC): A. salmonicida
subsp. salmonicida ATCC 33658 (hereinafter referred as ASS) and A. salmonicida
subsp. masoucida ATCC 27013 (hereinafter referred as ASM). The A. salmonicida
isolates were first screened using a Vitek System®2 (bioMérieux®). All strains of A.
salmonicida were stored in tryptic soy broth (TSB; Difco) with 10% glycerol at -
80°C and sub-cultured for 48 h on tryptic soy agar (TSA; Difco) at 22°C. To assess
purity, single colonies were selected and sub-cultured three times, and the grown
bacterial cells were harvested for further experiments.
1.2.2. Antimicrobial susceptibility test
Antimicrobial susceptibility tests were conducted via broth micro-dilution
methods according to the guidelines of the Clinical and Laboratory Standards
Institute (CLSI) (7). ASS was utilized as a quality control bacterial strain (7).
Seven antimicrobials were diluted in flowing ranges: ampicillin (0.06 to 32 μg/ml),
enrofloxacin (0.002 to 4 μg/ml), florfenicol (0.12 to 64 μg/ml), gentamicin (0.06 to
44
32 μg/ml), oxolinic acid (0.004 to 8 μg/ml), oxytetracycline (0.03 to 16 μg/ml), and
trimethoprim-sulfamethoxazole (0.03/0.6 to 2/38 μg/ml). All antimicrobials were
purchased from Sigma-Aldrich. The antimicrobials were two-fold serially diluted
in cation-adjusted MHB (CAMHB; Difco) and volumes of 100 μl of dilutions were
placed into 96-well micro-titer plates. The inoculations were prepared as follows:
18 strains of A. salmonicida were adjusted to a McFarland value of 0.5 and were
diluted 10-fold with CAMHB. Via the addition of 5 μl of inocula into each of the
micro-titer wells, the final cell densities were adjusted to 5 × 105 CFU/ml. In all
cases, two control wells without antimicrobials or inocula were maintained. After
44 to 48 h of incubation at 22°C, the lowest concentration of antibiotics that visibly
inhibited bacterial growth was defined as the minimal inhibitory concentration
(MIC). The MIC results of A. salmonicida subsp salmonicida were used to classify
the strains as resistant or sensitive, in accordance with the cut-off values
established by Miller et al. (23) and the guidelines of M45-A (7) and M31-A3 (8).
1.2.3. DNA extraction and polymerase chain reactions (PCR)
The genomic DNA was extracted by harvesting the cells with sterile water
followed by 10 min of boiling. After 3 min of centrifugation at 10,000 × g, the
supernatants were collected and 1: 100 dilutions in sterile water were utilized as a
PCR template. All isolates were confirmed as A. salmonicida using Fer-3 and Fer-4
PCR primers (3). Subspecies were determined by A. salmonicida subsp.
salmonicida-specific PCR with MIY1 and MIY2 primers (4, 25) and also
submitted for 16S rRNA sequencing at Macrogen Inc. (Korea). Two multiplex PCR
procedures were conducted to amplify the tetracycline resistance genes (tetA to
45
tetE) (26) and to detect the plasmid-mediated quinolone-resistant determinant, qnr
(6). The QRDRs of the gyrA and parC genes were detected using the following
primers: ASGYRA1, ASGYRA2, ASPARC3, and ASPARC4 (10). The primers
used in this study were shown in Table 1.2.
1.2.4. Sequence analysis
Sequencing was conducted by Macrogen Inc. and the sequences were analyzed
with the AlignX tool in the Vector NTI program (Invitrogen). BLAST searches
were conducted using both the BLASTN and BLASTX algorithms provided by the
National Center for Biotechnology Information website (http//www.ncbi.
nlm.nih.gov).
1.2.5. Pulsed-field gel electrophoresis (PFGE)
Harvested bacterial cells were diluted with cell suspension buffer (100 mM
Tris-HCl, 100 mM EDTA, pH 8.0) up to an optical density (OD) of 1.0 at 600 nm.
A cell suspension volume of 100 μl was mixed with an equal volume of 1.6%
SeaKem Gold agar (FMC Corporation) and solidified in a 100 μl plug mould. The
plugs were then incubated for 2 h with 1mg/ml of lysozyme at 37°C and subjected
to 1 mg/ml of proteinase K at 50°C for 8 h. The DNA plugs were digested for 18 h
with 30 U of SpeI (New England Biolabs) at 37°C and electrophoresed in 1.0%
SeaKem Gold agarose gel with a CHEF-Mapper III PFGE (Bio-Rad) system. The
running conditions were 6 V/cm at 14°C for 22 h, and the pulse times were 1.5 to
25 s. The Lambda ladder PFG marker (New England Biolabs) was included as a
size marker. The gels were stained with ethidium bromide and photographed under
46
UV transillumination. The genetic relationships among isolates were analyzed with
Bionumerics software (Applied Maths) and the clusters were determined using the
Unweighted Pair Group Method with Arithmetic Mean (UPGMA) algorithm with
the 70% Dice coefficient (DC) of similarity (2.0% position tolerance).
1.3. Results
1.3.1. Bacterial identification
The 16 A. salmonicida strains and two reference strains were identified
successfully using a Vitek System®2 and PCR (3). Among the 16 isolates, 14
strains were PCR confirmed as A. salmonicida subsp. salmonicida (4, 24). The
other two strains were confirmed as A. salmonicida subsp. achromogenes (AS03)
and A. salmonicida subsp. flounderacida (AS16), as their 16S rRNA sequences
showed 100% homology with the 16S rRNA gene of A. salmonicida subsp.
achromogenes strain 870626-1/1C (GenBank accession No. AM296505.1) and A.
salmonicida subsp. flounderacida strain HQ010320-1 (GenBank accession No.
AY786177.1), respectively. All strains of A. salmonicida utilized in this study are
shown in Table 1.1.
1.3.2. MICs
The MIC values of the A. salmonicida isolates are shown in Table 1.3. ASS was
used to qualify the MIC quality control ranges approved by CLSI (8). Because cut-
off values had not been determined for all antibiotics, three references (7, 8, 22)
were used for interpretation, as was the case in other previous reports (2, 6, 27).
According to the epidemiological cut-off value for A. salmonicida to
47
oxytetracycline and oxolinic acid (23), eight oxytetracycline-resistant strains were
detected, and all of the isolates were oxolinic acid-resistant. Enrofloxacin
resistance, however, was noted in only one isolate (AS16), although enrofloxacin is
one of the quinolones, like oxolinic acid (8). Interestingly, ampicillin resistance
was detected only in three isolates (AS03, AS16, and ASM) although there have
been some reports showing that A. salmonicida is naturally resistant to narrow-
spectrum β-lactams (7). Only one isolate showed resistance to gentamicin, and all
strains were found to be susceptible to florenicol and trimithoprim-
sulfamethoxazole.
A total of nine multidrug-resistant (MDR) strains were observed: seven strains
(AS09 to AS15) that were resistant to oxytetracycline and oxolinic acid, one strain
(AS03) that was resistant to ampicilin and oxolinic acid, and one strain (AS16) that
was resistant to five antibiotics (ampicillin, gentamicin, oxytetracycline,
enrofloxacin, and oxolinic acid). Strain AS16 exhibited high-level resistance to
both enrofloxacin (≥4 μg/ml) and oxolinic acid (≥8 μg/ml) although other A.
salmonicida subsp. salmonicida strains were susceptible to enrofloxacin (≤0.03
μg/ml) and showed low-level oxolinic acid resistance (1~2 μg/ml).
1.3.3. Tetracycline resistance (tet) genes in A.salmonicida isolates
The tetA gene (211 bp) was detected in seven isolates (AS09 to AS15) and the
tetE gene (744 bp) was detected in strain AS16 (Figure 1.1). The amplified PCR
products were sequenced and aligned with the tet genes on GenBank. All amplifed
tetA genes showed 100% nucleotide sequence similarity with the tetA of pRAS1, a
drug resistance plasmid of A. salmonicida (GenBank accession No. AJ517790.2).
48
The tetE gene, which was detected in AS16, showed 100% nucleotide sequence
similarity with the tetE gene of A. salmonicida subsp. salmonicida A449 plasmid 4
(pAsa4; GenBank accession No. CP000645.1) and A. salmonicida plasmid
pYA90644 (GenBank accession No. DQ366299.1).
1.3.4. Quinolone resistance genes and codon mutations in the QRDRs of
A.salmonicida isolates
No isolate was found to possess the qnr gene, which is associated with the
plasmid-mediated transfer of quinolone resistance (5). However, QRDRs were
detected in all isolates except ASM via the amplification of gyrA (663 bp) and
parC (418 bp). The QRDR sequences and the putative amino acid counterparts
were aligned with the sequences of gyrA (GenBank accession No. L42453.1) and
parC (GenBank accession No. AF473701.1) of A. salmonicida ATCC 14174
(Table 1.3). Among the 16 oxolinic acid-resistant strains, 15 of the strains harbored
a point mutation on the gyrA codon 83 leading to Ser83→Arg83 (AS01 to AS15
except AS03) or Ser83→Asn83 (AS16) substitutions. Additionally, AS16 had a
single nucleotide mutation (AAA→AAG) at the parC codon 80 without an amino
acid substitution. No substitution was detected on the gyrA codon 87 (Asp87) and
92 (Leu92) and parC codon 80 (Lys80) and 84 (His84).
1.3.5. Strain typing by PFGE
All A. salmonicida strains utilized in this study were clustered into four groups
on the basis of the results of PFGE (Figure 1.2). ASM, AS03, and AS16 were
included in group A, B, and C, respectively. The other 14 A. salmonicida subsp.
49
salmonicida isolates and ASS were classified in the same cluster, which was
designated group D.
1.4. Discussion
Considering the widespread use of tetracycline and quinolones in the
aquaculture industry (12), we focused on the phenomenon of antimicrobial
resistance against those two antibiotics. In this study, tetracycline resistance in A.
salmonicida was strictly related to the presence of the tetA and tetE genes. Those
genes were also detected in other A. salmonicida strains from a variety of fish
species in other countries (23, 34). The nucleotide sequences of tetA and tetE genes
in this study showed 100% similarity to tetA on pRAS1and tetE on pAsa4. Because
the pRAS1 and pAsa4 plasmids can be transferred into or replicate within certain
strains of Escherichia coli (29, 33), it has been suspected that tetracycline
resistance has been disseminated between various bacterial species. Indeed,
recently a specimen of A. hydrophila isolated from Korea was found to harbor the
tetE of pAsa4 (Ji Hyung Kim, personal communication). The location and
transferability of the tetA and tetE genes in strains of A. salmonicida clearly
warrants further investigation.
Despite the high level of activity of quinolones against Aeromonas species (14,
16), a number of quinolone-resistant Aeromonas strains were reported (10, 32). The
acquisition of quinolone resistance appears to be attributable principally to
mutations of the QRDRs, particularly on gyrA codons 83, 87, and 92 and on parC
codons 80 and 84 (10, 11). Interestingly, the mutations on gyrA codon 83 that result
in Ser83→Ile83 and Ser83→Val83 substitutions have, thus far, been reported only in
50
strains of Aeromonas (2, 11, 26). In this study, 14 A. salmonicida subsp.
salmonicida strains harbored a point mutation on gyrA codon 83 leading to a Ser83
→Arg83 substitution, and showed low-level resistance to oxolinic acid. Additionally,
one strain of A. salmonicida subsp. flounderacida harbored a Ser83→Asn83
substitution and exhibited high-level resistance to both oxolinic acid and
enrofloxacin. On the basis of these results, amino acid substitutions on gyrA codon
83 may affect the level and spectrum of quinolone resistance in A. salmonicida.
However, AS03 strain which was identified as A. salmonicida subsp.
achromogenes showed low-level resistance to oxolinic acid without mutations or
amino acid substitutions on QRDRs. An important direction for further
investigation would involve determining if this strain is related with the efflux
pump that is generally responsible for low-level quinolone resistance (28).
The genetic similarity exhibited among A. salmonicida strains was consistent
with their subspecies. This genetic heterogeneity between typical and atypical A.
salmonicida strains has been commented on in previous reports (9, 13).
Interestingly, 14 A. salmonicida subsp. salmonicida strains isolated from Korea
were found to be discernable from ASS although they were included in the same
cluster; this suggests geographical differences in the distribution of A. salmonicida.
Additionally, the close relationship between the tetracycline-resistant and
susceptible strains appears to imply horizontal transfer of tet genes among isolates
of A. salmonicida subsp. salmonicida. On the other hand, other antimicrobial
resistance was in concord with PFGE groups or subspecies.
Thus far, only a few antibiotics are approved for use in the aquatic industry (17,
22), nevertheless, antibiotic resistance is expected to continue to become more
51
frequent (18, 19, 20, 21). The detection of MDR in Korean strains of A.
salmonicida suggests that antibiotic resistance in aquaculture can also pose a risk to
humans and animals. Thus, stricter guidelines for the use of tetracycline and
quinolones in aquaculture will be necessary to prevent the dissemination and
acquisition of antibiotic resistance.
1.5. References
1. Adams, C. A., B. Austin, P. G. Meaden, and D. McIntosh. 1998. Molecular
characterization of plasmid-mediated oxytetracycline resistance in Aeromonas
salmonicida. Appl. Environ. Microbiol. 64:4194-4201.
2. Alcaide, E., M. D. Blasco, and C. Esteve. 2010. Mechanisms of quinolone resistance in
Aeromonas species isolated from humans, water and eels. Res. Microbiol. 161:40-45.
3. Beaz-Hidalgo, R., G. E. Magi, S. Balboa, J. L. Barja, and J. L. Romalde. 2008.
Development of a PCR protocol for the detection of Aeromonas salmonicida in fish by
amplification of the fstA (ferric siderophore receptor) gene. Vet. Microbiol. 128:386-
394.
4. Byers, H. K., N. Gudkovs, and M. S. Crane. 2002. PCR-based assays for the fish
pathogen Aeromonas salmonicida. I. Evaluation of three PCR primer sets for detection
and identification. Dis. Aquat. Org. 49:129-138.
5. Cattoir, V., L. Poirel, C. Aubert, C. J. Soussy, and P. Nordmann. 2008. Unexpected
occurrence of plasmid-mediated quinolone resistance determinants in environmental
Aeromonas spp. Emerg. Infect. Dis. 14:231-237.
6. Cattoir, V., L. Poirel, V. Rotimi, C. J. Soussy, and P. Nordmann. 2007. Multiplex PCR
for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing
enterobacterial isolates. J. Antimicrob. Chemother. 60:394-397.
52
7. CLSI. 2006. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of
Infrequently Isolated or Fastidious Bacteria; Approved Guideline M45-A. Clinical and
Laboratory Standards Institute, Waune, PA, USA.
8. CLSI. 2008. Performance Standards for Antimicrobial Disk and Dilutin Susceptibility
Tests for Bacreria Isolated From Animals: Approved Standard—Third Edition M31-
A3. Clinical and Laboratory Standards Institute, Waune, PA, USA.
9. Garcia, J. A., J. L. Larsen, I. Dalsgaard, and K. Pedersen. 2000. Pulsed-field gel
electrophoresis analysis of Aeromonas salmonicida ssp. salmonicida. FEMS
Microbiol. Lett. 190:163-166.
10. Giraud, E., G. Blanc, A. Bouju-Albert, F. X. Weill, and C. Donnay-Moreno. 2004.
Mechanisms of quinolone resistance and clonal relationship among Aeromonas
salmonicida strains isolated from reared fish with furunculosis. J. Med. Microbiol.
53:895-901.
11. Goni-Urriza, M., et al. 2002. Type II topoisomerase quinolone resistance-determining
regions of Aeromonas caviae, A. hydrophila, and A. sobria complexes and mutations
associated with quinolone resistance. Antimicrob. Agents Chemother. 46:350-359.
12. Guerin-Faublee, V., M. L. Delignette-Muller, M. Vigneulle, and J. P. Flandrois. 1996.
Application of a modified disc diffusion technique to antimicrobial susceptibility
testing of Vibrio anguillarum and Aeromonas salmonicida clinical isolates. Vet.
Microbiol. 51:137-149.
13. Hänninen, M. L., and V. Hirvelä-Koski. 1997. Pulsed-field gel electrophoresis in the
study of mesophilic and psychrophilic Aeromonas spp. J. Appl. Microbiol. 83:493-498.
14. Janda, J. M., and S. L. Abbott. 1998. Evolving concepts regarding the genus
Aeromonas: an expanding panorama of species, disease presentations, and unanswered
questions. Clin. Infect. Dis. 27:332-344.
15. Jones, B. L., and M. H. Wilcox. 1995. Aeromonas infections and their treatment. J.
53
Antimicrob. Chemother. 35:453-461.
16. Jun, L. J., et al. 2004. Detection of tetracycline-resistance determinants by multiplex
polymerase chain reaction in Edwardsiella tarda isolated from fish farms in Korea.
Aquaculture 240:89-100.
17. Ko, W. C., et al. 2003. in vitro and in vivo activities of fluoroquinolones against
Aeromonas hydrophila. Antimicrob. Agents Chemother. 47:2217-2222.
18. Kwon, N. H., et al. 2006. Characteristics of methicillin resistant Staphylococcus
aureus isolated from chicken meat and hospitalized dogs in Korea and their
epidemiological relatedness. Vet. Microbiol. 117:304-312.
19. L'Abee-Lund, T. M., and H. Sorum. 2001. Class 1 integrons mediate antibiotic
resistance in the fish pathogen Aeromonas salmonicida worldwide. Microb. Drug
Resist. 7:263-272.
20. L'Abee-Lund, T. M., and H. Sorum. 2000. Functional Tn5393-like transposon in the R
plasmid pRAS2 from the fish pathogen Aeromonas salmonicida subspecies
salmonicida isolated in Norway. Appl. Environ. Microbiol. 66:5533-5535.
21. L'Abee-Lund, T. M., and H. Sorum. 2002. A global non-conjugative Tet C plasmid,
pRAS3, from Aeromonas salmonicida. Plasmid 47:172-181.
22. McIntosh, D., et al. 2008. Transferable, multiple antibiotic and mercury resistance in
Atlantic Canadian isolates of Aeromonas salmonicida subsp. salmonicida is associated
with carriage of an IncA/C plasmid similar to the Salmonella enterica plasmid
pSN254. J. Antimicrob. Chemother. 61:1221-1228.
23. Miller, R. A., and R. Reimschuessel. 2006. Epidemiologic cutoff values for
antimicrobial agents against Aeromonas salmonicida isolates determined by frequency
distributions of minimal inhibitory concentration and diameter of zone of inhibition
data. Am. J. Vet. Res. 67:1837-1843.
24. Miranda, C. D., C. Kehrenberg, C. Ulep, S. Schwarz, and M. C. Roberts. 2003.
54
Diversity of tetracycline resistance genes in bacteria from Chilean salmon farms.
Antimicrob. Agents Chemother. 47:883-888.
25. Miyata, M., V. Inglis, and T. Aoki. 1996. Rapid identification of Aeromonas
salmonicida subspecies salmonicida by the polymerase chain reaction. Aquaculture
141:13-24
26. Nawaz, M., K. Sung, S. A. Khan, A. A. Khan, and R. Steele. 2006. Biochemical and
molecular characterization of tetracycline-resistant Aeromonas veronii isolates from
catfish. Appl. Environ. Microbiol. 72:6461-6466.
27. Oppegaard, H., and H. Sorum. 1994. gyrA mutations in quinolone-resistant isolates of
the fish pathogen Aeromonas salmonicida. Antimicrob. Agents Chemother. 38:2460-
2464.
28. Park, Y. K., et al. 2009. Antibiotic susceptibility and resistance of Streptococcus iniae
and Streptococcus parauberis isolated from olive flounder (Paralichthys olivaceus).
Vet. Microbiol. 136:76-81.
29. Poole, K. 2000. Efflux-mediated resistance to fluoroquinolones in gram-negative
bacteria. Antimicrob. Agents Chemother. 44:2233-2241.
30. Reith, M. E., et al. 2008. The genome of Aeromonas salmonicida subsp. salmonicida
A449: insights into the evolution of a fish pathogen. BMC Genomics 9:427.
31. Rhodes, G., et al. 2000. Distribution of oxytetracycline resistance plasmids between
aeromonads in hospital and aquaculture environments: implication of Tn1721 in
dissemination of the tetracycline resistance determinant tet A. Appl. Environ.
Microbiol. 66:3883-3890.
32. Schmidt, A. S., M. S. Bruun, I. Dalsgaard, and J. L. Larsen. 2001. Incidence,
distribution, and spread of tetracycline resistance determinants and integron-
associated antibiotic resistance genes among motile aeromonads from a fish farming
environment. Appl. Environ. Microbiol. 67:5675-5682.
55
33. Sinha, S., S. Chattopadhyay, S. K. Bhattacharya, G. B. Nair, and T. Ramamurthy. 2004.
An unusually high level of quinolone resistance associated with type II topoisomerase
mutations in quinolone resistance-determining regions of Aeromonas caviae isolated
from diarrhoeal patients. Res. Microbiol. 155:827-829.
34. Sorum, H., T. M. L'Abee-Lund, A. Solberg, and A. Wold. 2003. Integron-containing
IncU R plasmids pRAS1 and pAr-32 from the fish pathogen Aeromonas salmonicida.
Antimicrob. Agents Chemother. 47:1285-1290.
35. Wiklund, T., and I. Dalsgaard. 1998. Occurrence and significance of atypical
Aeromonas salmonicida in non-salmonid and salmonid fish species: a review. Dis.
Aquat. Org. 32:49-69.
56
Table 1.1. Aeromonas salmonicida strains used in this study.
Name Source Year Bacterial identification
Vitek System®2 PCR (3) PCR (4) 16S rRNA sequence
AS01 Cherry salmon (Oncorhynchus masou masou) 2006 A.salmonicida + + subsp. salmonicida
AS02 Cherry salmon (Oncorhynchus masou masou) 2006 A.salmonicida + + subsp. salmonicida
AS03 Crucian carp (Carassius carassius) 2006 A.salmonicida + - subsp. achromogenes
AS04 Neon tetra (Paracheirodon innesi) 2007 A.salmonicida + + subsp. salmonicida
AS05 Rainbow trout (Oncorhynchus mykiss) 2008 A.salmonicida + + subsp. salmonicida
AS06 Rainbow trout (Oncorhynchus mykiss) 2008 A.salmonicida + + subsp. salmonicida
AS07 Rainbow trout (Oncorhynchus mykiss) 2008 A.salmonicida + + subsp. salmonicida
AS08 Rainbow trout (Oncorhynchus mykiss) 2008 A.salmonicida + + subsp. salmonicida
AS09† Chum salmon (Oncorhynchus keta) 2008 A.salmonicida + + subsp. salmonicida
AS10 Chum salmon (Oncorhynchus keta) 2008 A.salmonicida + + subsp. salmonicida
AS11 Chum salmon (Oncorhynchus keta) 2008 A.salmonicida + + subsp. salmonicida
AS12 Chum salmon (Oncorhynchus keta) 2009 A.salmonicida + + subsp. salmonicida
AS13 Malma trout (Salvelinus malma malma) 2009 A.salmonicida + + subsp. salmonicida
AS14 Malma trout (Salvelinus malma malma) 2009 A.salmonicida + + subsp. salmonicida
AS15 Cherry salmon (Oncorhynchus masou masou) 2009 A.salmonicida + + subsp. salmonicida
AS16 Sewage water 2007 A.salmonicida + - subsp. flounderacida
ASS ATCC 33658, Atlantic salmon (Salmo salar) - A.salmonicida + + subsp. salmonicida
ASM ATCC 27013, Masou salmon (Oncorhynchus masou) - A.salmonicida + - subsp. masoucida
57
Table 1.2. PCR primers used in this study.
Name Sequences (5’ to 3’) Target gene Reference
Fer-3 CGGTTTTGGCGCAGTGACG fstA (3)
Fer-4 AGGCGCTCGGGTTGGCTATCT
MIY1 AGCCTCCACGCGCTCACAGC Asal-3 (4, 25)
MIY2 AAGAGGCCCCATAGTGTGGG
tetAF GCTACATCCTGCTTGCCTTC tetA
(26)
tetAR GCATAGATCGCCGTGAAGAG
ClassB tetAF TCATTGCCGATACCACCTCAG tetB
ClassB tetAR CCAACCATCATGCTATTCCATCC
ClassC tetAF CTGCTCGCTTCGCTACTTG tetC
ClassC tetAR GCCTACAATCCATGCCAACC
ClassD tetAF TGTGCTGTGGATGTTGTATCTC tetD
ClassD tetAR CAGTGCCGTGCCAATCAG
ClassE tetAF ATGAACCGCACTGTGATGATG tetE
ClassE tetAR ACCGACCATTACGCCATCC
ASGYRA1 CCATGAGCGTGATCGTAGGA gyrA
(10) ASGYRA2 CTTTGGCACGCACATAGACG
ASPARC3 CAGCGGCGCATCATCTAC parC
ASPARC4 GGATATCGGTGGCCATGC
QnrAm-F AGAGGATTTCTCACGCCAGG qnrA1 to
qnrA6
(5)
QnrAm-R TGCCAGGCACAGATCTTGAC
QnrBm-F GGMATHGAAATTCGCCACTG qnrB1 to
qnrB6 QnrBm-R TTTGCYGYYCGCCAGTCGAA
QnrSm-F GCAAGTTCATTGAACAGGGT qnrS1 to
qnrS2 QnrSm-R TCTAAACCGTCGAGTTCGGCG
58
Table 1.3. Minimal inhibitory concentrations (MICs), tetracycline resistance (tet) genes, mutations in QRDRs in A. salmonicida strains.
Strains
MIC (μg/ml)
tet gene
gyrA QRDR* parC QRDR
AM‡ GM SXT FFC OTC ENR OA Codon
83 Aa83
Codon
87 Aa87
Codon
92 Aa92
Codon
80 Aa80
Codon
84 Aa84
AS01 2 4 0.12 1 0.5 0.008 2 (R) † - § AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS02 2 4 0.12 2 0.5 0.008 2 (R) - AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS03 32 (R) 2 0.06 1 0.06 0.004 2 (R) - AGT Ser GAC Asp TTG Leu AAA Lys CAC His
AS04 0.25 2 0.12 0.5 0.12 0.015 1 (R) - AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS05 0.12 4 0.12 2 1 0.004 2 (R) - AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS06 0.25 4 0.12 1 1 0.004 1 (R) - AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS07 0.25 2 0.12 1 1 0.008 2 (R) - AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS08 0.25 2 0.12 1 1 0.004 1 (R) - AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS09 0.12 4 0.12 2 >16 (R) 0.015 2 (R) tetA AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS10 0.12 2 0.12 1 >16 (R) 0.004 1 (R) tetA AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS11 0.12 2 0.12 1 >16 (R) 0.008 1 (R) tetA AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS12 0.12 2 0.12 1 >16 (R) 0.004 1 (R) tetA AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS13 0.12 1 0.12 1 >16 (R) 0.004 1 (R) tetA AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS14 2 4 0.12 2 >16 (R) 0.004 2 (R) tetA AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS15 4 4 0.12 2 >16 (R) 0.015 2 (R) tetA AGA Arg GAC Asp TTG Leu AAA Lys CAC His
AS16 32 (R) 32 (R) 0.12 2 >16 (R) >4 (R) >8 (R) tetE ATT Asn GAC Asp TTG Leu AAG Lys CAC His
ASS 0.12 0.25 0.03 1 0.12 0.004 0.008 - AGT Ser GAC Asp TTG Leu AAA Lys CAC His
ASM 32 (R) 0.5 0.12 1 0.12 0.03 0.015 - - - - - - - - - - -
* Nucleotide changes and corresponding amino acid substitutions are shown in bold.
† Resistance (R) was determined with MIC results according to Miller et al., (23) and CLSI guidelines (7, 8).
‡ Abbreviations; AM, ampicillin; GM, gentamicin; SXT, Trimethoprim-sulfamethoxazole; FFC, florfenicol; OTC, oxytetracycline; ENR, enrofloxacin; OA, oxolinic acid.
§ Not amplified.
59
Figure 1.1. Multiplex PCR assay of tetracycline resistance genes (tetA of 211 bp and tetE
of 744 bp) in two reference strains and 16 isolates of Aeromonas salmonicida. Lane M,
molecular mass marker; lane 1 to 18, strains AS01, AS02, AS03, AS04, AS05, AS06, AS07,
AS08, AS09, AS10, AS11, AS12, AS13, AS14, AS15, ASS, ASM and AS16, respectively.
Marker sizes (bp) are indicated.
60
Figure 1.2. PFGE profiles of 18 Aeromonas salmonicida strains and UPGMA dendrogram.
The vertical dotted line denotes a hypothetical node of 70% Dice coefficient of similarity.
61
Chapter II
Isolation, characterization and genomic analysis of
the two T4-like Aeromonas phages (phiAS4 and
phiAS5) infecting A. salmonicida subsp. salmonicida
as potential candidates for furunculosis control
Abstract
In this study, we report two Myoviridae bacteriophages (named as phiAS4 and
phiAS5) infecting Aeromonas salmonicida, isolated from environmental waters in
Korea. The two phages showed broad host ranges to other Aeromonadaceae as well
as A. salmonicida, and their biological properties were simultaneously investigated.
Furthermore, the complete genomes of phiAS4 and phiAS5 were sequenced, and
final assembly yielded linear double-stranded DNA genomes of 163,875 bp and
225,268 bp with G+C content of 41.3 and 43.0%, respectively. Genomic analysis
uncovered 271 and 343 putative ORFs, 67 and 69 putative promoters, 25 and 33
terminator regions, and 16 and 24 tRNA-encoding genes in phiAS4 and phiAS5,
respectively. A high degree of similarity to the Aeromonas phages 25 and Aeh1
were found in most ORFs of phiAS4 and phiAS5, respectively. The phages were
further compared with their relatives including enterobacter phage T4, and the
results demonstrated that they could be classified as new members of the T4-like
group. Moreover, the functional activity of the putative lysozyme murein hydrolase
(orf117) in phiAS5, which had no holin or holin-like gene, was investigated, and
the result revealed that it may use a dual lysis system during host cell lysis. Based
62
on these results, the isolated phages have the potential for controlling A.
salmonicida in aquaculture and may also advance our understanding of the
biodiversity of T4-like phages.
Keywords: Aeromonas salmonicida, bacteriophage phiAS4 and phiAS5, lysozyme
murein hydrolase, T4-like phages
63
2.1. Introduction
From the 20th century, bacteriophages (hereafter referred to as phages) have
received attention due to their potential as alternative antimicrobial agents for a
variety of bacterial pathogens (20, 25). Phages are not only highly diverse in their
species number (approximately 1031 different species in the biosphere), but also
contribute to bacterial diversity through horizontal transfer of virulence and drug-
resistance genes among host bacteria (35). Tailed phages are virtually ubiquitous
among the species examined to date, and Myoviridae, which have contractile tail,
are relatively well-characterized, especially enterobacter phage T4 and its relatives
(T4-like phages). The genetic compositions of several T4-like phages with the
common morphology of Myoviridae and relatively large double-stranded (ds) DNA
genome sizes (ca. 160~250 kb) have been described (24). The majority of
characterized T4-like phages infect Escherichia coli or other enterobacteria, but
some phages infect phylogenetically distant bacterial species such as Aeromonas,
Vibrio, and cyanobacteria (7), and those distant T4-like phages varied significantly
in virion morphology (13, 36).
Aeromonas salmonicida which belongs to the family Aeromonadaceae, is the
causative agent of the fish disease known as furunculosis and is one of the most
important pathogens of salmonid species in worldwide aquaculture (21, 40). The
emerging resistance of A. salmonicida to commercially used antibiotics such as
tetracycline and quinolones (21) has been of great concern, and several therapeutic
applications of phage against this fish pathogen have been attempted in recent
years (17, 38). Furthermore, a number of phages infecting Aeromonadaceae
(especially in A. salmonicida) have been isolated and characterized (2, 4, 6, 18, 19,
64
26, 29, 31), and most of them were classified into Myoviridae in the VIIIth ICTV
Report (http://www.ictvdb.org/Ictv/index.htm) as P1-, P2- and T4-like viruses (8).
Recent studies of Aeromonas phages have focused on virulent T4-like phages and
have included extensive genomic investigations (7, 22, 24, 27, 28, 36); the
complete genome sequences of four phages (Aeromonas phages 25, 31, 44RR2.8t
and Aeh1) have already been deposited in GenBank.
Here, we describe the basic biological properties and complete genome
sequences of two newly isolated T4-like virulent phages (named as Aeromonas
phage phiAS4 and Aeromonas phage phiAS5) that infect A. salmonicida and other
Aeromonadaceae. We also cloned and expressed the predicted lysozyme murein
hydrolase gene of phiAS5 to investigate its functional activity.
2.2. Materials and methods
2.2.1. Bacterial strains and growth conditions
Seventeen A. salmonicida strains of 3 different subspecies and 26 other bacterial
strains representing 12 different species were used in this study and are shown in
Table 2.1. All bacterial strains were cultured in tryptic soy broth (TSB) or sub-
cultured on tryptic soy agar (TSA) at 20°C for Aeromonas spp and at 37°C for
other bacterial species. All strains were stored at -80°C with 10% glycerol until
needed.
2.2.2. Isolation of phages infecting A. salmonicida subsp. salmonicida
To isolate phages infecting A. salmonicida subsp. salmonicida, various samples
were collected from the fish, sewage and pond water of the rainbow trout
65
(Oncorhynchus mykiss) culture farms and river waters in Korea. One of the
previously confirmed A. salmonicida subsp. salmonicida clinical isolates, AS01
(21), was used as the indicator host strain for phage isolations. The AS01 strain was
co-cultivated with collected samples for 36 h at 20°C and the culture was
centrifuged for 20 min at 10,000 × g. The resultant supernatant was filtered with a
0.45-μm membrane filter. This procedure, from co-cultivation to filtration, was
repeated twice to increase the phage titer. To examine whether the filtrate contained
virulent phages, a conventional double-layered agar method (3) was used with the
filtrate. Several types of phage plaques were respectively collected and inoculated
into TSB containing log-phase AS01 (OD600, 0.4~0.6), and co-cultivation was
performed at 20°C for 36 h. The successive single plaque isolations were
performed at least 3 times to obtain pure cultures that were titered by the double-
layered agar method.
2.2.3. Electron microscopy
Phage suspensions (phiAS4: 1.7 × 109 PFU/ml; phiAS5: 7.3 × 109 PFU/ml)
were concentrated and purified by CsCl density gradient ultra-centrifugation
(gradient-density: 1.15, 1.45, 1.50 and 1.70 g/ml; 250,000 × g; 22 h; 4°C) in SM
buffer (100 mM NaCl, 50 mM Tris [pH 7.5], and 10 mM MgSO4), and subjected to
transmission electron microscopy (TEM) for morphological analysis. The purified
phage samples were loaded onto a copper grid, negatively stained with 2% uranyl
acetate and dried. The morphology of phages was observed using a Zeiss TEM
EM902 (Zeiss) at an accelerating voltage of 80 kV. Phage sizes were calculated by
the means of at least 5 measurements.
66
2.2.4. Host range and efficiency of plating (EOP) analysis
The host ranges of the isolated phages were determined by dropping 10 μl of
diluted phage suspensions (phiAS4: 9.3 × 106 PFU/ml; phiAS5: 1.2 × 107 PFU/ml)
in double-layered agar plates inoculated with each of the 17 A. salmonicida strains
and the 26 bacterial strains including 2 motile Aeromonas sp., 3 Streptococcus sp.,
2 Enterococcus sp., 1 Listeria sp., 1 Staphylococcus sp. and 4 Vibrio sp. strains.
The plates were incubated at 20°C for all the Aeromonas strains and 37°C for the
other bacteria strains for 24 h, and checked for the presence or the absence of
plaque formation. For efficiency of plating (EOP) analysis, phage suspensions
(phiAS4: 1.3 × 104 PFU/ml; phiAS5: 1.5 × 104 PFU/ml) were assayed by the
double-layered agar method against each phage-susceptible bacterial strain. The
number of plaques was determined after 24 h incubation, and the EOP was
quantified by calculating the ratio of PFU obtained with each phage-susceptible
strain to PFU obtained with the indicator strain AS01. All tests were repeated three
times.
2.2.5. One step growth
Phage suspensions (phiAS4: 9.3 × 106 PFU/ml; phiAS5: 7.3 × 106 PFU/ml)
were added to cultures of early-exponential-phase host strain AS01 (OD600,
0.1~0.2) and absorbed for 5 min, then centrifuged at 10,000 × g for 30 s. After
supernatants were removed, the pellets containing phages-infected bacterial cells
were suspended in 20 ml of TSB and incubated at 20°C with shaking at 250 rpm.
Aliquots were taken at 10 min intervals for 90 min, and the titers in the aliquots
67
were immediately determined by the double-layered agar method. This assay was
performed in triplicate.
2.2.6. Thermal and pH stability
For thermo-stability tests, phage suspensions (phiAS4: 9.3 × 106 PFU/ml;
phiAS5: 1.2 × 107 PFU/ml) were incubated at 4°C, 20°C, 40°C or 55°C, and
aliquots were taken at 30 and 60 min. For pH stability tests, 100 μl of phage
suspensions (phiAS4: 9.3 × 106 PFU/ml; phiAS5: 1.2 × 107 PFU/ml) were
inoculated in a series of tubes containing 1 ml of TSB with at pH 3.0, pH 5.0, pH
7.0, pH 9.0 or pH 11.0 (adjusted with 1 M HCl or 1 M NaOH) and incubated at
20°C; aliquots were taken at 30 and 60 min. All of the tests were performed in
triplicate, and the phage titer was determined by the double-layered agar method.
2.2.7. Analysis of genomic nucleic acid and pulsed-field gel electrophoresis
(PFGE)
Preparation of phage genomic DNA was performed as previously described (34).
The purified nucleic acids of phages were digested with 10 U of DNase I, RNase A
or Mung bean nuclease (TaKaRa Biomedicals) according to the manufacturer’s
instructions. The PFGE of phage genomic DNA was performed as previously
described (37), with some modifications. Briefly, 500 μl of phage suspension was
mixed with 500 μl of 2% (w/v) NuSieve GTG agarose (FMC BioProducts),
dispensed into plug molds and solidified. The plugs were punched out of the molds
into a small volume of digestion buffer (500 mM EDTA, 10 mM Tris [pH 8.0], 1%
[w/v] SDS and 1 mg/ml of proteinase K) and incubated at 50°C overnight. The
68
digestion buffer was decanted, and the samples were washed three times with TE
buffer and then digested with 10 U of SacII, Sau3AI, MspI, XbaI, NotI, HindIII,
SmaI, SphI, NcoI, HpaII, SpeI and EcoRI (New England Biolabs) for 1 h at 37°C.
The plugs were then washed three times with TE buffer, placed in wells of 1.2%
Pulsed Field Certified agarose (Bio-Rad) in 0.5X TBE and overlaid with molten
0.5% NuSieve GTG agarose. The samples were electrophoresed using a CHEF-DR
III System (Bio-Rad) at 6 V/cm with pulse ramps from 5 to 15 s for 16 h at 14°C in
0.5X TBE buffer and compared to Low-Range PFG Marker and Mid-Range I PFG
Marker (New England Biolabs).
2.2.8. Sequencing and analysis of genomic DNA
Sequencing of phage genomic DNA was performed by Macrogen Inc. (Seoul,
Korea) using standard shotgun sequencing reagents and a 454 GS-FLX Titanium
Sequencing System (Roche). The full-length genome sequence was obtained by
sequence assembly using the SeqMan II sequence analysis software (DNASTAR)
and contig gaps were filled in by primer walking. The potential open reading
frames (ORFs) that possibly encode gene products were predicted using Microbial
Genome Annotation Tools (http://www.ncbi.nlm.nih.gov/genomes/MICROBES
/glimmer_3.cgi). We considered AUG, UUG and GUG as start codons, and UAA,
UGA, and UAG as stop codons of ORFs. The ORFs with a length of more than 25
amino acids were considered. The putative functions of the ORFs were analyzed by
BLASTP at the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). Putative promoter regions were
predicted using the Neural Network Promoter Prediction tool of the Berkeley
69
Drosophila Genome Project (minimum promoter score: 0.9)
(http://www.fruitfly.org/seq_tools/promoter.html). Rho-independent transcription
terminators were identified using FindTerm programs (http://www.softberry.ru
/berry.phtml?topic=findterm&group=programs&subgroup=gfindb) (energy thres-
hold value: -11). Additional characteristics of the putative protein products
(transmembrane domains, signal peptides, pI and molecular weights) were
predicted with proteomic tools at ExPASy (http://us.expasy.org). Putative tRNAs
were examined with the tRNAscan-SE search program (http://www.genetics.
wustl.edu/eddy/tRNAscan-SE/). Phage genome maps were drawn using the DNA
Master program (http://cobamide2.bio.pitt.edu/computer.htm). The genomes of
phiAS4 and phiAS5 were subjected to pair-wise analysis using the Artemis
Comparison Tool (ACT) (5) with T4 phage and its close homologs Aeromonas
phage 25 and Aeromonas phage Aeh1, respectively. The protein-sequences
similarities of the phages were analyzed using CoreGenes3.0 (http://binf.gmu.
edu:8080/CoreGenes3.0) (42).
2.2.9. Expression and purification of the recombinant protein phiASL5
The orf117 of phiAS5, which was predicted as lysozyme murein hydrolase
(phiASL5), was PCR-cloned into the pGEM-T easy vector (Promega) and sub-
cloned into the pET-21a (+) vector (Novagen). The PCR cloning was performed
with sense primer (5’- ATG CTT GCA CAA ATG CTA AAG -3’) and antisense
primer (5’- TCA AAA GCC ATA GGG AGC ATA -3’). For sub-cloning, a sense
primer containing the NdeI restriction site (5’- CAT ATG CTT GCA CAA ATG
CTA -3’) and an antisense primer containing the XhoI restriction site (5’- CTC
70
GAG AAA GCC ATA GGG AGC -3’) were used. After treatment of the PCR
product with NdeI and XhoI restriction enzymes, the product was cloned into the
NdeI and XhoI sites of the pET-21a (+) vector, thereby constructing the phiASL5
protein expression plasmid encoding a C-terminal 6X-histidine tag. The plasmid
was transformed into Escherichia coli BL21 (DE3) pLysS (Novagen), and the
resultant transformants were cultured in 1000 ml of Luria-Bertani (LB) medium
containing ampicillin and chloramphenicol (100 μg/ml each) at 37°C and 250 rpm.
Induction was performed with 1 mM isopropyl-β-d-thiogalactopyranoside at an
OD600 of 0.5–1.0, and cultures were further incubated for 8 h at 30°C and 250 rpm
to allow for expression of the phiASL5 protein. Following expression, the culture
was centrifuged at 10,000 × g for 15 min, and the resultant cell pellet was
resuspended in 25 ml of binding buffer (20 mM Tris–HCl, 500 mM NaCl, 5 mM
imidazole, pH 7.9). Cells were disrupted by sonication for 5 min (1 s pulse with 3 s
intervals between pulses). The whole-cell lysate was centrifuged at 18,500 × g for
15 min at 4°C. The supernatant was purified by affinity chromatography using a
Ni-NTA column (Qiagen). The column was pre-equilibrated with three column
volumes of binding buffer, and loaded with the supernatant. The column was then
washed with six additional column volumes of washing buffer (20 mM Tris–HCl,
500 mM NaCl, 80 mM imidazole, pH 7.9), and the recombinant protein was eluted
with six column volumes of elution buffer (20 mM Tris–HCl, 500 mM NaCl, 1 M
imidazole, pH 7.9). All elution fractions were collected, and the purity of the
protein preparation was assessed by SDS polyacrylamide gel electrophoresis (SDS-
PAGE). The lysate of uninduced cells was also purified under the same conditions
for use as a negative control in the following activity tests.
71
2.2.10. Zymogram assay of the recombinant protein phiASL5
The mureinolytic activity of the purified recombinant protein was examined by
a zymogram assay using autoclaved Staphylococcus aureus SA1 cells according to
the previously described method (33). Briefly, the solution containing phiASL5
was separated on a 10% (w/v) SDS-PAGE gel containing 0.2% (w/v) autoclaved
SA1 cells. After electrophoresis, the zymogram gel was washed for 30 min with
distilled water at room temperature, then transferred into buffer containing 25 mM
Tris-HCl (pH 7.5) and 0.1% (v/v) Triton X-100, and further incubated for 16 h at
37°C. The zymogram gel was rinsed with distilled water, stained with 0.1% (w/v)
methylene blue in 0.001% (w/v) KOH for 2 h at room temperature, and then
destained with distilled water. The elution fraction prepared from an uninduced
culture was used as a negative control.
2.2.11. Nucleotide sequence accession numbers
Nucleotide sequence data for the phages phiAS4 and phiAS5 were deposited in
the GenBank database under accession numbers HM452125 (NC_014635) and
HM452126 (NC_014636), respectively. All the other phage genomic DNA
sequences are available in GenBank: Aeromonas phage 25 [NC_008208],
Aeromonas phage 44RR2.8t [NC_005135], Aeromonas phage 31 [NC_007022],
Aeromonas phage Aeh1 [NC_005260], Vibrio phage KVP40 [NC_005083],
enterobacteria phage T6 [AY262134], enterobacteria phage IME08 [NC_014260]
and enterobacteria phage T4 [NC_000866].
72
2.3. Results
2.3.1. Isolation and electron microscopy of phages phiAS4 and phiAS5
Two phages infecting A. salmonicida strain AS01 were isolated from river water
samples and successfully propagated; the phages formed different plaque sizes
(approximately 2.0 mm and 0.5 mm for phiAS4 and phiAS5, respectively) on
AS01 lawns after 36 h incubation at 20°C. The isolated phages were named
phiAS4 and phiAS5, and classified by transmission electron microscopic analysis
according to the classification of Ackermann (1). Phage phiAS4 was
morphologically assigned to the order Caudovirales and family Myoviridae
morphotype A2 (icosahedral head and contractile sheathed tails); the tail length and
width were 108 ± 16 nm (n=5) and 17 ± 3 nm (n = 5), and the head length and
diameter were 70 ± 12 nm (n = 5) and 49 ± 6 nm (n = 5) (Figure 2.1A). Phage
phiAS5 was also classified into the order Caudovirales and family Myoviridae
morphotype A2 but displayed different virion morphology compared to phiAS4;
the tail length and width were 98 ± 7 nm (n = 5) and 22 ± 2 nm (n = 5), and the
head length and diameter were 121 ± 4 nm (n = 5) and 71 ± 4 nm (n = 5) (Figure
2.1B).
2.3.2. Host ranges and EOPs of phiAS4 and phiAS5
The host ranges of phiAS4 and phiAS5 were tested on various Aeromonas spp.:
A. salmonicida; subsp. salmonicida (n=15), subsp. achromogenes (n=1), and subsp.
masoucida (n=1); A. hydrophila (n=14); and A. sobria (n=2). Phage phiAS4 was
able to infect all the A. salmonicida subsp. salmonicida strains including subsp.
masoucida and achromogenes, whereas phiAS5 did not infect subsp.
73
achromogenes. The variable EOPs and production of turbid plaques (phiAS4:
AS05, 06, 07, 08, 10 and 12; phiAS5: AS05, 06, 07, 08 and 10) against 17 A.
salmonicida strains indicate that phiAS4 and phiAS5 have different infection
characteristics, respectively. Interestingly, phiAS4 and phiAS5 displayed broad
host ranges, infecting motile Aeromonas species including A. hydrophila and A.
sobria with forming turbid plaques and relatively lower EOPs than with A.
salmonicida (Table 2.1). However, the phages were not able to lyse the 10 other
bacterial species used in this study.
2.3.3. One step growth and thermal/pH stability of phiAS4 and phiAS5
One step growth curves of the phage isolates were examined to identify the
growth pattern of each phages and the number of progeny phages released by the
lysis of a single bacterial strain. Approximately 87.4% of phiAS4 and 58.8% of
phiAS5 virions adsorbed to AS01 cells within 5min. The latent periods of phiAS4
and phiAS5 were estimated to be approximately 30 and 20 min with average burst
sizes of approximately 395.8 and 68.1 PFU/cell, respectively (Figure 2.2). The
stability of phiAS4 and phiAS5 was assessed by calculating PFU changes under
different pH and temperature conditions. Almost no reduction of PFUs was
observed after 1 h of incubation at pH 7.0, 9.0 or 11.0, but significant reductions
were found at low pH. Phage phiAS4 was stable at pH 5.0 but showed 100%
reduction after 1 h at pH 3.0, while phiAS5 was as extremely unstable at pH 5.0 as
phiAS4 was at pH 3.0. These results suggested that low-pH conditions might affect
the stability of phiAS4 and phiAS5. In thermal stability tests, phiAS4 and phiAS5
were stable for at least 1 h at 4, 20 and 40°C but were not stable at 55°C (data not
74
shown).
2.3.4. Genomic analysis of phiAS4 and phiAS5
Phages belonging to the family Myoviridae usually possess dsDNA as its
genome (1). In this study, the genomes of phiAS4 and phiAS5 were digested by
DNase I but not by RNase A or Mung Bean Nuclease, thus indicating that its
genomes were consisted of dsDNA. In addition, PFGE results revealed that the
genomes of phiAS4 and phiAS5 could be digested with several restriction
endonucleases (phiAS4: SacII, MspI, XbaI and NotI; phiAS5: Sau3AI, XbaI,
HindIII and EcoRI) and that their genome sizes were approximately 160 kb and
220 kb, respectively (data not shown).
Genome sequencing determined that the complete genome of phiAS4 was
163,875 bp with total G+C content of 41.3%. In additions, a total of 67 promoters,
25 terminator regions and 271 ORFs were predicted in its genome (Figure 2.3).
Based on the similarity of nucleotide and amino acid sequences of predicted ORFs,
the closest relative of phiAS4 in the GenBank database was identified as
Aeromonas phage 25. However, the gene arrangement in phiAS4 genome was
differed from Aeromonas phage 25. The similarity of the complete genomic
sequence of phage phiAS4 with Aeromonas phage 25 was approximately 95.0%,
and the ORFs of phiAS4 were mainly comprised homologs of Aeromonas phage 25
ORFs (239 ORFs with amino acid identity ranging from 41 to 100%). Moreover,
23 and 5 phiAS4 ORFs were derived from Aeromonas phage 44RR2.8t and
Aeromonas phage 31, respectively. Three phiAS4 ORFs (orf89, orf188 and orf231)
showed no homology to known phage- or bacteria-related sequences in the
75
GenBank database. Concrete gene information, such as positions, directions, sizes,
molecular weights and putative functions of each phiAS4 ORFs is shown in Table
2.2. The ORFs of phiAS4 genome were not clustered together by functional roles
such as DNA metabolism or phage structure. However, the predicted ORFs of
phage DNA metabolism-related genes were categorized into five groups as follows:
i) DNA replication, recombination and repair, orf4, orf21, orf45, orf46, orf48,
orf49, orf50, orf51, orf75, orf93, orf169, orf171, orf232, orf233, orf234, orf237,
orf238, orf239, orf241, orf243, orf244, orf247, orf250, orf251, orf252, orf260 and
orf262; ii) phage genome modification and restriction or host DNA breakdown,
orf60 and orf68; iii) nucleotide biosynthesis and metabolism, orf56, orf57, orf58,
orf143, orf181, orf214, orf215, orf216, orf222, orf245 and orf256; iv) control of
host RNA polymerase transcription, orf34, orf47, orf61, orf62, orf78, orf79, orf230,
orf236 and orf240; v) genome packaging, orf116, orf117 and orf213. Most ORFs
encoding DNA metabolism-associated genes were highly homologous with
Aeromonas phage 25, thus indicating that phage phiAS4 might use a similar DNA
metabolism system. The predicted ORFs of phage structural genes were widely
scattered across the entire genome. The ORFs encoding phage structural genes and
their functions in the phiAS4 genome are summarized as follows: i) head
morphogenesis, orf94, orf95, orf102, orf105, orf106, orf107, orf108, orf109, orf110,
orf111, orf119, orf120, orf121, orf122, orf123, orf139 and orf 246; ii) tail and
baseplate morphogenesis, orf40, orf41, orf42, orf43, orf44, orf80, orf81, orf82,
orf83, orf84, orf85, orf86, orf87, orf88, orf112, orf113, orf114, orf115, orf118,
orf124, orf125, orf126, orf127, orf128, orf129, orf130, orf131, orf133, orf134,
orf136 and orf142. Furthermore, a total of 16 tRNA genes (including one pseudo-
76
gene) were identified, including a cluster of two genes containing Ser and Met
anticodon sequences and lone tRNA genes with anticodons for Leu, Asn, Tyr, Lys,
Pro, Thr, Trp, Ile, Asp and Arg.
The genome size of phiAS5 was 225,268 bp, with 43.0% total G+C content. A total
of 69 promoters, 33 terminator regions and 343 ORFs were predicted in phiAS5
(Figure 2.4). Based on the genome similarity analysis, phage phiAS5 showed
approximately 79.1% nucleotide sequence similarity to Aeromonas phage Aeh1
and predominantly comprised homologous ORFs (309 ORFs with amino acid
identity ranging from 26 to 95%). However, several ORFs were most similar to
ORFs in other phages: two in Vibrio phage KVP40 and one each in enterobacteria
phage T6, enterobacteria phage IME08, Aeromonas phage 44RR2.8t and
Aeromonas phage 31. Eleven phiAS5 ORFs showed no homology to any reported
phage- or bacteria-related sequences in the GenBank database. Concrete gene
information such as positions, directions, sizes, molecular weights and putative
functions of each phiAS5 ORFs are shown in Table 2.3. ORFs fulfilling similar
functions were broadly dispersed across the phiAS5 genome, as in phiAS4. We
sorted the phiAS5 ORFs largely into two functional categories, nucleotide
metabolism and phage structural proteins, as described above. The predicted phage
DNA metabolism-related genes of phage phiAS5 were further categorized into five
groups: i) DNA replication, recombination and repair, orf34, orf37, orf40, orf43,
orf46, orf106, orf107, orf109, orf110, orf132, orf137, orf139, orf141, orf143,
orf144, orf146, orf147, orf148, orf151 and orf152; ii) phage genome modification
and restriction or host DNA breakdown, orf98; iii) nucleotide biosynthesis and
metabolism, orf99, orf101, orf105, orf163, orf164, orf166, orf167, orf171, orf172
77
and orf322; iv) control of host RNA polymerase transcription, orf45, orf108, orf119,
orf124, orf145, orf159 and orf291; v) genome packaging, orf10, orf11 and orf176.
Because most of the phage DNA metabolism-related genes were homologous to
those of Aeromonas phage Aeh1, we considered that phage phiAS5 might use a
similar phage DNA metabolism system. ORFs encoding the phage structural genes
of phiAS5 were located at the middle and both ends of the genome, and their
functions are summarized as follows: i) head morphogenesis, orf14, orf16, orf17,
orf18, orf19, orf20 and orf329; ii) tail and baseplate morphogenesis, orf1, orf6,
orf7, orf9, orf12, orf13, orf111, orf112, orf113, orf115, orf323, orf326, orf327,
orf330, orf331, orf333, orf336, orf337, orf338, orf339, orf340, orf341, orf342 and
orf343. Twenty-four tRNA genes (including one pseudo-gene and one unknown
isotype-gene) were also identified, including a cluster of three genes containing
Leu, Phe and Met anticodon sequences and lone tRNA genes with anticodons for
Ala, Gly, Pro, Thr, Arg, Asn, Lys, Asp, Glu, His, Gln, Ile, Cys and Trp. Among the
tRNA genes, the presence of an intron was predicted in the tRNAs with anticodons
for Phe (nucleotide positions 181,036-181,153) and Glu (nucleotide positions
193,784-193,877).
Genomic comparison of phage phiAS4 with the related Aeromonas phage 25
and enterobacter phage T4 revealed that the phages were considerably similar in
gene inventory (Figure 2.5A). However, the genome of phiAS4 differed in two
aspects. First, two remarkable regions of genome inversions (orf4~orf11,
orf12~orf271) were found in phiAS4 with a symmetrical gene order relative to
Aeromonas phage 25 (similar inversions were also found when the phiAS4 genome
was compared to the genome of enterobacter phage T4). Second, there were several
78
genes scattered throughout the genome of each phage that have no apparent
homologs in the other phages. We were able to find homologs for a considerable
number of inventoried genes among phage phiAS5, Aeromonas phage Aeh1 and
enterobacter phage T4 (Figure 2.5B). However, the genomes showed differences in
gene order, and several genes had no apparent homologs in the other phages. Based
on the ACT comparison result, the genome of phiAS5 can be divided into two
portions (orf1~orf128 and orf129~orf343) that are reserved (a large-scale genome
translocation) relative to the order of Aeromonas phage Aeh1. The genome division
of phiAS5 occurred between orf128 and orf129, which are predicted as membrane
integrity protectors; and the homologs of orf128 and orf129 in phiAS5 are found at
each ends of the Aeromonas phage Aeh1 genome.
2.3.4. Functional characterization of lysozyme murein hydrolase of phiAS5
Similar to other phages of the order Caudovirales, phiAS4 encoded a dual lysis
system as previously described (41). The putative proteins ORF36 and ORF37
were predicted as holin (similar to Phage_holin_T [pfam11031]) and e lysozyme
(similar to lysozyme_like superfamily [cl00222]), respectively, and displayed high
amino acid sequence similarity to enterobacter phage T4 by coregene analysis
(Figure 2.3). In addition, the predicted holin protein contained only one
transmembrane region (amino acids, 35-54). However, in phiAS5, neither holin nor
a holin-like protein was detected by BLASTP search and coregene analysis, and
lysozyme murein hydrolase, which was similar to phage_T4-like_lysozyme
[cd00735], was found solely in orf117 (Figure 2.4). These findings were also
concordant with the genome of Aeromonas phage Aeh1, which encoded no
79
predicted holin or holin-like protein in it. Thus, to investigate the functional
activity of the orf117 gene product, it was expressed in E.coli BL21 (DE3) pLysS,
and designated as phiASL5. The recombinant phiASL5 protein, which was
successfully expressed in this E. coli-based expression system and purified by
affinity chromatography, showed a molecular weight of approximately 18 kDa
according to SDS-PAGE (Figure 2.6A). However, phiASL5 was mainly expressed
as inclusion bodies at 37°C, and low-temperature (30°C) culture was required for
soluble expression. Purified phiASL5 did not show lytic activity or growth
inhibition against A. salmonicida or the other bacterial species used in this study,
and only weak cell lysis was observed against S. aureus strain SA1 (data not
shown). Therefore, the mureinolytic activity of the purified phiASL5 protein was
confirmed by a zymogram assay showing hydrolysis of S. aureus SA1
peptidoglycan (Figure 2.6B).
2.4. Discussion
According to Ackermann (1), 43 phages infecting Aeromonadaceae have been
reported, all of which were morphologically classified as tailed phages (33 of
Myoviridae, 7 of Siphoviridae and 3 of Podoviridae). Some of these phages (such
as phage Aeh1, phage 25, phage 31 and phage 44RR2.8t) were further investigated
genetically (7, 22, 24, 27, 28, 36), and some others (such as HER10, phage O, R
and B) have been used as therapeutic agents in aquaculture (17, 38). Furthermore,
the potential phylogenetic relationship between Aeromonas phages and
enterobacteria phages (especially phage T4) were firstly suggested by their
morphological similarity (2), and later confirmed by genomic comparison (7, 24,
80
27, 28).
In this study, phages phiAS4 and phiAS5, which belong to Myoviridae, were
isolated from river water in Korea. These two phages showed differences in several
biological properties, such as morphology, host range, plaque size and burst size.
Although the host strain for phage isolation was A. salmonicida subsp. salmonicida,
the phages displayed broad host ranges extending to other Aeromonadaceae strains,
such as A. hydrophila and A. sobria, and to other subspecies of A. salmonicida,
such as subsp. masoucida and subsp. achromogenes. The broad host range of
aeromonoas phages was also previously reported (2). Based on these results, it may
be assumed that several Aeromonas phages, including phiAS4 and phiAS5, might
use common outer membrane protein or lipopolysaccharide in Aeromonadaceae as
receptor during its adsorption to host cells. Remarkably, phiAS4 and phiAS5 were
able to infect tmulti-drug resistant A. salmonicida subsp. salmonicida strains such
as AS09, AS10, AS11, AS12, AS13, AS14 and AS15 (Table 2.1), and showed clear
host cell lysis. To date, antibiotic-resistant A. salmonicida causes critical problems
in worldwide aquaculture (21, 30, 32). Thus, phages with broad infectivity against
antibiotic-resistant A. salmonicida strains may be adapted for control of
furunculosis in aquaculture, and animal experiments are currently in preparation.
According to genomic analysis, phiAS4 and phiAS5 showed very similar
genotypes to other T4-like Aeromonas phages that had been isolated at different
times and from different geographical regions such as Aeromonas phages 25 and 31
(isolated in France), 44RR2.8t (isolated in Canada) and Aeh1 (isolated in the USA).
The genomes of phiAS4 and phiAS5 were very similar to Aeromonas phage 25 and
Aeromonas phage Aeh1, respectively, at the nucleotide sequence level, but their
81
specific differences in gene inventory, gene order and the presence of several
unpredicted hypothetical proteins clearly indicated that they were distinct from
previously discovered phages. In phage phiAS4, the ORFs mainly comprised those
of phage 25 but with a dramatically inverted genome (Figure 2.5A), and several
ORFs were very similar to phage 31 and 44RR2.8t, showing mosaicism in its
genome. Phage phiAS4 was isolated in Korea, a geographical region distinctly
different from France and Canada. Thus, it may be assumed that Aeromonas phages
with similar gene inventories are distributed worldwide and may transfer genes
horizontally among phages. On the other hand, the genome of phage phiAS5
predominantly comprised ORFs of Aeromonas phage Aeh1 but showed genome
division and rearrangement (Figure 2.5B), and several ORFs had predicted origins
in phages infecting other distant bacterial species, such as Vibrio and enterobacteria
phages as well as Aeromonas phage 31. Interestingly, a probable mobE homolog of
Aeromonas phage Aeh1, which belong to HNH homing endonuclease, was located
in the intercistronic region of a split form of the nrdA gene (9-11), whereas the
freestanding mobE (orf136) of phiAS5 was found between other phage DNA
metabolic genes apart from nrd genes. Moreover, the mobE and nrdA genes of
phiAS5 did not show high homology to those of Aeromonas phage Aeh1 (amino
acid identity of 43 and 88%, respectively). This observation indicates that the
location and functions of mobE may differ between closely related T4-like
Aeromonas phages.
It is unknown why the genomes of phiAS4 and phiAS5 would be arranged with
inverted gene position or translocation as described above. However, it is clear that
these phages with such genome arrangements are fully functional, as they survived
82
to be detected and sequenced in our analysis. Previous theories of phage evolution
have suggested that evolution by illegitimate recombination usually occurs by
recombination events that will not interrupt the individual modules (14, 15), as was
reported for Burkholderia phage KS10 (12), cyanophage Syn9 (39), and
Pseudomonas aeruginosa phage EL (16). Additionally, 109 and 94 putative ORFs
in phiAS4 and phiAS5 were predicted as coregenes with similar to enterobacter
phage T4 and their relatives, Aeromonas phage 25 and Aeromonas phage Aeh1,
respectively (Figure 2.3 and 2.4). As we expected, nearly all the predicted
coregenes were associated with phage DNA metabolisms or were structural genes.
Consistent with the similarity of their genome inventories to enterobacter phage T4,
phage phiAS4 and phiAS5 contained three sets of T4-like fibrous structures with
distinct functions. Phage phiAS4 contained long tail fiber (orf44), short tail fiber
(orf124) and whiskers (orf123) genes, whereas phiAS5 contained wac fibritin neck
whiskers (orf1), long tail fiber (orf111 and orf112) and short tail fiber (orf343)
genes. The presence of these three structural genes clearly indicated that the two
phages were closely related to enterobacter phage T4 (23), in accordance with their
morphological analysis in this study. These findings suggest that phages phiAS4
and phiAS5 are strongly related to enterobacter phage T4 by genetic as well as
morphological characteristics and might use similar phage DNA metabolism and
morphogenesis systems.
To investigate the functional activity of lysozyme murein hydrolase in phiAS5, a
recombinant plasmid harboring orf117 was constructed by conventional cloning
methods and expressed using an E. coli-based expression system. When
recombinant phiASL5 was expressed in E. coli BL21 (DE3) pLysS, reductions of
83
cell growth (OD600) or cell lysis were not observed during cultivation. These results
indicated that the expressed phiASL5 was unable to permeabilize the outer
membrane of E. coli and therefore could not lyse the cells by itself. When aliquots
of purified phiASL5 were directly dropped on bacterial lawn-forming plates, it was
not able to lyse or to inhibit the growth of any of the gram-negative bacterial
strains used in this study or A. salmonicida strain AS01, and only slight, weak cell
lysis was observed against S. aureus strain SA1 (data not shown). Thus, the
mureinolytic activity of phiASL5 was confirmed by a zymogram using S. aureus
SA1 peptidoglycan. These results indicated that the outer membrane of gram-
negative bacteria prevents access of phiASL5 to the peptidoglycan layer, and phage
phiAS5 may also use a dual lysis system as previously described (41). However, it
is clear that any holin or holin-like proteins in phiAS5 (or in Aeromonas phage
Aeh1) are not homologous to those of enterobacter phage T4 or other T4-like
Aeromonas phages. Further studies are currently in preparation to investigate the
lytic mechanisms of phage phiAS5 and Aeromonas phage Aeh1 for potential
applications as bio-control agents.
2.5. References
1. Ackermann, H. W. 2007. 5500 Phages examined in the electron microscope. Arch.
Virol. 152:227-243.
2. Ackermann, H. W., et al. 1985. Aeromonas bacteriophages: Reexamination and
classification. Ann. Inst. Pasteur Virol. 136:175-199.
3. Adams, M. H. 1959. Bacteriophages. Interscience Publishers, New York.
4. Beilstein, F., and B. Dreiseikelmann. 2008. Temperate bacteriophage øO18P from an
84
Aeromonas media isolate: Characterization and complete genome sequence. Virology
373:25-29.
5. Carver, T., K. et al. 2005. ACT: the artemis comparison tool. Bioinformatics 21:3422-
3423.
6. Chow, M. S., and M. A. Rouf. 1983. Isolation and partial characterization of two
Aeromonas hydrophila bacteriophages. Appl. Environ. Microbiol. 45:1670-1676.
7. Comeau, A. M., C. Bertrand, A. Letarov, F. Tetart, and H. M. Krisch. 2007. Modular
architecture of the T4 phage superfamily: a conserved core genome and a plastic
periphery. Virology 362:384-396.
8. Fauquet, C., M. Mayo, J. Maniloff, U. Desselberger, and A. Ball. 2005. Virus taxonomy.
VIIIth report of the international committee on taxonomy of viruses:35-85.
9. Friedrich, N. C., et al. 2007. Insertion of a homing endonuclease creates a genes-in-
pieces ribonucleotide reductase that retains function. Proc. Natl. Acad. Sci. U. S. A.
104:6176-6181.
10. Gibb, E. A., and D. R. Edgell. 2007. Multiple controls regulate the expression of
mobE, an HNH homing endonuclease gene embedded within a ribonucleotide
reductase gene of phage Aeh1. J. Bacteriol. 189:4648-4661.
11. Gibb, E. A., and D. R. Edgell. 2009. An RNA hairpin sequesters the ribosome binding
site of the homing endonuclease mobE gene. J. Bacteriol. 191:2409-2413.
12. Goudie, A., et al. 2008. Genomic sequence and activity of KS10, a transposable phage
of the Burkholderia cepacia complex. BMC Genomics 9:615.
13. Hambly, E., et al. 2001. A conserved genetic module that encodes the major virion
components in both the coliphage T4 and the marine cyanophage S-PM2. Proc. Natl.
Acad. Sci. U. S. A. 98:11411-11416.
14. Hendrix, R. W. 2003. Bacteriophage genomics. Curr. Opin. Microbiol. 6:506-511.
15. Hendrix, R. W. 2002. Bacteriophages: evolution of the majority. Theor. Popul. Biol.
85
61:471-480.
16. Hertveldt, K., et al. 2005. Genome comparison of Pseudomonas aeruginosa large
phages. J. Mol. Biol. 354:536-545.
17. Imbeault, S., S. Parent, M. Lagacé, C. F. Uhland, and J. F. Blais. 2006. Using
bacteriophages to prevent furunculosis caused by Aeromonas salmonicida in farmed
brook trout. J. Aquat. Anim. Health 18:203-214.
18. Ishiguro, E., T. Ainsworth, R. Harkness, W. Kay, and T. Trust. 1984. A temperate
bacteriophage specific for strains of Aeromonas salmonicida possessing A-layer, a cell
surface virulence factor. Curr. Microbiol. 10:199-202.
19. Ishiguro, E., W. Kay, and T. Trust. 1980. Temperate bacteriophages for Aeromonas
salmonicida. FEMS Microbiol. Lett. 8:247-250.
20. Kim, J. H., D. K. Gomez, T. Nakai, and S. C. Park. 2010. Isolation and identification
of bacteriophages infecting ayu Plecoglossus altivelis altivelis specific
Flavobacterium psychrophilum. Vet. Microbiol. 140:109-115.
21. Kim, J. H., et al. 2011. Molecular characterization of tetracycline- and quinolone-
resistant Aeromonas salmonicida isolated in Korea. J. Vet. Sci. 12:41-48.
22. Lavigne, R., et al. 2009. Classification of Myoviridae bacteriophages using protein
sequence similarity. BMC Microbiol. 9:224.
23. Letarov, A., X. Manival, C. Desplats, and H. M. Krisch. 2005. gpwac of the T4-type
bacteriophages: structure, function, and evolution of a segmented coiled-coil protein
that controls viral infectivity. J. Bacteriol. 187:1055-1066.
24. Nolan, J., V. Petrov, C. Bertrand, H. Krisch, and J. Karam. 2006. Genetic diversity
among five T4-like bacteriophages. Virol. J. 3:30.
25. Park, S. C., I. Shimamura, M. Fukunaga, K. I. Mori, and T. Nakai. 2000. Isolation of
bacteriophages specific to a fish pathogen, Pseudomonas plecoglossicida, as a
candidate for disease control. Appl. Environ. Microbiol. 66:1416-1422.
86
26. Paterson, W. D., R. J. Douglas, I. Grinyer, and L. A. McDermott. 1969. Isolation and
preliminary characterization of some Aeromonas salmonicida bacteriophages. J.
Fisheries Res. Board Canada 26:629-632.
27. Petrov, V. M., et al. 2006. Plasticity of the gene functions for DNA replication in the
T4-like phages. J. Mol. Biol. 361:46-68.
28. Petrov, V. M., S. Ratnayaka, and J. D. Karam. 2010. Genetic insertions and
diversification of the PolB-Type DNA polymerase (gp43) of T4-related phages. J. Mol.
Biol. 395:457-474.
29. Popoff, M. 1971. Étude sur les Aeromonas salmonicida. - II. Caractérisation des
bactériophages actifs sur les Aeromonas salmonicida et lysotypie. Ann. Rech. Vét.
2:33-45.
30. Rhodes, G., et al. 2000. Distribution of oxytetracycline resistance plasmids between
aeromonads in hospital and aquaculture environments: implication of Tn1721 in
dissemination of the tetracycline resistance determinant tet A. Appl. Environ.
Microbiol. 66:3883-3890.
31. Rodgers, C. J., J. H. Pringle, D. H. Mccarthy, and B. Austin. 1981. Quantitative and
qualitative studies of Aeromonas salmonicida bacteriophage. J. Gen. Microbiol.
125:335-345.
32. Schmidt, A. S., M. S. Bruun, I. Dalsgaard, and J. L. Larsen. 2001. Incidence,
distribution, and spread of tetracycline resistance determinants and integron-
associated antibiotic resistance genes among motile aeromonads from a fish farming
environment. Appl. Environ. Microbiol. 67:5675-5682.
33. Son, J. S., et al. 2010. Antibacterial and biofilm removal activity of a podoviridae
Staphylococcus aureus bacteriophage SAP-2 and a derived recombinant cell wall
degrading enzyme. Appl. Microbiol. Biotechnol. 86:1439-1449.
34. Son, J. S., et al. 2010. Complete genome sequence of a newly isolated lytic
87
bacteriophage, EFAP-1 of Enterococcus faecalis, and antibacterial activity of its
endolysin EFAL-1. J. Appl. Microbiol. 108:1769-1779.
35. Suttle, C. A. 2005. Viruses in the sea. Nature 437:356-361.
36. Tétart, F., et al. 2001. Phylogeny of the major head and tail genes of the wide-ranging
T4-type bacteriophages. J. Bacteriol. 183:358-366.
37. Uchiyama, J., et al. 2008. Isolation and characterization of a novel Enterococcus
faecalis bacteriophage φEF24C as a therapeutic candidate. FEMS Microbiol. Lett.
278:200-206.
38. Verner-Jeffreys, D. W., et al. 2007. Furunculosis in atlantic salmon (Salmo salar L.) is
not readily controllable by bacteriophage therapy. Aquaculture 270:475-484.
39. Weigele, P., et al. 2007. Genomic and structural analysis of Syn9, a cyanophage
infecting marine Prochlorococcus and Synechococcus. Environ. Microbiol. 9:1675-
1695.
40. Wiklund, T., and I. Dalsgaard. 1998. Occurrence and significance of atypical
Aeromonas salmonicida in non-salmonid and salmonid fish species: a review. Dis.
Aquat. Org. 32:49-69.
41. Young, R., I. N. Wang, and W. D. Roof. 2000. Phages will out: strategies of host cell
lysis. Trends Microbiol. 8:120-128.
42. Zafar, N., R. Mazumder, and D. Seto. 2002. CoreGenes: a computational tool for
identifying and cataloging "core" genes in a set of small genomes. BMC
Bioinformatics 3:12.
88
Table 2.1. Host ranges and EOPs of Aeromonas phage phiAS4 and phiAS5 against all the
bacterial strains used in this study.
Bacterial species Strain Phage infectivity and EOPs a
Source phiAS4 phiAS5
A. salmonicida subsp. salmonicida AS01 +++ b (1.00) +++ (1.00) 1
AS02 +++ (0.75±0.08) +++ (0.84±0.07) 1
AS04 +++ (1.25±0.01) +++ (0.63±0.08) 1
AS05 ++ b (0.82±0.07) ++ (2.82±0.05) 1
AS06 ++ (1.18±0.10) ++ (0.21±0.02) 1
AS07 ++ (0.24±0.02) ++ (0.14±0.01) 1
AS08 ++ (0.27±0.04) ++ (1.31±0.06) 1
AS09 +++ (0.77±0.02) +++ (0.39±0.02) 1
AS10 ++ (2.13±0.08) ++ (0.34±0.04) 1
AS11 +++ (0.62±0.05) +++ (0.23±0.04) 1
AS12 ++ (0.53±0.01) +++ (0.37±0.03) 1
AS13 +++ (0.17±0.03) +++ (0.30±0.02) 1
AS14 +++ (0.56±0.06) +++ (0.32±0.01) 1
AS15 +++ (0.57±0.03) +++ (0.35±0.03) 1
ATCC 33658 +++ (1.18±0.06) +++ (0.98±0.04) 3
A. salmonicida subsp. achromogenes AS03 +++ (0.21±0.01) - b 1
A. salmonicida subsp. masoucida ATCC 27013 +++ (2.10±0.09) +++ (0.97±0.08) 3
A. hydrophila SNUFPC-A1 - ++ (0.42±0.01) 2
SNUFPC-A2 - - 2
SNUFPC-A3 - - 2
SNUFPC-A4 - - 2
SNUFPC-A5 - - 2
SNUFPC-A6 ++ (0.64±0.13) ++ (0.67±0.06) 2
SNUFPC-A7 - - 2
SNUFPC-A8 - - 2
SNUFPC-A9 ++ (0.78±0.07) + b (0.11±0.02) 2
SNUFPC-A10 - - 2
SNUFPC-A11 - - 2
JUNAH - - 2
SNUFPC-A20 + (0.25±0.03) + (0.27±0.03) 2
ATCC 7966 - + (0.11±0.03) 3
A. sobria SNUFPC-A16 - + (0.75±0.05) 2
Aro - - 2
ATCC 43979 - - 3
Streptococcus iniae ATCC 29178 - - 3
S. agalactiae ATCC 27956 - - 3
S. suis ATCC 43765 - - 3
Enterococcus faecium ATCC 51558 - - 3
E. faecalis ATCC 29212 - - 3
Vibrio vulnificus ATCC 27562 - - 3
V. parahaemolyticus ATCC 17802 - - 3
V. algynolyticus ATCC 17749 - - 3
Staphylococcus aureus ATCC 13301 - - 3
Listeria monocytogenes ATCC 19114 - - 3 a The EOP values were shown as mean ± SD.
b +++: clear plaque, ++: turbid plaque, +: veiled plaque, -: no plaque.
c 1: strains from Kim et al. (2011); 2: strains from Han et al. (2011); 3: strains purchased from the American Type
Culture Collection (ATCC).
89
Table 2.2. Predicted ORFs and its products of Aeromonas phage phiAS4.
Gene Gene product Amino acid
Identity (%) Putative function [organism] (E-value)
Predicted TMH
and signal peptide ORF
No. Range Strand
aa
size
MW
(kD) pI
TMHHM SignalP
1 42-176 + 44 5.3 6.09 93 hypothetical protein
[Aeromonas phage 25] (6e-16) 0 N
2 224-358 + 44 5.4 8.66 65 hypothetical protein
[Aeromonas phage 25] (8e-09) 0 N
3 343-561 + 72 8.3 9.47 73 hypothetical protein
[Aeromonas phage 44RR2.8t] (7e-12) 0 N
4 653-2476 + 607 68.0 5.79 99 gp39 plus60 DNA topoisomerase II large subunit
[Aeromonas phage 25] (0) 0 N
5 2576-2827 + 83 9.7 5.15 92 hypothetical protein
[Aeromonas phage 25] (2e-37) 0 N
6 2917-3132 + 71 7.9 8.96 98 hypothetical protein
[Aeromonas phage 25] (2e-33) 0 N
7 3134-3382 + 82 9.7 4.77 50 hypothetical protein
[Aeromonas phage 44RR2.8t] (3e-13) 0 N
8 3697-3975 + 92 10.5 6.04 97 hypothetical protein
[Aeromonas phage 25] (6e-46) 0 N
9 3959-4225 + 88 10.2 4.73 97 hypothetical protein
[Aeromonas phage 25] (3e-45) 0 N
10 4238-5968 + 576 65.1 7.57 92 protector from prophage-induced early lysis
[Aeromonas phage 25] (0.0) 0 N
11# 5952 - 6353 + 138 15.9 4.45 94 protector from prophage-induced early lysis
[Aeromonas phage 25] (2e-72) 0 N
12 6380 - 7318 + 312 35.2 5.28 95 host ATPase affecting protein
[Aeromonas phage 25] (1e-176) 0 N
13 7362 - 7661 + 99 11.3 4.97 94 hypothetical protein
[Aeromonas phage 25] (2e-48) 0 N
14 7661 - 8311 + 216 25.0 6.52 97 hypothetical protein
[Aeromonas phage 25] (6e-124) 0 N
90
15 8373 - 8579 + 68 8.1 7.77 65 hypothetical protein
[Aeromonas phage 44RR2.8t] (1e-20) 0 N
16 8576 - 8872 + 98 11.3 4.59 52 hypothetical protein
[Aeromonas phage 44RR2.8t] (4e-14) 0 N
17 8948 - 9112 + 54 6.2 6.18 88 hypothetical protein
[Aeromonas phage 25] (6e-21) 0 N
18 9125 - 9808 + 227 26.3 5.98 95 hypothetical protein
[Aeromonas phage 25] (7e-127) 0 N
19 9808 - 10044 + 78 9.4 4.32 100 hypothetical protein
[Aeromonas phage 25] (1e-38) 0 N
20 10200 - 10670 + 156 17.8 9.84 97 host nucleoid disrupting protein
[Aeromonas phage 25] (1e-85) 0 N
21 10680 - 12323 + 547 62.4 5.07 96 gp52 DNA topoisomerase subunit
[Aeromonas phage 25] (0.0) 0 N
22 12433 - 13011 + 192 22.2 9.14 97 hypothetical protein
[Aeromonas phage 25] (2e-109) 0 N
23 13123 - 13392 + 89 10.4 9.26 97 hypothetical protein
[Aeromonas phage 25] (3e-42) 0 N
24 13486 - 14142 + 218 24.4 7.69 88 activator of middle promoters
[Aeromonas phage 25] (3e-104) 0 N
25 14224 - 15288 + 354 41.2 6.10 99 hypothetical protein
[Aeromonas phage 25] (0.0) 0 Y
26 15330 - 16406 + 358 41.1 5.37 97 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
27 16450 - 17496 + 348 40.3 6.84 98 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
28 17543 - 17923 + 126 14.5 5.02 94 hypothetical protein
[Aeromonas phage 25] (2e-56) 0 N
29 18042 - 19016 + 324 36.2 4.86 98 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
30 19146 - 19442 + 98 10.9 6.08 94 hypothetical protein
[Aeromonas phage 25] (2e-47) 0 N
31 19486 - 19611 + 41 4.9 4.83 92 hypothetical protein
[Aeromonas phage 25] (4e-14) 1 N
91
32# 19620 - 19742 + 40 4.8 10.29 97 hypothetical protein
[Aeromonas phage 25] (2e-05) 0 N
33 19726 - 20001 + 91 10.1 6.06 94 hypothetical protein
[Aeromonas phage 25] (8e-34) 2 N
34 20078 - 20269 + 63 7.0 4.39 98 host sigma70-binding protein
[Aeromonas phage 25] (1e-23) 0 N
35 20364 - 20627 + 87 9.8 4.27 93 hypothetical protein
[Aeromonas phage 25] (2e-41) 0 N
36 20667 - 21323 - 218 25.4 5.66 97 holin
[Aeromonas phage 25] (9e-113) 1 N
37 21387 - 21881 - 164 18.4 9.22 98 e lysozyme
[Aeromonas phage 25] (7e-93) 0 N
38 21893 - 22594 - 233 26.8 9.65 91 hypothetical protein
[Aeromonas phage 25] (3e-122) 0 N
39 22609 - 23091 - 160 17.3 9.33 83 hypothetical protein
[Aeromonas phage 25] (1e-70) 0 N
40 23078 - 25801 - 907 94.6 5.76 87 gp36 small distal tail fiber subunit
[Aeromonas phage 25] (0.0) 0 N
41# 25803 - 26132 - 127 13.8 9.19 85 gp36 small distal tail fiber subunit
[Aeromonas phage 25] (6e-52) 0 N
42 26152 - 26538 - 128 13.5 7.91 88 gp36 small distal tail fiber subunit
[Aeromonas phage 25] (8e-59) 0 N
43 26761 - 27903 - 380 42.3 5.52 95 gp35 tail fiber hinge
[Aeromonas phage 25] (0.0) 0 N
44 27913 - 31578 - 1221 131.0 6.21 96 gp34 proximal tail fiber subunit
[Aeromonas phage 25] (0.0) 0 N
45 31651 - 32565 + 304 35.1 8.26 99 RNaseH
[Aeromonas phage 25] (1e-174) 0 N
46 32678 - 32860 + 60 7.1 5.02 100 dsDNA binding protein
[Aeromonas phage 25] (1e-27) 0 N
47 32860 - 33114 + 84 9.5 4.99 100 gp33 transcription protein
[Aeromonas phage 25] (4e-42) 0 N
48 33122 - 33499 + 125 14.9 9.30 96 gp59 DNA helicase loader
[Aeromonas phage 25] (1e-64) 0 N
92
49# 33525 - 33782 + 85 10.0 7.97 98 gp59 DNA helicase loader
[Aeromonas phage 25] (4e-41) 0 N
50 33852 - 34538 + 228 25.5 8.62 99 gp32 ssDNA-binding protein
[Aeromonas phage 25] (3e-127) 0 N
51 34567 - 34737 + 56 5.6 2.99 95 gp32 ssDNA-binding protein
[Aeromonas phage 25] (4e-05) 0 Y
52 34853 - 35086 + 77 8.7 4.81 58 hypothetical protein
[Aeromonas phage 31] (6e-19) 0 N
53 35098 - 35340 + 80 9.1 5.31 92 hypothetical protein
[Aeromonas phage 25] (7e-28) 0 Y
54 35369 - 35788 + 139 15.9 9.30 96 hypothetical protein
[Aeromonas phage 25] (9e-60) 2 N
55 35880 - 36980 + 366 41.8 4.88 96 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
56 37164 - 37715 + 183 20.5 6.08 96 dihydrofolate reductase
[Aeromonas phage 25] (3e-99) 0 N
57 37712 - 38233 + 173 19.9 9.38 99 thymidylate synthetase
[Aeromonas phage 25] (2e-85) 0 N
58 38233 - 38550 + 105 11.7 4.94 99 thymidylate synthetase
[Aeromonas phage 25] (5e-54) 0 N
59 38551 - 38853 + 100 11.5 8.87 99 hypothetical protein
[Aeromonas phage 25] (2e-52) 0 N
60# 38962 - 39240 + 92 10.5 8.93 94 endonuclease II
[Aeromonas phage 25] (5e-43) 0 N
61 39263 - 40414 + 383 44.3 5.25 96 RNA ligase
[Aeromonas phage 25] (0.0) 0 N
62 40491 - 41039 + 182 20.4 9.39 97 transcription terminator
[Aeromonas phage 25] (1e-77) 0 N
63 41068 - 41313 + 81 9.3 9.56 98 hypothetical protein
[Aeromonas phage 25] (6e-38) 0 N
64 41370 - 41549 + 59 6.9 5.15 100 hypothetical protein
[Aeromonas phage 25] (2e-27) 0 N
65 41542 - 41880 + 112 12.7 9.37 100 PseT
[Aeromonas phage 25] (9e-54) 0 N
93
66# 41944 - 42438 + 164 19.0 4.81 98 PseT
[Aeromonas phage 25] (9e-93) 0 N
67 42546 - 42788 + 80 8.9 6.16 96 hypothetical protein
[Aeromonas phage 25] (5e-38) 0 N
68 42785 - 43303 + 172 18.9 7.67 97 dCMP deaminase
[Aeromonas phage 25] (2e-94) 0 N
69 43314 - 43631 + 105 11.9 4.81 93 hypothetical protein
[Aeromonas phage 25] (4e-50) 0 N
70 43628 - 44188 + 186 21.1 6.86 83 hypothetical protein
[Aeromonas phage 44RR2.8t] (2e-85) 0 N
71 44198 - 44716 + 172 19.7 4.99 58 hypothetical protein
[Aeromonas phage 44RR2.8t] (5e-52) 0 N
72 44790 - 45113 + 107 11.7 5.85 71 gp31
[Aeromonas phage 44RR2.8t] (2e-39) 0 N
73 45161 - 45352 + 63 7.3 10.91 95 hypothetical protein
[Aeromonas phage 25] (7e-26) 0 N
74 45410 - 46111 + 233 26.9 5.80 96 hypothetical protein
[Aeromonas phage 25] (5e-133) 0 N
75# 46270 - 47631 + 444 50.6 6.08 98 gp30 DNA ligase
[Aeromonas phage 25] (0.0) 0 N
76 47725 - 47991 + 88 10.1 4.97 78 hypothetical protein
[Aeromonas phage 25] (3e-34) 0 N
77 48021 - 48917 + 298 34.2 5.46 90 hypothetical protein
[Aeromonas phage 25] (1e-158) 0 N
78 48948 - 50552 + 534 59.9 8.82 86 adenosylribosyltransferase
[Aeromonas phage 25] (0.0) 0 N
79 50557 - 50904 + 115 13.3 5.05 93 adenosylribosyltransferase
[Aeromonas phage 25] (3e-56) 0 N
80 50933 - 51520 - 199 22.2 4.89 98 gp54 base plate-tail tube initiator
[Aeromonas phage 25] (3e-115) 0 N
81 51679 - 51792 - 37 4.4. 8.19 100 gp54 base plate-tail tube initiator
[Aeromonas phage 25] (5e-11) 0 N
82 51795 - 52823 - 342 37.7 5.54 98 gp48 base plate protein
[Aeromonas phage 25] (0.0) 0 N
94
83 52820 - 54517 - 565 63.7 5.33 98 gp29 base plate hub
[Aeromonas phage 25] (0.0) 0 N
84 54517 - 55044 - 175 19.6 5.69 100 gp28 base plate distal hub sub
[Aeromonas phage 25] (1e-95) 0 N
85 55041 - 56156 - 371 42.7 5.38 99 gp27 base plate hub subunit
[Aeromonas phage 25] (0.0) 0 N
86 56156 - 56905 - 249 29.4 5.29 99 gp51 base plate protein
[Aeromonas phage 25] (1e-141) 0 N
87 56954 - 57559 + 201 22.8 5.18 98 gp26 base plate hub subunit
[Aeromonas phage 25] (8e-113) 0 N
88 57556 - 57939 + 127 14.5 4.65 100 gp25 base plate wedge subunit
[Aeromonas phage 25] (8e-67) 0 N
89 57974 - 58108 + 44 5.0 10.67 - Unknown
0 N
90 58248 - 58721 + 157 17.3 8.80 98 hypothetical protein
[Aeromonas phage 25] (5e-84) 0 N
91 58723 - 58887 + 54 5.8 4.53 83 hypothetical protein
[Aeromonas phage 25] (3e-17) 0 N
92 58923 - 59156 - 77 8.8 4.43 97 hypothetical protein
[Aeromonas phage 25] (1e-36) 0 N
93 59167 - 60654 - 495 56.5 8.96 97 helicase
[Aeromonas phage 25] (0.0) 0 N
94 60706 - 61407 + 233 26.5 4.54 95 minor capsid protein
[Aeromonas phage 25] (2e-120) 0 N
95 61451 - 61987 + 178 19.5 4.29 93 large outer capsid protein
[Aeromonas phage 25] (2e-89) 0 N
96 62116 - 62874 + 252 29.2 8.86 93 hypothetical protein
[Aeromonas phage 25] (5e-137) 0 N
97 62934 - 63272 + 112 12.5 8.60 98 hypothetical protein
[Aeromonas phage 44RR2.8t] (9e-60) 0 N
98 63277 - 63522 + 81 9.3 5.79 96 hypothetical protein
[Aeromonas phage 25] (3e-39) 0 N
99 63522 - 64007 + 161 18.7 5.52 92 hypothetical protein
[Aeromonas phage 25] (3e-72) 0 N
95
100 64000 - 64401 + 133 15.5 9.74 96 hypothetical protein
[Aeromonas phage 25] (1e-68) 0 N
101 64469 - 65365 + 298 35.0 9.01 95 hypothetical protein
[Aeromonas phage 25] (3e-89) 0 N
102 65427 - 66659 - 410 44.9 4.66 98 gp24 precursor of head vertex subunit
[Aeromonas phage 25] (0.0) 0 N
103 66669 - 66965 - 98 10.5 8.77 89 hypothetical protein
[Aeromonas phage 25] (6e-35) 0 N
104 66917 - 67036 - 39 4.2 9.63 73 hypothetical protein
[Aeromonas phage 25] (5e-07) 0 N
105 67115 - 68704 - 529 56.4 5.37 98 gp23 precursor of major head subunit
[Aeromonas phage 25] (0.0) 0 N
106# 68724 - 68996 - 90 9.8 4.38 98 gp22 prohead core protein
[Aeromonas phage 25] (1e-43) 0 N
107 68956 - 69552 - 198 22.1 4.58 95 gp22 prohead core protein
[Aeromonas phage 25] (3e-80) 0 N
108 69542 - 70198 - 218 23.6 4.90 99 gp21 prohead core protein and protease
[Aeromonas phage 25] (1e-114) 0 N
109 70281 - 70622 - 113 12.3 9.81 89 gp68 prohead core protein
[Aeromonas phage 25] (4e-51) 0 N
110 70623 - 70832 - 69 7.9 4.01 98 gp67 prohead core protein
[Aeromonas phage 25] (6e-28) 0 N
111 70833 - 72383 - 516 60.4 5.43 98 gp20 head portal vertex protein
[Aeromonas phage 25] (0.0) 0 N
112 72425 - 72913 - 162 18.4 4.75 91 gp19 tail tube monomer
[Aeromonas phage 25] (2e-83) 0 N
113 73142 - 74029 - 295 32.3 5.95 98 gp18 tail sheath monomer
[Aeromonas phage 25] (3e-156) 0 N
114 74010 - 74138 - 42 4.8 6.52 100 gp18 tail sheath monomer
[Aeromonas phage 25] (7e-11) 0 N
115 74135 - 74950 - 271 28.6 5.18 96 gp18 tail sheath monomer
[Aeromonas phage 25] (9e-146) 0 N
116 75003 - 76841 - 612 69.7 5.83 96 gp17 terminase subunit
[Aeromonas phage 25] (0.0) 0 N
96
117 76838 - 77287 - 149 16.9 4.28 98 gp16 terminase subunit
[Aeromonas phage 25] (5e-80) 0 N
118 77298 - 78107 - 269 31.5 5.26 98 gp15 proximal tail protein
[Aeromonas phage 25] (7e-155) 0 N
119 78107 - 78256 - 49 5.5 4.43 91 gp14 head completion protein
[Aeromonas phage 25] (1e-17) 0 N
120 78307 - 78870 - 187 21.8 5.45 97 gp14 head completion protein
[Aeromonas phage 25] (1e-99) 0 N
121 78874 - 78999 - 41 4.5 4.29 100 gp13 head completion protein
[Aeromonas phage 25] (1e-16) 0 N
122 78953 - 79798 - 281 31.4 6.10 96 gp13 head completion protein
[Aeromonas phage 25] (4e-144) 0 N
123 79943 - 81703 - 586 63.3 4.54 96 whiskers
[Aeromonas phage 25] (0.0) 0 N
124 81700 - 83097 - 465 49.6 5.00 96 gp12 short tail fibers
[Aeromonas phage 25] (0.0) 0 N
125 83097 - 83759 - 220 24.0 4.97 95 gp11 base plate wedge component
[Aeromonas phage 25] (1e-119) 0 N
126 83759 - 85573 - 604 66.3 4.54 95 gp10 base plate wedge component
[Aeromonas phage 25] (0.0) 0 N
127 85573 - 86148 - 191 20.7 8.50 95 gp9 base plate wedge component
[Aeromonas phage 25] (3e-102) 0 N
128 86441 - 87427 - 328 37.3 4.59 95 gp8 base plate wedge component
[Aeromonas phage 25] (0.0) 0 N
129# 87420 - 87653 - 77 8.8 4.78 93 gp7 base plate wedge component
[Aeromonas phage 25] (8e-36) 0 N
130 87730 - 89592 - 620 71.4 5.58 95 gp7 base plate wedge component
[Aeromonas phage 25] (0.0) 1 N
131 89564 - 90478 - 304 35.0 4.83 97 gp7 base plate wedge component
[Aeromonas phage 25] (9e-173) 0 N
132 90505 - 90918 - 137 14.9 4.31 95 gp6 base plate wedge component
[Aeromonas phage 25] (1e-67) 0 N
133 90890 - 91186 - 98 11.3 5.78 87 baseplate wedge subunit
[Aeromonas phage 44RR2.8t] (2e-42) 0 N
97
134 91333 - 92127 - 264 29.4 4.69 99 gp6 base plate wedge component
[Aeromonas phage 25] (7e-130) 0 N
135 92389 - 92682 - 97 10.5 5.79 100 gp5.4 conserved hypothetical protein
[Aeromonas phage 25] (3e-49) 0 N
136# 92773 - 93297 + 174 20.6 4.94 98 gp53 base plate wedge component
[Aeromonas phage 25] (4e-96) 0 N
137 93306 - 95057 + 583 64.0 5.00 98 gp5 base plate lysozyme
[Aeromonas phage 25] (0.0) 0 N
138 95061 - 95441 + 126 13.9 4.64 84 gp5.1 conserved hypothetical protein
[Aeromonas phage 25] (4e-56) 0 N
139 95651 - 96007 + 118 14.0 9.48 98 gp4 head completion protein
[Aeromonas phage 25] (1e-63) 0 N
140 96007 - 96507 + 166 19.0 10.03 98 gp2 protein protecting DNA ends
[Aeromonas phage 25] (2e-92) 0 N
141 96507 - 96812 + 101 11.7 10.00 100 gp2 protein protecting DNA ends
[Aeromonas phage 25] (5e-52) 0 N
142 97082 - 97609 + 175 19.9 4.60 100 gp3 tip of tail tube
[Aeromonas phage 25] (9e-99) 0 N
143 97612 - 98295 + 227 26.1 5.61 97 gp1 dNMP kinase
[Aeromonas phage 25] (5e-129) 0 N
144 98292 - 98525 + 77 8.3 4.05 96 gp57A chaperone
[Aeromonas phage 25] (6e-33) 0 N
145 98525 - 98962 + 145 16.9 4.64 99 gp57B
[Aeromonas phage 25] (3e-79) 0 N
146 99069 - 99275 + 68 7.2 5.08 98 hypothetical protein
[Aeromonas phage 25] (3e-28) 0 Y
147 99325 - 99582 + 85 9.9 9.41 86 hypothetical protein
[Aeromonas phage 25] (7e-27) 2 N
148 99650 - 99796 + 48 5.5 3.95 38 hypothetical protein Bxe_C0352
[Burkholderia xenovorans LB400] (5.5) 0 N
149 99875 - 100213 + 112 13.0 4.57 91 hypothetical protein
[Aeromonas phage 25] (3e-49) 0 N
150 100182 - 100352 + 56 6.6 4.79 84 hypothetical protein
[Aeromonas phage 25] (7e-17) 0 N
98
151 100368 - 100634 + 88 10.2 9.40 94 hypothetical protein
[Aeromonas phage 25] (3e-40) 2 N
152 100695 - 100907 + 70 8.2 9.26 97 hypothetical protein
[Aeromonas phage 25] (4e-33) 0 N
153 101090 - 101467 + 125 14.1 5.56 90 hypothetical protein
[Aeromonas phage 25] (8e-34) 0 N
154# 101461 - 101727 + 88 10.4 4.75 87 hypothetical protein
[Aeromonas phage 25] (8e-34) 0 N
155# 101729 - 101938 + 69 8.1 4.63 95 hypothetical protein
[Aeromonas phage 25] (7e-31) 0 N
156# 102934 - 103074 + 46 6.9 8.16 55 hypothetical protein
[Aeromonas phage 44RR2.8t] (3e-08) 0 N
157 103071 - 103454 + 127 14.9 9.40 59 hypothetical protein
[Aeromonas phage 44RR2.8t] (1e-37) 0 N
158 104551 - 104907 + 118 13.2 5.03 54 hypothetical protein
[Aeromonas phage 31] (7e-30) 0 N
159 105009 - 105194 + 61 6.8 7.81 72 hypothetical protein
[Aeromonas phage 25] (5e-16) 2 N
160 106215 - 106664 + 149 16.9 9.44 87 hypothetical protein
[Aeromonas phage 44RR2.8t] (3e-69) 0 N
161 106778 - 106987 + 69 8.1 9.86 72 hypothetical protein
[Aeromonas phage 44RR2.8t] (1e-23) 0 N
162 106998 - 107192 + 64 7.9 8.01 77 hypothetical protein
[Aeromonas phage 25] (6e-13) 0 N
163 107243 – 107533 + 96 11.0 9.87 41 hypothetical protein
[Aeromonas phage 25] (1e-14) 0 N
164# 107550 – 107687 + 45 5.5 4.60 39 hypothetical protein
[Aeromonas phage 31] (0.30) 0 N
165 107762 – 107932 + 56 6.7 5.82 52 hypothetical protein
[Aeromonas phage 25] (5e-10) 0 N
166 107958 – 108371 + 137 15.6 6.57 66 hypothetical protein
[Aeromonas phage 25] (5e-40) 0 N
167 108372 – 109370 + 332 39.0 4.91 97 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
99
168 109424 – 111136 + 570 63.8 6.09 99 ribonucleotide reductase A subunit
[Aeromonas phage 25] (0.0) 0 N
169 111124 – 111840 + 238 27.2 9.23 98 putative GIY-YIG homing endonuclease
[Aeromonas phage 25] (1e-136) 0 N
170 112043 – 112270 + 75 8.4 6.11 86 hypothetical protein
[Aeromonas phage 25] (2e-29) 0 N
171 112373 – 112822 + 149 17.4 8.99 100 site-specific RNase
[Aeromonas phage 25] (6e-72) 0 N
172 112819 – 113370 + 183 20.8 9.35 77 Vs.1
[Aeromonas phage 44RR2.8t] (8e-79) 0 Y
173 113442 – 113717 + 91 10.7 4.78 85 hypothetical protein
[Aeromonas phage 25] (5e-36) 0 N
174 113762 – 113899 + 45 5.0 4.44 62 hypothetical protein
[Aeromonas phage 25] (2e-10) 0 N
175 113896 – 114336 + 146 16.1 4.56 92 hypothetical protein
[Aeromonas phage 25] (3e-74) 1 Y
176 114333 – 114815 + 160 17.7 4.68 79 hypothetical protein
[Aeromonas phage 25] (2e-69) 0 N
177 114802 – 114999 + 65 7.3 5.48 59 hypothetical protein
[Aeromonas phage 25] (3e-15) 0 N
178 114999 – 115328 + 109 12.8 4.29 64 hypothetical protein
[Aeromonas phage 31] (2e-35) 0 N
179 115321 – 115650 + 109 12.9 8.93 56 hypothetical protein
[Aeromonas phage 44RR2.8t] (7e-21) 0 N
180 115634 – 115786 + 50 5.9 3.95 56 hypothetical protein
[Aeromonas phage 25] (5e-08) 0 N
181 115817 – 116362 + 181 21.7 7.08 68 Thymidine kinase
[Aeromonas phage 25] (5e-49) 0 N
182 116436 – 116699 + 87 10.0 8.01 95 hypothetical protein
[Aeromonas phage 25] (1e-41) 0 N
183 116720 – 117643 + 307 34.0 6.51 94 hypothetical protein
[Aeromonas phage 25] (2e-166) 1 Y
184 117706 – 117933 + 75 8.2 4.87 93 hypothetical protein
[Aeromonas phage 25] (3e-27) 1 Y
100
185 117934 – 118542 + 202 20.7 8.28 95 hypothetical protein
[Aeromonas phage 25] (2e-99) 0 Y
186 118614 – 118745 + 43 5.0 9.74 66 hypothetical protein
[Aeromonas phage 44RR2.8t] (5e-04) 0 N
187 118729 – 118845 + 38 4.4 3.51 84 hypothetical protein
[Aeromonas phage 44RR2.8t] (2e-11) 0 N
188 118846 – 119094 + 82 9.5 4.46 - Unknown
0 N
189 119091 – 120287 + 398 46.8 4.43 94 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
190 120347 – 120745 + 132 15.1 8.27 94 hypothetical protein
[Aeromonas phage 25] (5e-68) 0 N
191 120726 – 120848 + 40 4.5 4.92 92 hypothetical protein
[Aeromonas phage 25] (8e-12) 0 N
192 120811 – 121107 + 98 11.4 6.71 98 hypothetical protein
[Aeromonas phage 25] (4e-48) 0 N
193 121230 – 121436 + 68 8.2 4.05 88 hypothetical protein
[Aeromonas phage 25] (1e-27) 0 N
194 121439 – 121750 + 103 12.1 5.95 93 hypothetical protein
[Aeromonas phage 25] (4e-45) 0 N
195 121862 – 122254 + 130 14.6 5.92 96 hypothetical protein
[Aeromonas phage 25] (2e-69) 0 N
196 122295 – 122663 + 122 14.2 4.80 85 hypothetical protein
[Aeromonas phage 25] (1e-53) 0 N
197 122664 – 122897 + 77 9.2 10.16 96 hypothetical protein
[Aeromonas phage 25] (8e-35) 2 N
198 122912 – 123958 + 348 40.2 5.92 96 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
199 124005 – 124508 + 167 19.6 6.96 54 hypothetical protein
[Aeromonas phage 44RR2.8t] (2e-43) 0 N
200 124519 – 125493 + 324 36.7 5.52 96 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
201 125493 – 125738 + 81 9.6 10.14 90 hypothetical protein
[Aeromonas phage 25] (5e-35) 0 N
101
202 125801 – 126055 + 84 9.0 9.92 90 hypothetical protein
[Aeromonas phage 25] (4e-33) 2 N
203 126052 – 126366 + 104 11.8 6.26 43 hypothetical protein
[Aeromonas phage 44RR2.8t] (7e-19) 0 N
204 126384 – 126677 + 97 11.0 4.53 96 hypothetical protein
[Aeromonas phage 25] (3e-46) 0 N
205 126678 – 127346 + 222 26.4 9.89 83 hypothetical protein
[Aeromonas phage 25] (1e-105) 0 N
206 127420 – 127566 + 48 5.1 7.78 97 hypothetical protein
[Aeromonas phage 25] (5e-17) 2 Y
207 127563 – 128219 + 218 20.0 6.34 92 hypothetical protein
[Aeromonas phage 25] (2e-90) 0 N
208 128222 – 129700 + 492 54.8 6.07 95 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
209 129746 – 130006 + 86 10.6 7.89 95 hypothetical protein
[Aeromonas phage 25] (1e-40) 0 N
210 129981 – 130187 + 68 8.1 5.42 98 hypothetical protein
[Aeromonas phage 25] (2e-25) 0 N
211 130210 – 130401 + 63 7.2 5.08 95 hypothetical protein
[Aeromonas phage 25] (2e-27) 0 N
212 130398 – 130796 + 132 15.9 4.92 97 hypothetical protein
[Aeromonas phage 25] (2e-63) 0 N
213 130825 – 131298 + 157 18.4 9.24 100 gp49 recombination endonuclease VII
[Aeromonas phage 25] (1e-87) 0 N
214 131295 – 132053 + 252 28.3 7.73 99 anaerobic ribonucleotide reductase subunit
[Aeromonas phage 25] (6e-137) 0 N
215 132010 – 132393 + 127 13.9 8.62 98 anaerobic ribonucleotide reductase subunit
[Aeromonas phage 25] (1e-64) 0 N
216# 132435 – 133121 + 228 26.0 5.98 95 anaerobic ribonucleotide reductase subunit
[Aeromonas phage 25] (4e-87) 0 N
217 133207 – 133518 + 103 11.8 4.61 96 hypothetical protein
[Aeromonas phage 25] (2e-52) 0 N
218 133530 – 133745 + 71 7.8 3.90 92 hypothetical protein
[Aeromonas phage 25] (2e-31) 0 N
102
219 133785 – 134690 + 301 34.9 6.83 98 hypothetical protein
[Aeromonas phage 25] (6e-177) 0 N
220 134887 – 135246 + 119 14.2 8.28 89 hypothetical protein
[Aeromonas phage 25] (8e-57) 0 N
221 135243 – 135554 + 103 11.9 5.69 97 hypothetical protein
[Aeromonas phage 25] (5e-53) 0 N
222 135547 – 135669 + 40 4.5 4.75 89 anaerobic nucleotide reductase subunit
[Aeromonas phage 25] (4e-11) 0 N
223 135916 – 136266 + 116 13.3 9.52 66 hypothetical protein
[Aeromonas phage 44RR2.8t] (2e-43) 0 N
224 136276 – 136863 + 195 22.3 6.23 69 e.6
[Aeromonas phage 44RR2.8t] (4e-72) 0 N
225 136909 – 137772 + 287 32.3 6.55 27 hypothetical protein
[Aeromonas phage 44RR2.8t] (3e-09) 0 N
226 137852 – 138190 + 112 12.5 8.96 99 gp55.2 conserved hypothetical protein
[Aeromonas phage 25] (2e-59) 0 N
227 138255 – 138509 + 84 9.4 6.35 91 hypothetical protein
[Aeromonas phage 25] (5e-39) 0 N
228 138574 – 139149 + 191 21.2 6.29 89 hypothetical protein
[Aeromonas phage 25] (4e-99) 0 N
229 139146 – 140585 + 479 55.1 5.96 97 hypothetical protein
[Aeromonas phage 25] (0.0) 0 N
230 140872 – 141390 + 172 20.3 5.26 98 gp55 sigma factor
[Aeromonas phage 25] (7e-96) 0 N
231# 141867 – 141980 + 37 4.3 10.60 - Unknown
0 N
232 142027 – 143094 + 355 40.0 4.96 90 gp47 recombination protein subunit
[Aeromonas phage 25] (0.0) 0 N
233 143091 – 143621 + 176 19.5 9.45 96 gp46 recombination protein subunit
[Aeromonas phage 25] (6e-89) 0 N
234 143676 – 144806 + 376 42.6 5.23 99 gp46 recombination protein subunit
[Aeromonas phage 25] (0.0) 0 N
235 144796 – 144978 + 60 7.1 4.77 93 gp45.2 conserverd hypothetical protein
[Aeromonas phage 25] (2e-25) 0 N
103
236 145039 – 145392 + 117 13.7 7.95 98 RNA polymerase binding protein
[Aeromonas phage 25] (1e-60) 0 N
237 145446 – 146117 + 223 24.4 4.77 99 gp45 sliding clamp protein
[Aeromonas phage 25] (2e-124) 0 N
238 146180 – 147145 + 321 35.8 6.03 100 gp44 clamp-loader subunit
[Aeromonas phage 25] (0.0) 0 N
239 147156 – 147728 + 190 21.8 7.79 96 gp62 clamp-loader subunit
[Aeromonas phage 25] (2e-104) 0 N
240 147738 – 148094 + 118 13.7 9.30 98 translational repressor protein
[Aeromonas phage 25] (9e-62) 0 N
241 148134 – 149708 + 524 60.3 8.35 95 gp43 split DNA polymerase
[Aeromonas phage 25] (0.0) 0 N
242 149687 – 150493 + 268 30.4 9.68 45 GIY-YIG endonuclease
[Aeromonas phage 25] (4e-61) 0 N
243 150496 – 150669 + 57 6.8 4.78 91 DNA polymerase, C-terminal fragment
[Aeromonas phage 44RR2.8t] (4e-21) 0 N
244 150879 – 151949 + 356 40.8 5.41 97 gp43 split DNA polymerase
[Aeromonas phage 25] (0.0) 0 N
245 151959 – 152642 + 227 26.5 5.21 99 gp42 dCMP hydroxymethylase
[Aeromonas phage 25] (5e-131) 0 N
246 152735 – 152905 + 56 6.4 5.01 93 gp40 initiator of head vertex
[Aeromonas phage 25] (1e-16) 0 N
247 152959 – 154269 + 436 49.3 7.06 99 gp41 DNA helicase
[Aeromonas phage 25] (0.0) 0 N
248 154448 – 154639 + 63 6.5 8.79 98 gp61.1 conserved hypothetical protein
[Aeromonas phage 25] (1e-26) 0 N
249 154636 – 154920 + 94 10.6 5.21 94 hypothetical protein
[Aeromonas phage 25] (1e-46) 0 N
250 154904 – 155695 + 263 29.2 9.37 97 gp61 primase
[Aeromonas phage 25] (9e-119) 0 N
251 155806 – 155958 + 50 5.9 8.55 72 DNA primase subunit
[Aeromonas phage 31] (4e-15) 0 N
252 156081 – 156542 + 153 18.1 8.59 98 endonuclease V
[Aeromonas phage 25] (4e-84) 0 N
104
253 156532 - 156645 + 37 4.5 6.11 64 hypothetical protein
[Aeromonas phage 25] (6e-10) 0 N
254 156642 – 157100 + 152 16.7 5.94 95 hypothetical protein
[Aeromonas phage 25] (9e-70) 0 Y
255 157069 – 157329 + 86 10.6 9.06 92 hypothetical protein
[Aeromonas phage 25] (3e-36) 0 N
256 157523 – 158038 + 171 20.1 4.85 94 gp56 dCTPase
[Aeromonas phage 25] (4e-92) 0 N
257 158038 – 158169 + 43 5.3 4.21 95 hypothetical protein
[Aeromonas phage 25] (6e-15) 0 N
258 158162 – 158353 + 63 7.3 6.70 98 hypothetical protein
[Aeromonas phage 25] (3e-29) 0 N
259 158357 – 158668 + 103 11.8 9.42 93 hypothetical protein
[Aeromonas phage 25] (5e-52) 0 N
260 158671 – 159987 + 438 50.4 7.61 97 DNA helicase
[Aeromonas phage 25] (0.0) 0 N
261 159944 – 160057 + 37 4.3 9.90 95 hypothetical protein
[Aeromonas phage 25] (9e-05) 0 N
262 160160 – 160825 + 221 25.7 5.46 99 exonuclease A
[Aeromonas phage 25] (7e-128) 0 N
263 160822 – 161079 + 85 9.6 4.46 82 hypothetical protein
[Aeromonas phage 25] (2e-35) 0 N
264 161076 – 161324 + 82 9.7 9.39 98 hypothetical protein
[Aeromonas phage 25] (1e-41) 0 N
265 161321 – 161710 + 129 15.2 10.14 96 hypothetical protein
[Aeromonas phage 25] (1e-69) 0 N
266 161695 – 162174 + 159 18.5 5.67 96 hypothetical protein
[Aeromonas phage 25] (2e-84) 0 N
267 162431 - 162682 + 83 9.3 4.17 93 hypothetical protein
[Aeromonas phage 25] (3e-38) 0 N
268 162743 – 162958 + 71 8.2 5.61 100 cef modifier of supressor tRNAs
[Aeromonas phage 25] (3e-33) 0 N
269 162958 – 163275 + 105 12.1 8.67 98 hypothetical protein
[Aeromonas phage 25] (3e-55) 0 N
105
# The symbolized putative # ORFs did not contained AUG as start codons or UAA as stop codons.
270 163281 – 163505 + 74 8.8 8.57 97 hypothetical protein
[Aeromonas phage 25] (9e-36) 0 N
271# 163564 - 163725 + 53 6.2 4.60 94 hypothetical protein
[Aeromonas phage 25] (4e-21) 0 N
106
Table 2.3. Predicted ORFs and its putative functions of Aeromonas phage phiAS5.
Gene Gene product Amino acid
Identity (%) Putative function (E-value)
Predicted TMH
and signal peptide ORF
No. Range Strand
aa
size
MW
(kD) pI
TMHHM SignalP
1# 2-2773 + 923 101.2 5.09 87 Wac fibritin neck whiskers
[Aeromonas phage Aeh1] (0.0) 0 N
2 2783-4387 + 534 59.6 5.41 83 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
3 4397-5002 + 201 22.2 4.77 75 hypothetical protein
[Aeromonas phage Aeh1] (4e-87) 0 N
4# 5044-5193 + 49 5.7 9.94 79 hypothetical protein
[Aeromonas phage Aeh1] (1e-14) 0 N
5 5203-5400 + 65 7.4 6.56 90 hypothetical protein
[Aeromonas phage Aeh1] (2e-26) 0 N
6 5416-6336 + 306 34.2 5.23 88 gp13 neck protein
[Aeromonas phage Aeh1] (2e-158) 0 N
7 6339-7136 + 265 30.9 4.46 77 gp14 neck protein
[Aeromonas phage Aeh1] (7e-121) 0 N
8 7133-7828 - 231 26.6 9.25 60 hypothetical protein
[Aeromonas phage Aeh1] (2e-67) 0 N
9 7934-8755 + 273 31.6 5.35 86 gp15 tail sheath stabilizer and completion protein
[Aeromonas phage Aeh1] (4e-142) 0 N
10 8752-9273 + 173 19.2 4.48 84 gp16 terminase DNA packaging enzyme small subunit
[Aeromonas phage Aeh1] (1e-82) 0 N
11 9257-11158 + 633 73.2 5.22 89 gp17 terminase DNA packaging enzyme large subunit
[Aeromonas phage Aeh1] (0.0) 0 N
12 11169-13208 + 679 74.0 5.12 87 gp18 tail sheath protein
[Aeromonas phage Aeh1] (0.0) 0 N
13 13260-13748 + 162 18.8 5.11 95 gp19 tail tube protein
[Aeromonas phage Aeh1] (5e-82) 0 N
14 13824-15389 + 521 60.5 5.58 89 gp20 portal vertex protein of head
[Aeromonas phage Aeh1] (0.0) 0 N
15 15389-15553 + 54 6.2 4.34 75 hypothetical protein 0 N
107
[Aeromonas phage Aeh1] (5e-15)
16 15600-16076 + 158 18.2 9.90 79 gp68 prohead core protein
[Aeromonas phage Aeh1] (3e-63) 0 N
17 16079-16699 + 206 22.4 5.09 85 gp21 prohead core scaffold protein and protease
[Aeromonas phage Aeh1] (1e-94) 0 N
18 16733-17524 + 263 29.5 4.52 85 gp22 prohead core scaffold protein
[Aeromonas phage Aeh1] (1e-120) 0 N
19 17591-19195 + 534 58.0 5.99 94 gp23 major head protein
[Aeromonas phage Aeh1] (0.0) 0 N
20 19278-20456 + 392 43.5 4.75 81 gp24 head vertex protein
[Aeromonas phage Aeh1] (0.0) 0 N
21 20710-21048 - 112 13.3 5.35 64 hypothetical protein
[Aeromonas phage Aeh1] (3e-37) 0 N
22 21086-21523 - 145 17.5 5.45 74 hypothetical protein
[Aeromonas phage Aeh1] (5e-58) 0 N
23# 21570-21752 - 60 6.7 4.59 Unknown
0 N
24 21755-22885 - 376 42.0 6.04 49 hypothetical protein
[Aeromonas phage Aeh1] (6e-109) 0 N
25 22940-23125 - 61 7.4 9.75 45 conserved hypothetical protein
[Bulleidia extructa W1219] (8.2) 0 N
26 23127-23525 - 132 14.7 9.60 52 hypothetical protein
[Aeromonas phage Aeh1] (2e-24) 0 N
27 23551-23778 - 75 8.7 10.33 88 hypothetical protein
[Aeromonas phage Aeh1] (1e-30) 0 N
28 23915-24478 - 187 21.6 4.70 70 hypothetical protein
[Aeromonas phage Aeh1] (2e-30) 0 N
29# 24525-25229 - 234 26.3 4.77 70 Inh inhibitor of prohead protease gp21
[Aeromonas phage Aeh1] (1e-92) 0 N
30 25226-25654 - 142 16.9 8.95 66 hypothetical protein
[Aeromonas phage Aeh1] (2e-49) 0 N
31 25644-25832 - 62 6.8 7.88 80 hypothetical protein
[Aeromonas phage Aeh1] (3e-20) 2 N
32 25865-26122 - 85 9.7 6.72 35 hypothetical protein 0 N
108
[Aeromonas phage Aeh1] (1e-10)
33 26119-26445 - 108 12.3 6.08 32 hypothetical protein
[Bifidobacterium animalis subsp. lactis HN019] (3.2) 0 N
34 26483-27508 - 341 38.6 5.69 79 RnlB-B RNA ligase 2
[Aeromonas phage Aeh1] (2e-122) 0 N
35 27510-27809 - 99 11.4 10.17 31 hypothetical protein
[Leeuwenhoekiella blandensis MED217] (2.7) 1 N
36# 27938-28327 - 129 15.0 5.19 82 hypothetical protein
[Aeromonas phage Aeh1] (1e-59) 1 Y
37 28457-29968 + 503 57.7 8.89 91 UvsW RNA-DNA and DNA-DNA helicase/ATPase
[Aeromonas phage Aeh1] (0.0) 0 N
38# 29955-30212 + 85 9.8 4.91 87 UvsW.1 conserved hypothetical protein
[Aeromonas phage Aeh1] (1e-34) 0 N
39 30238-30552 - 104 12.5 9.74 75 hypothetical protein
[Aeromonas phage Aeh1] (3e-42) 0 N
40 30556-30966 - 136 15.7 5.56 87 UvsY recombination, repair and single-stranded DNA
binding protein [Aeromonas phage Aeh1] (2e-64) 0 N
41 30963-31130 - 55 6.3 4.92 60 hypothetical protein
[Aeromonas phage Aeh1] (8e-14) 0 N
42 31131-31601 - 156 17.2 6.60 73 hypothetical protein
[Aeromonas phage Aeh1] (3e-58) 0 N
43 31632-32996 - 454 51.3 6.00 84 Dda DNA helicase
[Aeromonas phage Aeh1] (0.0) 0 N
44 32996-33331 - 111 12.8 4.21 64 hypothetical protein
[Aeromonas phage Aeh1] (1e-31) 0 N
45 33374-35317 + 647 71.2 6.68 52 Alt RNA polymerase ADP-ribosylase
[Aeromonas phage Aeh1] (0.0) 0 N
46 35345-36832 - 495 56.6 5.72 82 gp30 DNA ligase [Aeromonas phage Aeh1] (0.0)
0 N
47 36888-37277 - 129 13.6 4.97 42 hypothetical protein
[Acinetobacter sp. 6014059] (6e-11) 0 N
48 37279-37689 - 136 15.8 5.71 59 hypothetical protein
[Aeromonas phage Aeh1] (3e-37) 0 N
49 37686-38078 - 130 14.8 6.27 49 hypothetical protein
[Aeromonas phage Aeh1] (4e-29) 0 N
109
50 38078-38743 - 221 25.5 6.06 81 gp30.2 conserved hypothetical protein
[Aeromonas phage Aeh1] (2e-97) 0 N
51 38727-38969 - 80 9.2 5.47 62 hypothetical protein
[Aeromonas phage Aeh1] (4e-20) 0 N
52 38960-39211 - 83 10.0 4.96 40 hypothetical protein
[Aeromonas phage Aeh1] (4e-10) 0 N
53# 39223-39699 - 158 18.0 8.48 78 gp30.3 conserved hypothetical protein
[Aeromonas phage Aeh1] (1e-60) 0 N
54 39856-40314 - 152 16.9 4.77 46 hypothetical protein
[Aeromonas phage Aeh1] (9e-28) 0 N
55 40316-40528 - 70 8.3 4.99 40 hypothetical protein
[Aeromonas phage Aeh1] (5e-04) 2 N
56 40577-40996 - 139 15.6 10.75 74 hypothetical protein
[Aeromonas phage Aeh1] (4e-52) 0 N
57 41079-41363 - 94 10.5 7.99 74 lysis inhibition accessory protein
[Aeromonas phage Aeh1] (1e-34) 0 N
58 41437-41784 - 105 12.8 5.40 87 gp31 head assembly cochaperone with GroEL
[Aeromonas phage Aeh1] (6e-56) 0 N
59 41898-42227 - 109 12.7 7.77 77 gp31.1 conserved hypothetical protein
[Aeromonas phage Aeh1] (2e-43) 0 N
60 42224-42772 - 182 20.5 8.11 84 Cd dCMP deaminase
[Aeromonas phage Aeh1] (3e-90) 0 N
61 42769-43140 - 123 14.7 7.83 49 hypothetical protein
[Aeromonas phage Aeh1] (6e-20) 0 N
62 43140-43397 - 85 10.0 6.39 43 hypothetical protein
[Aeromonas phage Aeh1] (4e-13) 0 N
63 43394-43681 - 95 11.1 9.88 73 hypothetical protein
[Aeromonas phage Aeh1] (1e-33) 0 N
64 43755-44672 - 305 35.5 6.21 83 PseT polynucleotide 5'-kinase and 3'-phosphatase
[Aeromonas phage Aeh1] (3e-154) 0 N
65 44682-45185 - 167 19.4 4.50 27 hypothetical protein
[Aeromonas phage Aeh1] (0.003) 0 N
66 45226-45747 - 173 19.6 8.95 79 Vs.1 conserved hypothetical protein
[Aeromonas phage Aeh1] (3e-77) 0 Y
110
67 46026-46343 - 105 12.3 6.10 78 PseT.2 conserved hypothetical protein
[Aeromonas phage Aeh1] (7e-41) 0 Y
68 46334-46720 - 128 14.4 9.06 71 PseT.3 conserved hypothetical predicted membrane
protein [Aeromonas phage Aeh1] (4e-47) 1 N
69 46698-47192 - 164 18.9 8.87 75 hypothetical protein
[Aeromonas phage Aeh1] (6e-69) 0 N
70 47270-47893 - 207 23.3 4.91 60 Tk.4 conserved hypothetical protein
[Aeromonas phage Aeh1] (4e-62) 0 N
71 48080-48739 - 219 26.3 9.50 27 hypothetical protein
[Guillardia theta] (2.9) 0 N
72 49120-49860 - 246 28.3 9.13 28 hypothetical protein
[Aeromonas phage Aeh1] (4e-06) 0 N
73 49857-50351 - 164 19.0 6.12 31 hypothetical protein
[Aeromonas phage Aeh1] (1e-18) 0 N
74 50394-50750 - 118 13.8 5.09 53 hypothetical protein
[Aeromonas phage Aeh1] (1e-31) 0 N
75 50747-50941 - 64 7.4 9.78 41 hypothetical protein
[Aeromonas phage Aeh1] (4e-05) 0 N
76 50935-51354 - 139 15.2 6.41 41 hypothetical protein
[Aeromonas phage Aeh1] (4e-24) 2 Y
77 51549-52601 - 350 40.9 7.66 92 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
78 52687-53184 - 165 19.4 8.45 33 7-cyano-7-deazaguanine reductase
[cyanobacterium UCYN-A] (2.4) 0 N
79 53339-53533 - 64 7.3 7.83 63 hypothetical protein
[Aeromonas phage Aeh1] (7e-14) 0 N
80 53530-53799 - 89 10.4 5.75 37 hypothetical protein
[Aeromonas phage Aeh1] (3e-11) 1 Y
81 53781-54107 - 108 12.6 7.69 29 betaine lipid synthase [Pyrenophora tritici-repentis Pt-1C-BFP] (1.9)
0 N
82 54134-54559 - 141 16.1 4.70 30 hypothetical protein
[Aedes aegypti] (0.20) 1 Y
83 54556-54777 - 73 9.0 4.88 42 hypothetical protein
[Aeromonas phage Aeh1] (2e-04) 0 N
84 54832-55191 - 119 13.8 9.52 28 carbohydrate esterase family 5 protein 0 N
111
[Schizophyllum commune H4-8] (0.16)
85# 55180-55308 + 42 4.7 4.83 Unknown
0 N
86 55295-55858 - 187 21.1 8.75 93 hypothetical protein
[Aeromonas phage Aeh1] (3e-90) 1 Y
87 55920-56981 - 353 40.4 7.55 83 hypothetical protein
[Aeromonas phage Aeh1] (1e-176) 3 N
88 56996-58051 - 351 40.1 5.44 55 hypothetical protein
[Aeromonas phage Aeh1] (3e-103) 0 N
89 58051-58281 - 76 9.4 7.80 50 hypothetical protein
[Aeromonas phage Aeh1] (7e-15) 0 N
90 58278-58532 - 84 10.0 4.80 30 hypothetical protein
[Aeromonas phage Aeh1] (1e-04) 0 N
91 58529-58801 - 90 10.5 6.25 40 hypothetical protein
[Aeromonas phage Aeh1] (1e-09) 0 N
92 58798-59025 - 75 8.8 8.64 28 hypothetical protein
[Aeromonas phage Aeh1] (1e-05) 0 N
93 59025-59282 - 85 9.6 11.12 90 hypothetical protein
[Aeromonas phage Aeh1] (1e-36) 0 N
94 59377-59631 - 84 10.1 7.89 54 hypothetical protein
[Aeromonas phage Aeh1] (8e-16) 0 N
95 59637-59894 - 85 9.7 8.08 32 hypothetical protein
[Aeromonas phage Aeh1] (6e-07) 0 N
96 59934-60263 - 109 12.4 8.56 90 hypothetical protein
[Aeromonas phage Aeh1] (2e-51) 0 N
97 60366-61523 - 385 45.0 5.33 82 RnlA
[Aeromonas phage Aeh1] (0.0) 0 N
98 61486-61923 - 145 17.2 9.75 81 DenA endonuclease II
[Aeromonas phage Aeh1] (7e-66) 0 N
99 61920-62204 - 94 10.7 8.75 85 NrdA.1 conserved hypothetical protein
[Aeromonas phage Aeh1] (3e-43) 0 N
100 62179-62676 - 165 19.1 4.94 78 hypothetical protein
[Aeromonas phage Aeh1] (4e-72) 0 N
101 62640-63473 - 277 31.5 5.89 84 dTMP synthase 0 N
112
[Aeromonas phage Aeh1] (3e-139)
102 63470-63769 - 99 11.3 4.47 71 hypothetical protein
[Aeromonas phage Aeh1] (2e-33) 0 N
103 63760-64212 - 150 17.2 6.74 58 hypothetical protein
[Aeromonas phage Aeh1] (3e-42) 0 N
104 64213-64698 - 161 18.2 7.71 46 hypothetical protein
[Aeromonas phage Aeh1] (1e-19) 0 N
105 64688-65212 - 174 19.7 5.08 67 Frd dihydrofolate reductase
[Aeromonas phage Aeh1] (1e-63) 0 N
106 65267-66172 - 301 34.1 4.89 84 gp32 single-stranded DNA binding protein
[Aeromonas phage Aeh1] (3e-149) 0 N
107 66194-66844 - 216 25.2 9.44 89 gp59 loader of gp41 DNA helicase
[Aeromonas phage Aeh1] (3e-114) 0 N
108 66841-67083 - 80 9.2 4.41 70 gp33 late promoter transcription accessory protein
[Aeromonas phage Aeh1] (1e-22) 0 N
109 67083-67370 - 95 11.0 5.94 67 DsbA
[Aeromonas phage Aeh1] (2e-27) 0 N
110 67407-68327 - 306 35.7 6.92 86 RNaseH ribonuclease
[Aeromonas phage Aeh1] (2e-158) 0 N
111 68405-72118 + 1237 135.4 5.92 83 gp34 long tail fiber proximal subunit
[Aeromonas phage Aeh1] (0.0) 0 N
112 72129-76046 + 1305 144.6 5.84 70 gp35 hinge long tail fiber proximal connector
[Aeromonas phage Aeh1] (0.0) 0 N
113 76160-80101 + 1313 142.3 5.56 56 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
114 80201-80572 + 123 13.7 9.57 92 hypothetical protein
[Aeromonas phage Aeh1] (5e-61) 0 N
115 80628-84623 + 1331 141.7 6.15 72 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
116 84672-85199 + 175 20.7 9.81 92 hypothetical protein
[Aeromonas phage Aeh1] (2e-92) 1 N
117 85200-85697 + 165 18.8 9.55 80 lysozyme murein hydrolase
[Aeromonas phage Aeh1] (3e-75) 0 N
118 85687-86025 + 112 12.8 4.97 51 hypothetical protein 1 Y
113
[Aeromonas phage Aeh1] (1e-17)
119 86057-86350 - 97 11.2 4.72 86 AsiA anti-sigma 70 protein
[Aeromonas phage Aeh1] (1e-43) 0 N
120 86570-86887 - 105 12.3 5.62 42 hypothetical protein
[Aeromonas phage Aeh1] (2e-12) 0 N
121 86914-87039 - 41 4.9 10.52 70 hypothetical protein
[Aeromonas phage Aeh1] (8e-06) 0 N
122 87049-87483 - 144 16.7 9.20 64 hypothetical protein
[Aeromonas phage Aeh1] (9e-45) 3 N
123 87480-87755 - 91 10.6 5.50 76 hypothetical protein
[Aeromonas phage Aeh1] (2e-30) 0 N
124 87752-89068 - 438 50.1 6.64 83 gp52 topoisomerase II medium subunit
[Aeromonas phage Aeh1] (0.0) 0 N
125 89127-89633 - 168 19.3 9.71 68 hypothetical protein
[Aeromonas phage Aeh1] (2e-57) 0 N
126 89936-90157 - 73 8.9 5.11 84 hypothetical protein
[Aeromonas phage Aeh1] (1e-28) 0 N
127 90159-90725 - 188 21.5 5.65 87 NudE nudix hydrolase
[Aeromonas phage Aeh1] (2e-93) 0 N
128 90827-92125 - 432 47.4 9.50 67 membrane integrity protector
[Aeromonas phage Aeh1] (7e-160) 0 N
129 92247-94445 - 732 83.5 8.68 68 membrane integrity protector
[Aeromonas phage Aeh1] (0.0) 0 N
130 94536-94847 - 103 12.4 6.74 79 hypothetical protein
[Aeromonas phage Aeh1] (2e-40) 0 N
131 94850-95320 - 156 18.7 9.64 69 hypothetical protein
[Aeromonas phage Aeh1] (9e-59) 0 N
132 95370-97214 - 614 68.7 6.22 89 topoisomerase II large subunit
[Aeromonas phage Aeh1] (0.0) 0 N
133 97279-97773 - 164 18.9 6.06 50 hypothetical protein
[Aeromonas phage Aeh1] (1e-40) 0 N
134 97773-97988 - 71 8.6 5.42 82 hypothetical protein
[Aeromonas phage Aeh1] (6e-22) 0 N
135 97988-98164 - 58 6.7 4.23 87 hypothetical protein 0 N
114
[Aeromonas phage Aeh1] (3e-19)
136 98219-98962 + 247 29.0 9.84 36 MobE
[Enterobacteria phage T6] (2e-22) 0 N
137 98942-99622 - 226 26.3 5.28 83 DexA exonuclease A
[Aeromonas phage Aeh1] (3e-111) 0 N
138 99619-100098 - 159 17.5 5.39 80 hypothetical protein
[Aeromonas phage Aeh1] (4e-69) 0 N
139 100098-101129 - 343 40.2 8.93 86 gp61 DNA primase subunit
[Aeromonas phage Aeh1] (8e-178) 0 N
140 101174-101644 - 156 17.3 9.10 88 gp61.1 conserved hypothetical protein
[Aeromonas phage Aeh1] (8e-70) 0 N
141 101676-103130 - 484 54.6 5.49 87 gp41 DNA primase-helicase subunit
[Aeromonas phage Aeh1] (0.0) 0 N
142 103336-104079 - 247 29.8 9.39 47 hypothetical protein
[Aeromonas phage Aeh1] (7e-55) 0 N
143 104154-105386 - 410 45.9 4.87 86 UvsX
[Aeromonas phage Aeh1] (0.0) 0 N
144# 105497-108256 - 919 106.9 6.27 85 DNA polymerase
[Aeromonas phage Aeh1] (0.0) 0 N
145 108388-108750 - 120 14.4 8.89 87 RegA translational repressor protein
[Aeromonas phage Aeh1] (4e-56) 0 N
146 108763-109344 - 193 22.7 5.43 87 gp62 clamp loader subunit
[Aeromonas phage Aeh1] (2e-97) 0 N
147 109345-110313 - 322 36.5 6.07 90 gp44 clamp loader subunit [Aeromonas phage Aeh1] (1-173)
0 N
148 110405-111079 - 224 24.4 5.53 85 gp45 sliding clamp
[Aeromonas phage Aeh1] (8e-108) 0 N
149 111112-111396 - 94 11.2 5.08 75 RpbA RNA polymerase binding protein
[Aeromonas phage Aeh1] (1e-33) 0 N
150 111551-111727 - 58 7.2 4.53 71 gp45.2 conserved hypothetical protein
[Aeromonas phage Aeh1] (6e-18) 0 N
151 111729-114038 - 769 87.3 5.31 61 gp46 recombination endonuclease subunit
[Aeromonas phage Aeh1] (0.0) 0 N
152 114038-115066 - 342 39.9 4.99 73 gp47 recombination endonuclease subunit
[Aeromonas phage Aeh1] (1e-154) 0 N
115
153# 115276-116970 - 564 61.0 5.72 47 hypothetical protein
[Aeromonas phage Aeh1] (7e-129) 0 N
154 116958-117383 - 141 16.1 6.08 47 hypothetical protein
[Aeromonas phage Aeh1] (1e-28) 0 N
155 117392-117508 - 38 4.3 7.95 48 hypothetical protein
[Aeromonas phage Aeh1] (0.078) 0 N
156 117510-118184 - 224 24.9 6.10 77 hypothetical protein
[Aeromonas phage Aeh1] (9e-101) 0 N
157 118297-118686 - 129 15.0 6.12 59 hypothetical protein
[Aeromonas phage Aeh1] (2e-35) 0 N
158 118679-118930 - 83 9.6 5.18 50 hypothetical protein
[Aeromonas phage Aeh1] (1e-12) 0 N
159 118917-119441 - 174 20.7 5.70 76 gp55 sigma factor for T4 late transcription
[Aeromonas phage Aeh1] (3e-69) 0 N
160 119497-120939 - 480 55.1 8.47 84 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
161 120929-121177 - 82 9.5 5.58 73 gp55.2 conserved hypothetical protein
[Aeromonas phage Aeh1] (3e-28) 0 N
162 121255-121761 - 168 19.9 9.38 81 hypothetical protein
[Aeromonas phage Aeh1] (1e-76) 0 N
163 121758-122045 - 95 11.4 4.85 74 NrdH glutaredoxin
[Aeromonas phage Aeh1] (4e-35) 0 N
164 122042-122314 - 90 10.4 5.64 86 NrdC thioredoxin
[Aeromonas phage Aeh1] (6e-40) 0 N
165 122324-122701 - 125 14.2 5.15 64 Vs.6 conserved hypothetical protein
[Aeromonas phage Aeh1] (2e-42) 0 N
166 122698-123177 - 159 18.8 6.83 87 NrdG anaerobic NTP reductase small subunit
[Aeromonas phage Aeh1] (2e-75) 0 N
167 123215-125326 - 703 80.2 6.54 88 NrdD anaerobic NTP reductase large subunit
[Aeromonas phage Aeh1] (0.0) 0 N
168 125414-125806 - 130 14.4 8.53 65 hypothetical protein
[Aeromonas phage Aeh1] (7e-43) 0 N
169 125873-126145 - 90 10.4 8.28 31 putative glutathione peroxidase transmembrane protein
[Methylibium petroleiphilum PM1] (5.5) 0 N
170 126295-126552 - 85 10.1 6.40 65 hypothetical protein 0 N
116
[Aeromonas phage Aeh1] (1e-29)
171# 126656-127786 - 376 43.6 5.03 83 NrdB aerobic NDP reductase small subunit
[Aeromonas phage Aeh1] (0.0) 0 N
172 127833-130067 - 744 84.6 6.68 65
aerobic ribonucleoside diphosphate reductase large
subunit
[Vibrio phage KVP40] (0.0)
0 N
173 130181-130645 - 154 18.3 8.81 33 hypothetical protein
[Aeromonas phage Aeh1] (2e-20) 0 N
174 130703-131104 - 133 15.6 5.40 42 hypothetical protein
[Aeromonas phage Aeh1] (4e-19) 0 N
175 131162-131575 - 137 16.4 5.45 43 hypothetical protein
[Aeromonas phage Aeh1] (7e-20) 0 N
176 131650-132135 - 161 18.7 8.74 77 packaging and recombination endonuclease VII
[Aeromonas phage Aeh1] (2e-69) 0 N
177 132176-132736 - 186 21.9 6.97 36 hypothetical protein
[Aeromonas phage Aeh1] (4e-25) 0 N
178 132736-133290 - 184 21.4 4.59 40 hypothetical protein
[Aeromonas phage Aeh1] (3e-31) 0 N
179 133290-133607 - 105 12.1 6.55 45 hypothetical protein
[Chlorobium chlorochromatii CaD3] (1.4) 0 N
180 133604-134149 - 181 20.6 8.84 48 hypothetical protein
[Aeromonas phage Aeh1] (5e-39) 0 N
181 134152-134328 - 58 6.9 10.77 87 hypothetical protein
[Aeromonas phage Aeh1] (5e-22) 0 N
182 134510-134971 - 153 17.5 5.64 83 hypothetical protein
[Aeromonas phage Aeh1] (2e-74)0 0 N
183 135012-135227 - 71 8.3 4.49 52 hypothetical protein
[Aeromonas phage Aeh1] (4e-13) 0 N
184 135282-135629 - 115 13.6 9.28 49 hypothetical protein
[Aeromonas phage Aeh1] (2e-18) 0 N
185 135639-135869 - 76 8.9 4.85 53 hypothetical protein
[Aeromonas phage Aeh1] (2e-15) 0 N
186 135869-136249 - 126 14.7 9.45 54 hypothetical protein
[Aeromonas phage Aeh1] (8e-34) 0 N
117
187 136260-136400 - 46 5.3 9.10 Unknown
1 N
188 136475-137056 - 193 22.4 6.80 44 hypothetical protein
[Aeromonas phage Aeh1] (2e-40) 0 N
189 137053-137289 - 78 9.4 6.04 60 hypothetical protein
[Aeromonas phage Aeh1] (6e-18) 0 N
190 137341-138249 - 302 33.5 9.74 54 hypothetical protein
[Aeromonas phage Aeh1] (2e-82) 0 N
191 138358-138654 - 98 11.9 9.82 42 hypothetical protein
[Aeromonas phage Aeh1] (1e-12) 0 N
192 138697-139644 - 315 35.2 8.89 88 hypothetical protein
[Aeromonas phage Aeh1] (4e-161) 1 N
193 139648-139989 - 113 13.1 5.32 66 hypothetical protein
[Aeromonas phage Aeh1] (3e-38) 0 N
194 140072-140509 - 145 17.1 8.26 78 hypothetical protein
[Aeromonas phage Aeh1] (5e-57) 0 N
195 140631-140804 - 57 6.6 8.19 Unknown
2 N
196 140827-141084 - 85 9.8 3.95 83 hypothetical protein
[Aeromonas phage Aeh1] (1e-33) 0 N
197 141143-142084 - 313 35.0 9.09 34 hypothetical protein
[Aeromonas phage Aeh1] (1e-29) 0 N
198 142094-142249 - 51 6.0 8.61 40 hypothetical protein
[Aeromonas phage Aeh1] (8.4) 2 N
199 142249-142512 - 87 10.7 9.33 36 hypothetical protein
[Aeromonas phage Aeh1] (3e-06) 0 N
200 142496-142786 - 96 10.9 8.71 Unknown
0 N
201 142786-142956 - 56 6.3 4.43 56 hypothetical protein
[Aeromonas phage Aeh1] (1e-08) 0 N
202 143053-143271 - 72 8.4 5.19 47 hypothetical protein
[Aeromonas phage Aeh1] (6e-11) 0 N
203 143268-143504 - 78 8.9 7.91 63 hypothetical protein
[Aeromonas phage Aeh1] (5e-24) 0 N
118
204 143504-143692 - 62 7.1 4.08 33 hypothetical protein
[Aeromonas phage Aeh1] (6.3) 2 N
205# 143712-143828 - 38 4.6 4.19 Unknown
0 N
206 143852-144418 - 188 21.9 8.60 86 hypothetical protein
[Aeromonas phage Aeh1] (1e-91) 0 N
207 144402-144662 - 86 9.8 5.21 62 hypothetical protein
[Aeromonas phage Aeh1] (3e-19) 2 N
208 144691-144819 - 42 5.0 5.30 44 GF13197
[Drosophila ananassae] (3.8) 1 N
209 144816-144962 - 48 5.4 6.51 Unknown
1 N
210 144959-145240 - 93 11.1 4.92 53 hypothetical protein
[Aeromonas phage Aeh1] (2e-23) 0 N
211 145291-145623 - 110 12.4 8.89 50 hypothetical protein
[Aeromonas phage Aeh1] (2e-24) 0 N
212 145623-145796 - 57 6.5 4.25 53 hypothetical protein
[Aeromonas phage Aeh1] (2e-09) 0 N
213 145796-145987 - 63 7.6 4.89 68 hypothetical protein
[Aeromonas phage Aeh1] (1e-09) 0 N
214 146009-146494 - 161 18.8 5.29 86 hypothetical protein
[Aeromonas phage Aeh1] (1e-76) 0 N
215 146494-147747 - 417 48.5 5.87 69 hypothetical protein
[Aeromonas phage Aeh1] (5e-165) 0 N
216 147731-148435 - 234 27.3 9.78 29 hypothetical protein
[Aeromonas phage Aeh1] (2e-16) 0 N
217 148462-148662 - 66 7.6 9.63 89 hypothetical protein
[Aeromonas phage Aeh1] (9e-28) 0 N
218 148662-149861 - 399 47.0 5.61 90 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
219 149925-150701 - 258 30.2 9.50 40 uncharacterized protein
[Pongo abelii] (0.070) 0 N
220 150703-151518 - 271 31.5 8.85 26 hypothetical protein
[Aeromonas phage Aeh1] (6e-11) 0 N
119
221 151521-151742 - 73 8.6 4.79 44 hypothetical protein
[Aeromonas phage Aeh1] (5e-08) 0 N
222# 151795-152106 - 103 12.2 7.09 40 hypothetical protein
[Aeromonas phage Aeh1] (2e-15) 0 N
223 152279-152602 - 107 11.6 4.60 51 hypothetical protein
[Aeromonas phage Aeh1] (5e-20) 1 Y
224 152718-152951 - 77 8.9 9.56 62 hypothetical protein
[Aeromonas phage Aeh1] (3e-22) 0 N
225 153016-153564 - 182 20.5 5.96 46 hypothetical protein
[Aeromonas phage Aeh1] (2e-38) 0 Y
226 153561-153893 - 110 12.6 7.76 40 hypothetical protein
[Aeromonas phage Aeh1] (1e-11) 0 Y
227 154012-154542 - 176 18.8 4.38 51 hypothetical protein
[Aeromonas phage Aeh1] (6e-41) 0 Y
228 154568-154867 - 99 12.0 7.00 48 hypothetical protein
[Aeromonas phage Aeh1] (4e-15) 0 N
229 154864-155331 - 155 18.7 9.39 84 hypothetical protein
[Aeromonas phage Aeh1] (1e-74) 0 N
230 155333-155917 - 194 22.8 7.00 29 hypothetical protein
[Aeromonas phage Aeh1] (8e-16) 0 N
231 155973-156602 - 209 23.4 9.22 32 hypothetical protein
[Aeromonas phage Aeh1] (2e-08) 0 N
232 156735-157139 - 134 15.2 9.60 52 hypothetical protein
[Aeromonas phage Aeh1] (2e-35) 0 N
233 157145-157696 - 183 21.5 5.77 55 hypothetical protein
[Aeromonas phage Aeh1] (6e-50) 0 N
234 157686-157862 - 58 6.8 8.98 Unknown
2 N
235 157864-158127 - 87 10.0 4.93 89 hypothetical protein
[Aeromonas phage Aeh1] (6e-41) 0 N
236 158194-158520 - 108 13.0 9.43 62 hypothetical protein
[Aeromonas phage Aeh1] (1e-33) 0 N
237 158517-158996 - 159 18.3 9.82 28 hypothetical protein
[Aeromonas phage Aeh1] (7e-13) 0 N
120
238 159000-159146 - 48 5.4 5.71 Unknown
1 Y
239 159139-159483 - 114 13.0 8.61 46 hypothetical protein
[Aeromonas phage Aeh1] (2e-19) 0 N
240 159492-159683 - 63 7.5 9.22 87 hypothetical protein
[Aeromonas phage Aeh1] (2e-24) 0 N
241 159852-160298 - 148 16.9 5.72 79 hypothetical protein
[Aeromonas phage Aeh1] (3e-64) 0 N
242 160291-160563 - 90 10.8 6.29 54 hypothetical protein
[Aeromonas phage Aeh1] (3e-21) 0 N
243 160572-161495 - 307 35.4 8.44 66 hypothetical protein
[Aeromonas phage Aeh1] (7e-121) 0 N
244 161503-161778 - 91 10.6 9.72 33 L-serine dehydratase, iron-sulfur-dependent, alpha subunit
[Carboxydothermus hydrogenoformans Z-2901] (1.9) 0 N
245 161778-162251 - 157 18.3 6.85 56 hypothetical protein
[Aeromonas phage Aeh1] (4e-38) 0 N
246 162274-162660 - 128 15.0 5.46 36 hypothetical protein
[Aeromonas phage Aeh1] (6e-13) 0 N
247 162657-162932 - 91 10.6 6.84 46 hypothetical protein
[Aeromonas phage Aeh1] (2e-08) 0 N
248 162922-163203 - 93 11.3 9.81 65 hypothetical protein
[Aeromonas phage Aeh1] (2e-28) 0 N
249 163203-163388 - 61 7.0 9.63 85 hypothetical protein
[Aeromonas phage Aeh1] (2e-22) 0 N
250 163452-163769 - 105 12.2 5.05 36 hypothetical protein gp198
[Enterobacteria phage IME08] (8e-12) 0 N
251 163859-165301 - 480 53.6 6.04 87 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
252 165425-166096 - 223 24.8 5.00 88 hypothetical protein
[Aeromonas phage Aeh1] (2e-116) 0 Y
253 166215-166346 + 43 5.2 4.39 37 hypothetical protein
[Tetrahymena thermophila] (2.4) 0 N
254 166378-166608 - 76 8.7 4.73 75 hypothetical protein
[Aeromonas phage Aeh1] (2e-25) 0 N
121
255 166595-166834 - 79 9.3 5.40 51 hypothetical protein
[Aeromonas phage Aeh1] (4e-15) 0 N
256 166831-167784 - 317 37.0 6.50 84 NrdC.11 conserved hypothetical protein
[Aeromonas phage Aeh1] (1e-159) 0 N
257 167784-168131 - 115 13.0 8.62 26 hypothetical protein
[Aeromonas phage Aeh1] (2e-04) 1 N
258 168128-168598 - 156 17.8 6.43 77 hypothetical protein
[Aeromonas phage Aeh1] (7e-41) 0 N
259 168573-168803 - 76 9.0 7.96 67 hypothetical protein
[Aeromonas phage Aeh1] (4e-19) 0 N
260 168793-169167 - 124 14.9 9.93 30 hypothetical protein
[Aeromonas phage Aeh1] (2e-08) 1 N
261 169169-169420 - 83 9.7 7.95 31 hypothetical protein
[Aeromonas phage Aeh1] (3e-07) 0 N
262 169467-169829 - 120 13.9 8.26 70 hypothetical protein
[Aeromonas phage Aeh1] (2e-43) 0 N
263 169840-170067 - 75 8.7 10.33 85 hypothetical protein
[Aeromonas phage Aeh1] (4e-31) 0 N
264 170146-170436 - 96 11.5 8.79 65 hypothetical protein
[Aeromonas phage Aeh1] (1e-30) 0 N
265 170525-174076 - 1183 134.5 6.21 44 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
266 174220-175119 - 299 33.9 5.22 59 hypothetical protein
[Aeromonas phage Aeh1] (1e-98) 0 N
267 175181-175795 - 204 23.5 7.79 54 hypothetical protein
[Aeromonas phage Aeh1] (5e-55) 0 N
268 175805-176002 - 65 7.7 8.08 84 hypothetical protein
[Aeromonas phage Aeh1] (7e-23) 0 N
269 176031-176339 - 102 12.3 9.35 50 hypothetical protein
[Aeromonas phage Aeh1] (7e-10) 0 N
270 176371-176892 - 173 19.8 6.31 52 hypothetical protein
[Aeromonas phage Aeh1] (2e-43) 0 N
271 176879-177283 - 134 15.9 6.16 57 hypothetical protein
[Aeromonas phage Aeh1] (5e-35) 0 N
122
272 177291-177629 - 112 13.2 7.73 42 hypothetical protein
[Aeromonas phage Aeh1] (1e-16) 0 N
273 177653-178267 - 204 22.8 4.69 43 hypothetical protein
[Aeromonas phage Aeh1] (7e-35) 0 N
274 178264-178419 - 51 5.8 8.18 Unknown
0 N
275 178538-178816 - 92 11.0 7.83 45 hypothetical protein
[Aeromonas phage Aeh1] (1e-13) 2 N
276 178826-179017 - 63 7.1 4.90 42 hypothetical protein
[Aeromonas phage Aeh1] (2e-04) 2 N
277 179017-179244 - 75 8.7 6.25 76 hypothetical protein
[Aeromonas phage Aeh1] (3e-29) 0 N
278 179249-179800 - 183 21.0 5.98 38 hypothetical protein
[Aeromonas phage Aeh1] (5e-25) 0 N
279 179797-180189 - 130 15.6 8.48 44 hypothetical protein
[Aeromonas phage Aeh1] (2e-24) 0 N
280 180189-180443 - 84 10.1 4.61 75 hypothetical protein
[Aeromonas phage Aeh1] (2e-30) 0 N
281 180523-180705 - 60 7.3 7.91 66 hypothetical protein
[Vibrio cholerae TM 11079-80] (3e-14) 0 N
282 180698-180976 - 92 10.9 8.03 78 hypothetical protein
[Aeromonas phage Aeh1] (1e-34) 0 N
283 181445-181903 - 152 17.3 8.80 52 hypothetical protein
[Aeromonas phage Aeh1] (4e-36) 0 N
284 181933-182046 - 37 4.5 8.74 63 hypothetical protein
[Aeromonas phage Aeh1] (3e-05) 1 N
285 182270-182503 - 77 9.0 4.45 37 predicted protein
[Ostreococcus lucimarinus CCE9901] (6.7) 0 N
286 182517-182744 - 75 8.9 5.76 35 hypothetical protein
[Aeromonas phage Aeh1] (2e-05) 0 N
287 182734-183018 - 94 10.9 4.80 57 hypothetical protein
[Aeromonas phage Aeh1] (1e-23) 0 N
288 183008-183259 - 83 9.9 6.17 49 hypothetical protein
[Aeromonas phage Aeh1] (5e-16) 0 N
123
289 183261-183662 - 133 15.9 5.18 47 hypothetical protein
[Aeromonas phage Aeh1] (6e-26) 0 N
290 183747-185180 - 477 52.7 8.95 87 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
291 185197-185796 - 199 23.0 8.30 86 thymidine kinase
[Aeromonas phage Aeh1] (5e-102) 0 N
292 185847-186191 - 113 13.2 9.26 38 hypothetical protein
[Aeromonas phage Aeh1] (1e-15) 0 N
293 186191-186616 - 141 15.9 5.10 91 hypothetical protein
[Aeromonas phage Aeh1] (3e-71) 0 Y
294 186618-186821 - 67 7.9 6.00 64 hypothetical protein
[Aeromonas phage Aeh1] (5e-19) 0 N
295 186824-187066 - 80 9.1 9.34 60 hypothetical protein
[Aeromonas phage Aeh1] (3e-19) 0 Y
296 187063-187287 - 73 8.6 4.88 61 hypothetical protein
[Aeromonas phage Aeh1] (5e-21) 0 N
297 187284-187565 - 93 10.6 4.83 55 hypothetical protein
[Aeromonas phage Aeh1] (3e-19) 0 N
298 187567-187800 - 77 9.2 4.77 38 hypothetical protein
[Aeromonas phage Aeh1] (1e-04) 0 N
299 187897-188277 - 126 15.5 9.30 66 hypothetical protein
[Aeromonas phage Aeh1] (5e-42) 0 N
300 188332-188496 - 54 6.4 9.10 81 hypothetical protein
[Aeromonas phage Aeh1] (2e-17) 0 N
301 188606-188866 - 86 10.2 4.63 82 hypothetical protein
[Aeromonas phage Aeh1] (1e-32) 0 N
302 188859-189170 - 103 12.6 6.51 80 hypothetical protein
[Aeromonas phage Aeh1] (6e-43) 0 N
303 189170-189385 - 71 8.3 4.56 88 hypothetical protein
[Aeromonas phage Aeh1] (5e-28) 0 N
304 189522-189914 - 130 15.1 5.76 85 hypothetical protein
[Aeromonas phage Aeh1] (8e-58) 0 N
305# 190102-190257 - 51 6.0 4.76 83 hypothetical protein
[Aeromonas phage Aeh1] (1e-17) 0 N
124
306 190245-190466 - 73 8.3 9.55 73 hypothetical protein
[Aeromonas phage Aeh1] (4e-23) 0 N
307 190468-190902 - 144 16.8 8.79 28 hypothetical protein
[Aeromonas phage 44RR2.8t] (0.005) 0 N
308 191130-191294 - 54 6.3 4.93 56 hypothetical protein
[Vibrio phage KVP40] (0.004) 0 N
309 192027-192215 - 62 7.1 4.76 44 hypothetical protein
[Aeromonas phage Aeh1] (1e-04) 0 N
310 192219-192419 - 66 7.8 4.53 80 hypothetical protein
[Aeromonas phage Aeh1] (1e-21) 0 N
311 192403-192828 - 141 16.4 4.77 65 hypothetical protein
[Aeromonas phage Aeh1] (9e-48) 0 N
312 193878-194126 - 82 9.2 7.72 78 hypothetical protein
[Aeromonas phage Aeh1] (5e-23) 0 N
313 195074-195616 - 180 21.0 9.68 40 PHG31p119nc
[Aeromonas phage 31] (9e-25) 0 N
314 196437-196658 - 73 8.2 5.24 64 hypothetical protein
[Aeromonas phage Aeh1] (3e-19) 0 Y
315 196686-196973 - 95 10.9 8.72 86 hypothetical protein
[Aeromonas phage Aeh1] (1e-42) 0 Y
316 196970-197275 - 101 11.9 4.53 76 hypothetical protein
[Aeromonas phage Aeh1] (2e-41) 0 N
317 197350-198378 - 342 40.3 4.76 66 hypothetical protein
[Aeromonas phage Aeh1] (5e-125) 0 N
318 198487-198876 - 129 14.3 6.84 67 hypothetical protein
[Aeromonas phage Aeh1] (1e-45) 0 N
319 198886-199104 - 72 8.2 4.84 77 hypothetical protein
[Aeromonas phage Aeh1] (1e-26) 0 N
320 199506-200003 - 165 19.3 7.06 81 gp57B conserved hypothetical protein
[Aeromonas phage Aeh1] (5e-76) 0 N
321 200005-200238 - 77 8.8 4.50 72 hypothetical protein
[Aeromonas phage Aeh1] (4e-18) 0 N
322 200202-200891 - 229 26.8 5.69 75 gp1 dNMP kinase
[Aeromonas phage Aeh1] (4e-103) 0 N
125
323 200899-201471 - 190 21.2 4.99 85 gp3 tail completion and sheath stabilizer protein
[Aeromonas phage Aeh1] (7e-87) 0 N
324 201468-203339 - 623 67.8 9.18 58 hypothetical protein
[Aeromonas phage Aeh1] (8e-178) 0 N
325 203336-203458 - 40 4.9 4.84 Unknown
0 N
326 203506-204285 - 259 29.0 4.76 78 gp26 baseplate hub subunit
[Aeromonas phage Aeh1] (8e-119) 0 N
327 204536-205507 - 323 36.0 5.90 81 gp54 baseplate tail tube initiator
[Aeromonas phage Aeh1] (1e-157) 0 N
328 205553-206551 - 332 38.8 9.94 87 gp2 DNA end protector protein
[Aeromonas phage Aeh1] (3e-173) 0 N
329 206548-207012 - 154 18.4 9.65 80 gp4 head completion protein
[Aeromonas phage Aeh1] (7e-70) 0 N
330 207065-208132 + 355 38.5 7.61 71 gp48 baseplate tail tube cap
[Aeromonas phage Aeh1] (6e-152) 0 N
331 208135-208695 + 186 21.8 7.89 77 gp53 baseplate wedge subunit
[Aeromonas phage Aeh1] (5e-85) 0 N
332 208685-209911 + 408 45.8 5.49 76 hypothetical protein
[Aeromonas phage Aeh1] (0.0) 0 N
333 209911-211731 + 606 66.1 5.23 86 gp5 baseplate hub subunit and tail lysozyme
[Aeromonas phage Aeh1] (0.0) 0 N
334 211740-212288 + 182 20.4 5.36 77 gp5.1 conserved hypothetical protein
[Aeromonas phage Aeh1] (2e-79) 0 N
335 212290-212583 + 97 10.4 7.88 93 gp5.4 conserved hypothetical protein
[Aeromonas phage Aeh1] (1e-45) 0 N
336 212593-213015 + 140 16.1 5.17 77 gp25 baseplate wedge subunit
[Aeromonas phage Aeh1] (2e-60) 0 N
337 213015-214970 + 651 72.7 4.88 92 gp6 baseplate wedge subunit
[Aeromonas phage Aeh1] (0.0) 0 N
338 214970-218461 + 1163 133.8 5.23 89 gp7 baseplate wedge initiator
[Aeromonas phage Aeh1] (0.0) 1 N
339 218463-219449 + 328 37.7 5.86 92 gp8 baseplate wedge subunit
[Aeromonas phage Aeh1] (0.0) 0 N
126
# The symbolized putative ORFs did not contained AUG as start codons or UAA as stop codons.
340 219519-220445 + 308 33.6 5.81 93 gp9 baseplate wedge tail fiber connector
[Aeromonas phage Aeh1] (2e-157) 0 N
341 220445-222598 + 717 78.3 5.07 86 gp10 baseplate wedge subunit and tail pin
[Aeromonas phage Aeh1] (0.0) 0 N
342 222599-223573 + 324 35.7 5.80 82 gp11 baseplate wedge subunit and tail pin
[Aeromonas phage Aeh1] (1e-162) 0 Y
343 223570-224889 + 439 47.5 6.84 82 gp12 short tail fibers
[Aeromonas phage Aeh1] (0.0) 0 N
127
Figure 2.1. Electron microscopy of the two T4-like Myoviridae phages infecting A.
salmonicida subsp. salmonicida: phiAS4 (A) and phiAS5 (B). Virions were negatively
stained with 2% uranyl acetate. Scale bars represent 100 nm (A) and 50 nm (B),
respectively.
128
Figure 2.2. One step growth curves of phiAS4 and phiAS5 in A. salmonicida subsp.
salmonicida strain AS01. The latent periods and burst sizes were inferred from the curve
with triphasic patterns.
129
Figure 2.3. Genome map of Aeromonas phage phiAS4. The + and – stranded ORFs were colored as grey and white, respectively. The coregenes between
phiAS4, Aeromonas phage 25 and T4 phage were colored as green. The predicted tRNAs were indicated with red. Putative promoters and terminators are
indicated by an arrow bent to the right and inverted triangle on a vertical line, respectively.
130
Figure 2.4. Genome map of Aeromonas phage phiAS5. The + and – stranded ORFs were colored as grey and white, respectively. The CoreGenes between
phage phiAS5, Aeh1 and T4 were colored as green. The predicted tRNAs were indicated with red. Putative promoters and terminators were indicated by an
arrow bent to the right and inverted triangle on a vertical line, respectively.
131
Figure 2.5. Genome comparison of Aeromonas phage phiAS4 (A) and phiAS5 (B) to related phages using the Artemis Comparison Tool (ACT). Translated
BLAST (TBLASTX, score cutoff: 40) was used to align translated phage genome sequences. Blue and red lines represent reverse and forward matches,
respectively, and color intensity is proportional to the sequence homology. Nucleotide base-pairs are indicated between grey lines for each phage genome.
132
Figure 2.6. SDS-PAGE analysis of recombinant phiASL5 (A). Lane M, molecular size
markers; lane 1, lysate prepared from un-induced cells; lane 2, lysate prepared from
induced cells; lane 3, purified phiASL5. Zymogram assay of recombinant phiAS5 (B). Lane
1, negative control (elution fraction prepared from un-induced cells); lane 2, purified
phiASL5. An arrow indicates the position of the recombinant phiASL5 protein.
133
Chapter III
Isolation and characterization of a novel Aeromonas
phage PAS-1 infecting A. salmonicida subsp.
salmonicida and its applications in rainbow trout
(Oncorhynchus mykiss) furunculosis model therapy
Abstract
To search for candidate control agents against A. salmonicida subsp.
salmonicida infections in aquaculture, one lytic bacteriophage (phage), designated
as PAS-1, was isolated from the environmental water, and its several biological
properties were investigated. The phage showed broad host ranges to other
subspecies of A. salmonicida as well as A. salmonicida subsp. salmonicida
including antibiotic-resistant strains. The PAS-1 was morphologically classified as
Myoviridae and possessed approximately 48 kb of double-strand genomic DNA.
Moreover, partial genomic and structural proteomic analysis of PAS-1 revealed that
the phage was closely related to other Myoviridae phages infecting enterobacteria
or Aeromonas species. For the therapeutic applications of PAS-1, the phage was
preferentially co-cultured with one virulent A. salmonicida subsp. salmonicida
strain that possesses the ascV gene, and strong bacteriolytic activity was observed
against the bacteria. The administration of PAS-1 in rainbow trout (Oncorhynchus
mykiss) demonstrated that it was cleared within 200 h post-administration, and
temporal neutralizing activity against the phage was detected in the phage-
administrated fish serums. The protective effects of the phage were verified in
134
experimental rainbow trout furunculosis model therapy, showing increased survival
rates and mean time to death. Based on these results, phage PAS-1 could be
considered as potential therapeutic or prophylactic candidate against A.
salmonicida infections in aquaculture.
Key words: A. salmonicida subsp. salmonicida, phage therapy, PAS-1, rainbow
trout (Oncorhynchus mykiss), aquaculture
135
3.1. Introduction
The non-motile aeromonad, Aeromonas salmonicida is the causative agent of
bacterial septicemia and furunculosis in fish, and it has caused significant
economic losses in worldwide aquaculture operations (38). To date, five subspecies
of A. salmonicida (subsp. salmonicida, subsp. achromogenes, subsp. smithia, subsp.
masoucida and subsp. pectinolytica) are recognized (24), and their resistance to
commercialized antibiotics, such as tetracycline and quinolones, has led to great
concern (9, 28) due to its potential health risks to humans and animals (29, 32). In
addition, we have been able to detect the acquisition of antibiotic resistance in A.
salmonicida isolated from Korean aquaculture in recent years (14). Therefore,
alternative methods to control this fish pathogen are urgently needed.
Theoretically, bacteriophages (phages) can be used to treat infectious bacterial
disease, as an alternative approach to control pathogenic bacteria. In practice,
phages have been used as therapeutic or prophylactic agents against several fish
and shellfish pathogens in aquaculture (18, 19, 22), including A. salmonicida (10,
37). To date, a number of phages infecting A. salmonicida have been isolated and
characterized (2, 10-12, 16, 23, 25-27, 30, 37), and most of them were classified
into Myoviridae in the VIIIth ICTV Report (http://www.ictvdb.org/Ictv/index.htm)
as P1, P2 and T4-like viruses (8).
In the current study, we isolated one lytic Myoviridae phage (designated as
PAS-1) infecting A. salmonicida subsp. salmonicida and characterized it. The
isolated phage demonstrated a broad host range and efficient lytic activity toward
other subspecies of A. salmonicida including antibiotic-resistant strains.
Furthermore, we investigated the fate of PAS-1 in rainbow trout (Oncorhynchus
136
mykiss) and verified the protective effects of the phage against the fish furunculosis
model to evaluate its therapeutic or prophylactic potential in aquaculture.
3.2. Materials and methods
3.2.1. Bacterial strains
A total of 17 A. salmonicida strains of 3 different subspecies (subsp.
salmonicida, subsp. achromogenes and subsp. masoucida), 20 strains of motile
Aeromonas spp. (10 of A. hydrophila, 5 of A. sobria and 5 of A. media) and 11
other strains of different species were used in this study (Table 3.1). The bacterial
strains were cultured in tryptic soy broth (TSB) or sub-cultured on tryptic soy agar
(TSA) at 20°C for all Aeromonas spp. and at 37°C for other bacterial species. All
the strains were stored at -80°C with 10% glycerol until needed.
3.2.2. Phage isolation and host range determination
The conventional double-layered agar method described by Adams (3) was used
for the phage isolation and enumeration of its plaque-forming units (PFUs). One of
the previously confirmed antibiotic-resistant A. salmonicida subsp. salmonicida
strains, AS01 (14), was used as a host bacterial strain for the phage isolation.
Plaque morphologies were observed after 18 to 24 h of incubation. Bacterial
cultures in exponential phase were inoculated with environmental water samples of
the final effluent from the sewage of the rainbow trout culture farms in Korea. The
mixtures were incubated for 36 h at 20°C, centrifuged for 20 min at 10,000 × g and
filtered through a 0.45-μm pore size membrane filter. Pure phage strain was
obtained by three serial single-plaque isolations and designated as PAS-1. The
137
filtered phage lysate was precipitated with 10% (w/v) polyethylene glycol (PEG)
8000 in 1 M NaCl at 4°C for 12 h and collected by centrifugation at 10,000 × g for
10 min at 4°C. The purified phage was prepared by CsCl step gradients ultra-
centrifugation (gradient density: 1.15, 1.45, 1.50 and 1.70 g/ml; 250,000 × g; 22 h;
4°C), dialyzed in SM buffer (10 mM NaCl, 50 mM Tris [pH 7.5] and 10 mM
MgSO4) and stored at 4°C until used.
The host range of the phage was determined by the double-layered agar method;
bacteria were inoculated with all the 37 Aeromonas spp. strains and then checked
for the presence or absence of plaque formation. The plaque-forming ability of the
phage against each A. salmonicida strain was measured as the efficiency of plating
(EOP), which was measured against the standard of A. salmonicida subsp.
salmonicida AS01. To check the polyvalency of the phage, 10 strains of other
bacterial species were tested against the phage PAS-1.
3.2.3. Electron microscopy
The purified phage sample was loaded onto a copper grid followed by negative
staining with 2% uranyl acetate and drying. The morphology of the phage was
observed using a Zeiss TEM EM902 (Zeiss) at an accelerating voltage of 80 kV.
Phage sizes were calculated by the means of at least 10 measurements.
3.2.4. One step growth
The 10 μl of purified phage suspension (9.3 × 109 PFU/ml) was added to 10 ml
of inoculums of the host bacterial strain in early-exponential phase (OD600: 0.2) in
TSB, absorbed for 5 min and then centrifuged at 10,000 × g for 1 min. After the
138
supernatants were removed, the pellets containing the phages-infected bacterial
cells were suspended in 20 ml of fresh TSB and incubated with shaking at 250 rpm
and 20°C. Partial samples were taken at 10 min intervals for 120 min, and the
titrations from the aliquots were immediately determined.
3.2.5. Thermo- and pH-stability
For the thermo-stability tests, the phage suspension was incubated in TSB (final
phage concentration: 1.4 × 107 PFU/ml) at 4°C, 20°C, 40°C and 55°C for 60 min,
and aliquots were taken at 30 and 60 min. For pH-stability tests, the phage
suspension was inoculated in a series of tubes containing TSB (final phage
concentration: 1.2 × 107 PFU/ml) with final pH of 3.0, 5.0, 7.0, 9.0 and 11.0
(adjusted with 1 M HCl or 1 M NaOH), incubated at 20°C, and then titered at 30
and 60 min.
3.2.6. Phage genome analysis
Purified phage genomic DNA (gDNA) was prepared as previously described
(33), and it was subjected to nuclease treatment using DNase I (20 U/μl), RNase A
(5 U/μl) and Mung bean nuclease (20 U/μl) (Takara) according to the
manufacturer’s instructions. In addition, the size estimation and restriction analysis
of phage gDNA were performed by pulsed-field gel electrophoresis as previously
described (36), with some modifications. Briefly, 500 μl of phage suspension was
mixed with 500 μl of 2% (wt/vol) NuSieve GTG agarose (FMC BioProducts),
dispensed into plug molds and solidified. The plugs were punched out of the molds
into a small volume of digestion buffer (500 mM EDTA, 10 mM Tris [pH 8.0], 1%
139
SDS [w/v] and 1 mg/ml of proteinase K) and incubated at 50°C overnight. The
digestion buffer was decanted, and the samples were washed three times using TE
buffer and then digested with 10 U of SacII, Sau3AI, MspI, XbaI, NotI, HindIII,
SmaI, SphI, NcoI, HpaII, SpeI and EcoRI (New England Biolabs) for 1 h at 37°C,
respectively. The plugs were washed three times using TE buffer, placed in wells of
1.2% Pulsed Field Certified agarose (Bio-Rad) in 0.5X TBE and overlaid with
molten 0.5% NuSieve GTG agarose. The samples were electrophoresed using a
CHEF-DR III System (Bio-Rad) at 6 V/cm with pulse ramps from 5 to 15 s for 16
h at 14°C in 0.5X TBE buffer. The phage genome sequencing was performed by
Macrogen Inc. (Korea). Briefly, phage gDNA was sheared using a nebulizer
(Invitrogen) and blunt-end repaired. DNA fragments of the desired size (2 to 3 kb)
were blunt-end ligated into the pCR4 blunt-TOPO vector (Invitrogen) and
introduced into E. coli DH10B. Partial genome sequences were obtained by
sequencing with primer walking. The potential ORFs were predicted using
GeneMark.hmm (17), and gene sequence similarity was investigated using the
NCBI BLASTP program (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
3.2.7. Phage proteome analysis
Phage ghosts were prepared as previously described (15). Briefly, purified
phage suspension (8.4 × 1011 PFU/ml) was re-concentrated by ultra-centrifugation
at 100,000 × g at 4°C for 30 min. They were re-suspended in 10 M LiCl, heated to
46°C for 20 min and then ten-fold diluted with 50 mM Tris/HCl (pH 8.0) in 100
mM NaCl and 5 mM MgCl2, and treated with DNase I (20U/μl) (Takara) for 2 h at
37°C. Prepared phage ghosts were then analyzed by standard Tris-glycine sodium
140
dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using SDS
Ready-Gel (4 to 20% polyacrylamide gradient; Bio-Rad), and stained by
PlusOne™ Silver Staining Kit, Protein (GE Healthcare). Protein bands were
extracted from the gels, digested with trypsin, and identified by liquid
chromatography-tandem mass spectrometry (LC-MS/MS) using the proteomics
platform at the National Instrumentation Center for Environmental Management
(NICEM) at Seoul National University. All MS/MS data were searched using
ProteinPilotTM 3.0 Software (Applied Biosystems) against the GenBank non-
redundant protein database.
3.2.8. Selection of a virulent A. salmonicida strain and lysis test
To prepare host bacterial strain for experimental therapeutic applications of
PAS-1, the presence of the type III secretion system (TTSS) gene ascV was
screened by PCR in all 17 A. salmonicida strains used in this study. A pair of
primers, ascVF (5’-CAG CTC GCT ATA GCT CCC CT-3’) and ascVR (5’-GCC
CTC TAT CTC GAT CTC GG-3’), were designed based on the ascV gene of A.
salmonicida A449 plasmid 5 [GenBank accession number: NC_009350], and PCR
was carried out with using a GeneAmp PCR system 2720 (Applied Biosystems)
with the following steps: a predenaturation at 95°C for 3 min, followed by
amplification for 30 cycles at 95°C for 30 s, 52°C for 60 s and 72°C for 90 s and a
final extension at 72°C for 7 min. The amplified 399 bp of PCR products were
sequenced for final confirmations of the ascV gene in A. salmonicida.
Based on the bacterial screening result, the purified phage and A. salmonicida
subsp. salmonicida AS05 strain in early-exponential phase (OD600: 0.06, 1.3 × 107
141
CFU/ml) were co-cultured in 10 ml of fresh TSB at several doses of multiplicity of
infection (MOI): 0, 0.01,1, 100 and 10,000. The preparations were incubated with
shaking at 250 rpm and 20°C. Bacteria inoculated into TSB without phage (MOI:
0) were used as a control. The absorbance dose (OD600) was determined 0, 3, 6, 12,
24 and 48 h after inoculation, respectively.
3.2.9. Fish experiments
All the animal care and experimental procedures were approved by the
Institutional Animal Care and Use Committee (IACUC) at Seoul National
University. Experiments were performed using 3- to 4-month-old triploid juvenile
rainbow trout (avg. body length: 13.1 cm; avg. body weight: 17.1 g) purchased
from a private culture farm in Korea. Prior to the experiment, liver, kidney and
spleen of the fish were randomly sampled and screened for A. salmonicida
infection by PCR assay (4), and the fish were acclimatized at 14-15°C for 1 week.
All the fish were euthanized or anaesthetized by Ethyl 3-aminobenzoate
methanesulfonate (Tricaine methanesulfonate; Sigma-aldrich) before or after the
experiments.
In advance of the therapeutic applications, the fate of PAS-1 in fish kidneys and
the neutralizing activity of the phage-administrated fish serums against the phage
were preferentially investigated. The fish were treated with 0.1 ml of the purified
phage suspension by intra-muscular (IM) administration (3.0 × 107 PFU/fish), and
the fish kidneys (0.1 g) and aquarium waters were randomly sampled at 0, 6, 24, 48,
72, 96, 120, 144, 200, 240 and 360 h post-administration (pa), respectively.
Additionally, blood samples of the phage-administrated fish were obtained at 10,
142
15, 20, 25 and 30 days pa by caudal vein-puncture. The serum was collected by
centrifugation (1,500 × g, 30 min), and de-complementation was performed by heat
treatment for 30 min at 45°C as recommended by Sakai (31). Twenty microliters of
prepared serum samples was mixed with an equal volume of purified phage
suspension (1.9 × 107 PFU/ml) and incubated at 20°C for 2 h. The 0 h samples,
which were collected before phage administration, were used as a control in all the
experimental groups, and the phage PFUs were counted by the double-layered agar
method.
The protective effects of PAS-1 against A. salmonicida infection were evaluated
as below. The fish (20 fish in each experimental group) with identical conditions
(as previously described) were challenged with 0.1 ml of the bacterial suspension
in phosphate-buffered saline (PBS) containing fresh culture of A. salmonicida
AS05 by the IM method (2.5 × 102 CFU/fish). Following bacterial challenge, the
fish were immediately given 0.1 ml of the purified phage suspension by the IM
method (2.4 × 106 PFU/fish). The fish given SM buffer without the phage were
used as control. The fish were monitored for 14 days at 20°C, and bacteria from
kidneys of dead fish were re-isolated and confirmed by PCR assay (4).
3.2.10. Statistical analysis
Statistically significant differences in all the experiments were determined using
the student’s t-test. A P value of less than 0.05 was accepted as statistically
significant. The SPSS statistical software package version 13.0 (SPSS, Inc.,
Chicago, IL) was used for all statistical analyses.
143
3.2.11. Nucleotide accession numbers
The nucleotide sequence data of the RNA polymerase, DNA polymerase, large
subunit terminase, tail fiber, muramidase, head portal protein and one hypothetical
protein gene in the phage PAS-1 were deposited in the GenBank database under the
accession numbers JF342689, JF342683, JF342686, JF342690, JF342687,
JF342688 and JF342684, respectively.
3.3. Results
3.3.1. Morphology and host range of Aeromonas phage PAS-1
One phage, designated as PAS-1, was isolated from environmental water
samples and formed approximately 2 mm plaques in AS01 strains. The phage was
morphologically classified into the order Caudovirales and family Myoviridae
morphotype A1 (an icosahedral head and long contractile sheathed tails), according
to the classification of Ackermann (1) (Figure 3.1). The tail length and width were
123 ± 18 nm (mean ± SD) (n = 10) and 16 ± 2 nm (n = 10), respectively, and the
head diameter was 53 ± 7 nm (n = 10).
To evaluate the host range of PAS-1, it was tested on various motile Aeromonas
spp. as well as A. salmonicida strains. Among the 14 A. salmonicida subsp.
salmonicida isolates, 9 isolates produced completely clear plaques in double-layer
agar, whereas the other 5 isolates developed turbid plaques. Therefore, all 14 A.
salmonicida subsp. salmonicida isolates were considered to be susceptible to PAS-
1. The A. salmonicida subsp. salmonicida ATCC 33658, A. salmonicida subsp.
achromogenes AS03 and A. salmonicida subsp. masoucida ATCC 27013 were also
susceptible to the phage, showing clear plaques. The EOP values varied among the
144
A. salmonicida strains, and the highest EOP was detected in the multidrug-resistant
AS09 strain (Table 3.1). However, PAS-1 was not able to lyse the other 10
bacterial species or the motile Aeromonas spp. used in this study.
3.3.2. One step growth and stability of Aeromonas phage PAS-1
One step growth of PAS-1 was examined to assess the growth pattern and the
number of progeny phages released by the lysis of the indicator host strain, AS01.
The latent period and the average burst sizes were estimated to be approximately
40 min and 116.7 PFU/cell, respectively (Figure 3.2). The stability of PAS-1 was
assessed by calculating PFU changes under different pH and temperature
conditions. Almost no reduction in the PFUs was observed after 1 h incubation at
pH 5.0, 7.0, 9.0 and 11.0, whereas considerable reductions were found at pH 3.0. In
the thermo-stability tests, the phage was stable at 4°C and 20°C for 1 h but not at
40°C and 55°C (data not shown). These results suggest that low pH and high
temperature conditions might affect the stability of PAS-1.
3.3.3. Genomic and proteomic characteristics of Aeromonas phage PAS-1
In general, Myoviridae phages are known to possess double strand (ds) DNA
genomes (1). Likewise, the gDNA of PAS-1 was completely digested by DNase I
but not by RNase A or Mung bean nuclease; thus, it was presumed to be ds DNA.
In addition, the gDNA was digested by SacII, Sau3AI, MspI, NcoI, HpaII, and its
size was estimated by distinct fragments of NcoI as approximately 48 kb (data not
shown). For the genome analysis of the PAS-1, a preliminary phage genome
database was constructed by random shotgun sequencing. We were able to find 4
145
partial ORF sequences of phage-related proteins (RNA polymerase, DNA
polymerase, large subunit terminase, tail fiber) and 3 complete ORF sequences
(muramidase, head portal protein, hypothetical protein) by BLASTP searches in the
GenBank database, and the amino acid size, identity and E-values are shown in
Table 3.2. The predicted RNA polymerase, DNA polymerase, large subunit
terminase and one hypothetical protein of PAS-1 showed similarity to those of
enterobacteria phage phiEcoM-GJ1 [GenBank accession number NC_010106], and
the predicted tail fiber and putative muramidase proteins were homologous with
Aeromonas phage phiO18P [GenBank accession number NC_009542] which was
classified as a P2-like Myoviridae phage.
To investigate the structural proteins of PAS-1, purified phage particles were
subjected to SDS-PAGE and LC-MS/MS analysis. At least 14 distinct protein
bands, with molecular masses ranging from 8 to 140 kDa were separated, and 9
major protein bands were subjected to LC-MS/MS for peptide sequencing. From
these results, several partial peptide sequences of structural proteins, such as tail
sheath (140 and 11 kDa), head morphogenesis (52 kDa), wac fibritin neck whiskers
(48 kDa), major capsid (30 kDa) and prohead core (15 kDa) were obtained (Table
3.3).
3.3.4. Selection of a virulent A. salmonicida strain and lysis test
Among the 17 A. salmonicida strains used in this study, the ascV gene was
detected in AS03 (subsp. achromogenes), AS05 (subsp. salmonicida) and ATCC
27013 (subsp. masoucida). Therefore, the lytic activity of PAS-1 was tested on
early exponential-phase cultures of strain AS05 (Figure 3.3). When the cultures of
146
the AS05 strains were not infected by PAS-1 (MOI: 0), the OD600 value continued
to increase during the incubations. In contrast, when they were infected with PAS-1,
bacterial growths were apparently retarded at MOI 100 and 10,000 until 48 h after
phage infection. However, at MOI of 0.01 and 1, the OD600 values started to
increase gradually at 24 h after phage inoculation and nearly reached 0.5 at 48 h.
The presences of viable phage-resistant A. salmonicida was determined by plating
the lysates of the 4 phage-inoculated MOI groups (MOI: 0.01, 1, 100 and 10,000),
and several colonies were obtained from all the experimental groups regardless of
their increase in OD600 values. The appearance ratios of phage-resistant colonies
were inversely proportional to the MOI values of the samples, and the resistance
was continuously observed during their successive cultures in TSA plates (date not
shown).
3.3.5. Fate of Aeromonas phage PAS-1 in fish
For the evaluation of the fate of PAS-1 in rainbow trout, the purified phage was
administrated by the IM method to fish (3.0 × 107 PFU/fish). The phage in fish
kidneys was detected from 6 to 200 h pa, showing gradual reductions in its PFUs,
but not at 240 and 360 h pa. Moreover, the phage was also detected in the aquarium
waters of phage-administrated fish from 6 to 360 h pa, showing gradual reductions
in its PFUs (Figure 3.4). In addition, significant neutralizing activities against
PAS-1 were observed at 10 and 15 days pa (P < 0.01), and declined by 20, 25 and
30 days pa (Figure 3.5).
3.3.6. Protective effects of Aeromonas phage PAS-1 in fish furunculosis model
147
To demonstrate the therapeutic potential of PAS-1, the protective effects of the
phage were evaluated using a triploid rainbow trout-furunculosis model. Prior to
the experiments, an optimal challenge dose of A. salmonicida subsp. salmonicida
AS05 strain was investigated by the IM injection of different numbers of bacterial
cells, which ranged from 2.5 × 102 to 2.5 × 104 CFU/fish. The results indicated that
100% of the fish were killed within 2 days after challenge with 2.5 × 103 and 2.5 ×
104 CFU/fish. In contrast, when 2.5 × 102 cells were injected, 70% of the fish were
killed within 3 days, and the remainder died after 3 to 4 days (data not shown).
Therefore, the lowest dose (2.5 × 102 CFU/fish) was used throughout the
experiments for lethal A. salmonicida infection.
To evaluate the protective effects of PAS-1, purified phage was administrated
into fish at an MOI of 10,000 immediately after bacterial challenge, and the fish
were observed for 14 days. All the fish in control groups, which were administrated
SM buffer without PAS-1, died within 3 days (mean time to death: 2.5±0.3 days),
showing furuncles in the bacterial injection site. However, we were able to find
significant protective effects in phage-administrated groups; the fish in phage-
administrated groups showed 26.7±2.9% survival rates from lethal A. salmonicida
infection, and the mean time to death (3.3±0.6 days) was also increased as
compared to those of control group (Table 3.4). The survived fish did not showed
furuncles in the bacterial injection site and remained healthy until 14 days pa. The
bacteria were re-isolated from all the dead fish, from phage-administrated groups
as well as control groups, thus indicating that the mortalities and protective effects
were caused by A. salmonicida and the phage PAS-1, respectively.
148
3.4. Discussion
Phages are generally known to live in close proximity to their host bacteria, and
A. salmonicida is primarily a water-born bacterial pathogen in fish. Therefore, we
screened for the presences of phages within the environment in rainbow trout
culture farm waters in Korea, and one lytic phage, PAS-1, was isolated. To date, a
total of 43 Aeromonas phages have been reported and morphologically classified as
tailed phages (33 of Myoviridae, 7 of Siphoviridae and 3 of Podoviridae) (1). In the
same manner, PAS-1 was also classified into the order Caudovirales and family
Myoviridae by morphological analysis. The phage infected all the A. salmonicida
subsp. salmonicida strains used in this study, including A. salmonicida subsp.
salmonicida ATCC 33658. Based on these results, the infectivity of PAS-1 did not
seem to be related to the source, year of isolation or antibiotic resistance of the host
A. salmonicida subsp. salmonicida strains. Interestingly, PAS-1 also infected other
subspecies of A. salmonicida such as subsp. achromogenes (AS03) and subsp.
masoucida (ATCC 27013), forming enlarged clear plaques (3~4 mm), which
differed slightly from those of the subsp. salmonicida strains. Therefore, it can be
assumed that PAS-1 might use a common outer membrane protein or
lipopolysaccharide among at least 3 subspecies of A. salmonicida (subsp.
salmonicida, subsp. achromogenes and subsp. masoucida) as a receptor during its
adsorption in host cells. To date, antibiotic-resistant A. salmonicida and several
atypical A. salmonicida have caused critical problems in worldwide aquaculture
(14, 29, 32). With demonstrated lytic activity against antibiotic-resistant strains and
broad host ranges among subspecies, the phage PAS-1 might be a candidate for
controlling A. salmonicida infections in aquaculture.
149
The PAS-1 possessed approximately 48 kb of ds gDNA which was susceptible
to digestion with different restriction endonuclease, and at least 9 structural
proteins. To date, 7 phages (phage 25, 31, Aeh1, 44RR2.8t, phiAS4, phiAS5 and
phiO18P) infecting Aeromonadaceae have been fully sequenced, and they were
classified into Myoviridae in the VIIIth ICTV Report
(http://www.ictvdb.org/Ictv/index.htm) as T4-like (phage 25, 31, Aeh1, 44RR2.8t,
phiAS4 and phiAS5) and P2-like (phage phiO18P) phages. In general, T4-like and
P2-like phages have the common morphology of Myoviridae, whereas the gDNA
sizes are considerably different, with approximately 160~250 kb and 31~36 kb,
respectively. However, the gDNA size of PAS-1 was quite different from T4-like or
P2-like Aeromonas phages, thus indicating that the isolated phage is novel.
Furthermore, our preliminary PAS-1 genome sequencing data revealed that the
closest relatives, according to similarity in putative amino acid sequences found in
the GenBank database, were the enterobacteria phage phiEcoM-GJ1 and
Aeromonas phage phiO18P. The predicted RNA polymerase, DNA polymerase and
large subunit terminase protein of PAS-1 were similar to those of phage phiEcoM-
GJ1, and the tail fiber and putative muramidase protein were homologous with
phage phiO18P. Interestingly, the phage phiEcoM-GJ1 was reported as the first
member of a new genus in Myoviridae, which possesses a coliphage T7-like
transcriptional system (RNA polymerase) and T1-like DNA packaging system
(large subunit terminase) (13). In addition, a potential phylogenetic relationship
between Aeromonas and enterobacteria phages was suggested by their genomic (6,
20, 25, 26) and morphological similarity (2). Therefore, it can be assumed that
PAS-1 might be genetically similar to phage phiEcoM-GJ1, at least in DNA
150
replication, packaging and transcription systems. Moreover, the host range of a
phage was determined by its tail fiber genes (35), and PAS-1 showed homology in
its tail fiber and muramidase protein with phage phiO18P, which infects A. media
(5), thus indicating that it might have similar adsorption and lysis systems against
its host cells. Moreover, PAS-1 was also structurally related with other phages;
major capsid protein showed similarity to phage phiEcoM-GJ1, and wac fibritin
neck whiskers and prohead core protein were similar to other T4-like Aeromonas
phages, Aeh1 and 44RR2.8t, respectively. Based on the genomic and proteomic
analysis of the phage PAS-1, it was novel but closely related with other Myoviridae
phages infecting enterobacter or Aeromonas species. Detailed complete genome
analysis and identification of the ORFs will be the subject of future research.
The TTSS gene in A. salmonicida subsp. salmonicida, which is responsible for
secretion of the ADP-ribosylating toxin AexT, was encoded on a thermolabile
plasmid, and the absence of the TTSS gene ascV disabled bacteria to secreting
AexT, even though the strain contained the aexT gene (34). Therefore, we screened
for the ascV gene in all 17 A. salmonicida strains used in this study, and A.
salmonicida subsp. salmonicida AS05 strain was selected for further experiments.
In the host cell lysis tests using the AS05 strain, the growths of bacteria was
apparently inhibited after PAS-1 inoculations. However, the OD600 values at MOI
of 0.01 and 1 were increased after 24 h post phage-inoculation, and phage-resistant
bacteria were isolated in all the MOI groups. Therefore, it can be assumed that A.
salmonicida subsp. salmonicida has its own phage-resistant mechanisms and this
resistance can also be achieved at high MOI values (100 and 10,000). However,
bacterial growth was apparently inhibited until 48 h post phage-inoculation at MOI
151
of 100 and 10,000; thus, a high MOI value was chosen for the further experiments
in this study. The phage-resistant mechanisms of A. salmonicida subsp.
salmonicida against the phage will also be further investigated in the future.
Furthermore, the fate of PAS-1 and immune response against it in rainbow trout
were also investigated. The phage in fish kidneys was detected until 200 h pa,
showing gradual reductions in its PFUs, regardless of its presences in the aquarium
waters of phage-administrated rainbow trout. Therefore, we hypothesized the
development of potential neutralizing activity in rainbow trout serum against phage
for two reasons. First, despite the presence of PAS-1 in the aquarium water, it was
not detected in phage-administrated fish kidneys after 240 h pa; and second, the
PFUs of PAS-1 were not increased or maintained in the aquarium water while they
decreased in fish kidneys. This data indicates that the excretion from the fish or
leakage from injection-mediated puncture were not the main causes of PFU
reduction in the fish kidney. Based on these results, the neutralizing activity of
rainbow trout serum against PAS-1 was evaluated from 10 days pa, when the phage
was not detected in the fish kidneys. As we expected, the significant neutralizing
activities against PAS-1 were observed at 10, 15 and 20 days pa and declined later.
According to the previous results of neutralizing activity against phage MS2 in
brown trout (Salmo trutta) (21), the primary antibody production was initiated
within the first 7 days pa, and the peak of antibody titer were reached at 14 days pa.
Even though we did not investigate the initiation of neutralizing activity in rainbow
trout, it can be assumed that rainbow trout can also obtain humoral immunity
against administrated phage because of the phage presence in the fish kidney until
200 h pa. This was also one of the reasons why a high MOI value was chosen for
152
further experiments.
Based on these preliminary results, the protective effects of PAS-1 were
evaluated with an MOI of 10,000 in rainbow trout furunculosis model. Some
therapeutic or prophylactic uses of A. salmonicida phages were previously
attempted, but the studies faced several difficulties with failures in fish protections
(10, 37). Unlike previous reports, the fish in the phage-administrated groups in this
study showed significantly improved survival rates and considerably increased
mean time to death values as compared with the control groups. Unlike other fish-
pathogenic bacteria, A. salmonicida subsp. salmonicida is capable of causing
disease in healthy salmonids at very low levels of infection; estimated LD50 was
lower than 10 CFU/ml by intra-peritoneal injection (7), and bacterial challenge
with the AS05 strain (2.5 × 102 CFU/fish) caused 100% of mortality in rainbow
trout within 4 days (this study). Additionally, clinical furunculosis usually occurs in
fingerling and juvenile salmonids as per-acute form with high mortality within a
significantly shorter time compared to adult fish (38). Moreover, while
administering phages orally in salmonids for therapeutic usage, the fish stomach
could be a critical barrier of phage delivery due to low pH (pH 2.5~4.0). Therefore,
phage administration time after bacterial infection and its administration route
should be considered as the most important factors in phage therapy against
furunculosis, and such considerations may help to minimize economic losses in
worldwide salmonid culture caused by casual as well as antibiotic-resistant A.
salmonicida.
3.5. References
153
1. Ackermann, H. W. 2007. 5500 Phages examined in the electron microscope. Arch.
Virol. 152:227-243.
2. Ackermann, H. W., et al. 1985. Aeromonas bacteriophages: Reexamination and
classification. Ann. Inst. Pasteur Virol. 136:175-199.
3. Adams, M. H. 1959. Bacteriophages. Interscience Publishers, New York.
4. Beaz-Hidalgo, R., G. E. Magi, S. Balboa, J. L. Barja, and J. L. Romalde. 2008.
Development of a PCR protocol for the detection of Aeromonas salmonicida in fish by
amplification of the fstA (ferric siderophore receptor) gene. Vet. Microbiol. 128:386-
394.
5. Beilstein, F., and B. Dreiseikelmann. 2008. Temperate bacteriophage øO18P from an
Aeromonas media isolate: Characterization and complete genome sequence. Virology
373:25-29.
6. Comeau, A. M., C. Bertrand, A. Letarov, F. Tétart, and H. M. Krisch. 2007. Modular
architecture of the T4 phage superfamily: a conserved core genome and a plastic
periphery. Virology 362:384-396.
7. Daly, J. G., A. K. Kew, A. R. Moore, and G. Olivier. 1996. The cell surface of
Aeromonas salmonicida determines in vitro survival in cultured brook trout
(Salvelinus fontinalis) peritoneal macrophages. Microb. Pathog. 21:447-461.
8. Fauquet, C., M. Mayo, J. Maniloff, U. Desselberger, and A. Ball. 2005. Virus taxonomy.
VIIIth report of the international committee on taxonomy of viruses:35-85.
9. Giraud, E., G. Blanc, A. Bouju-Albert, F. X. Weill, and C. Donnay-Moreno. 2004.
Mechanisms of quinolone resistance and clonal relationship among Aeromonas
salmonicida strains isolated from reared fish with furunculosis. J. Med. Microbiol.
53:895-901.
10. Imbeault, S., S. Parent, M. Lagacé, C. F. Uhland, and J. F. Blais. 2006. Using
bacteriophages to prevent furunculosis caused by Aeromonas salmonicida in farmed
154
brook trout. J. Aquat. Anim. Health 18:203-214.
11. Ishiguro, E., T. Ainsworth, R. Harkness, W. Kay, and T. Trust. 1984. A temperate
bacteriophage specific for strains of Aeromonas salmonicida possessing A-layer, a cell
surface virulence factor. Curr. Microbiol. 10:199-202.
12. Ishiguro, E., W. Kay, and T. Trust. 1980. Temperate bacteriophages for Aeromonas
salmonicida. FEMS Microbiol. Lett. 8:247-250.
13. Jamalludeen, N., et al. 2007. Complete genomic sequence of bacteriophage øEcoM-
GJ1: a novel phage that has myovirus morphology and a podovirus-like RNA
polymerase. Appl. Environ. Microbiol. 74:516-525.
14. Kim, J. H., et al. 2011. Molecular characterization of tetracycline- and quinolone-
resistant Aeromonas salmonicida isolated in Korea. J. Vet. Sci. 12:41-48.
15. Konopa, G., and K. Taylor. 1979. Coliphage λ ghosts obtained by osmotic shock or
LiCl treatment are devoid of J- and H-gene products. J. Gen. Virol. 43:729-733.
16. Lavigne, R., et al. 2009. Classification of Myoviridae bacteriophages using protein
sequence similarity. BMC Microbiol. 9:224.
17. Lukashin, A. V., and M. Borodovsky. 1998. GeneMark.hmm: New solutions for gene
finding. Nucleic Acids Res. 26:1107-1115.
18. Munro, J., J. Oakey, E. Bromage, and L. Owens. 2003. Experimental bacteriophage-
mediated virulence in strains of Vibrio harveyi. Dis. Aquat. Org. 54:187-194.
19. Nakai, T., and S. C. Park. 2002. Bacteriophage therapy of infectious diseases in
aquaculture. Res. Microbiol. 153:13-18.
20. Nolan, J., V. Petrov, C. Bertrand, H. Krisch, and J. Karam. 2006. Genetic diversity
among five T4-like bacteriophages. Virol. J. 3:30.
21. O'Neill, J. G. 1979. The immune response of the brown trout, Salmo trutta, L. to MS2
bacteriophage: immunogen concentration and adjuvants. J. Fish Biol. 15:237-248.
22. Park, S. C., I. Shimamura, M. Fukunaga, K. I. Mori, and T. Nakai. 2000. Isolation of
155
bacteriophages specific to a fish Pathogen, Pseudomonas plecoglossicida, as a
candidate for disease control. Appl. Environ. Microbiol. 66:1416-1422.
23. Paterson, W. D., R. J. Douglas, I. Grinyer, and L. A. McDermott. 1969. Isolation and
preliminary characterization of some Aeromonas salmonicida bacteriophages. J.
Fisheries Res. Board Canada 26:629-632.
24. Pavan, M., S. Abbott, J. Zorzopulos, and J. Janda. 2000. Aeromonas salmonicida
subsp. pectinolytica subsp. nov., a new pectinase-positive subspecies isolated from a
heavily polluted river. Int. J. Syst. Evol. Microbiol. 50:1119-1124.
25. Petrov, V. M., et al. 2006. Plasticity of the gene functions for DNA replication in the
T4-like phages. J. Mol. Biol. 361:46-68.
26. Petrov, V. M., S. Ratnayaka, and J. D. Karam. 2010. Genetic insertions and
diversification of the PolB-type DNA polymerase (gp43) of T4-related phages. J. Mol.
Biol. 395:457-474.
27. Popoff, M. 1971. Étude sur les Aeromonas salmonicida. II. Caractérisation des
bactériophages actifs sur les Aeromonas salmonicida et lysotypie. Ann. Rech. Vét
2:33-45.
28. Reith, M. E., et al. 2008. The genome of Aeromonas salmonicida subsp. salmonicida
A449: insights into the evolution of a fish pathogen. BMC Genomics 9:427.
29. Rhodes, G., et al. 2000. Distribution of oxytetracycline resistance plasmids between
aeromonads in hospital and aquaculture environments: implication of Tn1721 in
dissemination of the tetracycline resistance determinant tet A. Appl. Environ.
Microbiol. 66:3883-3890.
30. Rodgers, C. J., J. H. Pringle, D. H. Mccarthy, and B. Austin. 1981. Quantitative and
qualitative studies of Aeromonas salmonicida bacteriophage. J. Gen. Microbiol.
125:335-345.
31. Sakai, D. K. 1981. Heat inactivation of complements and immune hemolysin
156
reactions in rainbow trout, maw trout, coho salmon, goldfish and tilapia. Tokyo
Nippon Suisan Gakkai 47:565-571.
32. Schmidt, A. S., M. S. Bruun, I. Dalsgaard, and J. L. Larsen. 2001. Incidence,
distribution, and spread of tetracycline resistance determinants and integron-
associated antibiotic resistance genes among motile aeromonads from a fish farming
environment. Appl. Environ. Microbiol. 67:5675-5682.
33. Son, J. S., et al. 2010. Complete genome sequence of a newly isolated lytic
bacteriophage, EFAP-1 of Enterococcus faecalis, and antibacterial activity of its
endolysin EFAL-1. J. Appl. Microbiol. 108:1769-1779.
34. Stuber, K., S. E. Burr, M. Braun, T. Wahli, and J. Frey. 2003. Type III secretion genes
in Aeromonas salmonicida subsp. salmonicida are located on a large thermolabile
virulence plasmid. J. Clin. Microbiol. 41:3854-3856.
35. Tétart, F., F. Repoila, C. Monod, and H. M. Krisch. 1996. Bacteriophage T4 host
range is expanded by duplications of a small domain of the tail fiber adhesin. J. Mol.
Biol. 258:726-731.
36. Uchiyama, J., et al. 2008. Isolation and characterization of a novel Enterococcus
faecalis bacteriophage φEF24C as a therapeutic candidate. FEMS Microbiol. Lett.
278:200-206.
37. Verner-Jeffreys, D. W., et al. 2007. Furunculosis in Atlantic salmon (Salmo salar L.)
is not readily controllable by bacteriophage therapy. Aquaculture 270:475-484.
38. Wiklund, T., and I. Dalsgaard. 1998. Occurrence and significance of atypical
Aeromonas salmonicida in non-salmonid and salmonid fish species: a review. Dis.
Aquat. Org. 32:49-69.
157
Table 3.1. Bacterial strains used in this study and infectivity of Aeromonas phage PAS-1.
Bacterial species Strain Host range a EOPs b Source c
A. salmonicida subsp. salmonicida AS01 ++ 1.00 1
AS02 ++ 0.68±0.06 1
AS04 ++ 2.04±0.02 1
AS05 ++ 0.2±0.05 1
AS06 + 0.87±0.13 1
AS07 + 0.08±0.02 1
AS08 + 0.08±0.01 1
AS09 ++ 3.24±0.26 1
AS10 + 0.98±0.10 1
AS11 ++ 0.31±0.05 1
AS12 + 0.57±0.03 1
AS13 ++ 0.16±0.02 1
AS14 ++ 0.09±0.02 1
AS15 ++ 0.23±0.05 1
ATCC 33658 ++ 0.92±0.10 3
A. salmonicida subsp. achromogenes AS03 ++ 0.32±0.06 1
A. salmonicida subsp. masoucida ATCC 27013 ++ 1.35±0.13 3
A. hydrophila SNUFPC-A3 - NDd 1
SNUFPC-A5 - ND 1
SNUFPC-A6 - ND 1
SNUFPC-A7 - ND 1
SNUFPC-A8 - ND 1
SNUFPC-A9 - ND 1
SNUFPC-A10 - ND 1
SNUFPC-A11 - ND 1
SNUFPC-A12 - ND 1
SNUFPC-A13 - ND 1
A. media SNUFPC-A17 - ND 1
SNUFPC-22 - ND 1
SNUFPC-23 - ND 1
SNUFPC-24 - ND 1
SNUFPC-25 - ND 1
A. sobria SNUFPC-A1 - ND 1
SNUFPC-A2 - ND 1
SNUFPC-A4 - ND 1
SNUFPC-A16 - ND 1
SNUFPC-A26 - ND 1
Streptococcus iniae ATCC 29178 - ND 3
S. agalactiae ATCC 27956 - ND 3
Enterococcus faecium CCARM 5192 - ND 2
E. faecalis CCARM 5168 - ND 2
Vibrio vulnificus ATCC 27562 - ND 3
V. parahaemolyticus ATCC 17802 - ND 3
V. algynolyticus ATCC 17749 - ND 3
Staphylococcus aureus SA1 - ND 1
Listeria monocytogenes LM01 - ND 1
Escherichia coli DH10B - ND 4 a ++, clear plaque; +, turbid plaque; -, no plaque.
b The EOP values were shown as mean ± SD.
c 1, laboratory collection; 2, obtained from the Culture Collection of Antimicrobial Resistant Microbes (CCARM)
in Korea; 3, purchased from the American Type Culture Collection; 4, purchased from Invitrogen.
d Not done.
158
Table 3.2. Partial and complete ORFs of Aeromonas phage PAS-1.
No. Amino acid
size Amino acid identity (%)
Putative functions [organism]
E-value GenBank
accession No.
1 80 36/80 (45) DNA polymerase
[Enterobacteria phage phiEcoM-GJ1] 3e-14 JF342683
2 135 86/136 (64) large subunit terminase
[Enterobacteria phage phiEcoM-GJ1] 5e-47 JF342686
3 338 129/352 (37) RNA polymerase
[Enterobacteria phage phiEcoM-GJ1] 1e-44 JF342689
4 136 35/136 (26) putative tail fiber protein
[Aeromonas phage phiO18P] 3e-05 JF342690
5* 153 125/153 (82) putative muramidase
[Aeromonas phage phiO18P] 6e-72 JF342687
6* 431 197/383 (52) head portal protein
[Xanthomonas phage phiL7] 2e-117 JF342688
7* 145 42/148 (29) hypothetical protein
[Enterobacteria phage phiEcoM-GJ1] 2e-11 JF342684
*complete ORFs
159
Table 3.3. SDS-PAGE profile of the PAS-1 virion and their protein profiles by liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis.
MW (kDa)
Amino acid sequence Putative function [Organism] E-value
140 ISLTVFPIR Tail sheath protein
[Listeria phage A511] 9.0
52 LSRIAESARQKVEYAIRDGINSGK Phage head morphogenesis protein [Acinetobacter baumannii AB0057]
3e-13
48 SVRSFDGQRAVSFALR Wac fibritin neck whiskers [Aeromonas phage Aeh1]
1e-05
44 MNIEQIMSR hypothetical protein
[Pseudomonas phage JG024] 0.88
30 QLEFIEAQTYDTLYPELEAR Major capsid protein
[Enterobacteria phage phiEcoM-GJ1] 6e-11
15 QIARRAAK gp68 prohead core protein
[Aeromonas phage 44RR2.8t] ] 203
13 IGEKLVCTFNQHSHR hypothetical protein
[Pseudomonas phage LMA2] 0.96
11 YENLSMNSADAR Tail sheath protein
[Lutiella nitroferrum 2002] 0.009
8 FGPALNYLDAG gp37
[Mycobacterium phage Nigel] 0.22
250 -
150 -
100 -
75 -
50 -
37 -
25 -
20 -
15 -
10 -
Marker
(kDa)
PAS-1
160
Table 3.4. Protective effects in rainbow trout by PAS-1 from lethal A. salmonicida infection.
No. of
experiments
Phage
administration No. of survivors/total fish Survival rate (%)
Mean time to
death (day)
1st Yes 5/20 25 3.2
No 0/20 0 2.5
2nd Yes 5/20 25 2.8
No 0/20 0 2.3
3rd Yes 6/20 30 3.9
No 0/20 0 2.8
Total Yes 16/60 26.7±2.9 3.3±0.6
No 0/60 0 2.5±0.3
161
Figure 3.1. Electron micrographs of negatively stained Aeromonas phage PAS-1 virions.
Arrows A and B indicate the neck and the contracted tail, respectively.
A
B
B
162
Figure 3.2. One step growth of Aeromonas phage PAS-1 in A. salmonicida subsp.
salmonicida AS01 strain. The results are shown as means ± standard deviations, and latent
time and burst size were inferred from the triplicate experiments.
163
Figure 3.3. Time course of lytic activity against the host cell by Aeromonas phage PAS-1.
Pre-exponential cultures of A. salmonicida subsp. salmonicida AS05 strain were infected
with PAS-1 at MOI of 0, 0.01, 1, 100 and 10,000. The results are shown as means ±
standard deviations from triplicate experiments.
164
Figure 3.4. Fate of the Aeromonas phage PAS-1 in the rainbow trout kidney (PFU/g) and
its aquarium water (PFU/ml). The 0 h samples were collected before phage administration
and used for controls. The results are shown as means ± standard deviations from triplicate
experiments.
165
Figure 3.5. The neutralizing activities against Aeromonas phage PAS-1 in rainbow trout
serum after administration of phage. PAS-1 incubated with PBS was used as the negative
control. The 0 day sample was used as standard for all the time course samples in this study,
and a decrease in the number of PFU obtained after incubation was considered evidence of
neutralization. Significant differences (P<0.01) were observed at 10 and 15 days pa (shown
with asterisks). The results are shown as means ± standard deviations from triplicate
experiments.
166
GENERAL CONCLUSION
Recently, the antibiotic resistance in A. salmonicida has been recognized as a
serious concern in world wide aquaculture. However, the acquisition and
prevalence of antibiotic resistance in this bacterium have not yet been investigated
in Korea. Therefore, in the first step towards, the acquisitions of antibiotic
resistance and its molecular characteristics in 16 A. salmonicida strains (14 of A.
salmonicida subsp. salmonicida and 1 each of A. salmonicida subsp. achromogenes
and subsp. flounderacida) isolated from Korean aqauculture were investigated. The
bacterial isolates showed high resistant rates against tetracycline and quinolones,
when measured via minimal inhibitory concentration tests. Most of the
tetracycline-resistant strains harbored tetA genes and most of the quinolone-
resistance of A. salmonicida isolates was due to point mutations in the gyrA codon
83 of QRDRs. Additionally, we confirmed the high genetic clonality among the
Korean A. salmonicida subsp. salmonicida stains, when compared to other isolates
from different geographical regions.
Therefore in the second step towards, in order to develop alternative control
methods against this antibiotic-resistnant fish pathogen, we isolated several
bacteriophages (phages) infecting A. salmonicida subsp. salmonicida from various
environmental waters or fish in Korea. Among those phages, several biological
properties and genome sequences of two T4-like Myoviridae phages (named as
phiAS4 and phiAS5) which showed broad host ranges to other Aeromonadaceae as
well as A. salmonicida subsp. salmonicida were analyzed. In addition, the
functional activity of the putative lysozyme murein hydrolase (orf117) in phiAS5,
167
which had no holin or holin-like gene, was investigated, and the result revealed that
it may use a dual lysis system during host cell lysis. Based on these results, we
confirmed that the two phages will have the potential for controlling A.
salmonicida subsp. salmonicida in Korean aquaculture and may also advance
recent understanding of the biodiversity in T4-like phages.
In the third step towards, to search for candidate control agents and to evaluate
its therapeutic potential against furunculosis in salmonid culture, we selected one
novel lytic Myoviridae phage (PAS-1) which showed the strongest bacteriolytic
activity among those isolated Aeromonas phages against virulent A. salmonicida
subsp. salmonicida that possesses TTSS-related ascV gene. And the protective
effects of PAS-1 were verified in experimental rainbow trout furunculosis model
therapy, showing increased survival rates and mean time to death.
Based on these results, it can be concluded that A. salmonicida subsp.
salmonicida already acquired resistance against antibiotics used for aquaculture in
Korea, and Aeromonas phages that infect those antibiotic-resistant A. salmonicida
subsp. salmonicida strains could be considered as altervative therapeutic or
prophylactic candidates against salmonid furunculosis in Korean aquaculture.
168
국
한 연어과 어류에 감염하는
항생제 내 Aeromonas salmonicida에 대한
박테리 파아지 제법 개발
2008-30469 지
공 보건학 공
울 학 과 학원
연어과 어 창병(furunculosis)과 다양한 어 에 균 증
야 하는 Aeromonas salmonicida subsp. salmonicida는 지속 계 어
양식분야에 심 한 피해를 야 했 며, 근 본 균 산용 항생
에 한 내 획득 타 산생 뿐만 아니라 공 보건에 잠재 인
우 인하여 심각한 아들여지고 있다. 그러나 한국 어
양식업 경우, 본 균 항생 내 획득 여부는 연구 지
않았다.
이러한 이 , 본 연구에 는 우 2006 부 2009 사이에
한국 연어과 어 , 타 양식어 양식 경에 분리 16주 A.
salmonicida (subsp. salmonicida 14주, subsp. achromogenes 1주 subsp.
flounderacida 1주) tetracycline과 quinolone 계열 항생 에 한 내 획득
여부를 조사하 다. 조사 16주 A. salmonicida 균주는 tetracycline과
169
quinolones 계열 항생 에 하여, 각각 50% (8주) 100% (16주) 내
나타내었다. Tetracycline 계열 항생 에 내 보인 8주 A.
salmonicida 경우, 7주는 tetA 내 자를, 1주는 tetE 내 자를 지
닌 것 인 었다. 또한, 본 균 quinolone 계열 항생 에 한 내
작 히 하여, quinolone-resistance determining regions (QRDRs)
gyrA parC 자 돌연변이 여부가 조사 었다. 본 조사 결과, 15
주 A. salmonicida gyrA 자 83번 코돈에 돌연변이가 생하여, 해
당 사 아미노산 산 이 Ser83→Arg83 Ser83→Asn83 변 가
것 인하 다. 그러나 근 quinolone 계열 항생 에 내 야 하는
것 알 있는 QRDRs 또 다른 gyrA 자 87번, 92번 코돈
parC 자 80번, 84번 코돈에 는 돌연변이가 찰 지 않았다. 다
인 항생 내 A. salmonicida subsp. salmonicida 14주 미주지
역에 분리 A. salmonicida subsp. salmonicida ATCC 33658간 체
사도를 하 하여 pulsed field gel electrophoresis (PFGE)를 행하
며, 그 결과 해당 균주 14주 모 미주지역에 분리 균과 다른
하나 사한 군집 구분 며, 한국 분리주 간 체 사도가
상당히 높 찰할 있었다.
다 단계 , 항생 내 A. salmonicida를 구 하 한 일 , 분
리 균주 A. salmonicida subsp. salmonicida에 감염하는 리 아
지 (이후 아지) 분리를 다양한 경 어 샘플에 실시하 다.
이러한 아지 분리 실험 결과 A. salmonicida subsp. salmonicida를 감염하
170
는 다양한 아지가 분리 었 며, 이 지역 경 에 분리
2종 T4-like 아지 (phiAS4 phiAS5) 상 체 분 이 행
었다. 미롭게도 본 아지들 A. salmonicida subsp. salmonicida 뿐만
아니라 Aeromonadaceae 분 는 다른 종 균들에도 감염능 나타
내었 며, 이를 통하여 주역 지닌 것 인 었다. 해당
아지 체 체 분 결과, phiAS4 phiAS5 모 double-
stranded DNA 체를 지니고 있었 며, 각각 163,875bp (G+C 함량:
41.3%) 225,268bp (G+C 함량: 43.0%) 분 었다. 아지 phiAS4
체에 는 271개 ORF, 67개 promoter, 25개 terminator 16개
tRNA가 견 었 며, 아지 phiAS5 체 경우 343개 ORF, 69
개 promoter, 33개 terminator 24개 tRNA가 견 었다. 특이하게
도, phiAS4 phiAS5 아지는 각각 존에 보고 었 T4-like Aeromonas
아지 25 T4-like Aeromonas 아지 Aeh1과 높 체 사도를
나타내었다. 상 아지들과 T4 phage 체 사도 분 결과,
phiAS4 phiAS5 아지는 새 운 종 T4-like 아지 분 는 것
인할 있었다. 또한 holing, holin-like 자가 견 지 않 phiAS5
아지 lysozyme murein hydrolase (orf117) 자 능
재조합 단 질 합 법에 라 검 하 고, 검사 결과 해당 아
지는 주 균 포 용해 시 dual lysis system (endolysin + holin) 용
하는 것 인할 있었다. 본 결과를 토 , 한국에 분리
phiAS4 phiAS5 아지는 한국 양식어 A. salmonicida subsp.
171
salmonicida 감염증 구 할 있는 잠재 인 항생 체 가능 지
니는 것 입증할 있었 며, 또한 해당 아지 체 분 통하
여 T4-like 아지 체 다양 인할 있었다.
마지막 단계 , 앞 시 아지 잠재 인 항생 체 가능
실 증명하 하여, 분리 었 다양한 아지들 A.
salmonicida subsp. salmonicida 균들에 강한 감염능과 용해능 보이는
다른 한 종 아지 (PAS-1)를 별하여 이에 한 효능효과 실험
행하 다. 본 아지는 지개 송어 양식장 출 에 분리 었 며, 항
생 내 균주를 포함한 다양한 아종 (subsp. salmonicida, subsp.
achromogenes subsp. masoucida) A. salmonicida를 감염하는 주
역과 불어 감염능 나타내는 균에 한 강한 용해능 나타내었다.
자 미경 사용한 태학 분 결과 본 아지는 Myoviridae 분
었 며, 체 분 결과 약 48 kb double-strand DNA를 지니
는 것 인 었다. 또한 자 열 이러스 구조 단 질 아
미노산 열 분 결과, 존에 보고 enterobacteria Aeromonas spp.를
감염하는 아지 사 힐 있었다. 본 아지 지개송어
에 A. salmonicida subsp. salmonicida에 한 구 능 검 하 하여,
근 A. salmonicida subsp. salmonicida 병원 에 가장 하게 이
있는 것 알 진 Type III secretion system ascV 자를 보 하며
항생 내 나타내는 A. salmonicida subsp. salmonicida AS05 균주를
하 며, 해당 균주에 한 아지 in vitro 용해능 우
172
하 다. 또한 해당 아지만 지개 송어에 종하여 감 를 조사
한 결과, 종 후 200시간 지 아지가 개체 내에 존재하며 지개 송
어가 종 아지에 하여 항원항체 통한 면역 나타냄
인하 다. 이러한 결과를 토 , 농도 아지를 사용하여
인공 A. salmonicida subsp. salmonicida AS05 균주에 감염 지개
송어에 한 료를 시도하 며, 아지 료를 시도한 어군에 폐
사 감소 폐사시간 연장 등 결과를 얻었다.
상 같 결과를 토 , 본 연구에 는 한국에 일 생
하는 A. salmonicida subsp. salmonicida 뿐만이 아니라 항생 내 균주에
한 아지 항생 체 가능 인할 있었다. 라 아지
를 사용한 A. salmonicida subsp. salmonicida 구 법 한국 연어과 어
양식 산업에 있어 해당 균에 한 료 한 항생 체
안이 있 것 사료 다.
Key words: Aeromonas salmonicida subsp. salmonicida, 항생 내 , 연어과
어 , 리 아지, 항생 체
Student number: 2008-30469
173
List of published articles
2012
1. Ji Hyung Kim, Jin Woo Jun, Casiano H. Choresca, Sang Phil Shin, Jee Eun Han, Se
Chang Park (2012) Complete genome sequence of a novel marine siphovirus pVp-1,
infecting Vibrio parahaemolyticus. J. Virol. 86:7013.
2. Ji Hyung Kim, Hye Kwon Kim, Van Giap Nguyen, Bong Kyun Park, Casiano H.
Choresca, Sang Phil Shin, Jee Eun Han, Jin Woo Jun, Se Chang Park (2012) Genomic
sequence of infectious hypodermal and hematopoietic necrosis virus (IHHNV) KLV-
2010-01 originating from the first Korean outbreak in cultured Litopenaeus vannamei.
Arch. Virol. 157:369-373.
3. Ji Hyung Kim, Jee Soo Son, Casiano H. Choresca, Sang Phil Shin, Jee Eun Han, Jin
Woo Jun, Do Hyung Kang, Chulhong Oh, Soo Jin Heo, Se Chang Park (2012)
Complete Genome sequence of bacteriophage phiAS7, a T7-like virus that infects
Aeromonas salmonicida subsp. salmonicida. J. Virol. 86:2894.
4. Ji Hyung Kim, Jee Soo Son, Yoon Jae Choi, Casiano H. Choresca, Sang Phil Shin,
Jee Eun Han, Jin Woo Jun, Se Chang Park (2012) Complete genomic sequence of a
T4-like bacteriophage phiAS4 infecting Aeromonas salmonicida subsp. salmonicida.
Arch. Virol. 157:391-395.
5. Ji Hyung Kim, Jee Soo Son, Yoon Jae Choi, Casiano H. Choresca, Sang Phil Shin,
Jee Eun Han, Jin Woo Jun, Do Hyung Kang, Chulhong Oh, Soo Jin Heo, Se Chang
Park (2012) Isolation and characterization of a lytic Myoviridae bacteriophage PAS-1
with broad infectivity in Aeromonas salmonicida. Curr. Microbiol. 64:418–426.
6. Ji Hyung Kim, Jee Soo Son, Yoon Jae Choi, Casiano H. Choresca, Sang Phil Shin,
Jee Eun Han, Jin Woo Jun, Se Chang Park (2012) Complete genome sequence and
characterization of a broad-host range T4-like bacteriophage phiAS5 infecting
Aeromonas salmonicida subsp. salmonicida. Vet. Microbiol. 157:164–171.
7. Jee Eun Han, Ji Hyung Kim, Casiano Choresca Jr., Sang Phil Shin, Jin Woo Jun, Ji
Young Chai, Sang Yoon Han, Se Chang Park (2012) First description of the qnrS-like
(qnrS5) gene and analysis of quinolone resistance-determining regions in motile
Aeromonas spp. from diseased fish and water. Res. Microbiol. 163:73–79.
174
8. Jin Woo Jun, Ji Hyung Kim, Casiano Choresca Jr., Sang Phil Shin, Se Chang Park
(2012) Isolation, molecular characterization and antibiotic susceptibility of Vibrio
parahaemolyticus in Korean seafood. Foodborne Pathog. Dis. 9:224-231.
9. Jee Eun Han, Ji Hyung Kim, Casiano Choresca Jr., Sang Phil Shin, Jin Woo Jun, Ji
Young Chai, Sang Yoon Han, Se Chang Park (2012) Prevalence of tet gene and
complete genome sequencing of tet gene-encoded plasmid (pAHH01) isolated from
Aeromonas species in South Korea. J. Appl. Microbiol. 112:631-638.
10. Jee Eun Han, Ji Hyung Kim, Casiano Choresca Jr., Sang Phil Shin, Jin Woo Jun, Ji
Young Chai, Sang Yoon Han, Se Chang Park (2012) A small IncQ-type plasmid
carrying the quinolone resistance (qnrS2) gene from Aeromonas hydrophila. Lett.
Appl. Microbiol. 54:374-376.
2011
1. Ji Hyung Kim, Casiano H. Choresca Jr., Sang Phil Shin, Jee Eun Han, Jin Woo Jun,
Se Chang Park (2011). Occurrence and antibiotic resistance of Vibrio vulnificus in
seafood and environmental waters in Korea. J. Food Saf. 31:518-524.
2. Ji Hyung Kim, Sun Young Hwang, Jee Soo Son, Jee Eun Han, Jin Woo Jun, Sang
Phil Shin, Casiano H. Choresca Jr., Yun Jaie Choi, Yong Ho Park, Se Chang Park
(2011). Molecular characterization of tetracycline- and quinolone-resistant Aeromonas
salmonicida isolated in Korea. J. Vet. Sci. 12:41-48.
3. Ji Hyung Kim, Casiano H. Choresca Jr., Sang Phil Shin, Jee Eun Han, Jin Woo Jun,
Sang Yoon Han, Se Chang Park (2011). Detection of infectious hypodermal and
hematopoietic necrosis virus (IHHNV) in Litopenaeus vannamei shrimp cultured in
South Korea. Aquaculture, 313:161-164.
4. Jin Woo Jun, Ji Hyung Kim, Casiano H. Choresca Jr., Sang Phil Shin, Jee Eun Han,
Dal Sang Jeong, Se Chang Park (2011) Isolation and molecular detection of
Plesiomonas shigelloides containing tetA gene from Asian arowana (Scleropages
formosus) in a Korean aquarium. Afr. J. Microbiol. Res. 5:5019-5021.
5. Jee Eun Han, Casiano H. Choresca Jr., Ok Jae Koo, Hyun Ju Oh, So Gun Hong, Ji
Hyung Kim, Sang Phil Shin, Jin Woo Jun, Byeong Chun Lee, Se Chang Park (2011).
Establishment of glass catfish (Kryptopterus bicirrhis) fin-derived cells. Cell Biol. Int.
Rep. 18:e00008.
6. Sang Yoon Han, Sang Phil Shin, Ji Hyung Kim, Casiano H. Choresca Jr., Jee Eun
Han, Jin Woo Jun, Se Chang Park (2011). Prevalence and different characteristics of
175
two serotypes of Streptococcus parauberis isolated from the farmed olive flounder,
Paralichthys olivaceus (Temminck & Schlegel), in Korea. J. Fish Dis. 34:731-739.
7. Sang Phil Shin, Jee Eun Han, Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca
Jr., Jin Woo Jun, Se Chang Park (2011). Identification of scuticociliate Philasterides
dicentrarchi from indo-pacific seahorses Hippocampus kuda. Afr. J. Microbiol. Res.
5:738-741.
8. Dennis K. Gomez, Seong Joon Joh, Hwan Jang, Sang Phil Shin, Casiano H. Choresca
Jr., Jee Eun Han, Ji Hyung Kim, Jin Woo Jun, Se Chang Park (2011). Detection of
koi herpesvirus (KHV) from koi (Cyprinus carpio koi) broodstock in South Korea.
Aquaculture, 311:42-47.
9. Casiano H. Choresca Jr., Dennis K. Gomez, Sang Phil Shin, Ji Hyung Kim, Jee Eun
Han, Jin Woo Jun, Se Chang Park (2011). Molecular detection of Edwardsiella tarda
with gyrB gene isolated from pirarucu, Arapaima gigas which is exhibited in an
indoor private commercial aquarium. Afr. J. Biotechnol. 10:848-850.
10. Sang Phil Shin, Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca Jr., Jee Eun
Han, Jin Woo Jun, Se Chang Park (2011). Detection and genetic analysis of
aquabirnaviruses in subclinically infected aquarium fish. J. Vet. Diagn. Invest. 23:325-
329.
11. Sang Phil Shin, Hyang Jee, Jee Eun Han, Ji Hyung Kim, Casiano H. Choresca Jr., Jin
Woo Jun, Dae Yong Kim, Se Chang Park (2011). Surgical removal of an anal cyst
caused by a protozoan parasite (Thelohanellus kitauei) from a koi (Cyprinus carpio). J.
Am. Vet. Med. Assoc. 238:784-786.
12. Casiano H. Choresca Jr., Dennis K. Gomez, Ji Hyung Kim, Jee Eun Han, Sang Phil
Shin, Byung Chun Lee, Se Chang Park (2011). Cryopreservation of goldfish caudal
fin explants using glycerol as a cryoprotecant. Cryo Letters 32:57-61.
13. Sang Yoon Han, Bo Kyu Kang, Bong Jo Kang, Jong Man Kim, Jee Eun Han, Ji
Hyung Kim, Casiano Choresca Jr., Sang Phil Shin, Jin Woo Jun and Se Chang Park
(2011) Protective Efficacy of a combined vaccine against Edwardsiella tarda,
Streptococcus iniae, and Streptococcus parauberis in farmed olive flounder
Paralichthys olivaceus. Fish pathol. 46:108-111.
2010
176
1. Ji Hyung Kim, Dennis K. Gomez, Toshihiro Nakai, Se Chang Park (2010). Isolation
and identification of bacteriophages infecting ayu Plecoglossus altivelis altivelis
specific Flavobacterium psychrophilum. Vet. Microbiol. 140:109-115.
2. Ji Hyung Kim, Dennis K. Gomez, Toshihiro Nakai, Se Chang Park (2010). Plasmid
profiling of Flavobacterium psychrophilum isolates from ayu (Plecoglossus altivelis
altivelis) and other fish species in Japan. J. Vet. Sci. 11:85-87.
3. Jin-Woo Jun, Ji Hyung Kim, Casiano Choresca Jr., Dennis K. Gomez, Sang-Phil
Shin, Jee-Eun Han, Se-Chang Park (2010). Isolation of Aeromonas sobria containing
hemolysin gene from Arowana (Scleropages formosus). J. Vet. Clin. 27:62-65.
4. Jee Eun Han, Sang Phil Shin, Ji Hyung Kim, Casiano H. Choresca Jr., Jin Woo Jun,
Dennis K. Gomez, Se Chang Park (2010). Mortality of cultured koi Cyprinus carpio
in Korea caused by Bothriocephalus acheilognathi. Afr. J. Microbiol. Res. 4:543-546.
5. Jin Woo Jun, Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr., Jee Eun
Han, Sang Phil Shin, Se Chang Park (2010). Occurrence of tetracycline-resistant
Aeromonas hydrophila infection in Korean cyprinid loach (Misgurnus
anguillicaudatus). Afr. J. Microbiol. Res. 4:849-855.
6. Sang-Phil Shin, Hyang Jee, Jee-Eun Han, Dennis K. Gomez, Ji Hyung Kim, Casiano
H. Choresca Jr., Jin-Woo Jun, Dae-Yong Kim, Se-Chang Park (2010). Occurrence of
goiter in flowerhorn cichlid (Family: Cichlidae) and its effect on liver. J. Vet. Clin.
27:202-204.
7. Jin-Woo Jun, Ji Hyung Kim, Jee-Eun Han, Sang-Phil Shin, Dennis K. Gomez,
Casiano Choresca Jr., Kyu-Seon Oh, Se-Chang Park (2010). Isolation of
Photobacterium damselae subsp. damselae from the giant grouper, Epinephelus
Lanceolatus. J. Vet. Clin. 27:618-621.
8. Casiano H. Choresca Jr., Dennis K. Gomez, Jee-Eun Han, Sang-Phil Shin, Ji Hyung
Kim, Jin-Woo Jun, Se-Chang Park (2010). Molecular detection of Aeromonas
hydrophila isolated from albino catfish, Clarias sp. reared in an indoor commercial
aquarium. Taehan Suui Hakhoe Chi Taehan Suui Hakhoe 50:331-333.
9. Gun Wook Baeck, Se Chang Park, Ji Hyung Kim, Ki Moon Nam, Sung Hoei Heo, Ju
Myun Park (2010). Reproductive ecology of a goldeye rockfish, Sebastes thompsoni
(Scorpaeniformes: Scorpaenidae) in the coastal waters of busan, Korea. Han Gug
Eoryu Hag Hoeji 22:34-40.
10. Sung Hoei Heo, Ju Myun Park, Se Chang Park, Ji Hyung Kim, Gun Wook Baeck
177
(2010). Feeding habits of 6 shark species in the southern sea of Korea. Fish Aquat. Sci.
43:254-261.
11. Gun Wook Baeck, Sung Hoei Heo, Se Chang Park, Ji Hyung Kim, Ju Myun Park
(2010). Seasonal variation in species composition and abundance of fish assemblages
collected by a three-side fyke net in the coastal waters off gori, Korea. Han Gug Eoryu
Hag Hoeji 22:186-194.
12. Casiano H. Choresca Jr., Seung Ho Choi, Dennis K. Gomez, Ji Hyung Kim, Se
Chang Park (2010). Bacteria isolated from the mucus of farm-raised adult and juvenile
charm abalone, Haliotis discus hannai. J. World Aquac. Soc. 41:139-144.
13. Casiano H. Choresca Jr., Ok Jae Koo, So Goon Hong, Hyun Joo Oh, Dennis K.
Gomez, Ji Hyung Kim, Byung Chun Lee, Se Chang Park (2010). Effect of dimethyl
sulfoxide on cell cycle synchronization of goldfish caudal fin derived fibroblasts cells.
Reprod. Domest. Anim. 45:E73-E77.
14. Jee-Eun Han, Dennis K. Gomez, Ji Hyung Kim, Casiano Choresca Jr., Sang-Phil
Shin, Se Chang Park (2010). Isolation of a zoonotic pathogen Kluyvera ascorbata
from egyptian fruit-bat Rousettus aegyptiacus. J. Vet. Med. Sci. 72:85-87.
2009
1. Gun Wook Baeck, Ji Hyung Kim, Casiano Choresca Jr., Dennis K. Gomez, Sang Phil
Shin, Jee Eun Han, Se Chang Park (2009). Mass mortality of doctor Fish (Garra rufa
obtusa) caused by Citrobacter freundii infection. J. Vet. Clin. 26:150-154.
2. Sang Phil Shin, Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr., Jee Eun
Han, Se Chang Park (2009). Isolation and characterization of Morganella morganii
from Asian water monitor Varanus salvator. J. Vet. Clin. 26:391-394.
3. Jee Eun Han, Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca, Sang Phil Shin,
Gun Wook Baeck, Se Chang Park (2009). Isolation of Photobacterium damselae
subsp. damselae from zebra shark Stegostoma fasciatum. Taehan Suui Hakhoe Chi
Taehan Suui Hakhoe 49:35-38.
4. Casiano H. Choresca Jr., Ok Jae Koo, Hyun Joo Oh, So Goon Hong, Dennis K.
Gomez, Ji Hyung Kim, Byung Chun Lee, Se Chang Park (2009). Different culture
conditions used for arresting the G0/G1 phase of the cell cycle in goldfish (Carassius
auratus) caudal fin-derived fibroblasts. Cell Biol. Int. 33:65-70.
178
2008
1. Ji Hyung Kim (2008). Bacterial and viral diseases in Korean cultured flounder
(Paralichthys olivaceus). M.Sc. Thesis, Seoul National University.
2. Dennis K. Gomez, Gun Wook Baeck, Ji Hyung Kim, Casiano H. Choresca Jr., Se
Chang Park (2008). Molecular detection of betanodaviruses from apparently healthy
wild marine invertebrates. J. Invertebr. Pathol. 97:197-202.
3. Dennis K. Gomez, Gun Wook Baeck, Ji Hyung Kim, Casiano H. Choresca Jr., Se
Chang Park (2008). Genetic analysis of betanodaviruses in subclinically infected
aquarium fish and invertebrate. Curr. Microbiol. 56:449-504.
4. Dennis K. Gomez, Gun Wook Baeck, Ji Hyung Kim, Casiano H. Choresca Jr., Se
Chang Park (2008). Molecular detection of betanodavirus in 6 wild marine fish
populations in Korea. J. Vet. Diagn. Invest. 20:38-44.
5. Ji Hyung Kim, Kyong Yeon Kim, Tae Youp Oh, Hwan Jang, Seong Joon Joh, Dennis
K. Gomez, Casiano H. Choresca Jr. Se Chang Park (2008). Infection of Clinostomum
complanatum in Korean barbell (Hemibarbus mylodon). J. Vet. Clin. 25:307-309.
6. Casiano H. Choresca Jr., Ji Hyung Kim, Dennis K. Gomez, Hwan Jang, Seong Joon
Joh, Se Chang Park (2008). Isolation of Serratia fonticola from Pirarucu Arapaimas
gigas. Taehan Suui Hakhoe Chi Taehan Suui Hakhoe 48:89-92.
7. Mi Hyeon You, Ji Hyung Kim, Dae Yong Kim, Dennis Kaw Gomez, Tae Sung Jung,
Se Chang Park (2008). Pleuritis and pericarditis associated with Klebsiella
pneumoniae in a Eurasian beaver (Castor Fiber). Taehan Suui Hakhoe Chi Taehan
Suui Hakhoe 48:501-503.
8. Jae Won Kim, Yang Ho Yoon, Hyun Chool Shin, Toru Takita, Ji Hyung Kim, Se
Chang Park, Chan Il Park, Gun Wook Baeck (2008). Reproduction of the goby fish
Periophthalmus magnuspinnatus in mud flat of suncheon bay, Korea. Hangug Susan
Haghoi Ji 41:289-293.
2007
1. Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr., Se Chang Park (2007).
179
Detection of major bacterial and viral pathogens in trash fish used to feed cultured
flounder in Korea. Aquaculture 272:105-110.
2. Ji Hyung Kim, Geun Mo Park, Kyong Yeon Kim, Tae Youp Oh, Dennis K. Gomez,
Se Chang Park (2007). Treatment in gill cover curling of Arowana. J. Vet. Clin. 24:56-
58
3. Ji Hyung Kim, Gun Wook Baeck, Kyong Yeon Kim, Tae Youp Oh, Dennis K.
Gomez, Se Chang Park (2007). Infectious of Proteus vulgaris in black-spotted
porcupine fish. J. Vet. Clin. 24:42-45.
4. Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca Jr., Gun Wook Baeck, Se
Chang Park (2007). Selective non digestion of yellow mealworm Tenebrio molitor
larvae by Arowana. Taehan Suui Hakhoe Chi Taehan Suui Hakhoe 47:191-195.
5. Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca Jr., Se Chang Park (2007).
Sensitivity between two diagnostic methods for detection of hepatopancreatic
parvovirus (HPV) infection in shrimp Penaeus monodon. Lab. Anim. Res. 23:109-112.
6. Gun Wook Baeck, Dennis K. Gomez, Kyu Seon Oh, Ji Hyung Kim, Casiano H.
Choresca Jr., Se Chang Park (2007). Detection of piscine nodaviruses from apparently
healthy wild marine fish in Korea. Bull. Eur. Assoc. Fish Pathol. 27:116-122.
2006
1. Ji Hyung Kim, Dennis K. Gomez, Gun Wook Baeck, Gee Wook Shin, Gang joon
Heo, Tae Sung Jung, Se Chang Park (2006). Pathogenicity of Streptococcus
parauberis to olive flounder, Paralichthys olivaceus. Fish Pathol. 41:171-173
2. Ji Hyung Kim, Kyung Taeck Lim, Dennis K. Gomez, Gun Wook Baeck, Gang Joon
Heo, Se Chang Park (2006). Fate and survivability of fish bacteriophage inoculated in
BALB/c mice. Lab. Anim. Res. 22:421-423.
3. Gun WooK Baeck, Ji Hyung Kim, Dennis K. Gomez, Se Chang Park (2006).
Isolation and characterization of Streptococcus sp. from diseased flounder
(Paralichthys olivaceus) in Jeju island. J. Vet. Sci. 7:53-58
2005
180
1. Ji Hyung Kim, Kyung Taek Lim, Tae Sung Jung, Nam Shik Shin, Jae Hak Park,
Gang Joon Heo, Se Chang Park (2005). Characterization of Aeromonas spp. isolated
from Neon tetra (Hyphessobrycon herbertaxelrodl). J. Vet. Clin. 22:114-118.
2. Kyung Taek Lim, Ji Hyung Kim, Jae Hak Park, Nam Shik Shin, Gang Joon Heo, Se
Chang Park (2005). Treatment of Dactylogyrosis in Oscar (Astronotus ocellatus). J.
Vet. Clin. 22:160-162.
181
List of conference attendance
2011
1. Jee Eun Han, Ji Hyung Kim, Casiano H. Choresca Jr., Sang Phil Shin, Jin Woo Jun, Ji
Young Chai and Se Chang Park: Quinolone resistance and their genetic determinants
in motile Aeromonas spp. from the diseased fishes and environmental water in Korea.
Aquaculture Europe 2011, Greece (Rhodes) Oct., 2011.
2. Jee Eun Han, Ji Hyung Kim, Casiano H. Choresca Jr., Sang Phil Shin, Jin Woo Jun
and Se Chang Park: Identification of tetracycline resistance gene encoded R- plasmid
in Aeromonas hydrophila from a cherry salmon. Aquaculture Europe 2011, Greece
(Rhodes) Oct., 2011.
3. Casiano H. Choresca Jr., Su Jin Kim, Jung Taeck Kang, Bego Roibas da Torre, Ji
Hyung Kim, Sang Phil Shin, Jee Eun Han, Jin Woo Jun and Se Chang Park:
Transfection of goldfish Carassius auratus caudal fin derived primary cells.
Aquaculture Europe 2011, Greece (Rhodes) Oct., 2011.
4. Sang Phil Shin, Ji Hyung Kim, Casiano H. Choresca Jr., Jee Eun Han, Jin Woo Jun
and Se Chang Park: Rapid detection and isolation of Salmonella sp. from amphibians
and reptiles. Aquaculture Europe 2011, Greece (Rhodes) Oct., 2011.
5. Jin Woo Jun, Ji Hyung Kim, Casiano H. Choresca Jr., Jee Eun Han, Sang Phil Shin
and Se Chang Park: Isolation, molecular characterization and antibiotic susceptibility
of Vibrio parahaemolyticus in Korean seafood. Aquaculture Europe 2011, Greece
(Rhodes) Oct., 2011.
6. Jin Woo Jun, Ji Hyung Kim, Casiano H, Choresca Jr., Jee Eun Han, Sang Phil Shin
and Se Chang Park: Isolation and molecular detiction of Plesiomonas shigelloides
containing tetA gene from asian arowana Scleropages formosus in a Korean aquarium.
Aquaculture Europe 2011, Greece (Rhodes) Oct., 2011.
7. Ji-Hyung Kim, Casiano H. Choresca Jr., Sang-Phil Shin, Jee-Eun Han, Jin-Woo Jun,
Se-Chang Park: Molecular identification of infectious hypodermal and Hematopoietic
Necrosis Virus (IHHNV) from Litopenaeus vannamei Shrimp Cultured in South
Korea. Aquaculture Europe 2011, Greece (Rhodes) Oct., 2011.
8. Ji-Hyung Kim, Casiano H. Choresca Jr., Sang-Phil Shin, Jee-Eun Han, Jin-Woo Jun,
Se-Chang Park: Antimicrobial resistance and clonal relatedness of Aeromonas
182
salmonicida isolates from cultured fish in South Korea. Aquaculture Europe 2011,
Greece (Rhodes) Oct., 2011.
9. Jin-Woo Jun, Ji-Hyung Kim, Casiano H. Choresca Jr., Sang-Phil Shin, Jee-Eun Han,
Eun-Chae Rye, Se Chang Park Vibrio parahaemolyticus in live seafood and related
environment: 2009 Korea survey. 2011 Korean Society of Veterinary Science
Conference and General Meeting, Korea (Chonan) Oct., 2011.
10. Ji-Hyung Kim, Casiano H. Choresca Jr., Sang-Phil Shin, Jee-Eun Han, Jin-Woo Jun,
Sang-Yoon Han, Do-Hyung Kang, Se-Chang Park: First detection and genome
sequencing of infectious hypodermal and hematopoietic necrosis virus (IHHNV) from
Litopenaeus vannamei shrimp cultured in South Korea. 2011 Korean Society of
Veterinary Science Conference and General Meeting, Korea (Chonan) Oct., 2011.
11. Sang-Phil Shin, Ji-Hyung Kim, Casiano H. Chroresca Jr., Jee-Eun Han, Jin-Woo Jun,
Eun-Chae Ryu, Se-Chang Park: Phylogenetic characterization of Thelohanellus
kitauei about host specificity and tissue tropism. 2011 Korean Society of Veterinary
Science Conference and General Meeting, Korea (Chonan) Oct., 2011.
12. Jee Eun Han, Ji Hyung Kim, Casiano Choresca Jr., Sang Phil Shin, Jin Woo Jun, Ji
Young Chai, Sang Yoon Han, Eun Chae Ryu, Se Chang Park: Detection of new qnrS
gene in motile Aeromonas spp. from diseased fish and water. 2011 Korean Society of
Veterinary Science Conference and General Meeting, Korea (Chonan) Oct., 2011.
13. Casiano Choresca Jr, Ji-Hyung Kim, Jee Eun Han, Sang Phil Shin, Jin Woo Jun, Eun
Chae Ryu, Byeong Chun Lee, Se Chang Park: Culture of goldfish caudal fin explants:
Influence of storage media, time and glycerol cryopreservation. 2011 Korean Society
of Veterinary Science Conference and General Meeting, Korea (Chonan) Oct., 2011.
14. Sang-Phil Shin, Ji-Hyung Kim, Casiano H. Chroresca Jr., Jee-Eun Han, Jin-Woo Jun,
Eun-Chae Ryu, Se-Chang Park: Comparison of detection methods of Salmonella sp.
from amphibians and reptiles. 2011 Korean Society of Veterinary Science Conference
and General Meeting, Korea (Chonan) Oct., 2011.
15. Jee Eun Han, Ji Hyung Kim, Casiano Choresca Jr., Sang Phil Shin, Jin Woo Jun, Eun
Chae Ryu, Se Chang Park: Prevalence of tet gene in Aeromonas species isolated from
environmental water and cultured fish in South Korea. 2011 Korean Society of
Veterinary Science Conference and General Meeting, Korea (Chonan) Oct., 2011.
16. Ji-Hyung Kim, Ji-Soo Son, Casiano-Hermopia Choresca Jr., Sang-Phil Shin, Jee-Eun
Han, Jin-Woo Jun, Do-Hyung Kang, Se-Chang Park: Isolation of a novel virulent
Myoviridae bacteriophage PAS-1 infecting Aeromonas salmonicida subsp.
183
salmonicida. 2011 Korean Society of Veterinary Science Conference and General
Meeting, Korea (Chonan) Oct., 2011.
17. Jin-Woo Jun, Ji-Hyung Kim, Casiano H. Choresca Jr., Jee-Eun Han, Sang-Phil Shin,
Eun-Chae Ryu, Se-Chang Park: Occurrence of Plesiomonas shigelloides infection
containing tetA gene in Asian arowana (Scleropages formosus). 2011 Korean Society
of Veterinary Science Conference and General Meeting, Korea (Chonan) Oct., 2011.
18. Casiano Choresca Jr., Su Jin Kim, Jung Taek Kang, Bego Roibas da Torre, Ji Hyung
Kim, Jee Eun Han, Sang Phil Shin, Jin Woo Jun, Eun Chae Ryu, Goo Jang, Byeong
Chun Lee, Se Chang Park: Transient transfection of red fluorescent protein gene in
goldfish caudal fin derived primary cells. 2011 Korean Society of Veterinary Science
Conference and General Meeting, Korea (Chonan) Oct., 2011.
2010
1. Sang Phil Shin, Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca Jr., Jee Eun
Han, Jin Woo Jun and Se Chang Park: Detection and genetic analysis of aqua-
birnaviruses in subclinically infected aquarium fish. Aquaculture Europe 2010, Portugal
(Porto) Oct., 2010.
2. Casiano H. Choresca Jr., Jee Eun Han, Dennis K. Gomez, Sang Phil Shin, Ji Hyung
Kim, Jin Woo Jun and Se Chang Park: Mortality of albino catfish Clarias batrachus
caused by Aeromonas hydrophila exhibited in an indoor commercial aquarium.
Aquaculture Europe 2010, Portugal (Porto) Oct., 2010.
3. Jee Eun Han, Sang Phil Shin, Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca
Jr., Jin Woo Jun and Se Chang Park: Mortality of cultured koi Cyprinus carpio in Korea
caused by Bothriocephalus acheilognathi. Aquaculture Europe 2010, Portugal (Porto)
Oct., 2010.
4. Jin Woo Jun, Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr., Jee Eun Han,
Sang Phil Shin and Se Chang Park: Occurrence of tetracycline-resistant Aeromonas
hydrophila infection in Korean cyprinid loach Misgurnus anguillicaudatus. Aquaculture
Europe 2010, Portugal (Porto) Oct., 2010.
5. Sang Phil Shin, Hyang Jee, Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca Jr.,
Jee Eun Han, Jin Woo Jun, Dae Yong Kim and Se Chang Park: Occurrence of goiter in
flowerhorn cichlid and its effect on liver. Aquaculture Europe 2010, Portugal (Porto)
Oct., 2010.
184
6. Jee Eun Han, Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr., Sang Phil
Shin, Jin Woo Jun and Se Chang Park: Antimicrobial resistance and its genetic
determinants in Aeromonas hydrophila from aquarium-cultured cherry salmon
Oncorhynchus masou masou. Aquaculture Europe 2010, Portugal (Porto) Oct., 2010.
7. Jin Woo Jun, Ji Hyung Kim, Dennis K. Gomez, Casiano H, Choresca Jr., Jee Eun Han,
Sang Phil Shin and Se Chang Park: Isolation of Photobacterium damselae subsp.
damselae from giant grouper Epinephelus lanceolatus. Aquaculture Europe 2010,
Portugal (Porto) Oct., 2010.
2009
1. Ji Hyung Kim, Dennis K. Gomez, Casiano H, Choresca Jr., Jee Eun Han, Jin Woo
Jun, Sang Phil Shin and Se Chang Park: Citrobacter freundii infection of doctor fish
Garra rufa obtusa with mass mortality. The 2nd FASAVA Congress 2009, Thailand
(Bangkok) Nov., 2009.
2. Ji Hyung Kim, Dennis K. Gomez, Casiano H, Choresca Jr., Jee Eun Han, Jin Woo
Jun, Sang Phil Shin and Se Chang Park: Experimental infection of aquatic animals
with low pathogenic avian influenza virus (H9N2) of Korean isolate. The 2nd
FASAVA Congress 2009, Thailand (Bangkok) Nov., 2009.
3. Jee Eun Han, Ji Hyung Kim, Dennis K. Gomez, Casiano H, Choresca Jr., Jin Woo
Jun, Sang Phil Shin and Se Chang Park: Isolation of a zoonotic pathogen Kluyvera
ascorbata from Egyptian fruit-bat Rousettus aegyptiacus. The 2nd FASAVA Congress
2009, Thailand (Bangkok) Nov., 2009.
4. Jee Eun Han, Ji Hyung Kim, Dennis K. Gomez, Casiano H, Choresca Jr., Jin Woo
Jun, Sang Phil Shin and Se Chang Park: Development of fish somatic cell line derived
from fin of glass catfish Kryptopterus bicirrhis. The 2nd FASAVA Congress 2009,
Thailand (Bangkok) Nov., 2009.
5. Sang Phil Shin, Dennis K. Gomez, Casiano H, Choresca Jr., Ji Hyung Kim, Jee Eun
Han, Jin Woo Jun and Se Chang Park: Morphological and molecular identification of
scuticociliate Philasterides dicentrarchi in Indo-Pacific deahorse Hippocampus kuda.
The 2nd FASAVA Congress 2009, Thailand (Bangkok) Nov., 2009.
6. Sang Phil Shin, Dennis K. Gomez, Casiano H, Choresca Jr., Ji Hyung Kim, Jee Eun
Han, Jin Woo Jun and Se Chang Park: Surgical removal of anal cyst from koi
Cyprinus carpio koi caused by Thelohanellus kitauei. The 2nd FASAVA Congress
2009, Thailand (Bangkok) Nov., 2009.
185
7. Dennis K. Gomez, Casiano H, Choresca Jr., Ji Hyung Kim, Sang Phil Shin, Jee Eun
Han, Jin Woo Jun and Se Chang Park: Mortality of banded hound shark Triakis
Scyllium caused by Citrobacter koseri in a commercial aquarium. The 2nd FASAVA
Congress 2009, Thailand (Bangkok) Nov., 2009.
8. Dennis K. Gomez, Casiano H, Choresca Jr., Ji Hyung Kim, Sang Phil Shin, Jee Eun
Han, Jin Woo Jun and Se Chang Park: Molecular detection of betanodaviruses from
wild marine or freshwater fishes and invertebrates in Korea. The 2nd FASAVA
Congress 2009, Thailand (Bangkok) Nov., 2009.
9. Casiano H, Choresca Jr., Dennis K. Gomez, Ji Hyung Kim, Sang Phil Shin, Jee Eun
Han, Jin Woo Jun and Se Chang Park: Isolation of Edwardsiella tarda from pirarucu
Arapaima Gigas maintained in a private commercial aquarium. The 2nd FASAVA
Congress 2009, Thailand (Bangkok) Nov., 2009.
10. Casiano H, Choresca Jr., Dennis K. Gomez, Ji Hyung Kim, Sang Phil Shin, Jee Eun
Han, Jin Woo Jun and Se Chang Park: Culture of goldfish caudal fin explants: Effect
of storage time, storing media and glycerol cryopreservation. The 2nd FASAVA
Congress 2009, Thailand (Bangkok) Nov., 2009.
11. Jin Woo Jun, Ji Hyung Kim, Dennis K. Gomez, Casiano H, Choresca Jr., Jee Eun
Han, Sang Phil Shin and Se Chang Park: Isolation of Aeromonas sobria encoding
hemolysin gene from dragon fish Scleropages formosus. The 2nd FASAVA Congress
2009, Thailand (Bangkok) Nov., 2009.
12. Jin Woo Jun, Ji Hyung Kim, Dennis K. Gomez, Casiano H, Choresca Jr., Jee Eun
Han, Sang Phil Shin and Se Chang Park: Mass mortality of cyprinid loach Misgurnus
anguillicaudatus caused by Aeromonas hydrophila. The 2nd FASAVA Congress 2009,
Thailand (Bangkok) Nov., 2009.
2008
1. Ji Hyung Kim, Se Chang Park, Dennis K. Gomez, Casiano. H. Choresca Jr., Gang
Joon Heo: Feeding trash fish can be a source of inoculum for streptococcosis in
cultured flounder. Aquaculture Europe 2008, Poland (Krakow) Sep., 2008.
2. Casiano H. Choresca Jr., Dennis K Gomez, Ji Hyung Kim, Sang Phil Shin, Jee Eun
Han, Se Chang Park: Effects on larval settlement of mucus-associated microflora of
charm abalone (Haliotis discus hannai). Aquaculture Europe 2008, Poland (Krakow)
Sep., 2008.
186
3. Casiano H. Choresca Jr., Se Chang Park, Byeong Chun Lee, Ok Jae Koo, Dennis K.
Gomez, So Gun Hong, Hyun Joo Oh, Ji Hyung Kim, Jee Eun Han, Sang Phil Shin,:
Cell cycle synchronization of goldfish (Carassius auratus) caudal fin derived
fibroblasts with different culture conditions to obtain G0/G1 phase somatic cell
population for fish nuclear transfer. Aquaculture Europe 2008, Poland (Krakow) Sep.,
2008.
4. Dennis K. Gomez, Ji Hyung Kim, Casiano H, Choresca Jr., Sang Phil Shin, Jee Eun
Han, Se Chang Park: Molecular epidemiological analyses of betanodaviruses from
fishes and invertebrates in Korea. 2008 Korean Society of Veterinary Science
Conference and General Meeting, Korea (Gwangju) Sept., 2008.
5. Sang Phil Shin, Ji Hyung Kim, Jee Eun Han, Casiano H. Choresca Jr., Dennis K.
Gomez, Se Chang Park: Identification of scuticociliate, Philasterides dicentranchi in
Indo-Pacific seahorse Hippocampus kuda using PCR. 2008 Korean Society of
Veterinary Science Conference and General Meeting, Korea (Gwangju) Sept., 2008.
6. Ji Hyung Kim, Dennis Kaw Gomez, Casiano Choresca Jr., Jee Eun Han, Sang Phil
Shin, Toshihiro Nakai, Se Chang Park: Isolation and characterization of Ayu
Plecoglossus altivelis altivelis specific Flavobacterium psychrophilum bacteriophages.
2008 Korean Society of Veterinary Science Conference and General Meeting, Korea
(Gwangju) Sept., 2008.
7. Casiano H. Choresca Jr., Dennis K Gomez, Ji Hyung Kim, Sang Phil Shin, Jee Eun
Han, Se Chang Park: Microflora associated with mucus of charm abalone Haliotis
discus hannai. 2008 Korean Society of Veterinary Science Conference and General
Meeting, Korea (Gwangju) Sept., 2008.
8. Jee Eun Han, Dennis Kaw Gomez, Ji Hyung Kim, Casiano Choresca Jr., Sang Phil
Shin, Se Chang Park: Isolation of a zoonotic pathogen Kluyvera ascorbata from
Egyptian fuit-bat Rousettus aegyptiacus. 2008 Korean Society of Veterinary Science
Conference and General Meeting, Korea (Gwangju) Sept., 2008.
9. Sang Phil Shin, Ji Hyung Kim, Jee Eun Han, Casiano H. Choresca Jr., Dennis K.
Gomez, Se Chang Park: Isolation of Morganella morganii from Asian water monitor
Varanus salvator. 2008 Korean Society of Veterinary Science Conference and General
Meeting, Korea (Gwangju) Sept., 2008.
10. Jee Eun Han, Sang Phil Shin, Dennis Kaw Gomez, Ji Hyung Kim, Casiano Choresca
Jr., Se Chang Park: Isolation of Photobacterium damselae spp. damselae from zebra
shark Stegosotoma fasciatum in the aquarium with zoonotic potential. 2008 Korean
187
Society of Veterinary Science Conference and General Meeting, Korea (Gwangju)
Sept., 2008.
11. Ji Hyung Kim, Dennis Kaw Gomez, Casiano Choresca Jr., Jee Eun Han, Sang Phil
Shin, Toshihiro Nakai, Se Chang Park: Plasmid profiling as a typing method for
Flavobacterium psychrophilum isolates from wild and cultured freshwater fish in
Japan. 2008 Korean Society of Veterinary Science Conference and General Meeting,
Korea (Gwangju) Sept., 2008.
12. Casiano H. Choresca Jr., Ok Jae Koo, So Gun Hong, Jee Eun Han, Dennis K. Gomez,
Ji Hyung Kim, Sang Phil Shin, Byeong Chun Lee, Se Chang Park: Preliminary study
of storing fish fin explants. 2008 Korean Society of Veterinary Science Conference
and General Meeting, Korea (Gwangju) Sept., 2008.
2007
1. Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr., Se Chang Park: Detection
of major bacterial and viral pathogens from trash fish for cultured flounder. 13th
International Symposium for World Association of Veterinary Laboratory
Diagnosticians, Preparing for the Animal Health of Challenges of the Future, Australia
(Melbourne) Nov., 2007
2. Dennis K. Gomez, Ji Hyung Kim, Casiano H. Choresca Jr., Se Chang Park:
Molecular detection of betanodaviruses from subclinically infected aquarium fishes
and invertebrates. 13th International Symposium for World Association of Veterinary
Laboratory Diagnosticians, Preparing for the Animal Health of Challenges of the
Future, Australia (Melbourne) Nov., 2007
3. Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr., Se Chang Park: Detection
of major bacterial and viral pathogens from trash fish for cultured flounder. 2007
International Symposium of Preventive Medicine (Prevention and Control of
Antimicrobial Resistance and Zoonoses), Korea (Seoul) Apr., 2007.
4. Dennis K. Gomez, Gun Wook Baeck, Ji Hyung Kim, Casiano H. Choresca Jr. Se
Chang Park: Betanodaviruses from subclinically infected wild marine invertebrates.
2007 International Symposium of Preventive Medicine (Prevention and Control of
Antimicrobial Resistance and Zoonoses), Korea (Seoul) Apr., 2007.
5. Casiano H. Choresca Jr., Dennis K. Gomez, Ji Hyung Kim, Se Chang Park: Bacterial
flora from mucus of charm abalone Haliotis discus hannai. 2007 International
188
Symposium of Preventive Medicine (Prevention and Control of Antimicrobial
Resistance and Zoonoses), Korea (Seoul) Apr., 2007.
2006
1. Ji Hyung Kim, Dennis K. Gomez, Gun Wook Baeck, Se Chang Park: Isolation and
pathogenicity test of Streptococcus parauberis from olive flounder (Paralichthys
olivaceus) in Korea. The 50th Annual Meeting and Conference of the Korean Society
of Veterinary Science, Korea (Tongyeung) Sep., 2006.
2. Dennis K. Gomez, Gun Wook Baeck, Ji Hyung Kim, Se Chang Park: Detection of
piscine nodaviruses from apparently healthy wild marine fish in Korean peninsula.
The 50th Annual Meeting and Conference of the Korean Society of Veterinary Science,
Korea (Tongyeung) Sep., 2006.
3. Dennis K. Gomez, Ji Hyung Kim, Se Chang Park: Detection of betanodaviruses, the
causative agent of viral nervous necrosis (VNN) from several ornamental fishes with
no clinical signs. The 50th Anniversary of the Korean Society of Veterinary Science
and the 30th Anniversary of the Korean Society of Veterinary Public Health – 2006
International Symposium (Roles and Contribution of Veterinary Medicine to
Preventive Medicine), Korea (Seoul) Apr., 2006.
2005
1. Ji Hyung Kim, Kyung Taek Lim, Ji Hun Choi, Tae Sun Kim, Geun Mo Park, Bo Gyu
Kang, Dennis K. Gomez, Se Chang Park: Isolation and characterization of
Streptococcus sp. from diseased flounder in Jeju isalnd. The Korean Society of
Veterinary Science, The 49th Annual Meeting of the Korean Society of Veterinary
Science, Korea (Jeju Island) Sep., 2005.
2. Kyung Taek Lim, Ji Hyung Kim, Ji Hun Choi, Tae Sun Kim, Geun Mo Park, Dennis
K. Gomez, Nam Shik Shin, Se Chang Park: Fate and survivability of bacteriophage in
mice. The Korean Society of Veterinary Science, The 49th Annual Meeting of the
Korean Society of Veterinary Science, Korea (Jeju Island) Sep., 2005.
189
Acknowledgements
I wish to express my sincere gratitude to Prof. Se Chang Park for my
encouragement, creative advice and guidance during my master and doctoral
courses. His abilities to guide unique and creative ideas along with his vast
technical experience for inspection have been of enormous impression for me. And
my thanks should be extended to the committee members of this doctoral thesis,
Prof. Byeong Chun Lee, Prof. Gee Wook Shin, Prof. Mahanama de Zoysa and Dr.
Seong Joon Joh for their valuable comments and advices.
Additionally, I express deepest thanks to the all the members of Laboratory of
Aquatic Animal Medicine in SNU (Mr. Casiano H. Choresca Jr., Mr. Sang Phil
Shin, Ms. Jee Eun Han, Mr. Jin Woo Jun, Mr. Sang Yoon Han, Ms. Yeon Hee Kim,
Ms. Eun Chae Ryu and Mr. Moon Sup Kim) for providing the support extended in
carrying out laboratory maintenances, many experimental advices and helps. And I
really wish to express my thanks to Dr. Dennis K. Gomez, who was a previous old
lab member and the one who gave me valuable advices, guidance and experiences.
And I wish to cherish the memory and pray for the deceased experimental animals
during my study. Also, I wish to thank all of my friends in College of Veterinary
Medicine in SNU including epidemiology, immunology, microbiology, avian
disease, veterinary public health, etc. and I really wish to gratitude to all the
members in virology Lab (especially my old mate Hye Kwon Kim, Hyung Joon
Moon, Sung Joon Park and Nguyen van Giap) who have shared difficulties
together for many years.
My doctoral courses and study would never been completed without the belief
190
from my family. I wish to give the biggest and greatest thanks to my mother, father,
grand-parents, brother and his wife. And I am also thankful to all of my relatives
and old buddies. I really would like to share this moment with my dearest love, Ms.
Hye Kyung Yeum, who has been looked for silver linings in every cloud for me.
And I express deepest thanks to the staff of Department of food and animal
science, College of Agriculture and Life Sciences (CALS) in SNU for molding me
into what I am now. Also, I'm really much obliged to Dr. Jee Soo Son for his efforts
and passion, and I wish to cherish every moment that we have investigated together
in the 1st floor at CALS.
Also, I wish to express my deep thank to Dr. Do Hyung Kang, Dr. Chulhong Oh,
Dr. Soo Jin Heo, all the lab colleagues and Indian Ocean research team in Korea
Ocean Research and Development Institute (KORDI) with their helps and advices.
And still, there are far too many people to be thanked, and my thanks and gratitude
are too numerous to list completely. I wish to express lively sense of gratitude to
everyone to be thanked.
All my study were financially supported by the Brain Korea 21 Program for
Veterinary Science in SNU, by a Korean Research Foundation Grant and by the
Basic Science Research Program through National Research Foundation of Korea
funded by the Ministry of Education, Science, and Technology.
April 23. 2012.
Ji Hyung Kim
