General and Comparative Endocrinology 166 (2010) 529–536

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier .com/locate /ygcen

Nucleotide sequence, tissue expression patterns and phylogenetic analysisof estrogen receptor one mRNA in the Murray rainbowfish (Melanotaeniafluviatilis) (Atheriniformes, Actinopterygii)

Marianne Woods a,b,*, Anupama Kumar a, Mary Barton b

a Centre for Environmental Contaminants Research, CSIRO Land and Water, PMB 2, Glen Osmond 5064, Australiab Sansom Institute, Division of Health Sciences, University of South Australia, North Terrace, Adelaide 5000, Australia

a r t i c l e i n f o

Article history:Received 9 July 2009Revised 12 February 2010Accepted 15 February 2010Available online 18 February 2010

Keywords:Estrogen receptorEsr1RainbowfishMelanotaenia fluviatilisTissue expressionPhylogenetic analysis

0016-6480/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.ygcen.2010.02.015

* Corresponding author. Address: Centre for EResearch, CSIRO Land and Water, PMB 2, Glen Osmo8 303 8565.

E-mail address: marianne.woods@csiro.au (M. Wo

a b s t r a c t

Estrogens are steroidal hormones that control many physiological processes in both female and malevertebrates. Like other vertebrates, fish have two distinct estrogen receptors (Esr) subtypes, Esr1 andEsr2a that have been isolated in a number of species, as well as a third subtype, Esr2b. The mRNA encod-ing the Esr1 was isolated from the female liver of an Australian freshwater fish, the Murray rainbowfish,Melanotaenia fluviatilis. The rainbowfish esr1 cDNA was 2569 bp in length and with an open readingframe to encode a protein of 611 amino acids. Phylogenetic analysis and multiple amino acid sequencealignment indicated close relationship and high similarity with killifish (Fundulus heteroclitus) and gilt-head sea bream (Sparus aurata). Expression of rainbowfish esr1 mRNA was abundant in the liver, gonadsand intestine of adult female and male rainbowfish. This is the first isolation of the full-length nucleotidesequence of an estrogen receptor from rainbowfish. This sequence provides a valuable molecular tool thatcan be used in future studies investigating estrogen mechanisms, actions and tissue-specific expressionin juvenile and adult rainbowfish.

� 2010 Elsevier Inc. All rights reserved.

1. Introduction

Estrogen receptors (Esr) are members of a large superfamily ofligand-dependent nuclear receptors. These also include receptorsfor other steroid hormones, secosteroids, thyroid hormone, reti-noids and a group of orphan receptors (Kumar and Thompson,1999). In mammals, two distinct estrogen receptor genes exist,(Esr1 and Esr2) (Kuiper et al., 1997), whereas in teleost fish oneEsr1 (formally known as ER) and two Esr2 subtypes, Esr2a andEsr2b (formally known as ER and ER, respectively) have been de-scribed (Hawkins et al., 2000). For two Esr subtypes (Esr1 andEsr2), one or multiple splice variants have been reported (Menuetet al., 2001; Caviola et al., 2007). The presence of these multiple Esrsubtypes in fish has lead to an increase in the characterisation andtissue-specific expression of these subtypes in different fish speciesincluding channel catfish (Ictalurus punctatus) (Xia et al., 2000),largemouth bass (Micropterus salmoides) (Sabo-Attwood et al.,2004), European sea bass (Dicentrarchus labrax) (Halm et al.,2004), goldfish (Carassius auratus) (Choi and Habibi, 2003), killifish(Fundulus heteroclitus) (Greytak and Callard, 2007) and zebrafish

ll rights reserved.

nvironmental Contaminantsnd 5064, Australia. Fax: +61

ods).

(Danio rerio) (Legler et al., 2002). Although all three Esr subtypesare activated by estrogens, the tissue distribution and expressionlevels, the responses exhibited, and the ligand-binding affinity toother molecules may diverge (Hawkins and Thomas, 2004; Pintoet al., 2006; Greytak and Callard, 2007).

Differential sex-specific tissue expressions of the Esr have beenshown in different fish species. For example, in largemouth bass(M. salmoides), females exhibited high levels of esr1 in the livertissue, while ovary tissue exhibited the highest levels of expressionof both esr2a and esr2b (Sabo-Attwood et al., 2004). In goldfish(C. auratus), both male and female fish had the highest expressionlevels of esr1 and esr2a2 in the pituitary tissue, whereas for esr2a1the highest expression was noted in the gonadal tissue (Choi andHabibi, 2003). In yellow perch (Perca flavescens), the female liverand ovary had the highest expression of esr1 and esr2a. In male li-ver tissue, moderate expression of both esr was reported, whereasno expression was observed for either esr subtype in the testis(Lynn et al., 2008). Comparative analysis of esr sex-specific tissueexpression is important in identifying target tissues of estrogensin each species.

Although multiple forms of the Esr have been described, thecloning and characterisation of the Esr in an Australian freshwaterfish species has not been previously reported. The Australian Mur-ray rainbowfish (Melanotaenia fluviatilis) belongs to the class Actin-opterygii (ray-finned fishes), order Atheriniformes (silversides) and

530 M. Woods et al. / General and Comparative Endocrinology 166 (2010) 529–536

family Melanotaeniidae, that includes a small group of fishes fromnorthern and eastern Australia, and from New Guinea and somenearby islands. It residues in inland Murray-Darling Basin, span-ning New South Wales, Victoria and South Australia (Allen,1991). It is a small fish, with adult fish averaging 8 cm in length.The rainbowfish is oviparous and under controlled laboratory con-ditions, spawning can occur daily throughout the year. The Murrayrainbowfish has been used successfully as a test species in previouslaboratory studies and to monitor environmental contaminants inAustralian water bodies. In 2002, a base-line reproductive study onthis species was conducted by Pollino and Holdway (2002) and in2007, Pollino et al. (2007) assessed the potential reproductive ef-fects of laboratory exposures of 17b-estradiol (E2) to male and fe-male fish. The authors reported changes in phosphoproteins and c-glutamyltranspeptidase (GTP) in male fish exposed to E2 at con-centrations ranging from 30 to 1000 ng/L within 14 days andchanges in egg production in females were observed at 300 and1000 ng/L (Pollino et al., 2007). A recent study by Woods et al.(2009) reported changes in the localisation and abundance ofesr1, esr2 and vitellogenin (vtg; female egg yolk protein) mRNAstaining in the liver and testis of mature male rainbowfish exposedto E2 via the water for 7 days. This study revealed that in malerainbowfish vtg protein was detected in the testis and was up-reg-ulated in response to E2 exposure. The function of this locally pro-duced vtg is unknown and may suggest implication in themediation of adverse effects of endocrine disrupting chemicalssuch as testicular growth inhibition, testis-ova and sex reversal.These studies indicate that the Murray rainbowfish may be a goodcandidate for investigating estrogen mechanisms, actions, and tis-sue-specific expression in juvenile and adult fish exposed to xeno-estrogen contaminants in the Australian riverine environment.

The aim of the current study was to clone esr1 in the Murrayrainbowfish in order to determine the sex-specific tissue distribu-tion of esr1 in male and female rainbowfish. In addition, the de-duced amino acid sequences were used to generate alignmentsand a phylogenetic tree with other esr1 sequences. The results fromthis study form the basis for further investigations on the molecu-lar regulation of esr1 and estrogen actions in rainbowfish.

Table 1Primers for esr1 and 18S rRNA used in RT-PCR and RACE PCR.

Oligo name Sequencea (50–30)

cesr11b TCACCATGATGACCCTGCTCcesr12b GGTGCDTTTTCDTTCTGCACTesr11 GCTGAGCCGACCTTACACTGesr12 CTGGTGCGTTTTTCTTTCTGC18SrRNA1 CAGTTATGGTTCCTTTGATCGC18SrRNA2 CTGCCCTATCAACTTTCGATG

2. Materials and methods

2.1. Animals

Mature female and male M. fluviatilis, (approximately 1 year oldweighing 2–3 g) were obtained from Ausyfish, Queensland. Uponarrival to the laboratory, fish were maintained under constant con-ditions in fish tanks containing an artificial freshwater recirculat-ing system (at 24 �C, pH 7.6, 8.4 ppm oxygen and a hardness of100 mg CaCO3/L) with a flow through rate of 5 L/min and fish load-ing not exceeding 10 g fish/L. A 16 h light:8 h darkness photoperiodwas maintained using cool white fluorescent lamps, with a 60 mindawn:dusk transition period. Fish were fed dried fish flakes (Nutri-fin, Aggies Aquariums) at 2% body weight per day. Fish were killedin accordance with the guidelines and principles of the Institute ofMedical and Veterinary Science Animal Ethics Committee and thetarget tissue (brain, gill, intestine, liver, muscle and gonads) wasexcised using sterile, RNase-free dissecting equipment. Tissueswere flash-frozen in liquid nitrogen and stored at –80 �C untilRNA isolation.

GSP1esr1 (5’) CTGGAGGTGCTGATGATCGGGCTGSP2esr1 (3’) TCACCATGATGACCCTGCTCACCANGSP1esr1 CCAAGTACTGCTGCTTGAGAGCTCATGG50esr1SEQ GACGAGGCATGCGATGTG

a A = adenine, C = cytosine, G = guanine, T = thymine, degenerate base pairsD = A + T + G, R = G + A.

b Primers designed based on census with other fish species.

2.2. RNA isolation and semi-quantitative RT-PCR

Total RNA was isolated from the brain, gill, intestine, liver, mus-cle and gonads (ovary or testis) from adult male and female rain-bowfish using a QIAGEN�RNeasy� mini total RNA isolation kit

(QIAGEN� Pty. Ltd.) according to the manufacturer’s protocol.RNA was treated with DNase 1 and the integrity was examinedon a denaturing agarose gel. Total RNA yield was estimated usingQuant-iT™ RiboGreen� RNA assay kit (Invitrogen). RNA was storedat �80 �C until use.

No published sequences exist for the rainbowfish. Therefore, con-sensus primers for esr1 (cesr11 and cesr12; Table 1) were designed ona conserved region of the LBD of the esr1 of zebrafish (D. rerio;AF349412), gilthead sea bream (Sparus aurata; AF136979), Nile tila-pia (Tilapia nilotica; U75604), channel catfish (I. punctatus;AF061275), goldfish (C. auratus; AY055725), medaka (Oryzias sp.;D28954) and rainbow trout (Oncorhynchus mykiss; AJ242740). Theseprimers were designed in highly conserved areas between fish spe-cies, but poorly conserved areas between esr1 and esr2a. Gene-spe-cific primers were designed based on sequence analysis of cDNAfragments obtained from RT-PCR with the consensus primers. Thegene-specific primer sets used for esr1 (esr11 and esr12) RT-PCRare listed in Table 1. The 18SrRNA1 and 18SrRNA2 primers (Table1) were designed on a conserved region of the 18S rRNA of giltheadsea bream (S. aurata; AY993930), killifish (F. heteroclitus; M91180),Japanese medaka (Oryzias latipes; AB105163), European perch (Percafluviatilis; AF518195) and Atlantic salmon (Salmo salar; AJ427629).

One step RT-PCR was used for amplification of fragments(which contained 300 ng of total RNA) following the manufac-turer’s protocol (QIAGEN� Pty. Ltd.). Negative controls (containingno RNA template) for each primer pair was run concurrently witheach reaction. PCR amplifications were performed using an Eppen-dorf Master Cycler Gradient (ThermoFisher Scientific). Reversetranscription was conducted at 50 �C for 30 min followed by an ini-tial PCR activation at 95 �C for 15 min. Amplification of esr1 wasperformed by 35 successive PCR cycles (94 �C for 30 s, 58 �C for30 s and 72 �C for 1 min). A final extension step was conductedat 72 �C for 10 min. Amplification of 18S rRNA was performed fol-lowing the same conditions used for esr1 except 0.3 lM of both for-ward and reverse primers were used and amplification wasconducted using 22 successive PCR cycles. The number of PCR cy-cles was optimised to ensure that the reaction was in the log-linearphase of amplification in order for inter-tissue comparisons to bemade. Values were normalised to the expression of the house-keeping gene, 18S rRNA. To estimate the molecular weights ofthe amplicons, 5 lL of amplified products were analysed on a 1%agarose gel stained with ethidium bromide. DNA was extractedand purified from the agarose gel using a QIAquick� gel extractionkit following the manufacturer’s protocol (QIAGEN� Pty. Ltd.),cloned in pGEM�-T Easy Vector (Promega) and sequenced at theMolecular Pathology Sequencing Centre at the Institute of Medicaland Veterinary Science, Adelaide, to confirm the identity of theproducts. Specific band and background densities were determinedfor each cDNA on a single gel by digital image analysis using theBio-Rad Quantity One software (expressed as intensity/mm2) in

M. Woods et al. / General and Comparative Endocrinology 166 (2010) 529–536 531

two male and two female fish. Statistical differences in geneexpression between tissues were evaluated using an ANOVA witha Tukey’s multiple comparisons test. All significant differenceswere determined at p < 0.05.

2.3. RACE PCR

Rapid amplification of cDNA ends (RACE) was employed toobtain full-length cDNAs of esr1 from the liver of female rainbow-fish using the partial cDNAs obtained from RT-PCR. Gene-specificprimers (GSPs) for RACE were designed directly from the cDNApartial sequences for both 50 and 30 ends (GSP1esr1 (50) andGSP2esr1 (30); Table 1). The primers were designed to obtain a re-gion of overlap, to verify that the 50 and 30 partial cDNAs obtainedduring RACE were from the original esr1 cDNA. First strand cDNAsynthesis and PCR reactions for 50 and 30 RACE were performed fol-lowing the protocol outlined in the SMART RACE cDNA Amplifica-tion Kit (BD Biosciences). RACE PCR was performed using the 50 and30-RACE-ready cDNAs as a template, the GSP primers (Table 1) andthe universal primers (supplied with the kit).

RACE PCR amplifications were performed using a PTC-200 Pel-tier Thermal Cycler (MJ Research) with the following conditions:hot start with 5 cycles of denaturation at 94 �C for 30 s and anneal-ing/extension at 72 �C for 3 min, 5 cycles of three-step cyclingincluding denaturation at 94 �C for 30 s, annealing at 70 �C for30 s and extension at 72 �C for 3 min, followed by 25–35 cyclesof three-step cycling of denaturation at 94 �C for 30 s, annealingat 68 �C for 30 s and extension at 72 �C for 3 min. Where multiplebands were produced within a single PCR reaction, the PCR wasoptimised to obtain single bands or nested gene-specific primers(NGSP1esr1; Table 1) were used to eliminate non-specific bands(using diluted PCR product from the original PCR). Positive andnegative controls were run concurrently with 50 RACE and 30 RACE.A positive control containing GSP1esr1 and GSP2esr1 was con-ducted to amplify the region of overlap in both 50- and 30 RACEPCR. Two negative controls, one containing the universal primermix only and the other containing the GSP esr1 only, were usedto determine suitability of cycling parameters and primers. Forlarge cDNA fragments and for fragments that proved difficult tosequence an additional primer was designed to aid in sequencing(50esr1SEQ; Table 1). DNA visualisation, purification, cloning andsequencing was conducted as described in the previous section.

2.4. Phylogenetic and sequence analysis

The rainbowfish Esr, together with previously reported verte-brate Esr1 sequences (36 species; for species and GenBank accessionnumbers, see legend of Fig. 4) were aligned using the AlignX pro-gram (Vector NTI Advance 10 suite; Invitrogen) which utilised theClustal W algorithm (Thompson et al., 1994). A guide tree, whichresembles a phylogenetic tree, in Vector NTI Advance is constructedusing the Neighbour-Joining method of (Saitou and Nei, 1987). TheNeighbour-Joining algorithm works on a matrix of distances be-tween all pairs of sequence to be analysed. These distances are re-lated to the degree of divergence between the sequences. Thephylogenetic trees produced using this method were ‘unrooted’meaning that a relationship among species can be specified, butwithout identifying a common ancestor or evolutionary path.

3. Results

3.1. Cloning and sequence analysis

Using PCR techniques and degenerate primers for esr1, a partialcDNA sequence was amplified from rainbowfish liver total RNA.

Sequence analysis revealed that the fragment was 368 bp andhad similarity to esr1. Using RACE PCR, a full-length rainbowfishesr1 cDNA was cloned in the 50 and 30 directions giving rise tocDNAs of 1.2 and 1.8 kb, respectively. The rainbowfish esr1 cDNAwas 2569 bp including the ATG start site and the TGA terminationsignal. The esr1 cDNA was composed of three regions: 121 bp of 50

untranslated region containing 5 stop codons; 1832 bp of codingregion (open reading frame); and 916 bp of 30 untranslated regioncontaining 20 stop codons. The coding region encodes a protein of611 amino acids (Fig. 1). The deduced protein sequence may beclassified as a-type estrogen receptor as it was homologous toknown a-type estrogen receptors (Fig. 2). The rainbowfish esr1cDNA sequence was registered in GenBank database underGU319956.

The deduced amino acid sequence of the rainbowfish Esr1 wascompared with seven other full-length Esr1 sequences from otherspecies including three fish, killifish (F. heteroclitus; BAC76957), gilt-head sea bream (S. aurata; AAD31032) and rainbow trout (O. mykiss;CAB45139) as well as chicken (Gallus gallus; NP_990514), housemouse (Mus musculus; NP_031982) and human (Homo sapiens;NP_000116) (Fig. 2). This alignment revealed that the amino acid se-quence of the rainbowfish Esr1 was similar to that of other fish spe-cies with the percentage identity ranging from 71% to 86% identicalresidues. Within fish species, rainbowfish Esr1 was most closely re-lated to the killifish (86% identity) while the rainbow trout sharedthe lowest identity (71%). The percentage identity with non-fish spe-cies was significantly lower with only 48% identical residues inhouse mouse and human. The A/B, D and F domains of the Esr1 be-tween species showed the most variance. In contrast, the C and E do-mains (DNA binding and ligand binding domains, respectively) weremore conserved with rainbowfish Esr1 sharing 92% identity with kil-lifish in the ligand binding domain (Fig. 3).

3.2. Phylogenetic analysis

Phylogenetic analysis using guide trees were constructed fromEsr1 amino acid alignments of 36 vertebrate species includingmammals, birds, reptiles and fish (Fig. 4). The tree consisted ofthree clusters. The non-fish species were clustered together intwo distinct sister clades and share the highest degree of diver-gence from the fish Esr1 clusters. Rainbowfish Esr1 was most clo-sely related to the killifish, represented by a common ancestralnode (Fig. 4).

3.3. Tissue distribution of esr1 mRNA

The expression of esr1 was analysed in the brain, gill, intestine,liver, muscle and gonads (ovary or testis) from adult male and fe-male rainbowfish using semi-quantitative RT-PCR. The expressionwas normalised against the expression of the house-keeping gene,18S rRNA, which produced similar expression profiles across thetissues confirming the amount of start template. In female fish,esr1 transcripts were most abundant in the liver with weakerexpression noted in the intestine, muscle, ovary, brain and gill. Inmale fish, esr1 transcripts were most abundant in the testis, intes-tine and liver with weaker expression noted in the gill and brainand no expression was detected in the muscle. Female esr1 expres-sion was greatest in the liver (almost two times the level of expres-sion in the males), whereas, male esr1 expression was greatest inthe testis (greater than two times the level in the ovaries) (Fig. 5).

4. Discussion

In this study, the full-length cDNA sequence for rainbowfishesr1 was characterised, phylogenetic analyses presented on the

Fig. 1. Nucleotide sequence of esr1 cDNA and the deduced amino acid sequence for the Murray rainbowfish, Melanotaenia fluviatilis (coding region only). The amplified DNAfragment of the original PCR using degenerate primers is boxed. The numbers on the right refer to the position of the nucleotides and the amino acids.

532 M. Woods et al. / General and Comparative Endocrinology 166 (2010) 529–536

deduced amino acid sequences and sex-specific tissue expressionpatterns determined. Rainbowfish esr1 cDNA was cloned whichcontained 2569 bp composing of three regions; 121 bp of 50

untranslated region, 1832 bp of coding region, and 916 bp of 30

untranslated region. The coding region encodes a protein of 611amino acids. The sequence was divided into six domains (A–F)using the nomenclature of Krust et al. (1986) in relation to theestablished domains of mammalian Esr and based on its sequencesimilarity to other steroid hormones.

The A/B domain was hypervariable across species and variedfrom 24% to 82% identity between these species. The A/B domaincontains the activation function 1 (AF-1) site, which showed simi-larity across species, but was not identical. The S118 residue of theAF-1 site, which can be a potentiation pathway of ER action, wasconserved across all species examined (Feng et al., 2001). Compar-isons between the deduced amino acid sequence of the rainbow-fish Esr1 and Esr1 from six species showed high levels ofsequence homology in the C and D domains. The C domain (DNAbinding) was highly conserved (93–99% identity) among species.The Esr1 of rainbowfish contained the highly conserved zinc-fingermotif, including the P and D boxes and the eight cysteine residues

important for DNA binding to estrogen response elements (Muel-ler-Fahrnow and Egner, 1999; Muramatsu and Inoue, 2000). Thesestructures are necessary for recognising and binding to the targetsites in DNA. These results suggest that the rainbowfish Esr1 mayinteract with the target sites on DNA as reported for other species.

The ligand binding domain (E domain) was highly conservedamong species with 92% amino acid sequence identity with killifish(F. heteroclitus). Several amino acids have been identified as impor-tant for ligand binding, dimerisation and transcriptional activationfunctions. In the ligand binding domain, nine amino acids residueshave been identified as important residues in estradiol-bindingstudies in human Esr1 (Danielian et al., 1992; Ekena et al., 1996;Brzozowski et al., 1997). Of these, amino acid R394 together withE353 and H524 (in humans) is critical polar contacts involved inthe Esr interaction with phenolic function at position three of17b-estradiol (Schwabe and Teichmann, 2004). All nine of theseamino acids were conserved in the rainbowfish Esr1. Single aminoacid substitutions in this domain are responsible for the differencesin ligand-binding affinity of Esr1 and in transactivation character-istics. Residues H513 and Y537, involved in receptor dimerisationand estrogen-dependent activation, were also conserved in the

Fig. 2. Aligned deduced amino acid sequence of Murray rainbowfish Esr1 with that of killifish (Fundulus heteroclitus; BAC76957), gilthead sea bream (Sparus aurata;AAD31032), rainbow trout (Oncorhynchus mykiss; CAB45139), chicken (Gallus gallus; NP_990514), house mouse (Mus musculus; NP_031982) and human (Homo sapiens;NP_000116), with species name and GenBank accession numbers given in parenthesis. Gaps (-) were introduced to optimise the sequence alignment. Important regions/residues are indicated as follows: the five/six domains of Esr (A–F domains) by bracketing arrows; AF-1 site, AF-2 site, P-box and D-box are boxed; 8 cysteine residues of zincfingers (black arrows); 9 residues identified in estradiol binding (open arrows) and 2 residues identified in receptor dimerisation (grey arrows).

Fig. 3. Domain structure of Murray rainbowfish Esr1 using the nomenclature of(Krust et al., 1986). The five/six domains of Esr (A–F domains) are indicatedinside each box and refer to the percentage amino acid identity for each domaincompared with rainbowfish Esr1. Numbers above each box refer to amino acidnumbers for each domain. Sequence identity compared with killifish (Fundulusheteroclitus; BAC76957), gilthead sea bream (Sparus aurata; AAD31032),rainbow trout (Oncorhynchus mykiss; CAB45139), chicken (Gallus gallus;NP_990514), house mouse (Mus musculus; NP_031982) and human (Homosapiens; NP_000116).

M. Woods et al. / General and Comparative Endocrinology 166 (2010) 529–536 533

rainbowfish. Analyses on the entire rainbowfish Esr1 sequenceindicated that it shares highest percent identity and phylogeneticrelationship with killifish (F. heteroclitus).

Tissue expression patterns of esr1 mRNA in rainbowfish werenormalised to the house-keeping gene 18S rRNA. House-keepinggenes are normally used to account for differences in RNA quantityand quality, the overall transcriptional activity and differences inthe cDNA synthesis. Although assumed stable, house-keeping genetranscripts such as glyceraldehyde-3-phosphate dehydrogenase(GAPDH), actins, L32, 28S and 18S rRNAs, have previously beenshown under certain experimental conditions and certain tissuetypes to exhibit either up- or down-regulation (Thellin et al.,1999; Schmittgen and Zakrajsek, 2000). This may lead to inaccura-cies in tissue-specific gene expression. Although considered minorin the current study, variation in the expression of 18S rRNA wasnoted between the different tissues types in the rainbowfish whichmay lead to either an under or over estimation of esr1 mRNA. How-ever, this would not affect the overall message regarding the tis-sue-specific expression in the rainbowfish.

Tissue expression patterns of esr1 in female and male rainbow-fish were similar to those previously described for other species. Inadult female rainbowfish, esr1 was highly expressed in the liver,

Fig. 4. Phylogenetic tree of 36 vertebrate Esr1 proteins generated using the Neighbour-joining algorithm. The tree was un-rooted indicating that the relationship amongspecies can be specified, but without a common ancestor or evolutionary path. The degrees of divergence between sequences are given in parenthesis, the smaller the valuethe less divergence. Species and GenBank accession numbers: American alligator (Alligator mississippiensis; BAD08348), Atlantic croaker (Micropogonias undulatus;AAG16713), Atlantic salmon (Salmo salar; AAY25396), bambooleaf wrasse (Pseudolabrus japonicus; ABB96483), bastard halibut (Paralichthys olivaceus; BAB85622), black seabream (Acanthopagrus schlegelii; AAL82743), cat (Felis catus; AAU11443), cattle (Bos taurus; AAS46251), channel catfish (Ictalurus punctatus; AAC69548), cherry salmon(Oncorhynchus masou; AAS92970), chicken (Gallus gallus; NP_990514), eelpout (Zoarces viviparus; AAO66473), European sea bass (Dicentrarchus labrax; CAD43599), fatheadminnow (Pimephales promelas; AAV41373), gilthead sea bream (Sparus aurata; CAB51479), gilthead sea bream (Sparus aurata; AAD31032), goldfish (Carassius auratus;AAL12298), haplochromis burtoni (Astatotilapia burtoni; AAR82891), house mouse (Mus musculus; NP_031982), human (Homo sapiens; NP_000116), Japanese eel (Anguillajaponica; BAA19851), Japanese quail (Coturnix japonica; AAN63674), javan medaka (Oryzias javanicus; AAX13999), killifish (Fundulus heteroclitus; BAC76957), largemouth bass(Micropterus salmoides; AAG44622), medaka (Oryzias sp.; BAA25900), nile crocodile (Crocodylus niloticus; BAE45626), nile tilapia (Tilapia nilotica; AAD00245), North Africancatfish (Clarias gariepinus; CAC37560), Norway rat (Rattus norvegicus; NP_036821), pig (Sus scrofa; NP_999385), protogynous wrasse (Halichoeres tenuispinis; AAP72178),rainbow trout (Oncorhynchus mykiss; CAB45139), red sea bream (Pagrus major; BAA22517), river fish (Varicorhinus barbatulus; CAD67996), sheep (Ovis aries; AAK52104),spectacled caiman (Caiman crocodilus; BAB79436) and zebrafish (Danio rerio; AAK16740).

534 M. Woods et al. / General and Comparative Endocrinology 166 (2010) 529–536

with lower levels expressed in the ovary. This confirms results pre-viously described for esr1 in other species including European seabass (D. labrax) (Halm et al., 2004), largemouth bass (M. salmoides)(Sabo-Attwood et al., 2004), yellow perch (P. flavescens) (Lynnet al., 2008) and killifish (F. heteroclitus) (Greytak and Callard,2007) and supports their role as estrogen target tissues being asso-ciated with reproduction.

In adult male rainbowfish, esr1 was highly expressed in thetestis and liver, confirming expression reported in other fish spe-cies including goldfish (C. auratus) (Choi and Habibi, 2003) andsea bream (S. aurata) (Socorro et al., 2000). In contrast, other spe-cies including European sea bass (D. labrax) (Halm et al., 2004)and yellow perch (P. flavescens) (Lynn et al., 2008) exhibitedlow esr1 expression in the testis and liver of male fish. Estrogenreceptor expression has been reported in the somatic testicularcells and haploid germ cells in male fish (Miura et al., 1999; Bou-ma and Nagler, 2001; Wu et al., 2001). A study by Woods et al.(2009) revealed the presence of esr1 and esr2 transcripts in thespermatogonia and spermatocytes as well as in somatic cells suchas the epithelial cells of the seminiferous tubules in rainbowfish(M. fluviatilis). These findings suggest that esr participate in the

regulation of estrogen-dependent male gamete developmentand fertility in rainbowfish. The relatively high levels of esr1 tran-scripts detected in the male liver and testis in adult male rain-bowfish in the current study together with a report on theinduction of esr1 and vitellogenin (vtg) in the liver and testis ofrainbowfish following a waterborne exposure to 17b-estradiol(Woods et al., 2009), may represent favourable conditions to de-tect exogenous estrogenic stimulation of plasma vtg or gametefeminisation in this species.

The esr1 was detected in the gill, brain and intestine of both fe-male and male rainbowfish. These tissues historically have notbeen designated as estrogen-responsive targets, but have also beendetected in other fish species (Socorro et al., 2000; Xia et al., 2000;Choi and Habibi, 2003; Andreassen et al., 2003; Zhu et al., 2008).Interestingly in the rainbowfish, high levels of esr1 expression wereobserved in the intestine of both female and male fish. In the cur-rent study the reason for this is not clear. However, in salmonids,the expression of esr in the gill and intestine may be related tothe role of estrogens in osmoregulation as E2 has been shown toantagonize metabolic and physiological changes that occur duringsmoltification (Madsen et al., 1997; Rogers et al., 2000).

Fig. 5. Semi-quantitative analyses of esr1 mRNA tissue distribution in female andmale Murray rainbowfish. Total RNA was isolated and purified from the liver (L),gonads (ovary (O) or testis (T), gill (G), brain (B), intestine (I), muscle (M) and blank(negative control; Bl) was subjected to RT-PCR analysis for determination of esr1expression. Identity of the PCR products was confirmed by DNA sequencing.Expression was normalised to 18S rRNA and the relative amounts were calculatedusing densitometric analysis using Bio-Rad molecular imager software (Bio-RadLaboratories). Band intensity was determined using the background subtractionmethod and band density was reported as intensity/mm2. Each column and verticalbar represents the mean ± SEM (n = 2, from two fish). Differences between tissueswere determined at p < 0.05 and values with dissimilar letters indicate significantdifference from each other.

M. Woods et al. / General and Comparative Endocrinology 166 (2010) 529–536 535

In summary, this study provides the full-length nucleotide se-quence of esr1 in the rainbowfish and the sex-specific tissue distri-bution in adult fish. Relatively high levels of esr1 in the testis ofmale rainbowfish and intestine of both male and female fish weredetermined. Further studies using real time PCR are necessary toconfirm the expression patterns observed and to determine anyseasonal changes in expression levels and tissue distribution.Although the cloning of esr1 in rainbowfish provides a valuablemolecular tool that can be used in future studies investigatingestrogen mechanisms, actions and, tissue-specific expression injuvenile and adult rainbowfish, the cloning of other Esr subtypeswould be beneficial to determine the functionality of the differentEsr in reproduction and other non-reproductive functions. Com-parative analysis of Esr sex-specific tissue expression is importantin identifying target tissues of estrogen and potential estrogeniccontaminants.

Acknowledgments

The authors would like to thank Anthony Woods and RossMcKinnon (Uni-SA) for use of their facilities, and Adrienne Greggand Graeme Batley for their valuable comments on thismanuscript.

References

Allen, G., 1991. Field guide to freshwater fishes of New Guinea, ChristensenResearch Institute.

Andreassen, T.K., Skjoedt, K., Anglade, I., Kah, O., Korsgaard, B., 2003. Molecularcloning, characterisation, and tissue distribution of oestrogen receptor alpha ineelpout (Zoarces viviparus). Gen. Comp. Endocrinol. 132, 356–368.

Bouma, J., Nagler, J.J., 2001. Estrogen receptor-alpha protein localisation in the testisof the rainbow trout (Oncorhynchus mykiss) during different stages of thereproductive cycle. Biol. Reprod. 65, 60–65.

Brzozowski, A.M., Pike, A.C., Dauter, Z., Hubbard, R.E., Bonn, T., Engstrom, O., Ohman,L., Greene, G.L., Gustafsson, J.A., Carlquist, M., 1997. Molecular basis of agonismand antagonism in the oestrogen receptor. Nature. 389, 753–758.

Caviola, E., Valle, L.D., Belvedere, P., Colombo, L., 2007. Characterisation of threevariants of estrogen receptor b mRNA in the common sole, Solea solea L(Teleostei). Gen. Comp. Endocrinol. 153, 31–39.

Choi, C.Y., Habibi, H.R., 2003. Molecular cloning of estrogen receptor alpha andexpression pattern of estrogen receptor subtypes in male and female goldfish.Mol. Cell. Endocrinol. 204, 169–177.

Danielian, P.S., White, R., Lees, J.A., Parker, M.G., 1992. Identification of a conservedregion required for hormone dependent transcriptional activation by steroidhormone receptors. EMBO J. 11, 1025–1033.

Ekena, K., Weis, K.E., Katzenellenbogen, J.A., Katzenellenbogen, B.S., 1996.Identification of amino acids in the hormone binding domain of the humanestrogen receptor important in estrogen binding. J. Biol. Chem. 271, 20053–20059.

Feng, W., Webb, P., Nguyen, P., Liu, X., Li, J., Karin, M., Kushner, P.J., 2001.Potentiation of estrogen receptor activation function 1 (AF-1) by Src/JNKthrough a Serine 118-independent pathway. Mol. Endocrinol. 15, 32–45.

Greytak, S.R., Callard, G.V., 2007. Cloning of three estrogen receptors (ER) fromkillifish (Fundulus heteroclitus): differences in populations from polluted andreference environments. Gen. Comp. Endocrinol. 150, 174–188.

Halm, S., Martinez-Rodriguez, G., Rodriguez, L., Prat, F., Mylonas, C.C., Carrillo, M.,Zanuy, S., 2004. Cloning, characterisation, and expression of three oestrogenreceptors (ERa, ERb1 and ERb2) in the European sea bass, Dicentrarchus labrax.Mol. Cell. Endocrinol. 223, 63–75.

Hawkins, M.B., Thomas, P., 2004. The unusual binding properties of the thirddistinct teleost estrogen receptor subtype ERba are accompanied by highlyconserved amino acid changes in the ligand binding domain. Endocrinology145, 2968–2977.

Hawkins, M.B., Thornton, J.W., Crews, D., Skipper, J.K., Dotte, A., Thomas, P., 2000.Identification of a third distinct estrogen receptor and reclassification ofestrogen receptors in teleosts. Proc. Natl. Acad. Sci. USA 97, 10751–10756.

Krust, A., Green, S., Argos, P., Bumar, V., Walter, J.M.B., Chambon, P., 1986. Thechicken oestrogen receptor sequence. homolgy with v-erbA and the humanoestrogen and glucocoticoid receptors. EMBO J. 5, 891–897.

Kuiper, G.G.J.M., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S.,Gustafsson, J.A., 1997. Comparison of the ligand binding specificity andtranscript tissue distribution of estrogen receptors a and b. Endocrinology138, 863–870.

Kumar, R., Thompson, E.B., 1999. The structure of the nuclear hormone receptors.Steroids 64, 310–319.

Legler, J., Zeinstra, L.M., Schuitemaker, F., Lanser, P.H., Bogerd, J., Brouwer, A.,Vethaak, A.D., De Voogt, P., Murk, A.J., Van der Burg, B., 2002. Comparison ofin vivo and in vitro reporter gene assays for short-term screening of estrogenicactivity. Environ. Sci. Technol. 36, 4410–4415.

Lynn, S.G., Birge, W.J., Shepherd, B.S., 2008. Molecular characterization and sex-specific tissue expression of estrogen receptor a (esr1), estrogen receptor ba(esr2a) and ovarian aromatase (cyp19a1a) in yellow perch (Perca flavescens).Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 149, 126–147.

Madsen, S.S., Mathiesen, A.B., Korsgaard, B., 1997. Effects of 17b-estradiol and 4-nonylphenol on smoltification and vitellogenesis in Atlantic Salmon (Salmosalar). Fish Physiol. Biochem. 17, 303–312.

Menuet, A., Anglade, I., Flouriot, G., Pakdel, F., Kah, O., 2001. Tissue-specificexpression of two structurally different estrogen receptor alpha isoforms alongthe female reproductive axis of an oviparous species, the rainbow trout. Biol.Reprod. 65, 1548–1557.

Miura, T., Miura, C., Ohta, T., Nader, M.R., Todo, T., Yamauchi, K., 1999. Estradiol-17bstimulates the renewal of spermatogonial stem cells in males. Biochem.Biophys. Res. Commun. 264, 230–234.

Mueller-Fahrnow, A., Egner, U., 1999. Ligand-binding domain of estrogen receptors.Curr. Opin. Biotechnol. 10, 550–556.

Muramatsu, M., Inoue, S., 2000. Estrogen receptors: how do they control reproductiveand nonreproductive functions? Biochem. Biophys. Res. Commun. 270, 1–10.

Pinto, P.I.S., Passos, A.L., Martins, R.S., Power, D.M., Canario, A.V.M., 2006.Characterization of estrogen receptor bb in sea bream (Sparus auratus):Phylogeny, ligand-binding, and comparative analysis of expression. Gen.Comp. Endocrinol. 145, 197–207.

Pollino, C., Holdway, D.A., 2002. Reproductive potential of crimson-spottedrainbowfish (Melanotaenia fluviatilis) following short-term exposure to bassstrait crude oil and dispersed crude oil. Environ. Toxicol. 17, 138–145.

Pollino, C.A., Georgiades, E., Holdway, D.A., 2007. Use of the Australian crimson-spotted rainbowfish (Melanotaenia fluviatilis) as a model test species forinvestigating the effects of endocrine disruptors. Environ. Toxicol. Chem. 26,2171–2178.

536 M. Woods et al. / General and Comparative Endocrinology 166 (2010) 529–536

Rogers, S.A., Llewellyn, L., Wigham, T., Sweeney, G.E., 2000. Cloning of the Atlanticsalmon (Salmo salar) estrogen receptor-alpha gene. Comp. Biochem. Physiol.Part B Biochem. Mol. Biol. 125, 379–385.

Sabo-Attwood, T., Kroll, K.J., Denslow, N.D., 2004. Differential expression oflargemouth bass (Micropterus salmoides) estrogen receptor isotypes alpha,beta, and gamma by estradiol. Mol. Cell. Endocrinol. 218, 107–118.

Saitou, N., Nei, M., 1987. The neighbour-joining method: a new method forreconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Schmittgen, T.D., Zakrajsek, B.A., 2000. Effect of experimental treatment on house-keeping gene expression: validation by real-time, quantitative RT-PCR. J.Biochem. Biophys. Methods. 46, 69–81.

Schwabe, J.W.R., Teichmann, S.A., 2004. Nuclear receptors: the evolution ofdiversity. Sci. STKE 2004. pe4.

Socorro, S., Power, D.M., Olsson, P.E., Canario, A.V., 2000. Two estrogen receptorsexpressed in the teleost fish, Sparus aurata: cDNA cloning, characterization andtissue distribution. J. Endocrinol. 166, 293–306.

Thellin, O., Zorzi, W., Lakaye, B., De Borman, B., Coumans, B., Hennen, G., Grisar, T.,Igout, A., Heinen, E., 1999. House-keeping genes as internal standards: use andlimits. J. Biotechnol. 75, 291–295.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving thesensitivity of progressive multiple sequence alignment through sequenceweighting, position-specific gap penalties and weight matrix choice. NucleicAcids Res. 22, 4673–4680.

Woods, M., Kumar, A., Barton, M., Woods, A., Kookana, R., 2009. Localisation ofestrogen responsive genes in the liver and testis of Murray rainbowfishMelanotaenia fluviatilis exposed to 17b-estradiol. Mol. Cell. Endocrinol. 303, 57–66.

Wu, C.F., Patino, R., Davis, K.B., Chang, X.T., 2001. Localisation of estrogen receptoralpha and beta RNA in germinal and nongerminal epithelia of the channelcatfish testis. Gen. Comp. Endocrinol. 124, 12–20.

Xia, Z.F., Gale, W.L., Chang, X.T., Langenau, D., Patino, R., Maule, A.G., Densmore, L.D.,2000. Phylogenetic sequence analysis, recombinant expression, and tissuedistribution of a channel catfish estrogen receptor b. Gen. Comp. Endocrinol.118, 139–149.

Zhu, P., Zhang, Y., Zhuo, Q., Lu, D., Huang, J., Liu, X., Lin, H., 2008. Discovery offour estrogen receptors and their expression profiles during testisrecrudescence in male Spinibarbus denticulatus. Gen. Comp. Endocrinol.156, 265–276.