INTRODUCTION

Peroxisomes were discovered and first named by de Duve(1965), however, the biological importance of this organelleremained unclear for many years. There has been a majorresurgence in interest regarding the biology and biogenesis ofperoxisomes in recent years, stimulated to a large degree bythe discovery that several genetic diseases are connected withperoxisome function. Many of these autosomal recessivediseases, including Zellweger syndrome which is generallyfatal (Goldfischer et al., 1973), were subsequently shown to becaused by defects in the import of some or most peroxisomalmatrix proteins (for reviews see Aubourg, 1994; Naidu andMoser, 1994; Singh, 1997; Wanders et al., 1995). Despite therenewed excitement and increased research activity in thisfield, the comprehensive details of peroxisome biology andbiogenesis remain to be elucidated. Nevertheless, ourunderstanding of these processes is vastly improved as a resultof recent studies from many laboratories. These investigationshave led to the discovery that peroxisomal proteins aresynthesized on free polyribosomes and are subsequently sortedto their final destination through the interactions betweenperoxisome targeting signals (PTS) and their cognatereceptors. Thus far, two PTSs have been fairly wellcharacterized. PTS1, found in approximately 50% ofperoxisomal proteins, consists of a carboxyl-terminaltripeptide composed of the amino acids SKL or conservativevariants thereof (S/A/C)(K/R/H/N)(L/M) (Amery et al., 1998;Elgersma et al., 1996b; Gould et al., 1987, 1989;

Lametschwandtner et al., 1998). PTS2 is found in the amino-terminal region of a small number of peroxisomal proteins,including thiolase, and consists of the amino acids(R/K)(L/V/I)X5(Q/H)(L/A) (Osumi et al., 1991; Swinkels etal., 1991).

Several peroxisomal matrix proteins and all of theperoxisomal membrane proteins identified thus far appear tobe targeted to the organelle by alternative, as yetuncharacterized, routes. There is some evidence to suggest thepresence of internal targeting sequences in yeast acyl-CoAoxidase (Kamiryo et al., 1989; Small et al., 1988), catalase(Kragler et al., 1993), and carnitine acetyltransferase(Elgersma et al., 1995), however, the precise nature of suchsignals is not yet clear. Signal sequences have been identifiedin two yeast peroxisomal membrane proteins; PMP47 fromCandida boidini (Dyer et al., 1996) and Pex3p from Pichiapastoris (Wiemer et al., 1996). The former sequence is a 20amino acid region contained within an intervening loopbetween two membrane-spanning regions of the protein, whilethe latter consists of a 40 amino acid stretch at the aminoterminus. These two sequences are not homologous, however,both contain a short segment of charged basic amino acids. Thespecific compositions of these signals and the componentsinvolved in the import pathways of the respective proteinsremain to be determined.

A further intriguing element of peroxisome biogenesis wasrevealed with the discovery that certain proteins can beimported into peroxisomes in the form of dimers or oligomers(Glover et al., 1994; McNew and Goodman, 1994).

533Journal of Cell Science 113, 533-544 (2000)Printed in Great Britain © The Company of Biologists Limited 2000JCS0837

We, and others, have identified a novel Saccharomycescerevisiae peroxisomal protein that belongs to theisomerase/hydratase family. The protein, named Dci1p,shares 50% identity with Eci1p, a ∆∆3-cis-∆∆2-trans-enoyl-CoA isomerase that acts as an auxiliary enzyme in the ββ-oxidation of unsaturated fatty acids. Both of these proteinsare localized to peroxisomes, and both contain motifsat their amino- and carboxyl termini that resembleperoxisome targeting signals (PTS) 1 and 2. However, wedemonstrate that the putative type 1 signaling motif is not

required for the peroxisomal localization of either of theseproteins. Furthermore, the correct targeting of Eci1p andDci1p occurs in the absence of the receptors for the type 1or type 2 peroxisome targeting pathway. Together, thesedata suggest a novel mechanism for the intracellulartargeting of these peroxisomal proteins.

Key words: Organelle biogenesis, Peroxisome, Targeting signals,Isomerase/hydratase, Transcriptional regulation

SUMMARY

Evidence for a novel pathway for the targeting of a Saccharomyces cerevisiae

peroxisomal protein belonging to the isomerase/hydratase family

Igor V. Karpichev* and Gillian M. Small‡

Department of Cell Biology and Anatomy, Mount Sinai School of Medicine, New York, NY 10029, USA*Permanent address: Center of Bioengineering, Russian Academy of Sciences, Moscow 117312, Russia‡Author for correspondence (e-mail: small@msvax.mssm.edu)

Accepted 18 November 1999; published on WWW 19 January 2000

534

Furthermore, the peroxisome import machinery is capable ofimporting 9 nm colloidal gold particles coated with humanserum albumin coupled to an SKL-containing peptide (Waltonet al., 1995). The mechanism by which peroxisomes take upthese multimeric complexes is not known. Thus, a completeunderstanding of peroxisome biogenesis awaits theidentification and characterization of all proteins that residewithin the organelle, as well as cytosolic proteins that arerequired for the targeting and translocation processes.

In the course of our studies on the transcriptional regulationof peroxisomal proteins in Saccharomyces cerevisiae, weidentified and characterized two transcription factors, Oaf1p andPip2p (Oaf2p), that mediate the fatty acid-dependent activationof genes encoding peroxisomal proteins (Karpichev et al., 1997;Luo et al., 1996). These proteins form a heterodimer and bindto a consensus sequence, termed the oleate response element(ORE; Einerhand et al., 1993; Filipits et al., 1993), found in thepromoters of target genes (Karpichev et al., 1997; Rottensteineret al., 1997). We recently performed a search of the yeastgenome database for ORE-containing genes, and identified22 genes that are regulated by the Oaf1p-Pip2p transcriptionfactors (Karpichev and Small, 1998). These included knownperoxisomal matrix and membrane proteins, cytosolic proteinsrequired for peroxisome biogenesis (peroxins), a mitochondrialprotein, as well as several open reading frames (ORFs), encodingproteins of unknown location and function. We subsequentlyfound that two of these ORFs, YLR284c and YOR180c, areinduced by oleate in an Oaf1p-Pip2p-dependent manner. ABLAST search revealed that the encoded proteins havehomology with a novel peroxisomal protein identified in rat andhuman, predicted to function as an enoyl-CoA hydratase(Fitzpatrick et al., 1995; see Fig. 1). Based on this homology wetentatively named the yeast genes EHD1 and EHD2,respectively. During the course of our studies, YLR284c wassubsequently shown to encode a peroxisomal ∆3-cis-∆2-trans-enoyl-CoA isomerase that is required for the β-oxidation ofunsaturated fatty acids, and was named ECI1 (Geisbrecht et al.,1998; Gurvitz et al., 1998), and the YOR180c protein was shownto have di-isomerase activity, and was named Dci1p (Gurvitz etal., 1999). Both Eci1p and Dci1p have amino acid motifs that

resemble PTS1. Here we show that these carboxyl-terminaltripeptides are not required for the peroxisomal localization ofthe respective proteins, and further demonstrate that the proteinsare targeted to peroxisomes in cells that lack the PTS2 receptor.In addition, our experiments demonstrate that Dci1p is localizedto aberrant peroxisomes in the absence of the PTS1 receptor,suggesting that alternative machinery is involved in theperoxisomal targeting of this protein.

MATERIALS AND METHODS

Yeast strains and mediaThe yeast strains used in this study are described in Table 1. Yeaststrains were grown in either YPD (1% yeast extract, 2% peptone, 2%glucose); SD (0.67% yeast nitrogen base without amino acids, 2%glucose); YPG (1% yeast extract, 2% peptone, 3% glycerol), YPGO(0.1% (w/v) oleic acid and 0.25% (v/v) Tween-40 added to YPG), orYNCO (1.4% yeast nitrogen base without amino acids, 0.3% (w/v)oleic acid and 0.75% (v/v) Tween-40, 0.3% casamino acids).Auxotrophic supplements were added to 20 µg/ml (40 µg/ml in thecase of leucine) as required.

RNA purification and northern blot analysisStrains were precultured in YPD to mid-logarithmic phase.Precultures were then used to inoculate YPD, YPG or YPGO mediaat an optical density at 600 nm of ≈0.1, and grown to mid-logarithmicphase. Poly(A)+ fractions were prepared from total RNA usingOligotex milk as specified by the manufacturer (Qiagen, Valencia,CA). The mRNA was resolved, transferred to nylon membrane, andhybridized overnight as described previously (Karpichev et al., 1997).Gene-specific probes were generated by PCR amplification withprimers based on sequence from the yeast genome database (Table 2),and yeast genomic DNA. The PCR products were resolved in astandard 1% agarose gel, purified using a Gene Clean kit (Bio 101,Vista, CA), and labeled with a Prime-It RmT kit (Stratagene, La Jolla,CA) and [α-32P]dCTP. Hybridization, and subsequent analyses wereperformed exactly as described previously (Karpichev and Small,1998).

Epitope taggingThe nine-amino acid epitope of influenza virus hemagglutinin (HA),which is recognized by monoclonal antibody 12CA5, was used to tag

I. V. Karpichev and G. M. Small

Table 1. Strains used in this studyS. cerevisiae strain Source*

W3031A MATa leu2 ura3 trp1 ade2 his3 (1)∆O1 (oaf1∆) MATa leu2 ura3 trp [pRS304-TRP1-POX1-lacz] ade2 his3 oaf1::HIS3 (2)∆P2 (pip2∆) MATa leu2 ura3 trp1 ade2 his3 pip2::HIS3 (3)∆O1P2 (oaf1∆pip2∆) MATa leu2 pip2::LEU2 ura3 trp1 ade2 his3 oaf1::HIS3 (4)eci1∆ MATa leu2 ura3 trp1 ade2 his3 eci1::HIS3 This studydci1∆ MATa leu2 ura3 trp1 ade2 his3 dci1::HIS3 This studyeci1∆dci1∆ MATa leu2 dci1::LEU2 ura3 ade2 his3 eci1::HIS3 This studyECI1HA MATa leu2 ura3 trp1 [pRS304-TRP1-ECI1HA] ade2 his3 This studyDCI1HA MATa leu2 ura3 trp1 [pRS304-TRP1-DCI1HA] ade2 his3 This studyECI1HA∆PTS1 MATa leu2 dci1::LEU2 ura3 [pRS306-URA3-ECI1HA∆PTS1] trp1ade2 his3 eci1::HIS3 This studyDCI1HA∆PTS1 MATa leu2 dci1::LEU2 ura3 [pRS306-URA3-DCI1HA∆PTS1] trp1 ade2 his3 eci1::HIS3 This study

pex7∆ECI1HA MATa leu2 pex7::LEU2 ura3 trp1 [pRS304-TRP1-ECI1HA] ade2 his3 This study pex7∆DCI1HA MATa leu2 pex7::LEU2 ura3 trp1 [pRS304-TRP1-DCI1HA] ade2 his3 This study eci1∆dci1∆pex7∆DCI1HA∆PTS1 MATa leu2 dci1::LEU2 ura3 [pRS306-URA3-DCI1HA∆PTS1] pex7::his Gade2 his3 eci1::HIS3 This study

pex5∆DCI1HA MATa leu2 ura3 pex5::URA3 trp1 [pRS304-TRP1-DCI1HA] ade2 his3 This studypex5∆pex7∆DCI1HA MATa leu2 pex7::LEU2 ura3 pex5::URA3 trp1 [pRS304-TRP1-DCI1HA3] ade2 his3 This study

*(1) Thomas and Rothstein (1989); (2) Luo et al. (1996); (3) Karpichev et al. (1997); (4) Karpichev and Small (1998).

535Novel peroxisomal targeting

the products of the ECI1 and DCI1 genes. Three tandem copies of theHA epitope were added to the amino-termini of the ECI1 and DCI1gene products directly downstream from the initiation codon, using acombination of PCR and subcloning techniques. All oligonucleotideprimers are shown in Table 2.

ECI1HATwo primers, EC3 and EC4, were used to amplify a 219 bp fragmentcontaining the 5′-noncoding region and the initiation codon of ECI1,immediately followed by a NotI site. A second pair ofoligonucleotides, EC5 and EC6, were used to amplify a 1030 bpfragment containing a NotI site followed by the ECI1 open readingframe and 182 nucleotides of 3′-prime non-coding sequence. Theresultant DNA fragments were subcloned into the PCR 2.1 TA vector(Invitrogen, Carlsbad, CA), creating two plasmids, pECI13 andpECI15. pEHD13 was cleaved with NotI and SpeI, and pEHD15 wascleaved with EcoRV and NotI. The released fragments were gel-purified and ligated together using T4-DNA ligase. Aliquots of SpeIand EcoRV were then added to the ligation mixture, which wasincubated at 37°C for 1 hour, and then resolved in a 1% agarose gel.The 1.22 kb SpeI/EcoRV fragment, containing the entire ECI1 genewas excised, purified, and subcloned into the SpeI and blunt-endedSacI sites of pRS304 (Sikorski and Hieter, 1989) producing pRSECI1.A triple HA epitope cassette with flanking NotI sites (Tyers et al.,1993) was then cloned into the NotI site of pRSECI1, resulting in aplasmid named pRSECI1HA.

DCI1HAA similar strategy to that described above, using oligonucleotideprimers EC1 with EC7, and EC2 with EC8, was used to add threecopies of the HA epitope to the DCI1 gene product, giving rise to theplasmid pRSDCI1HA.

ECI1∆PTS1In order to create an HA-tagged version of Eci1p in which thecarboxyl-terminal three amino acids are deleted, an oligonucleotideEC9, in which two stop codons replace the C-terminal tripeptideof Eci1p, was used in a Pfu-driven PCR with oligonucleotide EC3,using pRSECI1HA DNA as a template. The amplified DNAproduct was then cloned into NotI/XhoI-digested, blunt-ended anddephosphorylated pRS306 (Sikorski and Hieter, 1989), resulting inpECI1HA∆PTS1.

DCI1∆PTS1An HA-tagged version of Dci1p, lacking the putative PTS1 wascreated using a similar approach to that described above, usingoligonucleotides EC10 with EC1 in a PCR with pRSEC2HA DNA,producing pDCI1HA∆PTS1.

Disruption of ECI1, DCI1, PEX5 and PEX7In order to disrupt the endogenous copies of ECI1 and DCI1, DNAfragments encoding these genes were first amplified from total yeastDNA using the primer pairs EC3 with EC6, and EC1 with EC2,respectively. The purified fragments were then subcloned into thePCR 2.1 TA vector, resulting in pECI1 and pDCI1. pECI1 was thendigested with NdeI and ClaI, while pDCI1 was cleaved with NdeIand SmaI. Each respective plasmid was then blunt-ended,dephosphorylated, and a 1.7-kb fragment containing the S. cerevisiaeHIS3 gene was inserted into the digested plasmids, resulting inpeci1::HIS3 and pdci1::HIS3. The plasmids were digested withEcoRI, and the linear ECI1::HIS3 or DCI1::HIS3 fragment was usedfor transformation into S. cerevisiae W3031A. Selected clones werescreened for correct integration by PCR analysis of total DNA isolatedfrom the transformants. The disrupted strains, named eci1∆ and dci1∆,respectively, were selected for further studies.

To create a mutant strain in which both ECI1 and DCI1 weredisrupted, we first inserted a BglII blunt-ended LEU2 fragment intoNdeI/ClaI-digested, blunt-ended and dephosphorylated pECI1. Theresulting plasmid was cleaved with BamHI and NotI, and the reactionmixture was used for transformation into dci1∆ cells. Transformantswere screened for correct integration as described above, and thedouble disruption strain was named eci1∆dci1∆.

A pex5∆ strain was created by first amplifying a DNA fragmentencoding the majority of the open reading frame of this gene, usingPCR primers EC13 and EC14. The purified fragment was subclonedinto the PCR 2.1 TA vector, resulting in pPEX5. This plasmid wassubsequently digested with EcoNI and SspI, blunt-ended, and afragment containing the URA3 gene was inserted resultingppex5::URA3. A linear fragment containing the disrupted PEX5 genewas obtained from this plasmid using the PCR primers as before, andwas used for transformation into S. cerevisiae W3031A. Selectedclones were screened for correct integration by PCR analysis of totalDNA isolated from the transformants. The disrupted strain, namedpex5∆, was used in further studies.

In order to prepare a strain in which PEX7, encoding the PTS2receptor (Marzioch et al., 1994; Rehling et al., 1996; Zhang andLazarow, 1996), is disrupted, we first amplified a DNA fragmentencoding this gene using PCR primers EC11 and EC12. The purifiedfragment was subcloned into the PCR 2.1 TA vector, resulting inpPEX7. This plasmid was subsequently digested with NdeI, blunt-ended, and a HpaI fragment containing the LEU2 gene was inserted,resulting in ppex7::LEU2. A linear NotI/BamHI fragment was excisedand used for transformation into S. cerevisiae W3031A. Selectedclones were screened for correct integration by PCR analysis of totalDNA isolated from the transformants. The disrupted strain, namedpex7∆, was used in further studies.

To create a strain in which ECI1, DCI1 and PEX7 were alldisrupted, we prepared an additional construct to disrupt the PEX7gene. For this purpose, we used a system that allows repeated use ofURA3 selection in the construction of multiply disrupted genes (Alaniet al., 1987). The 3.8-kb BamHI/BglII fragment of pNKY274 (Alaniet al., 1987) was blunt-ended, and inserted into the PEX7 gene asdescribed above for the insertion of the LEU2 gene. A linearNotI/BamHI fragment was then excised and used for transformatoninto eci1∆dci1∆ cells. Selection of URA− auxotrophs was performedusing 5-FOA as described (Alani et al., 1987). Selected cloned werescreened for correct excision of the URA3 gene from the pex7::hisG-URA3-hisG fragment using a PCR analysis of total DNA extractedfrom the URA− auxotrophs and primers EC11 and EC12.

Subcellular fractionationYeast cells were harvested after growing 1 liter cultures in YPGO for18 hours. The cells were washed and resuspended in 4 ml/g cells (wetweight) of spheroplasting buffer (50 mM potassium phosphate, pH7.5, 0.5 M KCl, 10 mM Na2SO3 10 mM β-mercaptoethanol and 1mg/g cell wet weight of Zymolyase 100T (ICN Pharmaceuticals,

Table 2. Oligonucleotides used for primers in PCRsOligo-nucleotide Description

EC1 5′ GGACTCCACAAGTAGCGGCTG 3′EC2 5′ GGAAGAATTTGCATTGCCAAGG 3′EC3 5′ GCGGCACGAAGGAAAGAATCTG 3′EC4 5′ GGGCGGCCGCCCATATTGTTCTTCCTTCCTTT 3′EC5 5′ GGGCGGCCGCTCGCAAGAAATTAGGCAAAATG 3′EC6 5′ CGCATCTAAGAAGGAACGCCC 3′EC7 5′ GGGCGGCCGCCCATAGTTAGAAGATAACTCAC 3′EC8 5′ GGGCGGCCGCAGCAGTCGTGTGTGCTACC 3′EC9 5′ ACTATCACTTCCTTTGTTTCGAGCC 3′EC10 5′ CTCTAAATGCTATATTATTAGCGCCTGTTTCCCTCTTG 3′EC11 5′ ACCACCGACATAACCTCC 3′EC12 5′ GCTATTGTTCCTTTTCCAGTG 3′EC13 5′ GCAGTTGCACAAACATACTCAGCAC 3′EC14 5′ GGCTCCGTTTTCCATCAGTAGG 3′

536

Costa Mesa, CA)). Following incubation at 30°C for 20 minutes, thespheroplasts were harvested, washed twice with sorbitol buffer (1.2M sorbitol, 20 mM potassium phosphate, pH 7.4) and resuspended in10 ml of breaking buffer (0.6 M sorbitol, 5 mM MES, pH 6.0, 1 mMKCl, 0.5 mM EDTA, 1 mM PMSF and protease inhibitor cocktail togive a final concentration of 10 µg/ml of leupeptin, pepstatin,chymotrypsin and antipain). The suspension was homogenized witha Potter-Elvehjem homogenizer and then centrifuged (2,000 g, 5minutes) to remove nuclei and cell debris. The supernatant wasrecovered, and the pellet was resuspended, homogenized andcentrifuged a second time. The combined supernatants werecentrifuged (18,000 g, 20 minutes) to produce an organelle fraction(ML). The ML fraction was resuspended in 1 ml of breaking bufferand was layered onto a linear Nycodenz gradient (10-30% or 15-36%)containing 0.24 M sucrose, 5 mM MES, pH 6.0, and 1 mM EDTA,resting on a 50% Nycodenz cushion. The gradient was subjected tocentrifugation in an NVT 65 near vertical rotor (Beckman, Palo Alto,CA) at 20,000 rpm (21,000 g) for 2.5 hours at 4°C. Gradient fractions(0.5 or 1 ml) were collected from the top of the tube, and samples ofequal protein concentration were resolved by SDS-PAGE andanalyzed by immunoblotting.

Immunoelectron microscopyThe electron microscope immunolocalization with gold particles wascarried out as described previously (Karpichev et al., 1997), using12CA5 monoclonal antibody or guinea pig anti-thiolase, each diluted1:100 and Protein A conjugated to 10 nm gold diluted 1:50.

Other methodsStandard procedures for yeast transformation (Sherman, 1991) andmolecular biology (Ausubel et al., 1992) were used throughout.Protein concentrations were determined by the method of Bradford(1976) using γ-globulin as a standard. Catalase was measured asdescribed previously (Singh et al., 1992).

RESULTS

YOR180c encodes a protein that shares 50% identitywith Eci1pPrevious studies from our laboratory demonstrated that theproteins encoded by the ORFs YLR284c and YOR180c bothhave amino acid motifs that resemble peroxisome targetingsignals (Karpichev and Small, 1998). A BLAST searchdemonstrated that these two proteins are highly homologous toeach other, and also share homology with a mammalianperoxisomal protein, ECH1, that is induced in rats byperoxisome proliferators, and predicted to function as anenoyl-CoA hydratase (Fitzpatrick et al., 1995). We utilized theClustalW alignment program to compare the maximal linkageclustering of these three proteins, as well as the humanmitochondrial ∆3-cis-∆2-trans-enoyl-CoA isomerase (Fig. 1).The protein encoded by YOR180c, subsequently called Dci1p

I. V. Karpichev and G. M. Small

Fig. 1. Alignment of the deduced amino acid sequence of Dci1p with other members of the isomerase/hydratase protein family. The sequencesof S. cerevisiae peroxisomal Eci1p, Dci1p and mitochondrial Eci (HEcip) encoding a monofunctional enoyl-CoA isomerase (Janssen et al.,1994), and human peroxisomal ECH1 (HEchp) encoding a putative enoyl-CoA hydratase (Fitzpatrick et al., 1995), were aligned using theClustalW program. Amino acids that are identical in all four proteins are outlined, shown in bold and shaded dark gray. Similarities betweenamino acids are outlined and shown in light gray. The amino acid residue number is shown to the left. An arrow marks the conserved leucine atposition 130 of Eci1p (see text).

537Novel peroxisomal targeting

(Gurvitz et al., 1999), shares 50% identity with Eci1p. Ecip andDci1p share a similar degree of homology (approximately 18%identity) with both the human peroxisomal and mitochondrialproteins belonging to this hydratase/isomerase family (Fig. 1).Furthermore, the leucine at position 130 of Eci1p (denoted byan arrow in Fig. 1), that is conserved in yeast, human and ratisomerases, but not in rat 2-enoyl-CoA hydratase (Geisbrechtet al., 1998), is also conserved in Dci1p and in HECH1suggesting that both proteins may also function as isomerasesrather than hydratases. However, while an eci1∆ strain isunable to grow on unsaturated fatty acids (Geisbrecht et al.,1998; Gurvitz et al., 1998), we found that dci12∆ cells growat a similar rate to our wild-type strain on YNCO plates (datanot shown), suggesting that Dci1p is not required for growthon oleic acid. These findings are in agreement with the resultsof Gurvitz et al. (1999), and in contrast to the findings ofGeisbrecht et al. (1999).

Dci1p is induced by oleate in an Oaf1p-Pip2p-dependent fashion and encodes a novelperoxisomal proteinYOR180c contains an ORE consisting of the sequenceCGGAGTTTAGCGCGCTTACAGGGC at position −142 to −119 relative to the initiation codon. In order to determinewhether the expression of this gene is induced by oleate underthe control of Oaf1p and Pip2p, we measured the mRNA levelsof YOR180c in a wild-type strain, and in strains in whichOAF1, PIP2 or both of these genes are disrupted. Each strainwas grown in the presence of glucose, glycerol or glycerol plusoleate, and the YOR180c message was quantitated andnormalized to actin expression as described previously(Karpichev and Small, 1998). Our results demonstrated thatYOR180c mRNA is repressed in the presence of glucose,derepressed in glycerol, and is induced approximately 5- to 6-fold when oleate is added to the glycerol medium (Fig. 2A).This oleate-dependent induction is abolished in strains lackingeither OAF1 or PIP2 (Fig. 2A).

To investigate the expression and subcellular localization ofthe Dci1 protein, we prepared a construct (DCI1HA) in whichthree copies of the influenza virus HA epitope were added to the5-prime region of DCI1, directly downstream from the initiationcodon. Expression of DCI1HA in W3031A was approximately10-fold greater in cells grown in the presence of oleate,compared with cells grown in glycerol medium (Fig. 2B).

In order to determine whether Dci1p is a peroxisomalprotein we initially investigated the localization of the epitope-tagged protein by subcellular fractionation. Cells expressingDCI1HA were grown in oleate medium, converted tospheroplasts, and then subjected to differential centrifugation,as described in the Materials and Methods. The organelle-enriched pellet was resuspended in sorbitol buffer (pH 6.0),loaded onto a linear 15-36% Nycodenz gradient andcentrifuged (21,000 g) for 2.5 hours. Gradient fractions wereassayed for protein, and were analyzed by western blot for thepresence of acyl-CoA oxidase (peroxisomes), ATP/ADPcarrier protein (mitochondria) and for Dci1p, using an antibody(12CA5) that recognizes the HA epitope. The 12CA5 antibodylabeled a protein of approximately 30 kDa corresponding tothe predicted Mr of Dci1p, which co-localized with acyl-CoAoxidase (Fig. 3A), thus suggesting that Dci1p is a novelperoxisomal protein.

The peroxisomal localization of Dci1p was confirmed byimmunoelectron microscopy using the 12CA5 antibody.Peroxisomes are clearly decorated with gold particles (Fig.3B). Taken together the data described above confirms studiesperformed with a Dci1p-GFP fusion protein (Geisbrecht et al.,1999).

The carboxyl-terminal tripeptides of Eci1p or Dci1pare not required for their peroxisomal localization Eci1p and Dci1p each contain amino acid motifs that resemblethe carboxyl-terminal peroxisomal targeting signal 1 (PTS1;Gould et al., 1988). Eci1p terminates in the tripeptide His-Arg-Leu (HRL), while the amino acids His-Lys-Leu (HKL) arelocated at the carboxyl terminus of Dci1p. Although thesetripeptides have not been shown to act as functionalperoxisomal targeting signals, there are several lines ofevidence suggesting that they may be able to act in this

Fig. 2. DCI1 expression is induced by oleate in an Oaf1p-Pip2p-dependent manner. (A) Expression of DCI1 mRNA in wild-type(w.t), oaf1∆ (∆O1), pip2∆ (∆P2), and oaf1∆pip2∆ (∆O1P2) yeaststrains. Cells were grown in either YPD (glucose), YPG (glycerol),or YPGO (glycerol plus oleate) medium. Poly(A)+ RNA fractionsfrom cells grown in 50 ml cultures were resolved in a 1%formaldehyde agarose gel (see Materials and Methods). Levels ofDCI1 mRNA were quantitated from a northern blot, and the valueswere normalized using actin levels as an internal control for loading.Expression in our wild-type strain grown in the presence of oleate istaken to be 100%. (B) Extracts from wild-type (lanes 1 and 2) orDCI1HA (lanes 3 and 4) cells cultured in YPG (lanes 1 and 3) orYPGO (lanes 2 and 4) were separated by SDS-PAGE andimmunoblotted with polyclonal antibody against acyl-CoA oxidase(AOx) and the monoclonal antibody 12CA5, which recognizes theHA epitope (Dci1p).

538

capacity. First, a greater degree of degeneracy in the SKLsignal is permitted in yeast peroxisomal proteins comparedto higher eukaryotes (Roggenkamp, 1992; Subramani, 1993;Swinkels et al., 1992). Furthermore, the HRL tripeptide hasbeen shown to interact with the tetratricopeptide repeat domainof both yeast and human Pex5p (Lametschwandtner et al.,1998), the PTS1 receptor (Dodt et al., 1995; McCollum et al.,1993; Terlecky et al., 1995; Van Der Leij et al., 1993). In

I. V. Karpichev and G. M. Small

B

Fig. 3. Dci1p is localized to peroxisomes. (A) An organelle fractionobtained from YPGO-grown DCI1HA cells was separated on a linear15-36% Nycodenz gradient. The density (g/ml), and relative proteinvalues of gradient fractions are shown in the upper panel. Equalquantities of each fraction were loaded on a 10% SDS-polyacrylamide gel and analyzed by immunoblotting with antibodiesto peroxisomal acyl-CoA oxidase (AOx), mitochondrial ATP/ADPcarrier protein, or to the HA epitope (Dci1p), as shown in the lowerpanel. (B) Electron micrograph of a DCI1HA cell grown in YPGOmedium, showing a peroxisome decorated with gold particles (P). M,mitochondria; L, lipid droplet. Bar, 0.5 µm.

C

Fig. 4. Eci1p and Dci1p do not require their carboxyl-terminaltripeptides for peroxisomal targeting. Subcellular fractionation andimmunoblotting were carried out as described for Fig. 3A, with theexception that ECI1HA∆PTS1 and DCI1HA∆PTS1 cells were usedin A and B, respectively. The number of each fraction collected fromthe gradient is shown above the respective lanes of the gels, thedensity range of the gradient is shown below (ρ (g/ml)). (C) Electronmicrograph of a ECI1HA∆PTS1 cell grown in YPGO medium. P,peroxisome; M, mitochondria; L, lipid droplet. Bar, 0.5 µm.

539Novel peroxisomal targeting

addition, HRL and HKL meet with the more flexible consensusfound for the targeting of proteins to glycosomes ofTrypanosomes, being S/A/C/G/H/N/P-K/H/M/N/R/S-L/I/M/Y(Sommer et al., 1992). Taken together, these findings suggestthat HRL and HKL may act as functional PTS1s.

To determine whether the carboxyl-terminal tripeptides ofEci1p and Dci1p are required for their peroxisomallocalization, we prepared epitope-tagged versions of eachprotein in which their last three amino acids are deleted. Inorder to eliminate the possibility that one of these proteins (e.g.Eci1p) could oligomerize with the other (Dci1p) and beimported into peroxisomes in this manner, we expressed themutant proteins in a strain in which the endogenous copies of

both ECI1 and DCI1 were disrupted (see Table 1). Lysatesprepared from these cells, grown in the presence of oleate, weresubjected to subcellular fractionation as described above. BothEci1p∆PTS1 and Dci1p∆PTS1 were recovered in fractionswith a density of approximately 1.19-1.2 g/ml, that alsocontained the highest levels of acyl-CoA oxidase (Fig. 4A andB), suggesting that the truncated versions of each protein aretargeted to peroxisomes.

To confirm our finding that Eci1p∆PTS1 (which is expressedat a higher level than Dci1p) is localized in peroxisomes, weperformed immunoelectron microscopy on cells expressing theHA-tagged version of this protein. Peroxisomes are clearlylabeled using 12CA5 antibody and Protein A conjugated to 10nm gold particles (Fig. 4C), thus confirming that the last threeamino acids of Eci1p are not required for the peroxisomallocalization of this protein.

Since the experiments described above were performed instrains in which the endogenous copies of ECI1 and DCI1 weredisrupted, the results suggest that the import of Eci1p andDci1p occurs independently from each other, and does notrequire the presence of the other protein as was suggested byGeisbrecht et al. (1999).

Fig. 5. The PTS2 pathway is not required for peroxisomal targeting of the Eci proteins. (A) Amino terminal sequences of Eci1p and Dci1p,showing PTS2-like motifs. (B) pex7∆ECI1HA cells were subjected to isopycnic centrifugation as described in Fig. 3, and the fractions wereanalyzed for catalase activity and protein content (upper panel). Aliquots of high-speed supernatant (HS), high-speed pellet (ML) and densitygradient fractions were analyzed by immunoblotting with antibodies against acyl-CoA oxidase (AOx), the HA epitope (Eci1p), mitochondrialcytochrome oxidase (Cyt.Ox) and peroxisomal thiolase, as shown in the lower panel. (C) pex7∆DCI1HA cells were treated and analyzed asdescribed for B, except that the ATP/ADP carrier protein was used as a marker for mitochondria.

540

Does the peroxisomal targeting of Eci1p and Dci1poccur via the PTS2 pathway?Neither Eci1p nor Dci1p contain the consensus PTS2 at theiramino termini. However, they both contain amino acidsequences that bear some homology to the PTS2 motif, asshown in Fig. 5A. To determine whether the PTS2 targetingpathway is required for the peroxisomal localization of Eci1por Dci1p, we investigated the localization of each of theseproteins in a strain in which PEX7, encoding the PTS2receptor, was disrupted. We prepared a PEX7 deletion strain,and then introduced epitope-tagged versions of Eci1p orDci1p into this mutant strain. Cell lysates prepared from theresulting strains (pex7∆ECI1HA and pex7∆DCI1HA) werehomogenized and subjected to differential centrifugation. Themarker proteins for peroxisomes (acyl-CoA oxidase) andmitochondria (cytochrome oxidase or ATP/ADP carrierprotein) were recovered in the organelle pellet (ML), whereasthiolase (a PTS2 protein) was recovered in the high-speedsupernatant (HS) which contains the cell cytosol (Fig. 5B andC). A portion of each of the ML fractions was subjected tosubcellular fractionation as described above. Both Eci1p andDci1p co-localized with peroxisomal acyl-CoA oxidase andcatalase, at a density of approximately 1.20 g/ml (Fig. 5B andC). In Fig. 5C a negligible percentage of thiolase was detectedin the ML fraction, and this was recovered in the solublefractions of the gradient at a density of 1.1 g/ml. This most

likely represents protein contained in a small amount of high-speed supernatant that is unavoidably carried along with theorganelle pellet.

Since Eci1p and Dci1p are able to target to peroxisomeswhen their carboxyl-terminal amino tripeptides are deleted,and are also localized to peroxisomes in cells lacking afunctional PTS2 pathway, it is possible that they can utilizeeither pathway to achieve their correct localization. To addressthis question, we next asked whether versions of the proteinscarrying carboxyl-terminal deleteions are localized toperoxisomes in pex7∆ cells. It has been reported that Eci1p andDci1p are able to interact with each other, thus to avoid thepossibility that a version of Dci1p lacking the putative PTS1may enter peroxisomes via a complex with endogenous Dci1por Eci1p, we introduced the Dci1p∆PTS1 construct into ourpex7∆ strain in which the endogenous ECI1 and DCI1 geneswere also deleted (Table 1). Following subcellular fractionationof this strain, Dci1p∆PTS1 co-localized with peroxisomal acyl-CoA oxidase at a density of approximately 1.19-1.20 g/ml (Fig.6). Thus, the protein appears to achieve peroxisomallocalization in a manner that does not require a PTS1 targetingsignal, and that does not utilize the PTS2 pathway.

Does the peroxisomal localization of Dci1p requirethe presence of the PTS1 receptor?The majority of peroxisomal matrix proteins are targeted toperoxisomes via the PTS1 pathway, which requires Pex5p, thePTS1 receptor (Van Der Leij et al., 1993). In order toinvestigate the peroxisomal localization of the Dci1p in a strainin which the PEX5 gene was disrupted, we performedsubcellular fractionation of homogenates prepared frompex5∆DCI1HA cells. In this case, since peroxisomes lackmany of their matrix proteins and thus equilibrate to a lighterdensity, the subcellular fractionation was performed in a linear10-30% Nycodenz gradient and 0.5 ml fractions werecollected, in an attempt to better separate these aberrantperoxisomes. The import of peroxisomal thiolase should not beaffected in these cells, thus we can assume that the distributionof thiolase represents those fractions containing peroxisomes(lacking all proteins that are targeted via the PTS1 pathway).Thiolase was distributed broadly across the gradient at adensity ranging between 1.09 and 1.14 g/ml (Fig. 7A). Dci1pshared a similar distribution to thiolase, suggesting that thisprotein is also targeted to peroxisomes. However, the majorityof the multifunctional protein (MFP) which has a carboxyl-terminal SKL motif and thus is targeted via the PTS1 pathway,was localized in the cell cytosol and did not enter the gradient(Fig. 7A). Mitochondria, as represented by the distribution ofcytochrome oxidase, were also distributed broadly across adensity of 1.1 to 1.14 g/ml, which is the normal equilibrationdensity for yeast mitochondria.

Due to the abnormal distribution of thiolase in the gradientshown in Fig. 7A, immunoelectron microscopy was performedon pex5∆DCI1HA cells, using an antibody against thiolase.These cells contained a few small peroxisomes that werelabeled with gold particles within the matrix (Fig. 7B). Inaddition, the cells contained many larger structures withmultiple membranes that were also decorated with goldparticles (Fig. 7B), suggesting that these aberrant peroxisomesare formed when PTS1-targeted proteins are unable to enter theorganelle.

I. V. Karpichev and G. M. Small

Fig. 6. Peroxisomal targeting of Dci1p does not require the presenceof a PTS1 or a functional PTS2 pathway.eci1∆dci1∆pex7∆DCI1HA∆PTS1 cells were subjected to isopycniccentrifugation as described in Fig. 3, and the fractions were analyzedfor protein content (upper panel). Aliquots of high-speed supernatant(HS), high-speed pellet (ML) and density gradient fractions wereanalyzed by immunoblotting with antibodies against acyl-CoAoxidase (AOx), the HA epitope (Dci1p), thiolase and cytochromeoxidase (Cyt. Ox.) as shown in the lower panel.

541Novel peroxisomal targeting

Since Dci1p appears to be localized to peroxisomes in theabsence of either of the PTS receptors, we examined thedistribution of this protein in a strain lacking both Pex5p andPex7p. Dci1p equilibrated at a density that was slightly lighter(1.06 to 1.125 g/ml) than in gradients from cells lacking onlyone of the receptors (Fig. 7C). The fact that peroxisomesequilibrate at a lighter density in pex5∆pex7∆ cells is notsurprising, since the majority of peroxisomal proteins shouldnot be imported into the organelle in this double disruptionstrain. In this experiment, thiolase was mostly recovered in thecytosol, whereas a small amount of MFP was recovered in theorganelle fraction (ML). However, the protein that entered thegradient was recovered in the soluble fractions, as indicated by

co-localization with phosphoglycerate kinase (PGK), acytosolic protein (Fig. 7C).

Taken together, these data suggest that there is an additionalpathway or mechanism(s) for the peroxisomal localization ofDci1p.

DISCUSSION

Many peroxisomal proteins are induced when S. cerevisiae isgrown in the presence of a fatty acid such as oleate. Themajority of these proteins are transcriptionally regulated underthe control of the Oaf1p-Pip2p heterodimer, which binds to the

AB

Fig. 7. Dci1p is targeted to peroxisomes in theabsence of either of the known PTS receptors.A. pex5∆DCI1HA cells were subjected toisopycnic centrifugation as described in Fig. 3except that a linear 10-30% gradient was used,and 0.5 ml fractions were collected (upperpanel). Aliquots of high-speed supernatant(HS), high-speed pellet (ML) and densitygradient fractions were analyzed byimmunoblotting with antibodies against theperoxisomal multifunctional protein (MFP), theHA epitope (Dci1p), thiolase, cytochromeoxidase (Cyt. Ox.) and phosphoglyceratekinase (PGK) as shown in the lower panel.(B) Electron micrograph of a pex5∆DCI1HAcell grown in YPGO medium. A smallperoxisome labeled with anti-thiolase and 10nm gold is shown (P), in addition to aberrantperoxisomal structures (AP). Bar, 0.5 µm.(C) pex5∆pex7∆DCI1HA cells were subjectedto isopycnic centrifugation and the collectedfractions were analyzed by immunoblottingwith the same antibodies as described for A.

542

ORE sequence in the promoter of genes encoding such proteins(Karpichev et al., 1997; Luo et al., 1996; Rottensteiner et al.,1997). Through our search of the yeast genome data base forgenes containing this promoter response element (Karpichevand Small, 1998), we identified a novel peroxisomal proteinbelonging to hydratase/isomerase family of proteins. Thisprotein, which was subsequently named Dci1p (Geisbrecht etal., 1999), is 50% identical to peroxisomal ∆3,∆2-enoyl-CoAisomerase, encoded by the ECI1 gene (Geisbrecht et al., 1998;Gurvitz et al., 1998). Furthermore, Gurvitz et al. (1999)recently demonstrated that Dci1p has di-isomerase and 3,2-isomerase activities, and they suggest that this protein isdispensable for yeast survival and growth on oleic acid.

Having found that the DCI1 gene is induced by oleate in anOaf1p-Pip2p-dependent fashion, the next hint that Dci1pmight be localized to peroxisomes came from the fact that itcontains the tripeptide histidine-lysine-leucine at its carboxylterminus. This sequence is highly homologous to the serine-lysine-leucine motif that acts as the functional targeting signalof the majority of peroxisomal matrix proteins (Gould et al.,1987, 1989), and is also similar to the PTS1-like motifhistidine-lysine-leucine found at the carboxyl terminus ofEci1p. In addition, both Eci1p and Dci1p have PTS2-likesequences at their amino-termini. However, while we haveconfirmed that both of these proteins are localized toperoxisomes, we have found that their putative PTS1 signalsare not required for their peroxisomal localization.Furthermore, we have demonstrated that targeting of theseprotein does not require the PTS2 pathway, and that neither ofthe two known receptors for peroxisome import (PTS1 andPTS2) is required for Dci1p to localize to peroxisomes. Takentogether, these data suggest that Eci1p and Dci1p are targetedto peroxisomes via an alternative pathway or mechanism, andraises the possibility that they may have additional internaltargeting sequence(s). This phenomenon is not withoutprecedence. The YCAT gene of S. cerevisiae encodes acarnitine acetyltransferase that is found in both mitochondriaand peroxisomes. This protein has a mitochondrial targetingsignal at the amino terminus and a PTS1 (alanine-lysine-leucine) at the carboxyl terminus, however, peroxisomalimport is dependent on the carbon source in the growthmedium, since oleate-grown cells produce a shorter YCATtranscript that initiates at a downstream AUG (Elgersma et al.,1995). Deletion of both of the Ycatp targeting motifs revealedthe presence of an internal targeting sequence responsible formediating the peroxisomal import of this protein in a Pex5p-dependent fashion. Furthermore, an internal region of theYCAT gene interacts with PEX5, the PTS1 receptor, in a two-hybrid system, although the exact nature of the internal PTShas not yet been defined (Elgersma et al., 1995). Furtherexperiments are required to determine whether there is also aninternal peroxisomal targeting sequence in Eci1p and Dci1p,although a preliminary comparison between the amino acidssequences of these proteins and Ycatp did not reveal anyregions of significant homology. We have demonstrated thatDci1p is found exclusively in peroxisomes in oleate-growncells, however we have not addressed the localization of thisprotein in cells grown in glucose, since very few peroxisomesare present in non-induced cells.

The existence of peroxisomal proteins with more thanone functional targeting signal suggests that there is an

evolutionary pressure for the correct localization of thoseproteins, and further indicates that the proteins may haveessential roles in peroxisome biology or biogenesis. This hasbeen demonstrated for Pex8p (Per1p), a peroxisomal matrixprotein from the yeast Hansenula polymorpha (Waterham etal., 1994). This protein has a carboxyl-terminal PTS1sequence, AKL, in addition to the PTS2 sequence KLX5QLat amino acids 7 through 15. Experiments with Pex8p-PTS-β-lactamase fusion proteins suggested that both PTS signalsare capable of acting as peroxisomal targeting signals in vivo.Pex8p is required for peroxisome biogenesis and, while theprecise function of this protein is unclear, it has beensuggested that this peroxin may participate in triggering theprotein import competence of individual peroxisomes, thusindicating that its presence in pre-peroxisomal structures isessential for the formation of mature peroxisomes (Waterhamet al., 1994).

The data presented here on the peroxisomal targeting ofEci1p and Dci1p, taken together with peroxisome targetingstudies from many different laboratories, indicate that theprocess of peroxisomal protein import is more complex thanwas originally envisioned. A simplified model predicts thatrecognition of PTS1 and PTS2 targeting signals is performedby the PTS-specific receptors, Pex5p and Pex7p, respectively(Marzioch et al., 1994; Rehling et al., 1996; Terlecky et al.,1995; Van Der Leij et al., 1993; Zhang and Lazarow, 1996).These receptor-protein complexes would then be recognized bythe docking proteins Pex13p and Pex14p, both of which areperoxisomal membrane proteins that interact directly orindirectly with the PTS receptors (Brocard et al., 1997;Elgersma et al., 1996a; Erdmann and Blobel, 1996; Girzalskyet al., 1999; Gould et al., 1996), thus forming a complex at theperoxisome membrane that somehow facilitates import ofperoxisome matrix proteins. In addition, Pex18p and Pex21pinteract with Pex7p, and are also required for PTS2 targeting(Purdue et al., 1998). However, for the import of certainperoxisomal proteins there are additional features that do notfit with such a simplistic model. In the case of Eci1p and Dci1p,which can target to peroxisomes when their carboxyl-terminalamino acids are deleted and in the absence of a functional PTS2pathway, it seems likely that there are separate, as yet unknownsignaling sequence(s).

The model outlined above for the import of peroxisomalproteins does not account for the manner in which completelyfolded polypeptides, or albumin-SKL conjugated to goldparticles are translocated into peroxisomes (Walton et al.,1995). In addition, the peroxisomal protein Pex15p from S.cerevisiae appears to go to peroxisomes via the endoplasmicreticulum (ER; Elgersma et al., 1997), and rat PMP50 issynthesized on membrane-bound polyribosomes and is foundassociated with both the ER and peroxisomes (Bodnar andRachubinski, 1991), raising yet another possible mode ofimport for specific peroxisomal proteins. Clearly much remainsto be elucidated concerning the detailed mechanisms ofperoxisome biogenesis.

We are indebted to Vladimir Protopopov for performing all electronmicroscopy. We also thank Dr Rick Rachubinski for providing us withantibodies to acyl-CoA oxidase and thiolase. This work was supportedby NIH grant R55DKOD51992 and by the American HeartAssociation grant 9850107T.

I. V. Karpichev and G. M. Small

543Novel peroxisomal targeting

REFERENCES

Alani, E., Cao, L. and Kleckner, N. (1987). A method for gene disruptionthat allows repeated use of URA3 selection in the construction of multiplydisrupted yeast strains. Genetics 116, 541-545.

Amery, L., Brees, C., Baes, M., Setoyama, C., Miura, R., Mannaerts, G.P. and Van Veldhoven, P. P. (1998). C-terminal tripeptide Ser-Asn-Leu(SNL) of human D-aspartate oxidase is a functional peroxisome-targetingsignal. Biochem. J. 336, 367-371.

Aubourg, P. (1994). Adrenoleukodystrophy and other peroxisomal diseases.Curr. Opin. Genet. Dev. 4, 407-411.

Ausubel, F. J., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,Smith, J. A. and Struhl, K. (1992). Current Protocols in MolecularBiology. Greene Publishing Associates, New York.

Bodnar, A. G. and Rachubinski, R. A. (1991). Characterization of theintegral membrane polypeptides of rat liver peroxisomes isolated fromuntreated and clofibrate-treated rats. Biochem. Cell Biol. 69, 499-508.

Bradford, M. (1976). A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal. Biochem. 72, 248-254.

Brocard, C., Lametschwandtner, G., Koudelka, R. and Hartig, A. (1997).Pex14p is a member of the protein linkage map of Pex5p. EMBO J. 16,5491-5500.

de Duve, C. (1965). Functions of microbodies (peroxisomes). J. Cell Biol. 27,25A-26A.

Dodt, G., Braverman, N., Wong, C., Moser, A., Moser, H. W., Watkins, P.,Valle, D. and Gould, S. J. (1995). Mutations in the PTS1 receptor gene,PKR1, define complementation group 2 of the peroxisome biogenesisdisorders. Nature Genet. 9, 115-125.

Dyer, J. M., McNew, J. A. and Goodman, J. M. (1996). The sorting sequenceof the peroxisomal integral membrane protein PMP47 is contained within ashort hydrophilic loop. J. Cell Biol. 133, 269-280.

Einerhand, A. W. C., Kos, W. T., Distel, B. and Tabak, H. F. (1993).Characterization of a transcriptional control element involved inproliferation of peroxisomes in yeast in response to oleate. Eur. J. Biochem.314, 323-331.

Elgersma, Y., Kwast, L., Van den Berg, M., Snyder, W. B., Distel, B.,Subramani, S. and Tabak, H. K. (1997). Overexpression of Pex15p, aphosphorylated peroxisomal integral membrane protein required forperoxisome assembly in S. cerevisiae, causes proliferation of theendoplasmic reticulum membrane. EMBO J. 16, 7326-7341.

Elgersma, Y., van Roermund, W. T., Wanders, R. J. A. and Tabak, H. F.(1995). Peroxisomal and mitochondrial carnitine acetyltransferase ofSaccharomyces cerevisiae are encoded by a single gene. EMBO J. 14, 3472-3479.

Elgersma, Y., Kwast, L., Voorn-Brouwer, T., Van den Berg, M., Metzig,B., America, T., Tabak, H. F. and Distel, B. (1996a). The SH3 domain ofthe Saccharomyces cerevisae peroxisomal membrane protein Pex13pfunctions as a docking site for Pex5p, a mobile receptor for the import ofPTS1-containing proteins. J. Cell Biol. 135, 97-109.

Elgersma, Y., Vos, A., Van den Berg, M., van Roermund, C. W. T., Vander Sluijs, P., Distel, B. and Tabak, H. F. (1996b). Analysis of thecarboxyl-terminal peroxisomal targeting signal 1 in a homologous contextin Saccharomyces cerevisiae. J. Biol. Chem. 271, 26375-26382.

Erdmann, R. and Blobel, G. (1996). Identification of Pex13p, a peroxisomalmembrane receptor for the PTS1 recognition factor. J. Cell Biol. 135, 111-121.

Filipits, M., Simon, M. M., Rapatz, W., Hamilton, B. and Ruis, H. (1993).A Saccharomyces cerevisiae upstream activating sequence mediatesinduction of peroxisome proliferation by fatty acids. Gene 132, 49-55.

Fitzpatrick, D. R., Germain-Lee, E. and Valle, D. (1995). Isolation andcharacterization of rat and human cDNAs encoding a novel putativeperoxisomal enoyl-CoA hydratase. Genomics 27, 457-466.

Geisbrecht, B. V., Schulz, K., Nau, K., Geraghty, M. T., Schulz, H.,Erdmann, R. and Gould, S. J. (1999). Preliminary characterization ofYor180Cp: Identification of a novel peroxisomal protein of Saccharomycescerevisiae involved in fatty acid metabolism. Biochem. Biophys. Res.Commun. 260, 28-34.

Geisbrecht, B. V., Zhu, D., Schulz, K., Nau, K., Morrell, J. C., Geraghty,M., Schulz, H., Erdmann, R. and Gould, S. J. (1998). Molecularcharacterization of Saccharomyces cerevisiae ∆3, ∆2-enoyl-CoA isomerase.J. Biol. Chem. 273, 33184-33191.

Girzalsky, W., Rehling, P., Stein, K., Kipper, J., Blank, L., Kunau, W.-H.and Erdmann, R. (1999). Involvement of Pex13p in Pex14p localization

and peroxisomal targeting signal 2-dependent protein import intoperoxisomes. J. Cell Biol. 144, 1151-1162.

Glover, J. R., Andrews, D. W. and Rachubinski, R. A. (1994).Saccharomyces cerevisiae peroxisomal thiolase is imported as a dimer. Proc.Nat. Acad. Sci. USA 91, 10541-10545.

Goldfischer, S., Moore, C. L., Johnson, A. B., Spiro, A. J., Valsamis, M. P.,Wisniewski, H. K., Ritch, R. H., Norton, W. T., Rapin, I. and Gartner,L. M. (1973). Peroxisomal and mitochondrial defects in the cerebro-hepato-renal syndrome. Science 182, 62-64.

Gould, S. J., Keller, G.-A. and Subramani, S. (1987). Identification of aperoxisomal targeting signal at the carboxy terminus of firefly luciferase. J.Cell Biol. 105, 2923-2931.

Gould, S. J., Keller, G.-A. and Subramani, S. (1988). Identification ofperoxisomal targeting signals located at the carboxy terminus of fourperoxisomal proteins. J. Cell Biol. 107, 897-905.

Gould, S. J., Keller, G.-A., Hosken, N., Wilkinson, J. and Subramani, S.(1989). A conserved tripeptide sorts proteins to peroxisomes. J. Cell Biol.108, 1657-1664.

Gould, S. J., Kalish, J. E., Morrell, J. C., Bjorkman, J., Urquhart, A. J.and Crane, D. I. (1996). Pex13p is an SH3 protein of the peroxisomemembrane and a docking factor for the predominantly cytoplasmic PTS1receptor. J. Cell Biol. 135, 85-95.

Gurvitz, A., Mursula, A. M., Firzinger, A., Hamilton, B., Kilpelainen, S.H., Hartig, A., Ruis, H., Hiltunen, J. K. and Rottensteiner, H. (1998).Peroxisomal ∆3-cis-∆2-trans-enoyl-CoA isomerase encoded by ECI1 isrequired for growth of the yeast Saccharomyces cerevisiae on unsaturatedfatty acids. J. Biol. Chem. 273, 31366-31374.

Gurvitz, A., Mursula, A. M., Yagi, A. I., Hartig, A., Ruis, H., Rottensteiner,H. and Hiltunen, J. K. (1999). Alternatives to the isomerase-dependentpathway for the ß-oxidation of oleic acid are dispensable in Saccharomycescerevisiae. J. Biol. Chem. 274, 24514-24521.

Janssen, U., Fink, T., Lichter, P. and Stoffel, W. (1994). Humanmitochondrial 3, 2-trans-enoyl-CoA isomerase (DCI); gene structure andlocalization to chromosome 16p13. 3. Genomics 23, 223-228.

Kamiryo, T., Sakasegawa, Y. and Tan, H. (1989). Expression and transportof Candida tropicalis peroxisomal acyl-CoA oxidase in the yeast Candidamaltosa. Agric. Biol. Chem. 53, 179-186.

Karpichev, I. V., Luo, Y., Marians, R. C. and Small, G. M. (1997). Acomplex containing two transcription factors regulates peroxisomeproliferation and the coordinate induction of β-oxidation enzymes inSaccharomyces cerevisiae. Mol. Cell. Biol. 17, 69-80.

Karpichev, I. V. and Small, G. M. (1998). Global regulatory functions ofOaf1p and Pip2p (Oaf2p), transcription factors that regulate genes encodingperoxisomal proteins in Saccharomyces cerevisiae. Mol. Cell. Biol. 18,6560-6570.

Kragler, F., Langeder, A., Raupachova, J., Binder, M. and Hartig, A.(1993). Two independent peroxisomal targeting signals in catalase A ofSaccharomyces cerevisiae. J. Cell Biol. 120, 665-673.

Lametschwandtner, G., Brocard, C., Fransen, M., Van Veldhoven, P.,Berger, J. and Hartig, A. (1998). The difference in recognition of terminaltripeptides as peroxisomal targeting signal 1 between yeast and human isdue to different affinities of their receptor Pex5p to the cognate signal andto residues adjacent to it. J. Biol. Chem. 273, 33635-33643.

Luo, Y., Karpichev, I. V., Kohanski, R. A. and Small, G. M. (1996).Purification, identification and properties of a Saccharomycescerevisiae oleate-activated upstream activating sequence-binding proteinthat is involved in the activation of POX1. J. Biol. Chem. 271, 12068-12075.

Marzioch, M., Erdmann, R., Veenhuis, M. and Kunau, W. H. (1994). PAS7encodes a novel yeast member of the WD-40 protein family essential forimport of 3-oxoacyl-CoA thiolase, a PTS2-containing protein, intoperoxisomes. EMBO J. 13, 4908-4917.

McCollum, D., Monosov, E. and Subramani, S. (1993). The pas8 mutant ofPichia pastoris exhibits the peroxisomal protein import deficiencies ofZellweger syndrome cells-The PAS8 protein binds to the COOH-terminaltripeptide peroxisomal targeting signal and is a member of the TPR proteinfamily. J. Cell Biol. 121, 761-774.

McNew, J. A. and Goodman, J. M. (1994). An oligomeric protein is importedinto peroxisomes in vivo. J. Cell Biol. 127, 1245-1257.

Naidu, S. and Moser, H. W. (1994). Peroxisomal disorders. Pediatr. Neuro.12, 727-739.

Osumi, T., Tsukamoto, T., Hata, S., Tokota, S., Miura, S., Fujiki, Y.,Hijikata, M., Miyazawa, S. and Hashimoto, T. (1991). Amino-terminalpresequence of the precursor of peroxisomal 3-ketoacyl-CoA thiolase is a

544

cleavable signal peptide for peroxisomal targeting. Biochem. Biophys. Res.Commun. 181, 947-954.

Purdue, P. E., Yang, X. and Lazarow, P. B. (1998). Pex18p and Pex21p, anovel pair of related peroxins essential for peroxisomal targeting by thePTS2 pathway. J. Cell Biol. 143, 1859-1869.

Rehling, P., Marzioch, M., Niesen, F., Wittke, E., Veenhuis, M. and Kunau,W.-H. (1996). The import receptor for the peroxisome targeting signal 2(PTS2) in Saccharomyces cerevisiae is encoded by the PAS7 gene. EMBOJ. 15, 2901-2913.

Roggenkamp, R. (1992). Targeting signals for protein import intoperoxisomes. Cell Biochem. Func. 10, 193-199.

Rottensteiner, H., Kal, A. J., Hamilton, B. and Tabak, H. F. (1997). Aheterodimer of the Zn2Cys6 transcription factors Pip2p and Oaf1p controlsinduction of genes encoding peroxisomal proteins in Saccharomycescerevisiae. Eur. J. Biochem. 247, 776-783.

Sherman, F. (1991). Basic methods of yeast genetics. In Guide to YeastGenetics and Molecular Biology (ed. J. N. Abelson and M. Simon), pp. 3-38. Academic Press, New York.

Sikorski, R. S. and Hieter, P. (1989). A system of shuttle vectors and yeasthost strains designed for efficient manipulation of DNA in Saccharomycescerevisiae. Genetics 122, 19-27.

Singh, I. (1997). Biochemistry of peroxisomes in health and disease. Mol.Cell. Biochem. 167, 1-29.

Singh, K. K., Small, G. M. and Lewin, A. S. (1992). Alternative topogenicsignals in peroxisomal citrate synthase of Saccharomyces cerevisiae. Mol.Cell. Biol. 12, 5593-5599.

Small, G. M., Szabo, L. J. and Lazarow, P. B. (1988). Acyl-CoA oxidasecontains two targeting sequences each of which can mediate protein importinto peroxisomes. EMBO J. 7, 1167-1173.

Sommer, J. M., Cheng, Q. L., Keller, G. A. and Wang, C. C. (1992). In vivoimport of firefly luciferase into the glycosomes of Trypanosoma brucei andmutational analysis of the C-terminal targeting signal. Mol. Biol. Cell 3, 749-759.

Subramani, S. (1993). Protein import into peroxisomes and biogenesis of theorganelle. Annu. Rev. Cell Biol. 9, 445-478.

Swinkels, B. W., Gould, S. J., Bodnar, A., Rachubinski, R. A. and

Subramani, S. (1991). A novel, cleavable peroxisomal targeting signal atthe amino-terminus of the rat 3-ketoacyl-CoA thiolase. EMBO J. 10, 3255-3262.

Swinkels, B. W., Gould, S. J. and Subramani, S. (1992). Targetingefficiencies of various permutations of the concensus C-terminal tripeptideperoxisomal targeting signal. FEBS Lett. 305, 133-136.

Terlecky, S. R., Nuttley, W. M., McCollum, D., Sock, E. and Subramani,S. (1995). The Pichia pastoris peroxisomal protein PAS8p is the receptorfor the C-terminal tripeptide peroxisomal targeting signal. EMBO J. 14,3627-3634.

Thomas, B. J. and Rothstein, R. (1989). Elevated recombination rates intranscriptionally active DNA. Cell 56, 619-630.

Tyers, M., Tokiwa, G. and Futcher, B. (1993). Comparison of theSaccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator ofCln1, Cln2 and other cyclins. EMBO J. 12, 1955-1968.

Van Der Leij, I., Franse, M. M., Elgersma, Y., Distel, B. and Tabak, H. F.(1993). PAS 10 is a tetratricopeptide-repeat protein that is essential for theimport of most matrix proteins into peroxisomes of Saccharomycescerevisiae. Proc. Nat. Acad. Sci. USA 90, 11782-11786.

Walton, P. A., Hill, P. E. and Subramani, S. (1995). Import of stably foldedproteins into peroxisomes. Mol. Biol. Cell 6, 675-683.

Wanders, R. J., Schutgens, R. B. and Barth, P. G. (1995). Peroxisomaldisorders: a review. J. Neuropathol. Exp. Neurol. 54, 726-739.

Waterham, H. R., Titorenko, V. I., Haima, P., Cregg, J. M., Harder, W.and Veenhuis, M. (1994). The Hansenula polymorpha PER1 gene isessential for peroxisome biogenesis and encodes a peroxisomal matrixprotein with both carboxy- and amino-terminal targeting signals. J. CellBiol. 127, 737-749.

Wiemer, E. A. C., Luers, G. H., Faber, K. N., Wenzel, T., Veenhuis, M. andSubramani, S. (1996). Isolation and characterization of Pas2p, aperoxisomal membrane protein essential for peroxisome biogenesis in themethylotropic yeast Pichia pastoris. J. Biol. Chem. 271, 18973-18980.

Zhang, J. W. and Lazarow, P. B. (1996). Peb1p (Pas7p) is anintraperoxisomal receptor for the NH2-terminal, type 2, peroxisomaltargeting sequence of thiolase: Peb1p itself is targeted to peroxisomes by anNH2-terminal peptide. J. Cell Biol. 132, 325-334.

I. V. Karpichev and G. M. Small