Nonsteroidal anti-inflammatory drug induces proinflammatory damage in gastric mucosa through NF-κB activation and neutrophil infiltration: Anti-inflammatory role of heme oxygenase-1

Q1

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

Q2

Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Contents lists available at SciVerse ScienceDirect

Free Radical Biology and Medicine

0891-58http://d

AbbreICAM-1cule 1, Inuclear

n CorrE-m

udayb@

Pleasthrou

journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Nonsteroidal anti-inflammatory drug induces proinflammatorydamage in gastric mucosa through NF-κB activation and neutrophilinfiltration: Anti-inflammatory role of heme oxygenase-1 againstnonsteroidal anti-inflammatory drug

Samik Bindu, Somnath Mazumder, Sumanta Dey, Chinmay Pal, Manish Goyal, Athar Alam,Mohd.Shameel Iqbal, Souvik Sarkar, Asim Azhar Siddiqui, Chinmoy Banerjee,Uday Bandyopadhyay n

Department of Infectious Diseases and Immunology, Indian Institute of Chemical Biology, 4 Raja S. C. Mullick Road, Jadavpur, Kolkata 700032, West Bengal,India

a r t i c l e i n f o

Article history:Received 13 February 2013Received in revised form26 June 2013Accepted 19 July 2013

Keywords:NSAIDMitochondrial oxidative stressHeme oxygenase-1 (HO-1)AntioxidantsGastropathyInflammation

49/$ - see front matter & 2013 Published by Ex.doi.org/10.1016/j.freeradbiomed.2013.07.027

viations: HO-1, heme oxygenase-1; MOS, mi, intracellular adhesion molecule 1, VCAM-1, vL-1β, interleukin 1β; MCP-1, monocyte chemofactor-κBesponding author. Fax: 91 33 2473 0284.ail addresses: [email protected],iicb.res.in (U. Bandyopadhyay).

e cite this article as: Bindu, S; et algh NF-κB.... Free Radic. Biol. Med. (2

a b s t r a c t

Nonsteroidal anti-inflammatory drug (NSAID)-induced mitochondrial oxidative stress (MOS) is an importantprostaglandin (PG)-independent pathway of the induction of gastric mucosal injury. However, the molecularmechanism behind MOS-mediated gastric pathology is still obscure. In various pathological conditions of tissueinjury oxidative stress is often linked with inflammation. Here we report that MOS induced by indomethacin(an NSAID) induces gastric mucosal inflammation leading to proinflammatory damage. Indomethacin, timedependently stimulated the expression of proinflammatory molecules such as intercellular adhesion molecule1(ICAM-1), vascular cell adhesion molecule 1(VCAM-1), interleukin1β (IL-1β), and monocyte chemotacticprotein-1 (MCP-1) in gastric mucosa in parallel with the increase of neutrophil infiltration and injury of gastricmucosa in rat. Western immunoblotting and confocal microscopic studies revealed that indomethacin inducednuclear translocation of nuclear factor kappa-B (NF-κB) in gastric mucosal cells, which resulted in proin-flammatory signaling. The prevention of MOS by antioxidant tryptamine-gallic acid hybrid (SEGA) inhibitedindomethacin-induced expression of ICAM-1, VCAM-1, IL-1β, and MCP-1. SEGA also prevented indomethacin-induced NF-κB activation and neutrophil infiltration as documented by chromatin immunoprecipitation studiesand neutrophil migration assay, respectively. Hemeoxygenase-1 (HO-1), a cytoprotective enzyme associatedwith tissue repair mechanisms is stimulated in response to oxidative stress. We have investigated the role ofHO-1 against MOS and MOS-mediated inflammation in recovering from gastropathy. Indomethacin stimulatedthe expression of HO-1 and indomethacin-stimulated HO-1 expression was reduced by SEGA, an antioxidant,which could prevent MOS. Thus, the data suggested that the induction of HO-1 was a protective responseagainst MOS developed by indomethacin. Moreover, the induction of HO-1 by cobalt protoporphyrin inhibitedinflammation and chemical silencing of HO-1 by zinc protoporphyrin aggravated the inflammation byindomethacin. Thus, NSAID by promoting MOS-induced proinflammatory response damaged gastric mucosaand HO-1 protected NSAID-induced gastric mucosal damage by preventing NF-κB activation and proinflam-matory activity.

& 2013 Published by Elsevier Inc.

676869707172

Introduction

Development of gastric mucosal injury is a major limitation tothe use of nonsteroidal anti-inflammatory drugs (NSAIDs) for the

7374757677787980

lsevier Inc.

tochondrial oxidative stress;ascular cell adhesion mole-tactic protein-1; NF-κB,

. Nonsteroidal anti-inflamm013), http://dx.doi.org/10.101

treatment of chronic inflammatory diseases [1]. The severity ofgastric mucosal injury by NSAIDs is associated with the loss ofmucosal integrity, gastric mucosal bleeding, reduction in inherentantioxidant defense of gastric mucosa, apoptosis of mucosal cells,inhibition of cell renewal, and migration of cells of gastric pits to thedamaged epithelial lining [2,3]. Previous studies have opined thatNSAIDs-induced gastropathy was mediated by inhibiting cyclooxy-genase (COX), which is required for the production of the “protective”prostaglandins [4,5]. However, several recent studies suggest that themechanism by which NSAIDs promote gastric injury may be muchmore complex than originally thought. For example, Ligumsky et al.have shown that rectal administration of certain NSAIDs inhibited

8182

atory drug induces proinflammatory damage in gastric mucosa6/j.freeradbiomed.2013.07.027i

www.sciencedirect.com/science/journal/08915849

www.elsevier.com/locate/freeradbiomed

http://dx.doi.org/10.1016/j.freeradbiomed.2013.07.027



mailto:ubandyo&underscore;[email protected]





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

S. Bindu et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎2

prostaglandin production by greater than 95% yet did not inducegastric ulcers [6]. In addition, Langenbach et al. have shown thatdeletion of the prostaglandin-endoperoxide synthase 1 (Ptgs 1) geneencoding for the cyclooxygenase-1 (COX-1) isoenzyme in mice didnot result in the development of spontaneous gastric ulcers [7].Therefore, the existence of a nonprostaglandin-mediated pathway ofmucosal damage by indomethacin is clear. It has been shown thatoxidative stress especially mitochondrial oxidative stress (MOS) playsa pivotal role in different models of gastric mucosal injury, which isin accord with several reported data [3,8,9].

NSAID-induced mitochondrial pathology is mainly attributed tothe uncoupling of oxidative phosphorylation, which in turn leads to adecrease in cellular ATP/ADP ratio and subsequent dissipation ofmitochondrial membrane potential [10,11]. The fall of membranepotential results in opening of the permeability transition pores,ultimately releasing cytochrome c from intramitochondrial compart-ments which is a hallmark of apoptosis [12]. Recent studies have beenconducted to show that naturally occurring plant polyphenols act aspowerful antioxidants to protect intestinal Caco-2 cells against theoxidative mitochondrial and cell damage induced by indomethacin[13,14]. Mitochondria obtained from the gastric mucosa of rats treatedwith indomethacin showed structural and functional alterationswhich included a severe impairment of their stage 3 and 4 respirations[8]. Electron paramagnetic studies of NSAIDs on submitochondrialparticles demonstrated that indomethacin binds to a site nearComplex I and ubiquinone to generate free radical species insidemitochondria [15]. This resulted in mitochondrial dysfunction andgeneration of MOS, which is associated with inflammation. Reactiveoxidants derived from mitochondria act as signal-transducing mole-cules that intensify the up-regulation of inflammatory cytokinesubsets via discrete molecular pathways [16,17]. Thus, generation offree radicals and reactive oxidant-mediated damage of tissue oftenleads to inflammatory disorders [16–21]. The attraction of leukocytesto the specific tissue site is a hallmark incident in the initiation ofinflammation [22]. Many studies have revealed the involvement ofpolymorphonuclear leukocytes (PMN) in the pathogenesis of gastricmucosal injury [1,23,24]. Infiltration of neutrophils is further asso-ciated with production of superoxide and other reactive oxidants [25]and the development of oxidative stress in the gastric mucosa [26,27].The overall process of inflammation is orchestrated by chemokinesand cytokines. Thus, inflammation plays a significant role in thepathogenesis of gastric injury [26]. NSAID-treated gastric mucosa canrecover from its injury with time [28]. This demonstrates its inherentcytoprotective mechanism. Heme oxygenase-1 (HO-1) is a cytopro-tective factor which actively participates in the tissue repair mechan-ism. Under basal conditions, HO-1 is expressed at low levels but ishighly induced in response to various agents including oxidativestress [29] and inflammatory cytokines [30–32] beside other stimu-lators [33]. The expression of HO-1 is increased in inflamed stomach[34] and during the healing phase of gastric ulcers [26,35]. InNSAID-induced gastropathy, MOS is considered as an importantprostaglandin-independent mechanism for the induction of injuryin gastric mucosa [8]. However, the mechanism behind MOS action isstill elusive. Existing literature establishes MOS as a critical player ininducing inflammation [16]. Here we report that NSAID by promotingMOS induced proinflammatory responses to develop gastric mucosalinjury and HO-1 protected this NSAID-induced gastropathy by pre-venting NF-κB activation and proinflammatory activities in gastricmucosa.

Materials and methods

Materials

Indomethacin, glucose-6-phosphate dehydrogenase, glucose6-phosphate, hemin, and cobalt protoporphyrin were obtained

Please cite this article as: Bindu, S; et al. Nonsteroidal anti-inflammthrough NF-κB.... Free Radic. Biol. Med. (2013), http://dx.doi.org/10.101

from Sigma. Taurine was procured from SRL, India. The RevertAidH-Minus First Strand cDNA synthesis kit, 2X PCR Master Mix, andnuclease-free water were purchased from Fermentas. HO-1 anti-body was procured from Abcam. NFκB, IκB, and IKKβ antibodieswere obtained from Santa Cruz Biotechnology (Santa Cruz, CA).The custom-based primer sequences were purchased from Inte-grated DNA Technologies Inc. (San Diego, CA, USA). Hoechst 33342,Alexa Fluor 647, and TRIzol were purchased from Invitrogen.Protease inhibitor cocktail (Set V), zinc protoporphyrin, andsecondary anti-rabbit HRP-conjugated antibody were purchasedfrom Calbiochem. All other reagents were of analytical gradepurity.

Animals and indomethacin-induced gastric mucosal injury

Sprague-Dawley rats (180–220 g) were used in all experiments.Animals were kept at 2472 1C with 12-h light and dark cycles.The animals were fasted for 24 h before initiating the experiment.They only had access to water to avoid food-induced enhancedsecretion of acid and its indulging effect on gastric lesions. Theanimal ethics committee guidelines were stringently followedwhile carrying out all in vivo studies. Indomethacin-induced gastricmucosal injury or treatment with zinc protoporphyrin (ZnPP) andcobalt protoporphyrin (CoPP) was performed as described [36–38].Briefly, all the animals were divided into control, indomethacin,indomethacin plus ZnPP (50 μg kg�1 bw), and indomethacin plusCoPP (10 mg kg�1 bw). Gastric mucosal tissue injury was induced inthe starved animals with oral administration of indomethacin at adose of 48 mg kg�1 bw. The indomethacin-treated rats were sub-divided into three groups (six to eight rats in each group). Theindomethacin-induced animals were sacrificed at 0, 1, and 4 h afterindomethacin treatment. Stomachs were subsequently used forfurther studies. ZnPP and CoPP were given 30 min prior to indo-methacin administration. The animals that were treated withindomethacin plus ZnPP and CoPP groups were sacrificed 4 h afterindomethacin treatment. The control animals received vehicle only(no indomethacin). Mean ulcer index was calculated as describedpreviously [8,28].

RNA isolation and RT-PCR

Total RNA was isolated from gastric mucosa of control andexperimental sets of rats using the TRIzol reagent according to themanufacturer′s instructions (Invitrogen, Carlsbad, CA). Briefly,stomach tissues (100 mg) from rat were collected from each set,taken in 1.5 ml microfuge tube containing 1 ml of TRIzol, andminced finely. The minced tissues were homogenized and incu-bated for 3–5 min for complete dissociation of nucleoproteincomplexes and finally 0.2 ml of chloroform was added per 1 mlof TRIzol. The tubes were inverted several times for 15 s, incubatedfor 2–3 min at room temperature, and then centrifuged at 12,000gfor 15 min at 4 1C. The transparent aqueous phase was aspiratedout and taken in a new tube and 0.5 ml of 100% isopropanol wasadded. The tubes were incubated for 1 h at �20 1C for precipita-tion of RNA. The tubes were next centrifuged at 12,000g for 10 minand the supernatant was discarded while the RNA pellet waswashed with 0.5 ml of 70% ethanol. This process was repeatedonce again. The tubes were next centrifuged at 7500 g for 5 min.The supernatant was discarded and the pellet was air-dried toremove the traces of alcohol. The pellet was next dissolved in 50 μlof nuclease free water by incubating at 60 1C for 10–15 min andresulting RNA solution was quantified spectrophotometrically.Then, 10 μg of RNA was treated with rDNase (DNA-free kit,Invitrogen, Carlsbad, CA) according to the instruction provided in





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117

S. Bindu et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎ 3

the kit and finally purified RNA was used for cDNA synthesis. TotalRNA (2 mg) was reverse-transcribed using the RevertAid FirstStrand cDNA synthesis kit (Fermentas, USA) according to themanufacturer′s instructions. The cDNA obtained was diluted forPCR. The primers were purchased from Integrated DNA Technol-ogies Inc. (San Diego, CA, USA). The details of primer sequences areprovided in Table 1. The PCR protocol consisted of the followingsteps: 95 1C for 2 min for initial denaturation, 35 cycles ofdenaturation at 94 1C for 1 min, annealing for 45 s at respectiveannealing temperatures (Table 1), extension at 72 1C for 2 min, andextension at 72 1C for 10 min. The PCR-amplified products wereresolved with the help of a 2% agarose gel and documented in aGel Doc system (Bio-Rad).

Histological study

Stomachs from control and indomethacin-treated rats at dif-ferent time points (0, 1, and 4 h) were fixed in 10% formalinphosphate-buffered saline (PBS) (pH 7.4) for 12 h at 25 1C andembedded in paraffin. Further, semithin sections were preparedwhich were ultimately taken on poly-L-lysine-coated glass slidesand double-stained with eosin-hematoxylin [3,39]. The slideswere then observed under a microscope (Leica DM-2500, Ger-many) equipped with a high-resolution digital camera.

Assay of myeloperoxidase (MPO) activity

MPO-chlorinating activity was measured on the basis of thechlorination of taurine with the MPO/H2O2/Cl� system [9,40].5-Thio-2-nitrobenzoic acid (TNB) from 5,5′-dithiobis-2-nitroben-zoic acid (DTNB) was prepared before starting the assay. The pH ofa 2 mM DTNB solution was increased to prepare TNB. Theconcentration of TNB (extinction coefficient is 14,100 M�1 cm�1)was spectrophotometrically measured at 412 nm [40]. Mucosaltissues excised from rats sacrificed at 0, 1, and 4 h after indo-methacin treatment were homogenized in PBS (pH 7.4) and werecentrifuged at 10,000 g for 10 min. The supernatant was discardedand the pellet was then dissolved in ice-cold solubilization buffer(0.5% hexadecyltrimethyl ammonium bromide in PBS, pH 7.4). Toensure lyses the samples were then sonicated and freeze-thawedthree times. They were further centrifuged at 12,000 g for 30 minat 4 1C and the supernatant was used for the MPO assay. Tubescontaining 880 ml PBS (pH 7.4) and 80 ml tissue samples wereincubated for 5 min in a water bath at 25 1C. Then 40 ml H2O2

(2.5 mM) was added and mixed well. After 30 min the reactionwas terminated by adding 40 ml of catalase and then 100 ml TNBwas added to each well. Hypochlorous acid reacts with taurine toproduce taurine chloramine, which then reacts with yellow TNB toproduce colorless DTNB. After 20 min the absorbance was mea-sured at 412 nm. The amount of MPO in the sample is proportionalto the decrease in TNB concentration and MPO activity was

118119120121122123124125126127128129130131132

Table 1PCR primer sequences: The forward primers (FP) and the reverse primers (RP) usedin this study are tabulated along with their annealing temperatures.

Genes Primer sequences (5′ 3′)- Annealing temperature (1C)

ICAM-1 FP GTGAGCGTCCATATTTAGGCATGG 55RP ACAGACACTAGAGGAGTGAGCAGG 55

VCAM-1 FP GGAGACACTGTCATTATCTCCTG 55RP TCCTTTCATGTTGGCTTTTCTTGC 55

IL-1β FP GTCACTCATTGTGGCTGTGG 55RP GCAGTGCAGCTGTCTAATGG 55

MCP-1 FP ATGCAGGTCTCTGTCACG 55RP CTTCTGGACCCATTCCTTATTGG 55

β-Actin FP CTATGTTGCCCTAGACTTCG 56RP TTGATCTTCATGGTGCTAGG 56


expressed as units per gram. One unit is the amount of MPO thatcan produce 1.0 nmol of taurine chloramine, which in turn canoxidize 2.0 nmol of TNB to DTNB in the specified assay condition.

Preparation of nuclear extracts

Nuclear extracts were isolated using nuclear extraction buffers I(10 mM Hepes, 1.5 mM MgCl2, 10 mM KCl, and 0.5% Triton X-100)and II (1 M NaCl, 0.2 M EDTA, 20% glycerol, and 0.5 mM DTT). Thegastric mucosa collected at different time points after indometha-cin treatment was minced and homogenized in buffer I. Thesehomogenates were centrifuged, and the supernatants were keptseparately as cytosols. The pellets were resuspended in thesame volume of both buffers I and II, vortexed, kept on ice for30 min, and then centrifuged to obtain the nuclear extracts in thesupernatant.

Western immunoblotting

The cytosolic and nuclear proteins were separated in a 12%polyacrylamide-SDS gel at constant voltage (100 V). Proteins werethen transferred to a nitrocellulose membrane in a transferapparatus with a current intensity of 400 mA for 120 min in a190 mM glycine, 20 mM Tris base buffer (pH 8.3). The membranewas incubated for 3 h in the blocking buffer TBS (25 mM Tris,150 mM NaCl, 2 mM KCl, pH 7.4) to which 5% nonfat dry milk hadbeen added. The membrane was then quickly washed with thesame buffer without milk. The membrane was incubated over-night in the last buffer with 0.2% bovine serum albumin (BSA)solution containing 1:500 anti-NFκB, IKKβ, and IκB (Santa Cruz).The membrane was then washed well with TBS containing 0.1%Tween 20. The membrane was incubated for 2 h in the same buffercontaining secondary antibody (1:1000 HRP-labeled anti-rabbitIgG). The membrane was washed well with the incubation buffer.The protein detection was performed with a standard Western blotdetection system. Prestained standards were used as molecularweight markers and were run in parallel. The densitometricanalyses give the measure of the increase in the protein levelsafter normalization with the protein level of actin in each sample.

Confocal microscopy

Gastric mucosal cells were isolated from experimental rats asdescribed earlier [39]. Mucosa from control and indomethacin-treated stomachs collected from 4 h was scraped in Hanks′balanced salt solution (HBSS) (pH 7.4) containing 100 units/mlpenicillin and 100 μg/ml streptomycin at different time points.Mucosa was then minced and suspended in HBSS (pH 7.4)containing 0.05% hyaluronidase and 0.1% collagenase. For 30 min,the suspension was incubated at 37 1C in 5% CO2 under shakingconditions. The suspension was then filtered through a sterilenylon mesh. The filtrate was centrifuged at 600 g for 5 min, andthe cell pellet was washed with Hanks’ balanced salt solution (pH7.4) for subsequent studies. About 100 μl of cell suspension(approximately 105 cells) from different experimental groupswas spread on poly-L-lysine-coated slides kept at room tempera-ture. Cells were then washed with Tris-buffered saline (TBS), fixedin 4% paraformaldehyde, and permeabilized with 0.25% Triton X-100. Cells were then washed with TBS and blocked with 1% bovineserum albumin in TBS-Tween 20. Immunostaining was performedusing antibody against NFκB (Santa Cruz Biotechnology) devel-oped in rabbit (1:50) and goat anti-rabbit Alexa Fluor 647-conjugated secondary antibody (1:500; Invitrogen). For nuclearstaining cells were incubated with Hoechst dye for 5 min beforemounting with 90% glycerol. Cells were imaged at with a Nikon





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687


A1R confocal imaging system (60x objective, digital zooming upto 300x).

Neutrophil isolation

Neutrophils were isolated from rat blood as described [9].Neutrophils were isolated from rat blood using the Histopaquegradient technique with slight modifications. In a 15 ml tube, 5 mlof rat blood was slowly layered over 5 ml volume of Histopaque(1077 mg/ml). As a result, a two-step gradient was formed. Thetube was then centrifuged at 400g for 45 min in a swinging rotor.The upper phase was discarded. Further, 2 ml of 6% dextransolution (MW 250,000–500,000) was added. The volume wasincreased to 7 ml with phosphate-buffered solution and thenhomogenized. The tube was then incubated at 37 1C for 20 min.The supernatant was further centrifuged at 270 g for 10 min. Thepellet was then suspended in 0.83% (w/v) NH4Cl and kept for5 min to remove erythrocytes. It was again centrifuged at 480g for10 min. Finally, the cells were washed with HBSS by centrifugationat 270 g for 8 min and suspended in 1 ml HBSS and proceeded forfurther experiments.

888990919293949596979899

100101102103104105106107108109

Neutrophil migration assay

Neutrophil migration or chemotaxis toward gastric mucosaltissue homogenate was performed in a Transwell system (Corning,NY, USA) using 5-μm polycarbonate membrane [41]. Gastricmucosal homogenates were collected from rats sacrificed atdifferent time points treated with indomethacin and SEGA plusindomethacin. Mucosal tissues from rat stomach were collected,weighed, and homogenized in equal volume of PBS (Ca2+/Mg2+

free) and centrifuged to collect the cytosol. Equal volume of allsamples was then loaded in the bottom wells. Neutrophils presentin RPMI 1640 (5�104/50 μl) were added to the upper wells andincubated for 2 h at 37 1C under 5% CO2 atmosphere. The numberof migrated neutrophils was counted on Neubauer chambers. As apositive control, 1 nM leukotriene B4 was taken in the bottomwells whereas for negative control only PBS (Ca2+/Mg2+ free) wasused. The ratio of the migrated neutrophils in the presence ofsamples or leukotriene B4 and the number of neutrophils migratedonly in presence of PBS (Ca2+/Mg2+ free) is referred to aschemotactic index.

110111112113114115116117118119120121122123124125126127128129130131132

Chromatin immunoprecipitation (ChIP)

ChIP was performed as described [42] earlier with slight mod-ification. After indomethacin treatment, gastric mucosal tissue sam-ples (100 mg for each sample) at different time points wereincubated with 1% formaldehyde in PBS for 15 min at room tem-perature to allow protein-DNA cross-linking. Cross-linking waschecked by adding fresh glycine to a final concentration of 0.125 M.Samples were washed twice by centrifugation at 600g for 5 minwithice-cold PBS supplemented with a protease inhibitor cocktail (Cal-biochem, Set V). Samples were thenminced and homogenized in SDSlysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris, pH 8.1) (500 ml)and kept on ice for 15–20 min. This was followed by centrifugation at600g for 10 min at 4 1C to pellet down the nuclei. The pellets werefurther subjected to lysis using SDS lysis buffer and kept on ice for30 min and sonication at 40% maximum amplitude (10 s on, 60 s off)for 12 pulses to obtain fragments in the range of 200–1000 bp. Thesamples were then centrifuged for 10 min at 13,000 rpm at 4 1C. Analiquot of the lysates used in the immunoprecipitationwas processedalong with the rest of the sample as input DNA samples. Chromatinwas precleared using rabbit IgG (1 mg/sample) bound to protein A


Sepharose for 2 h at 4 1C. Precleared chromatin was immunopreci-pitated using rabbit anti-NF-κB antibody and rabbit IgG as control.The reactions were incubated on a rotor at 4 1C for overnight. Thiswas followed by a wash with PBS and incubation with herring spermDNA (5 mg/sample) for 2 h at 4 1C. DNA cross-linked proteins werethen immunoprecipitated by adding the precleared samples to theherring sperm DNA/protein A Sepharose and the mixture was keptovernight at 4 1C. Subsequently the sample was washed serially oncein (a) low salt immune complex wash buffer, (b) high salt immunecomplex wash buffer, (c) LiCl immune complex wash buffer, andfinally twice in a buffer containing 10 mM Tris-HCl, pH 8.0, and1 mM EDTA. To remove the precipitated complexes from the beads,the mixtures were incubated for 30 min in 250 ml of 1% SDS with100 mM NaHCO3. The cross-link between protein and DNA wasreversed by heating the samples at 65 1C overnight in 250 ml TEwith 2.5 ml proteinase K (20 mg/ml). DNA was purified using aQiaquick PCR purification kit according to the manufacturer′s proto-cols. DNA from ChIP and input samples were resuspended in 15 mland 30 ml EB buffer of the Quiaquick kit, respectively. For PCRamplification of ICAM-1 promoter region, 2 ml of the ChIP and0.5 ml of input DNA were used as template using the forward primer5′-CCATAAATATGGGGGTGTGG-3′ and the reverse primer 5′-CCGGT-GAACACACACTGAAG-3′ [43].

Heme oxygenase-1 assay

HO-1 activity was assayed in tissue homogenates obtained atdifferent time points as described earlier [35,44]. Gastric mucosascraped from rat was homogenized in a homogenization buffer[1 mM PBS (pH 7.4)] and centrifuged at 12,000g for 30 min. Mucosaltissue homogenates of control and experimental samples were usedfor the assay. The assay mixture consisted of a 1:1 mixture of gastricmucosal homogenate (200 mg of protein) and assay buffer (0.8 mMNADPH, 2 mM glucose-6-phosphate, 0.2 U of glucose 6-phosphatedehydrogenase, 1 mM MgCl2, 100 mM potassium phosphate buffer,20 mM hemin, and 2 mg of rat liver cytosol as a source of biliverdinreductase). The final volume was made up to 1 ml. The mixture wasincubated at 37 1C for 1 h in the dark. Reactions were terminated bykeeping the samples on ice for 5 min. The bilirubin formed wasextracted with chloroform and A464–530 was measured. Theamount of bilirubin formed was calculated from its extinctioncoefficient (40 mM/L/cm). The HO-1 activity was expressed asnanomoles of bilirubin formed per milligram of protein per60 min (nmol of bilirubin/mg protein/h) [54].

Statistical analysis

All data are presented as mean7SE. The level of significancewas determined by unpaired Student′s t test with one-wayanalysis of variance (ANOVA) and Tukey′s multiple comparisontest as applied. The GraphPad Prism 5 statistical software was usedfor data analysis. A P value ≤ 0.05 was considered as significant. Allthe experiments were performed three times and in triplicates.

Results

Indomethacin time dependently stimulates the expression ofproinflammatory molecules in parallel with the increase of neutrophilinfiltration and injury in gastric mucosa in rat

To follow the implication of MOS in inducing proinflammatorysignaling by NSAID, we administered indomethacin (an NSAID) inrat. The primary focus was to monitor the expression of proin-flammatory genes at three different time points: at the time of





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

67686970717273747576777879808182838485868788899091

Fig. 2. Myeloperoxidase (MPO) activity in gastric mucosa after indomethacintreatment. MPO activity in gastric mucosa was measured at 0, 1, and 4 h afterindomethacin treatment and represented in terms of unit per gram (U/g) of wettissue. The details of the methodology are described under Materials and methods.Data are presented as mean7SE. The values having different superscript letterswere significantly different (Po0.05; n¼6).


indomethacin administration (0 h), the onset of injury (1 h), andthe time of maximum injury (4 h). Mucosal injury after indo-methacin treatment at these three time points (0, 1, and 4 h) wasexamined. Intragastric administration of indomethacin induceshemorrhagic lesions in stomach that were first observed macro-scopically at 1 h after indomethacin administration. These hemor-rhagic lesions continued to develop over the next 2–4 h and wereattributed with injury index (II) (Fig. 1) The histological datacorresponding to each time point (Fig. 1A, inset a, b, c) furtherdemonstrated that indomethacin disrupted the fine structure ofgastric mucosal architecture at the time of maximum injury (4 h).At the time (1 h) of onset of mucosal injury initiation of cell sheddingfrom the superficial mucosa was also visible. However, the mucosaretained its natural architecture at the time of indomethacin admin-istration (0 h).

Gene expressions of proinflammatory cytokines and chemo-kines (IL-1β and MCP-1) and endothelial cell adhesion molecules(ICAM-1 and VCAM-1) were followed by RT-PCR after exposing therats to indomethacin. The data indicated a significant increase ofendothelial cell adhesion molecules (ICAM-1 and VCAM-1), cyto-kine (IL-1β), and chemokine (MCP-1). ICAM-1 was found to beincreased significantly (about 3.5-fold) over control (0 h) in both1 and 4 h (Fig. 1B and C). The expressions of IL-1β, both at 1 and4 h were 1.4- and 2-fold higher than the control, respectively. Thechemokine MCP-1 was increased 3.5-fold during the maximum

Fig. 1. Indomethacin induced gastric mucosal injury and proinflammatory response. (Aadministration (ip) was quantitated as injury index (II) as described under Materials and(0, 1, and 4 h) after indomethacin administration. The values with different superscript lICAM-1, VCAM-1, IL-1β, and MCP-1 to study the proinflammatory response at 0, 1, and 4RT-PCR data. The 0 h sample is considered as control. Data are presented as mean7SE (*significantly different (Po0.05).


injury (4 h) (Fig. 1B and C). The cell adhesion molecules, cytokines,and chemokines all coordinated in the process of neutrophilinfiltration at the site of injury. Neutrophils contain myeloperox-idase enzymes. MPO activity is considered as the marker forneutrophil infiltration and inflammation [45,46]. Therefore,MPO activity was measured in gastric mucosa at 0, 1, and 4 hafter indomethacin treatment by following chlorination activity.

9293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

) Gastric mucosal injury at different time points (0, 1, and 4 h) after indomethacinmethods. Inset, Histological sections of gastric mucosa of rat at different time pointsetters were significantly different (Po0.05). (B) RT-PCR to follow the expression ofh after indomethacin treatment in gastric mucosa. (C) Densitometric analyses of thePo0.001 versus control; n¼6). The values having different superscript letters were





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Fig. 3. Activation and nuclear localization of NF-κB in gastric mucosa after indomethacin treatment. NF-κB activation was monitored in the gastric mucosa of three separategroups of rats at different time points (0, 1, and 4 h) post indomethacin administration as described under Materials and methods. (A) Western immunoblot of IKKβ, IκB, andNF-κB (cytosol) in gastric mucosa of indomethacin-treated rats at different time points. (B) Assessment of the expression of IKKβ, IκB, and NF-κB by densitometric analyses ofthe Western immunoblot data. Data are presented as mean7SE (*Po0.001 versus control; 0 h¼control; n¼6). The values having different superscript letters weresignificantly different (Po0.05). (C) Western immunoblot for NF-κB localization in nucleus at three different time points (0, 1, and 4 h). Histone 3 A was used as a loadingcontrol for the nuclear sample. (D) Densitometric analyses of the Western immunoblot (*Po0.001 versus control; n¼6). Data are presented as mean7SE (*Po0.001 versuscontrol; 0 h¼control; n¼6). The values having different superscript letters were significantly different (Po0.05).


MPO chlorination activity was found to be increased after thetreatment of indomethacin with time (Fig. 2). During the max-imum injury there was 3.5-fold increases in the activity of MPO ingastric mucosa at 4 h with a 2.5-fold increase at 1 h afterindomethacin administration, suggesting a positive correlationbetween injury and infiltration of neutrophils after indomethacintreatment.

Activation and nuclear translocation of NF-κB by indomethacinin gastric mucosal cells

Now our focus is to investigate what regulated the proinflam-matory genes. NF-κB is a major proinflammatory transcriptionfactor controlling a wide number of genes including cytokines,chemokines, and cell adhesion [9]. We were interested to find outthe involvement of NF-κB during indomethacin-induced gastricmucosal injury. Activation of NF-κB is reliant on its upstreamproteins IKKβ and IκB. In an inactivated state NF-κB remainedcomplexed with IκB. Degradation of IκB is necessary for the releaseof NF-κB, which then translocates inside nucleus. We performedWestern immunoblotting to determine the levels of IKKβ, IκB, andNF-κB in gastric mucosa at 0, 1, and 4 h after indomethacintreatment (Fig. 3A and B). An increase of IκB degradation inparallel with the increase of NF-κB expression was evident(Fig. 3A). NF-κB expression was also found to be enhanced inparallel with the increase of mucosal injury (Fig. 3A and B). Tissuelysate and nuclear extracts were prepared for Western immuno-blotting. Data indicated that there was significant increase in NF-κB level in cell lysate at the time of initial injury (1 h) andmaximum injury (4 h) over control (0 h). Since NF-κB is a tran-scription factor, activated NF-κB is supposed to enter inside thenucleus in order to exert its effect. To check, Western immuno-blotting was performed using anti-NF-κB antibody in the nuclearsamples of gastric mucosa collected from 0, 1, and 4 h. The dataclearly showed an increased localization of NF-κB inside thenucleus at the time of maximum injury than at 0 and 1 h(Fig. 3C and D). However, NF-κB translocation was higher at 1 hthan the control (0 h) (Fig. 3C and D).


The nuclear translocation of NF-κB was further verified byconfocal microscopic studies using gastric mucosal cells isolatedfrom control rat and rat sacrificed at 4 h (when the injury ismaximum) after indomethacin treatment (Fig. 4). Red fluorescencerepresented cells immunostained with NF-κB primary antibodyand Alexa Fluor 647 secondary antibody (Fig. 4, first column). Bluefluorescence represented the nucleus (Fig. 4, second column). Thethird column represented the merge of the red and blue fluorescence.In the control, an almost negligible level of NF-κB in the nucleuswas evident from weak red fluorescence signal while red fluores-cence in the cytosol represented the cytosol-restricted NF-κBbefore activation (Fig. 4, upper panel), whereas in the mucosalcells from indomethacin-treated rat, a significantly high red signalthan control indicated NF-κB overexpression and its increasednucleus translocation after indomethacin treatment (Fig. 4, lowerpanel). The image analysis documented the colocalization (pink) ofNF-κB (red) with Hoechst (blue) (Fig. 4, third column).

Role of mitochondrial oxidative stress in indomethacin-inducedactivation and translocation of NF-κB and inflammation

MOS plays a pivotal role in the apoptotic tissue injury in gastricmucosa after indomethacin treatment [8,28,47]. Now, we wereinterested to confirm whether MOS played any role in the devel-opment of inflammatory response in the gastric mucosa byindomethacin. We have used a novel antioxidant molecule SEGA,which has already been reported to prevent indomethacin-induced MOS [48]. Western immunoblotting of NF-κB was per-formed in the presence of indomethacin and SEGA plus indo-methacin. Western immunoblot documented that SEGApretreatment reduced indomethacin induced NF-κB expression(Fig. 5A). All the cell adhesion molecules have NF-κB binding sitesin their promoter regions and NF-κB binding resulted in theinduction of these genes. Therefore, it was necessary to performa chromatin immunoprecipitation assay to confirm the nucleartranslocation and binding of the NF-κB to the promoter region ofdifferent inflammatory genes. ICAM-1 was used as a representa-tive of the above-noted genes and NF-κB binding was assessed at





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Fig. 4. Indomethacin induces nuclear translocation of NF-κB in gastric mucosal cells. Colocalization of NF-κB (red) with nucleus-specific Hoechst dye (blue). The upper panelrepresents gastric mucosal cells from control rats; the lower panel represents gastric mucosal cells from indomethacin-treated rats. The first column represents cellsimmunostained with NF-κB primary antibody and Alexa Fluor 647 secondary antibody giving red fluorescence specific for NF-κB, the second column represents cellsimmunostained with Hoechst dye giving blue fluorescence specific for nucleus, and the third column shows the merged (pink) image of the first and second columns. Thedetails of the experimental procedure are described under Materials and methods.

Fig. 5. Effect of SEGA on the expression of proinflammatory genes and infiltration of neutrophils in gastric mucosa after indomethacin treatment. (A) NF-κB expression ingastric mucosal tissue homogenate in indomethacin-treated and SEGA-pretreated indomethacin-treated rats. (B) The nuclear localization of NF-κB was confirmed by ChIPanalysis through its binding to ICAM-1 gene promoter. Lanes 1–5: Loaded with gastric mucosal samples of rat sacrificed at 0, 1, 4, 24, and 48 h after indomethacin treatment.Lane 6: samples collected from rats treated with SEGA plus indomethacin (4 h). Upper panel: Input denotes amplification of the DNA in soluble chromatin beforeimmunoprecipitation. Second panel: Chromatin immunoprecipitated with normal rabbit IgG. Bottom panel: ChIP assay PCR products from immunoprecipitates obtainedusing antibodies against NF-κB with nuclear extracts of gastric mucosal tissue. (C) RT-PCR analysis of ICAM-1, VCAM-1, IL-1β, MCP-1, and actin expression in gastric mucosa ofthree separate sets of rats: contol, indomethacin treated, and SEGA plus indomethacin treated. The rats were sacrificed 4 h after indomethacin treatment. (D) Densitometricanalyses of the RT-PCR data. (E) Chemotaxic index of neutrophils indicating neutrophil migration in gastric mucosa at different time points (0, 1, 4, 24, and 48 h) and ingastric mucosa at 4 h after SEGA plus indomethacin treatment. (F) Assay of MPO activity in gastric mucosa at different time points (0, 1, 4, 24, and 48 h) post indomethacintreatment as well as SEGA-pretreated indomethacin-treated rats (4 h). The details of the methodology are described under Materials and methods. Data are presented asmean7SE (**Po0.001 versus control;##,Po0.001 versus indomethacin at 4 h; n¼6).


different time points after indomethacin as well as with samplestreated with SEGA prior to indomethacin treatment. The gastricmucosa has an inherent “cytoprotective” mechanism by which itheals and rejuvenates itself with time from MOS-mediateddamage [28]. Therefore a time kinetic study is necessary. We


isolated chromatin from 0, 1, 4, 24, and 48 h and from indometha-cin plus SEGA treated rats sacrificed at 4 h were immunoprecipi-tated with anti-NF-κB p65 antibody or rabbit IgG (as negativecontrol). PCR analysis showed that NF-κB p65 antibody precipi-tated the ICAM-1 promoter region from 1, 4, and 24 h significantly





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990


with maximum at 4 h (Fig. 5B, bottom, lanes 1–5, bottom panel).However, no significant DNA binding was observed at 0 and 48 h(Fig. 5B). When treated with SEGA the DNA binding of NF-κB wasalso not significant. This indicated that SEGA by inhibiting MOSreduced the nuclear translocation of NF-κB, which resulted in thereduction of inflammatory response in gastric mucosa (Fig. 5B,lane 6, bottom panel). Chromatin samples immunoprecipitated byrabbit IgG did not exhibit any DNA binding as clear from PCR data(Fig. 5B, bottom, second panel). Input samples confirmed equalloading of sample (Fig. 5B, bottom top panel). Therefore, the datashowed a steady binding of NF-κB to the promoter region of ICAM-1 at 1, 4, and 24 h but at 48 h NF-κB binding was not significant.Since NF-κB nuclear translocation is associated with inflammation,the significant reduction of NF-κB binding indicated the reductionof inflammation at 48 h. (Fig. 5B, bottom top panel). But SEGApretreatment reduced NF-κB binding to the promoter of celladhesion molecules. Now, binding of NF-κB to the promoterregions leads to the transcription of the proinflammatory genes.Therefore, we followed the mRNA expression of proinflammatorygenes in the presence of indomethacin and indomethacin plusSEGA. The gene expression pattern clearly indicated that SEGApretreatment sharply decreased indomethacin-induced expressionof inflammatory cytokines (MCP-1 and IL-1β) and cell adhesionmolecules (ICAM-1 and VCAM-1) (Fig. 5C and D). The expressions

Fig. 6. The relation of the expression of proinflammatory genes and neutrophil infiltrtreatment. (A) HO-1 activity was measured by following the formation of bilirubin at dMaterials and methods. II represents injury index. Inset a, The mRNA expressions of ICAM48 h) after indomethacin treatment corresponding to HO-1 activity at similar time poin(B) Fold increase of MPO activity in gastric mucosal samples at different time points (4,methodology are described under Materials and methods. (C) Western immunoblot opretreated indomethacin-treated rats. (D) Densitometric analyses of the Western immuncontrol, n¼6).


of cytokines and chemokines are associated with the infiltration ofneutrophils to the injured site [49]. Therefore, we performedneutrophil chemotaxis assay to document neutrophil attractiontoward gastric mucosa in the presence or absence of SEGA. Thechemotaxis of neutrophil was represented as chemotactic index(Fig. 5E). We also measured MPO activity (marker for neutrophil)in tissues collected at different time points after indomethacintreatment (Fig. 5F). The chemotactic index and MPO activity werehighest at the time of maximum injury (4 h) (Fig. 5E and F). Theinfiltration of neutrophil, as evident from the data (Fig. 5E and F),significantly persisted up to 24 h after and it was decreased at48 h. SEGA prevented neutrophil infiltration in gastric mucosa asevident from both reduced chemotactic index and MPO activity(Fig. 5E and F).

HO-1 protected NSAID-induced gastric mucosal damageby preventing NF-κB activation and proinflammatory activity

HO-1 is a stress response protein induced in response tooxidative insults [29]. Sustained expression of HO-1 in gastricmucosa has been shown to control MOS and ultimately recoversthe gastric mucosa from injury induced by indomethacin [28].Since inflammation is associated with the MOS, we were inter-ested in investigating the anti-inflammatory role of HO-1 against

919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

ation with the status of HO-1 activity at different time points after indomethacinifferent times (0, 4, 24, and 48 h) after indomethacin treatment as described under-1, VCAM-1, IL-1β, and MCP-1 were followed at different time points (0, 4, 24, and

ts, Inset b, Densitometric analyses of the RT-PCR data represented as fold increase.24, and 48 h) after indomethacin treatment with respect to 0 h. The details of thef HO-1 in gastric mucosal samples of control, indomethacin-treated, and SEGA-oblot. Data are presented as mean7SE (**Po0.001 versus control; *Po0.05 versus





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104


indomethacin in gastric mucosa. Since gastric mucosal autohealingis a time-consuming process, HO-1 activity and inflammationstatus were analyzed up to 48 h. HO-1 activity was representedas fold alteration of HO-1 activity relative to control at 4, 24, and48 h, respectively. The fold alteration of HO-1 activity was max-imum at 24 h and maintained an elevated status up to 48 h(Fig. 6A). Here, the inflammatory status was checked and com-pared with the HO-1 activity. The data clearly indicated thatalthough up to 24 h there was an up-regulation of theinflammation-related genes but at 48 h there was a clear sign ofreduction of their expression (Fig. inset, 6a and b). MPO activity asa result of neutrophil infiltration was also in the elevated status upto 24 h but the activity was declined at 48 h (Fig. 6B). Thus, thepersistence of higher level of HO-1 expression up to 48 h pre-vented the expression of proinflammatory molecules in gastricmucosa (Fig. 6A and B).

Now the question is if HO-1 prevents gastric mucosal inflamma-tory response and consequent injury by combating MOS, thenadministration of SEGA prior to indomethacin treatment shouldeliminate the possibility of persistent HO-1 expression. Therefore,Western immunoblotting was performed with gastric mucosalhomogenates of control, indomethacin-treated and SEGA-pretreated,and indomethacin-treated rats at 4 h (Fig. 6C). The data indicatedthat HO-1 was induced after 4 h of indomethacin treatment butSEGA pretreatment significantly prevented the induction of HO-1 byindomethacin (Fig. 6C and D). These data suggested that SEGA byameliorating oxidative stress minimized the necessary expression ofHO-1. The state of inflammation at 4 h was tested further by creatingsituations where HO-1 activity was chemically knocked down and aswell as chemically induced using an inhibitor of HO-1 and an inducer,respectively. ZnPP and CoPP are known inhibitor and inducer of HO-1, respectively. Rats were treated with ZnPP or CoPP before indo-methacin administration followed by the isolation of stomachs at 4 h.In order to investigate whether the absence or presence of HO-1 hasany effect on inflammation, ZnPP plus indomethacin and CoPP plusindomethacin-treated gastric mucosa of rats were further processed.Gene expressions of proinflammatory cytokines, chemokines,cell adhesion molecules, NF-κB in cytosol, and MPO activity were

Fig. 7. Anti-inflammatory activity of HO-1 against indomethacin-induced proinflammaVCAM-1, IL-1β, and MCP-1 in four different groups: control, indomethacin, indomethaciafter indomethacin treatment. Details of the experimental procedures are described(C) Western immunoblot of NF-κB in cytosol of gastric mucosa in four separate groups oand only indomethacin treated. (D) Assay of MPO activity in gastric mucosal samples odescribed under Materials and methods. II represents injury index. Data are presented


compared with the control group. The data indicated that inhibitionof HO-1 by ZnPP up-regulated the inflammatory genes, NF-κBactivation and expression, and neutrophil infiltration (as monitoredby MPO activity) compared to control (only vehicle) and onlyindomethacin-treated rats (Fig. 7A–D). But in CoPP-pretreated indo-methacin-treated group, the decrease in the proinflammatory genes,NF-κB expression, and MPO activity was evident (Fig. 7A–D), indicat-ing an anti-inflammatory role of HO-1 in controlling indomethacin-induced mucosal inflammatory damage.

Discussion

We have presented data to show that MOS played a critical rolein NSAID-induced NF-κB activation and inflammation in gastricmucosa. HO-1 protected NSAID-induced MOS-mediated gastricmucosal damage by preventing NF-κB activation and proinflam-matory activity.

The inhibitory effect of NSAIDs on COX is due to its anti-inflammatory action because COX is imperative for the synthesis ofprostaglandins (PGs) such as PGE2, which is supposed to induceinflammation. Accumulating data have demonstrated that COX-1knockout mice do not have mucosal injury; however, they readilyundergo gastrointestinal ulceration and bleeding when challengedwith aspirin and other nonselective NSAIDs [7,50]. Prostaglandins areextremely potent inhibitors of mast cell degranulation [51] and mastcells are capable of releasing a variety of mediators (e.g., leukotrieneC4and platelet-activating factor) that can contribute to mucosalinjury [52,53]. The effects of NSAIDs on mast cells do not seem tobe crucial to the pathogenesis of mucosal injury [54]. This latterconclusion is based on the observation that rats in which mucosalmast cells have been depleted by chemical means, or mice that aregenetically deficient of mast cells, exhibit similar susceptibility toNSAID-induced gastric injury as do their respective controls [54].Therefore a prostaglandin-independent mechanism is accepted as amajor cause in NSAID-induced gastropathy [3,8,28,39,47,48]. How-ever, gastric mucosal injury by NSAID is associated with inflamma-tory response [20,55,56]. This gives rise to an interesting situation

105106107108109110111112113114115116117118119120121122123124125126127128129130131132

tory response in gastric mucosa. (A) RT-PCR to monitor the expression of ICAM-1,n plus ZnPP, and indomethacin plus CoPP. All the groups of rats were sacrificed 4 hunder Materials and methods. (B) Densitometric analyses of the RT-PCR data.

f rats: untreated, ZnPP plus indomethacin treated, CoPP plus indomethacin treated,f the same groups of rats as described above. The details of the methodology areas mean7SE (**Po0.001 versus control; *Po0.05 versus control; n¼6).





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132


where despite the inhibition of the inflammation-inducing moleculeprostaglandin anti-inflammatory drugs like indomethacin (NSAID)inflict inflammation.

We know that the NF-κB family of transcription factors play amajor role in the regulation of the expression of a number of genesimplicated in inflammation [57]. We monitored the activation ofNF-κB and consequent inflammatory responses in the gastricmucosa after indomethacin treatment as well as after antioxidantSEGA treatment. A significant increase in NF-κB activation andinflammatory gene expression was found after indomethacintreatment which was well correlated with gastric mucosal injurywith time. When mucosal injury was under control at 48 h NF-κBactivation and gene expression (ICAM-1, VACM-1, IL-1β, and MCP-1) were also turned down. The NF-κB/Rel family is composed offive members, c-Rel, p65, Rel B, p50, and p52. In most nonactivatedcells, NF-κB remains in a cytoplasmic inactive complex through itsassociation with the inhibitory proteins IκBs. Inducers of NF-κBactivate a dimeric IκB kinase (IKK) complex, which phosphorylatesIκBα on Ser-32 and Ser-36, leading to subsequent ubiquitinationand degradation of IκBα and release of NF-κB proteins. Free NF-κBdimers translocate to the nucleus where they regulate target genetranscription [58]. NF-κB has been shown to have an antiapoptoticeffect as well as a proapoptotic effect under different conditions[59]. The activation of NF-κB was followed by neutrophil in theindomethacin-treated gastric mucosa. NF-κB signaling has a cor-relation with neutrophil infiltration and inflammation in a numberof diseases [9,60].

Activation of NF-κB stimulated the expression of proinflamma-tory cytokines and chemokines such as IL-1β and MCP-1 in thegastric mucosa. These together with other inflammatory mediatorscan up-regulate the expression of β2 integrins such as CD11b/CD18and many receptors on the surface of the neutrophils [61]. Further,they are also associated with the machinery responsible for reactiveoxidant generation in the neutrophils [61]. The ICAM-1 and VCAM-1 are inducible endothelial cell surface molecules involved inleukocyte adhesion whereas IL-1β is a known cytokine and MCP-1is a C-C chemokine. Indomethacin-induced damage is associatedwith reduced cell renewal and epithelialization [39]. IL-1β has beenattributed to the inhibition of migration and proliferation ofepithelial cells, resulting in a failure of wound healing [62]. One ofthe initial events of inflammation is leukocyte infiltration andactivation. During inflammation, aggregation of platelet and infil-tration of neutrophils into the wound site are the hallmark events[63,64]. Excessive inflammation can impede healing at the site ofwound. Myeloperoxidase is released from neutrophil at the site ofinjury after neutrophil infiltration to that site [45]. Measurement ofMPO activity provides a quantitative assessment of neutrophilinfiltration [45]. Therefore, both neutrophil migration (representedas chemotactic index) and MPO activity in the gastric mucosa wereassessed. Neutrophil chemotaxis and MPO activity documented aconsiderable increase in neutrophil infiltration with time (0, 1, 4,and 24 h), which was found to be significantly reduced at 48 h.

Now, the question is what instigated these inflammatoryresponses? We know that among different inducers, NF-κB isregulated by reactive oxidants in a number of ways [65,66]. Themechanism of reactive oxidant-induced NF-κB is still very elusive[65,67]. NSAID is known to induce damage in gastric mucosa bymeans of oxidative stress [3,8]. The reactive oxidants produced areresponsible for mediating inflammatory cytokine release [68,69].Infiltrated neutrophils in the gastric mucosa also produce super-oxide radical anion (O2

�) which can further damage a number ofcellular components [68]. At the site of inflammation neutrophilreleases MPO which utilizes hydrogen peroxide to catalyze theproduction of highly damaging (HOCl) hypochlorous acids as wellas a plethora of other free radicals [70]. Thus, it is clear thatinflammation and oxidative stress go hand in hand. Now, to


confirm whether MOS is the major perpetrator behind the inflam-mation in gastric mucosa after indomethacin treatment weused an antioxidant SEGA. SEGA also effectively amelioratedindomethacin-induced inflammation in gastric mucosa. It is wellknown that the healing of gastric mucosa after NSAID treatmentoccurs automatically without any antioxidant therapy, however, abit slowly [28]. Thus, under stressed conditions the cell employsan inherent cytoprotective mechanism to restore its normal status.HO-1, a multifaceted enzyme, is one such cytoprotective factorwhich has been found to be up-regulated under different types ofstress [29]. Moreover HO-1 has been attributed to rescuing thegastric mucosa from indomethacin-induced injury by amelioratingMOS [28]. It has been shown that HO-1 enters inside mitochondriaand counters MOS [28]. HO-1 expression persists for a long timeeven after the mucosal injury has been under control [28]. Sincethe mucosal damage is associated with both inflammation andoxidative stress HO-1 may show its anti-inflammatory action byreducing MOS. Thus, we were interested to see whether HO-1 bycontrolling MOS reduces gastric mucosal inflammation. In order toinvestigate this anti-inflammatory effect of HO-1 in gastric mucosaa time kinetic study was necessary. We found that HO-1 main-tained its up-regulated status after indomethacin treatment up to48 h while both injury and inflammation were abated. HO-1 playsa major role as a cytoprotective anti-inflammatory molecule inmany diseases [26,71]. Induction of HO-1 resolves the woundhealing by amelioration of inflammation, proliferation, and pro-tection against apoptosis [71,72]. During indomethacin-inducedMOS-mediated mucosal injury the possibility of heme overload ingastric mucosa has been discussed previously [28]. Moreover,heme is a known chemoattractant of neutrophil and a prooxidant[9,41]. Wagener et al. reported that heme is a potent inducer ofinflammation and HO-1 antagonized heme-mediated inflamma-tion [73,74]. Thus a vicious cycle is formed among MOS, heme, andactivated neutrophil-mediated reactive oxidants, ultimately lead-ing to a redox environment. In our previous work, it has beenshown that HO-1 enters inside mitochondria, reduces heme over-load in mitochondria, and combats MOS in a time-dependentfashion. Consequently it prevented gastric mucosal injury inducedby NSAIDs. The sole substrate of HO-1 is the heme. HO-1catabolizes free heme finally into biliverdin, CO, and free iron[75]. Bilirubin is produced from biliverdin, both of which togetherhave antioxidant potential [74–79]. CO, which is produced inequimolar concentrations to biliverdin and ferrous iron duringheme oxidation by HO-1, possesses anti-inflammatory propertiessuch as the capacity to inhibit platelet aggregation, or the expres-sion of proinflammatory cytokines [80]. The HO-1/CO/biliverdinpathway has been found to inhibit the rolling, adhesion, andmigration of neutrophils during inflammation [81]. HO-1 has beensupposed to inhibit the adverse effects of NSAIDs in gastric mucosaof mice possibly by its anti-inflammatory function [26]. However,the mechanism of induction of anti-inflammatory activity is stillelusive. Now, when MOS is taken care of by an antioxidant SEGAthe expression of HO-1 is subsided.

Then we were interested to see whether inhibition or inductionof HO-1 activity has any role in gastric mucosal inflammation afterindomethacin treatment at the time of maximum injury. ZnPP andCoPP were used to inhibit and induce HO-1, respectively. MoreoverHO-1 can translocate inside mitochondria and scavenge intrami-tochondrial heme which also facilitate in reducing MOS [28]. At4 h the injury is maximum for which the indomethacin plus ZnPPor CoPP-treated rats were sacrificed only after 4 h. In the presenceof ZnPP the injury inflicted by indomethacin surpasses thatinflicted by indomethacin alone. While in the presence of CoPPthe injury diminishes. Although HO-1 expression is increasedduring maximum injury, the expression is not at its highest. It isclear that the natural HO-1 expression employed by the cells for





123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687


4 h is not sufficient enough to overcome the injury. However,when it is overinduced by CoPP, the inflammation is taken care ofwithin 4 h which is positively correlated with the injury index. Incomparison, the spontaneous healing in the absence of anyinducer required a much longer duration. HO-1, once up-regulated at 4 h, maintained this elevated status even up to 48 hwith a peak at 24 h, by which time the inflammatory responsedeclined. Thus the cell shows an inherent cytoprotective mechan-ism (autohealing) by employing HO-1 in the battle againstmucosal injury. HO-1, slow but steady, wins the battle.

Thus, indomethacin induces MOS, which activates NF-κB trans-location to nucleus and thereby stimulates the expression ofproinflammatory genes. These proinflammatory signaling mole-cules stimulate infiltration of neutrophils in the gastric mucosa,which further aggravates gastric mucosal injury. HO-1 has beenfound to offer cytoprotection against MOS-mediated inflammationrestoring tissue integrity. When HO-1 activity was inhibited therewas a clear indication of enhanced inflammation and injury byindomethacin while both inflammation and injury were subsidedwhen HO-1 activity was enhanced by CoPP before indomethacintreatment.

888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Acknowledgments

We gratefully acknowledge the Council of Scientific and IndustrialResearch (CSIR), New Delhi, for providing grants through a suprain-stitutional project (BEnD, BSC0206) to carry out this work. We thankDr. Anupam Banerjee for his help in confocal microscopy.

References

[1] Morise, Z.; Granger, D. N.; Fuseler, J. W.; Anderson, D. C.; Grisham, M. B.Indomethacin induced gastropathy in CD18, intercellular adhesion molecule 1,or P-selectin deficient mice. Gut 45:523–528; 1999.

[2] Wallace, J. L. How do NSAIDs cause ulcer disease? Baillieres Best Pract. Res. Clin.Gastroenterol 14:147–159; 2000.

[3] Pal, C.; Bindu, S.; Dey, S.; Alam, A.; Goyal, M.; Iqbal, M. S.; Maity, P.; Adhikari, S.S.; Bandyopadhyay, U. Gallic acid prevents nonsteroidal anti-inflammatorydrug-induced gastropathy in rat by blocking oxidative stress and apoptosis.Free Radic. Biol. Med. 49:258–267; 2010.

[4] Whittle, B. J. Temporal relationship between cyclooxygenase inhibition, asmeasured by prostacyclin biosynthesis, and the gastrointestinal damageinduced by indomethacin in the rat. Gastroenterology 80:94–98; 1981.

[5] Rainsford, K. D.; Willis, C. Relationship of gastric mucosal damage induced inpigs by antiinflammatory drugs to their effects on prostaglandin production.Dig. Dis. Sci 27:624–635; 1982.

[6] Ligumsky, M.; Sestieri, M.; Karmeli, F.; Zimmerman, J.; Okon, E.; Rachmilewitz,D. Rectal administration of nonsteroidal antiinflammatory drugs. Effect on ratgastric ulcerogenicity and prostaglandin E2 synthesis. Gastroenterology98:1245–1249; 1990.

[7] Langenbach, R.; Morham, S. G.; Tiano, H. F.; Loftin, C. D.; Ghanayem, B. I.;Chulada, P. C.; Mahler, J. F.; Lee, C. A.; Goulding, E. H.; Kluckman, K. D.; Kim, H.S.; Smithies, O. Prostaglandin synthase 1 gene disruption in mice reducesarachidonic acid-induced inflammation and indomethacin-induced gastriculceration. Cell 83:483–492; 1995.

[8] Maity, P.; Bindu, S.; Dey, S.; Goyal, M.; Alam, A.; Pal, C.; Mitra, K.; Bandyo-padhyay, U. Indomethacin, a non-steroidal anti-inflammatory drug, developsgastropathy by inducing reactive oxygen species-mediated mitochondrialpathology and associated apoptosis in gastric mucosa: a novel role ofmitochondrial aconitase oxidation. J. Biol. Chem. 284:3058–3068; 2009.

[9] Dey, S.; Bindu, S.; Goyal, M.; Pal, C.; Alam, A.; Iqbal, M. S.; Kumar, R.; Sarkar, S.;Bandyopadhyay, U. Impact of intravascular hemolysis in malaria on liverdysfunction: involvement of hepatic free heme over-load, NFkappaB activationand neutrophil infiltration. J. Biol. Chem. 287:26630–26646; 2012.

[10] Mahmud, T.; Rafi, S. S.; Scott, D. L.; Wrigglesworth, J. M.; Bjarnason, I.Nonsteroidal antiinflammatory drugs and uncoupling of mitochondrial oxida-tive phosphorylation. Arthritis Rheum. 39:1998–2003; 1996.

[11] Carrasco-Pozo, C.; Gotteland, M.; Speisky, H. Apple peel polyphenol extractprotects against indomethacin-induced damage in Caco-2 cells by preventingmitochondrial complex I inhibition. J. Agric. Food Chem 59:11501–11508; 2011.

[12] Suzuki, Y.; Inoue, T.; Ra, C. NSAIDs, Mitochondria and calcium signaling:special focus on aspirin/salicylates. Pharmaceuticals 3:1594–1613; 2010.

[13] Carrasco-Pozo, C.; Gotteland, M.; Speisky, H. Protection by apple peel poly-phenols against indometacin-induced oxidative stress, mitochondrial damageand cytotoxicity in Caco-2 cells. J. Pharm. Pharmacol 62:943–950; 2010.


[14] Carrasco-Pozo, C.; Pastene, E.; Vergara, C.; Zapata, M.; Sandoval, C.; Gotteland,M. Stimulation of cytosolic and mitochondrial calcium mobilization byindomethacin in Caco-2 cells: modulation by the polyphenols quercetin,resveratrol and rutin. Biochim. Biophys. Acta 1820:2052–2061; 2012.

[15] Somasundaram, S.; Simpson, R.; Rafi, S.; Shergill, J. K.; Bjarnason, I.; Wriggles-worth, J. 2, 4-Diamino-6-hydroxy pyrimidine inhibits NSAIDs inducednitrosyl-complex EPR signals and ulcer in rat jejunum. BMC Gastroenterol2:8; 2002.

[16] Bulua, A. C.; Simon, A.; Maddipati, R.; Pelletier, M.; Park, H.; Kim, K. Y.; Sack, M.N.; Kastner, D. L.; Siegel, R. M. Mitochondrial reactive oxygen species promoteproduction of proinflammatory cytokines and are elevated in TNFR1-associated periodic syndrome (TRAPS). J. Exp. Med. 208:519–533; 2011.

[17] Naik, E.; Dixit, V. M. Mitochondrial reactive oxygen species drive proinflam-matory cytokine production. J. Exp. Med. 208:417–420; 2011.

[18] Gadient, R. A.; Patterson, P. H. Leukemia inhibitory factor, interleukin 6, andother cytokines using the GP130 transducing receptor: roles in inflammationand injury. Stem Cells 17:127–137; 1999.

[19] Welty, S. E.; Rivera, J. L.; Elliston, J. F.; Smith, C. V.; Zeb, T.; Ballantyne, C. M.;Montgomery, C. A.; Hansen, T. N. Increases in lung tissue expression ofintercellular adhesion molecule-1 are associated with hyperoxic lung injuryand inflammation in mice. Am. J. Respir. Cell. Mol. Biol. 9:393–400; 1993.

[20] Watanabe, T.; Higuchi, K.; Hamaguchi, M.; Shiba, M.; Tominaga, K.; Fujiwara,Y.; Matsumoto, T.; Arakawa, T. Monocyte chemotactic protein-1 regulatesleukocyte recruitment during gastric ulcer recurrence induced by tumornecrosis factor-alpha. Am. J. Physiol. Gastrointest. Liver Physiol. 287:G919–G928;2004.

[21] Yadav, S. K.; Adhikary, B.; Chand, S.; Maity, B.; Bandyopadhyay, S. K.;Chattopadhyay, S. Molecular mechanism of indomethacin-induced gastropa-thy. Free Radic. Biol. Med. 52:1175–1187; 2012.

[22] Luster, A. D. Chemokines—chemotactic cytokines that mediate inflammation.N. Engl. J. Med. 338:436–445; 1998.

[23] Nishida, K; Ohta, Y; Kobayashi, T; Ishiguro, I. Involvement of the xanthine-xanthine oxidase system and neutrophils in the development of acute gastricmucosal lesions in rats with water immersion restraint stress. Digestion58:340–351; 1997.

[24] La Casa, C; Villegas, I; Alarcon de la Lastra, C; Motilva, V; Martin Calero, MJ.Evidence for protective and antioxidant properties of rutin, a natural flavone,against ethanol induced gastric lesions. J. Ethnopharmacol 71:45–53; 2000.

[25] Winterbourn, C. C. Biological reactivity and biomarkers of the neutrophiloxidant, hypochlorous acid. Toxicology 181-182:223–227; 2002.

[26] Uc, A.; Zhu, X.; Wagner, B. A.; Buettner, G. R.; Berg, D. J. Heme oxygenase-1 isprotective against nonsteroidal anti-inflammatory drug-induced gastriculcers. J. Pediatr. Gastroenterol. Nutr. 54:471–476; 2012.

[27] Demir, S.; Yilmaz, M.; Koseoglu, M.; Akalin, N.; Aslan, D.; Aydin, A. Role of freeradicals in peptic ulcer and gastritis. Turk. J. Gastroenterol. 14:39–43; 2003.

[28] Bindu, S.; Pal, C.; Dey, S.; Goyal, M.; Alam, A.; Iqbal, M. S.; Dutta, S.; Sarkar, S.;Kumar, R.; Maity, P.; Bandyopadhyay, U. Translocation of heme oxygenase-1 tomitochondria is a novel cytoprotective mechanism against non-steroidal anti-inflammatory drug-induced mitochondrial oxidative stress, apoptosis, andgastric mucosal injury. J. Biol. Chem. 286:39387–39402; 2011.

[29] Gozzelino, R.; Jeney, V.; Soares, M. P. Mechanisms of cell protection by hemeoxygenase-1. Annu. Rev. Pharmacol. Toxicol. 50:323–354; 2010.

[30] Kim, Y. S.; Pi, S. H.; Lee, Y. M.; Lee, S. I.; Kim, E. C. The anti-inflammatory role ofheme oxygenase-1 in lipopolysaccharide and cytokine-stimulated induciblenitric oxide synthase and nitric oxide production in human periodontalligament cells. J. Periodontol 80:2045–2055; 2009.

[31] Rizzardini, M.; Terao, M.; Falciani, F.; Cantoni, L. Cytokine induction of haemoxygenase mRNA in mouse liver. Interleukin 1 transcriptionally activates thehaem oxygenase gene. Biochem. J 290(Pt 2):343–347; 1993.

[32] Ning, W.; Song, R.; Li, C.; Park, E.; Mohsenin, A.; Choi, A. M.; Choi, M. E. TGF-beta1 stimulates HO-1 via the p38 mitogen-activated protein kinase in A549pulmonary epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol 283:L1094–-L1102; 2002.

[33] Keyse, S. M.; Tyrrell, R. M. Heme oxygenase is the major 32-kDa stress proteininduced in human skin fibroblasts by UVA radiation, hydrogen peroxide, andsodium arsenite. Proc. Natl. Acad. Sci. USA 86:99–103; 1989.

[34] Barton, S. G.; Rampton, D. S.; Winrow, V. R.; Domizio, P.; Feakins, R. M.Expression of heat shock protein 32 (hemoxygenase-1) in the normal andinflamed human stomach and colon: an immunohistochemical study. Cell.Stress Chaperones 8:329–334; 2003.

[35] Guo, J. S.; Cho, C. H.; Wang, W. P.; Shen, X. Z.; Cheng, C. L.; Koo, M. W.Expression and activities of three inducible enzymes in the healing of gastriculcers in rats. World J. Gastroenterol. 9:1767–1771; 2003.

[36] Bandyopadhyay, U.; Biswas, K.; Chatterjee, R.; Bandyopadhyay, D.; Chatto-padhyay, I.; Ganguly, C. K.; Chakraborty, T.; Bhattacharya, K.; Banerjee, R. K.Gastroprotective effect of Neem (Azadirachta indica) bark extract: possibleinvolvement of H(+)-K(+)-ATPase inhibition and scavenging of hydroxylradical. Life Sci. 71:2845–2865; 2002.

[37] Biswas, K.; Bandyopadhyay, U.; Chattopadhyay, I.; Varadaraj, A.; Ali, E.;Banerjee, R. K. A novel antioxidant and antiapoptotic role of omeprazole toblock gastric ulcer through scavenging of hydroxyl radical. J. Biol. Chem.278:10993–11001; 2003.

[38] Ueda, K.; Ueyama, T.; Yoshida, K.; Kimura, H.; Ito, T.; Shimizu, Y.; Oka, M.;Tsuruo, Y.; Ichinose, M. Adaptive HNE-Nrf2-HO-1 pathway against oxidativestress is associated with acute gastric mucosal lesions. Am. J. Physiol. Gastro-intest. Liver Physiol. 295:G460–G469; 2008.


http://refhub.elsevier.com/S0891-5849(13)00371-7/sbref1





































































































































123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657

585960616263646566676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113


[39] Maity, P.; Bindu, S.; Choubey, V.; Alam, A.; Mitra, K.; Goyal, M.; Dey, S.; Guha,M.; Pal, C.; Bandyopadhyay, U. Lansoprazole protects and heals gastric mucosafrom non-steroidal anti-inflammatory drug (NSAID)-induced gastropathy byinhibiting mitochondrial as well as Fas-mediated death pathways withconcurrent induction of mucosal cell renewal. J. Biol. Chem. 283:14391–14401;2008.

[40] Weiss, S. J.; Klein, R.; Slivka, A.; Wei, M. Chlorination of taurine by humanneutrophils. Evidence for hypochlorous acid generation. J. Clin. Invest.70:598–607; 1982.

[41] Porto, B. N.; Alves, L. S.; Fernandez, P. L.; Dutra, T. P.; Figueiredo, R. T.; Graca-Souza, A. V.; Bozza, M. T. Heme induces neutrophil migration and reactiveoxygen species generation through signaling pathways characteristic ofchemotactic receptors. J. Biol. Chem. 282:24430–24436; 2007.

[42] Freitas-Junior, L. H.; Hernandez-Rivas, R.; Ralph, S. A.; Montiel-Condado, D.;Ruvalcaba-Salazar, O. K.; Rojas-Meza, A. P.; Mancio-Silva, L.; Leal-Silvestre, R.J.; Gontijo, A. M.; Shorte, S.; Scherf, A. Telomeric heterochromatin propagationand histone acetylation control mutually exclusive expression of antigenicvariation genes in malaria parasites. Cell 121:25–36; 2005.

[43] Wiggins, J. E.; Patel, S. R.; Shedden, K. A.; Goyal, M.; Wharram, B. L.; Martini, S.;Kretzler, M.; Wiggins, R. C. NFkappaB promotes inflammation, coagulation,and fibrosis in the aging glomerulus. J. Am. Soc. Nephrol. 21:587–597; 2010.

[44] Slebos, D. J.; Ryter, S. W.; van der Toorn, M.; Liu, F.; Guo, F.; Baty, C. J.; Karlsson,J. M.; Watkins, S. C.; Kim, H. P.; Wang, X.; Lee, J. S.; Postma, D. S.; Kauffman, H.F.; Choi, A. M. Mitochondrial localization and function of heme oxygenase-1 incigarette smoke-induced cell death. Am. J. Respir. Cell. Mol. Biol. 36:409–417;2007.

[45] Mullane, K. M.; Kraemer, R.; Smith, B. Myeloperoxidase activity as a quanti-tative assessment of neutrophil infiltration into ischemic myocardium. J.Pharmacol. Methods 14:157–167; 1985.

[46] Loria, V.; Dato, I.; Graziani, F.; Biasucci, L. M. Myeloperoxidase: a newbiomarker of inflammation in ischemic heart disease and acute coronarysyndromes. Mediators Inflamm. 2008:135625; 2008.

[47] Maity, P.; Bindu, S.; Dey, S.; Goyal, M.; Alam, A.; Pal, C.; Reiter, R.; Bandyo-padhyay, U. Melatonin reduces indomethacin-induced gastric mucosal cellapoptosis by preventing mitochondrial oxidative stress and the activation ofmitochondrial pathway of apoptosis. J. Pineal Res. 46:314–323; 2009.

[48] Pal, C.; Bindu, S.; Dey, S.; Alam, A.; Goyal, M.; Iqbal, M. S.; Sarkar, S.; Kumar, R.;Halder, K. K.; Debnath, M. C.; Adhikari, S.; Bandyopadhyay, U. Tryptamine-gallic acid hybrid prevents non-steroidal anti-inflammatory drug-inducedgastropathy: correction of mitochondrial dysfunction and inhibition of apop-tosis in gastric mucosal cells. J. Biol. Chem. 287:3495–3509; 2012.

[49] Lundberg, A. H.; Granger, N.; Russell, J.; Callicutt, S.; Gaber, L. W.; Kotb, M.;Sabek, O.; Gaber, A. O. Temporal correlation of tumor necrosis factor-alpharelease, upregulation of pulmonary ICAM-1 and VCAM-1, neutrophil seques-tration, and lung injury in diet-induced pancreatitis. J. Gastrointest. Surg.4:248–257; 2000.

[50] Darling, R. L.; Romero, J. J.; Dial, E. J.; Akunda, J. K.; Langenbach, R.;Lichtenberger, L. M. The effects of aspirin on gastric mucosal integrity, surfacehydrophobicity, and prostaglandin metabolism in cyclooxygenase knockoutmice. Gastroenterology 127:94–104; 2004.

[51] Hogaboam, C. M.; Bissonnette, E. Y.; Chin, B. C.; Befus, A. D.; Wallace, J. L.Prostaglandins inhibit inflammatory mediator release from rat mast cells.Gastroenterology 104:122–129; 1993.

[52] Rioux, K. P.; Wallace, J. L. Mast cell activation augments gastric mucosal injurythrough a leukotriene-dependent mechanism. Am. J. Physiol 266:G863–G869;1994.

[53] Rosam, A. C.; Wallace, J. L.; Whittle, B. J. Potent ulcerogenic actions of platelet-activating factor on the stomach. Nature 319:54–56; 1986.

[54] Rioux, K. P.; Wallace, J. L. Mast cells do not contribute to nonsteroidal anti-inflammatory drug-induced gastric mucosal injury in rodents. Aliment. Phar-macol. Ther 10:173–180; 1996.

[55] Morise, Z.; Komatsu, S.; Fuseler, J. W.; Granger, D. N.; Perry, M.; Issekutz, A. C.;Grisham, M. B. ICAM-1 and P-selectin expression in a model of NSAID-inducedgastropathy. Am. J. Physiol. 274:G246–G252; 1998.

[56] Watanabe, T.; Higuchi, K.; Tominaga, K.; Fujiwara, Y.; Arakawa, T. Acidregulates inflammatory response in a rat model of induction of gastric ulcerrecurrence by interleukin 1beta. Gut 48:774–781; 2001.

[57] Li, Q.; Verma, I. M. NF-kappaB regulation in the immune system. Nat. Rev.Immunol. 2:725–734; 2002.

[58] Suleyman, H.; Demircan, B.; Karagoz, Y. Anti-inflammatory and side effects ofcyclooxygenase inhibitors. Pharmacol. Rep. 59:247–258; 2007.

[59] Perkins, N. D.; Gilmore, T. D. Good cop, bad cop: the different faces of NF-kappaB. Cell Death Differ. 13:759–772; 2006.


[60] Tak, P. P.; Firestein, G. S. NF-kappaB: a key role in inflammatory diseases. J. Clin.Invest. 107:7–11; 2001.

[61] Jaeschke, H. Mechanisms of liver injury. II. Mechanisms of neutrophil-inducedliver cell injury during hepatic ischemia-reperfusion and other acute inflam-matory conditions. Am. J. Physiol. Gastrointest. Liver Physiol 290:G1083–G1088;2006.

[62] Nakamura, E.; Takahashi, S.; Matsui, H.; Okabe, S. Interleukin-1beta inhibitsgrowth factor-stimulated restoration of wounded rat gastric epithelial cellmonolayers. Dig. Dis. Sci. 43:476–484; 1998.

[63] Eming, S. A.; Krieg, T.; Davidson, J. M. Inflammation in wound repair:molecular and cellular mechanisms. J. Invest. Dermatol. 127:514–525; 2007.

[64] Dovi, J. V.; He, L. K.; DiPietro, L. A. Accelerated wound closure in neutrophil-depleted mice. J. Leukoc. Biol. 73:448–455; 2003.

[65] Bubici, C.; Papa, S.; Dean, K.; Franzoso, G. Mutual cross-talk between reactiveoxygen species and nuclear factor-kappa B: molecular basis and biologicalsignificance. Oncogene 25:6731–6748; 2006.

[66] Schieven, G. L.; Kirihara, J. M.; Myers, D. E.; Ledbetter, J. A.; Uckun, F. M.Reactive oxygen intermediates activate NF-kappa B in a tyrosine kinase-dependent mechanism and in combination with vanadate activate the p56lckand p59fyn tyrosine kinases in human lymphocytes. Blood 82:1212–1220;1993.

[67] Morgan, M. J.; Liu, Z. G. Crosstalk of reactive oxygen species and NF-kappaBsignaling. Cell. Res. 21:103–115; 2011.

[68] Kwiecien, S.; Brzozowski, T.; Konturek, P. C.; Pawlik, M. W.; Pawlik, W. W.;Kwiecien, N.; Konturek, S. J. Gastroprotection by pentoxyfilline against stress-induced gastric damage. Role of lipid peroxidation, antioxidizing enzymes andproinflammatory cytokines. J. Physiol. Pharmacol. 55:337–355; 2004.

[69] Rada, B.; Gardina, P.; Myers, T. G.; Leto, T. L. Reactive oxygen species mediateinflammatory cytokine release and EGFR-dependent mucin secretion in air-way epithelial cells exposed to Pseudomonas pyocyanin. Mucosal Immunol4:158–171; 2011.

[70] Tiden, A. K.; Sjogren, T.; Svensson, M.; Bernlind, A.; Senthilmohan, R.; Auchere,F.; Norman, H.; Markgren, P. O.; Gustavsson, S.; Schmidt, S.; Lundquist, S.;Forbes, L. V.; Magon, N. J.; Paton, L. N.; Jameson, G. N.; Eriksson, H.; Kettle, A. J.2-Thioxanthines are mechanism-based inactivators of myeloperoxidase thatblock oxidative stress during inflammation. J. Biol. Chem. 286:37578–37589;2011.

[71] Lundvig, D. M.; Immenschuh, S.; Wagener, F. A. Heme oxygenase, inflamma-tion, and fibrosis: the good, the bad, and the ugly? Front. Pharmacol 3:81;2012.

[72] Wagener, F. A.; van Beurden, H. E.; von den Hoff, J. W.; Adema, G. J.; Figdor, C.G. The heme-heme oxygenase system: a molecular switch in wound healing.Blood 102:521–528; 2003.

[73] Wagener, F. A.; Feldman, E.; de Witte, T.; Abraham, N. G. Heme induces theexpression of adhesion molecules ICAM-1, VCAM-1, and E selectin in vascularendothelial cells. Proc. Soc. Exp. Biol. Med. 216:456–463; 1997.

[74] Wagener, F. A.; Eggert, A.; Boerman, O. C.; Oyen, W. J.; Verhofstad, A.;Abraham, N. G.; Adema, G.; van Kooyk, Y.; de Witte, T.; Figdor, C. G. Heme isa potent inducer of inflammation in mice and is counteracted by hemeoxygenase. Blood 98:1802–1811; 2001.

[75] Kumar, S.; Bandyopadhyay, U. Free heme toxicity and its detoxificationsystems in human. Toxicol. Lett. 157:175–188; 2005.

[76] Siow, R. C.; Sato, H.; Mann, G. E. Heme oxygenase-carbon monoxide signallingpathway in atherosclerosis: anti-atherogenic actions of bilirubin and carbonmonoxide? Cardiovasc. Res. 41:385–394; 1999.

[77] Wagener, F. A.; da Silva, J. L.; Farley, T.; de Witte, T.; Kappas, A.; Abraham, N. G.Differential effects of heme oxygenase isoforms on heme mediation ofendothelial intracellular adhesion molecule 1 expression. J. Pharmacol. Exp.Ther. 291:416–423; 1999.

[78] Hayashi, S.; Takamiya, R.; Yamaguchi, T.; Matsumoto, K.; Tojo, S. J.; Tamatani,T.; Kitajima, M.; Makino, N.; Ishimura, Y.; Suematsu, M. Induction of hemeoxygenase-1 suppresses venular leukocyte adhesion elicited by oxidativestress: role of bilirubin generated by the enzyme. Circ. Res. 85:663–671; 1999.

[79] Vachharajani, T. J.; Work, J.; Issekutz, A. C.; Granger, D. N. Heme oxygenasemodulates selectin expression in different regional vascular beds. Am. J.Physiol. Heart Circ. Physiol 278:H1613–H1617; 2000.

[80] Wunder, C.; Potter, R. F. The heme oxygenase system: its role in liverinflammation. Curr. Drug Targets Cardiovasc. Haematol. Disord 3:199–208;2003.

[81] Freitas, A.; Alves-Filho, J. C.; Secco, D. D.; Neto, A. F.; Ferreira, S. H.; Barja-Fidalgo, C.; Cunha, F. Q. Heme oxygenase/carbon monoxide-biliverdin path-way down regulates neutrophil rolling, adhesion and migration in acuteinflammation. Br. J. Pharmacol. 149:345–354; 2006.























































































































































Documents

Nonsteroidal anti-inflammatory drug induces proinflammatory damage in gastric mucosa through NF-κB activation and neutrophil infiltration: Anti-inflammatory role of heme oxygenase-1