Proc. Natl. Acad. Sci. USAVol. 93, pp. 10891-10896, October 1996Genetics

NOMAD: A versatile strategy for in vitro DNA manipulationapplied to promoter analysis and vector designDMITRI REBATCHOUK, NIKOLAI DARASELIA, AND JONATHON 0. NARITAtDepartment of Biological Sciences, Laboratory for Molecular Biology, University of Illinois at Chicago, 900 South Ashland Avenue, Chicago, IL 60607

Communicated by Emanuel Margoliash, University of Illinois at Chicago, Chicago, IL, June 3, 1996 (received for review January 16, 1996)

ABSTRACT Molecular analysis of complex modularstructures, such as promoter regions or multi-domain pro-teins, often requires the creation of families of experimentalDNA constructs having altered composition, order, or spacingof individual modules. Generally, creation of every individualconstruct of such a family uses a specific combination ofrestriction sites. However, convenient sites are not alwaysavailable and the alternatives, such as chemical resynthesis ofthe experimental constructs or engineering of different re-striction sites onto the ends ofDNA fragments, are costly andtime consuming. A general cloning strategy (nucleic acidordered assembly with directionality, NOMAD; WWW re-source locator http://Lmbl.bios.uic.edu/NOMAD/NO-MAD.html) is proposed that overcomes these limitations. Useof NOMAD ensures that the production of experimentalconstructs is no longer the rate-limiting step in applicationsthat require combinatorial rearrangement ofDNA fragments.NOMAD manipulates DNA fragments in the form of "mod-ules" having a standardized cohesive end structure. Speciallydesigned "assembly vectors" allow for sequential and direc-tional insertion of any number of modules in an arbitrarypredetermined order, using the ability of type IIS restrictionenzymes to cut DNA outside of their recognition sequences.Studies of regulatory regions in DNA, such as promoters,replication origins, and RNA processing signals, constructionof chimeric proteins, and creation of new cloning vehicles, areamong the applications that will benefit from using NOMAD.

DNA of any living organism can be regarded as a modularstructure consisting of individual elements such as regionscoding for protein domains and protein-binding sites. All theseelements, or modules, perform discrete functions and cannotbe subdivided without loss of functionality. Modules arecharacterized by a certain degree of context independence andare often found in different combinations in vivo. For instance,regulatory regions such as promoters, replication origins, andRNA processing signals usually consist of many distinct pro-tein-binding sites, and closely related or identical sites arecommonly found in different regulatory regions.To elucidate the function of a modular regulatory region in

DNA, such as a promoter, it is not sufficient to merely identifyindividual regulatory modules. It is necessary to determine thespacing, orientation, and order of the constituent modulesrequired for their normal interaction and, consequently, forthe function of the region as a whole. This information can beobtained by systematically rearranging DNA modules in vitroand testing the resulting constructs. Similarly, RNA domainsthat regulate translational efficiency, subcellular localization,or processing can be dissected and tested by rearrangingindividual elements in experimental DNA constructs. Thesame approach can be applied to studies of multi-domainproteins, where the function of a complex protein is deter-mined by the activities of the individual domains interacting

with one another. Thus, modular analysis, or functional testingof experimental constructs having altered modular structure,is a powerful approach to a wide variety of biological problems.However, complications of a purely technical nature havemade it difficult to consistently apply the concept of modularanalysis. Traditional cloning techniques require a specificcombination of restriction sites to be used for the creation ofevery new construct having an altered order of constituentelements. The required sites are not always available, andintroduction of specific restriction sites onto the ends of DNAfragments becomes prohibitively time consuming as the num-ber of required constructs increases. Significantly, rearrangedmodular constructs produced by the conventional techniqueare not always directly comparable to one another and mayrequire additional control experiments, because the order ofmodules is not the only variable that changes. The sequence atmodule junctions is unavoidably altered as different adaptorsare used. This can be critical, especially when short protein-binding regions are rearranged. Thus, limitations intrinsic tothe traditional cloning strategy generally preclude comprehen-sive modular analysis of all but the simplest modular structures.The alternative strategy, direct chemical resynthesis of therequired constructs, is resource intensive and thus acceptableonly for relatively short regions and a limited number of testconstructs.The goal of this work was to develop a general strategy for

combinatorial manipulation of DNA fragments in vitro. Nu-cleic acid ordered module assembly with directionality (NO-MAD) permits the researcher to rapidly create families ofDNA constructs of predetermined structure from a pool offragments. NOMAD is well suited for modular analysis be-cause DNA fragments containing individual regulatory orstructural elements can be directionally combined in anydesired order in the experimental construct. This strategy hasnumerous uses, including construction of chimeric proteinsand analysis ofDNA sequences containing multiple regulatoryelements.NOMAD is also applicable to the construction of cloning

vectors. Common cloning vehicles consist of segments, whichconfer particular behaviors onto the vector, such as the abilityto replicate in a particular host or render the host resistant toan antibiotic. DNA fragments containing origins of replica-tion, resistance markers, reporter genes, and other similarelements are repeatedly used in different vectors. The abilityto combine vector components with unlimited flexibility wouldstreamline creation of "custom designed" vectors.NOMAD uses two major elements: DNA fragments having

standardized end structures, termed modules (Fig. 1A) andassembly vectors (Fig. 1 B and C) that allow for sequential anddirectional insertion of any number of modules, as well as theirrelease individually or in blocks ("composite modules"). To

Abbreviations: NOMAD, nucleic acid ordered module assembly withdirectionality; IIS REase, type IIS restriction endonuclease; HMG2,3-hydroxy-3-methylglutaryl-CoA reductase 2; UTR, untranslated re-gion; SIS, sequential insertion site; eSIS, excisable SIS.tTo whom reprint requests should be addressed. e-mail: jon@uic.edu.

10891

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 93 (1996)

A

1 A

120 BsmBI BsaI-.*.~~~~~ 150

pNOMADI CCGAAAAGTGT.TT ACC PGCTGCATTA

SLS GGCTTTTCAC TCTGAGGJTCGACGTAATBsMAI BsMAI

120 BsaI 5..OII BsmBI 1501 F-

pNCWLVAI)2 CCGA L_i GGCGC C0Ir TAeSOEiD Cr ACCGC A_GAA AT

BsmiAI B5AI

SspR~ ~~ 144

Xffinrl 1812 X X B ; gt 4

Scal 1693 y i E Nspl 324Pvul 1583 -.&J.Pf

pNOMAD1pNOMAD2

2000bpFdi2 1435 -

B

C

r3n~~~~

_"4

Eo>

D -W,3

2 A

B

C

D

~~~~~~~~~2]E1 -

-m*

_~~~ZZh

E A8 L^

B911 1333

AIwN1 736

Ba 1161 /

FIG. 1. (A) A CCTTGG-bracketed NOMAD module as a part ofa larger DNA fragment, such as a PCR product. An arbitrarily selected"positive" orientation is shown by an arrow in the body of a module.pNOMAD compatible cohesive ends (on shaded background) are

produced upon digestion with StyI. (B and C) pNOMAD1 andpNOMAD2 are identical beyond the depicted regions: a sequentialcloning site (SIS) (B) in pNOMAD1 and an excisable SIS (eSIS) (C)in pNOMAD2. BsaI, BsmAI, and BsmBI recognition sites are boxed;linkers that upon cleavage produce the StyI (CCTTGG) compatiblecohesive ends are on shaded background.

manipulate the modules, NOMAD relies on the properties ofthe type IIS restriction endonucleases (IIS REases). IISREases efficiently cut DNA at a precise distance outside oftheir recognition sequence and can produce sticky ends of anysequence within the overall structure (e.g., a 4-nucleotide 5'overhang). Digestion of a vector with a IIS REase, followed byinsertion of a DNA fragment having compatible cohesive ends,leaves the type IIS site intact and unduplicated. The vector canbe cut again by the same IIS REase, and another DNAfragment can be inserted next to the one inserted at theprevious step. When the sticky ends used in joining arerotationally nonequivalent, the fragments are inserted direc-tionally.

Several vectors that use IIS REases for manipulating DNAhave been described (refs. 1-3; for review see ref. 4). However,all of these vectors were constructed for use in specializedapplications, and no system as versatile as NOMAD has beenpreviously proposed. In addition, vectors pNOMAD1 (Fig. 1B)and pNOMAD2 (Fig. 1C) incorporate several key featuresabsent from the earlier constructs. Convergently orientedrecognition sequences for two different type IIS REases (BsaIand BsmBI) flank the insertion site of pNOMAD1 (an SIS),allowing for sequential addition of new modules to either sideof an initial insert (Fig. 2-1). The insert, which can consist ofseveral modules, can be released as a whole by cutting withboth IIS REases at the same time. This feature is notablebecause new constructs do not always have to be built byadding all of the modules one by one. Previously assembledmulti-module blocks (composite modules) can be inserted intheir entirety. In fact, creation of families of related constructs

mE Modules

(directionality not shown)

assembly vector DNA

eSISrecognition sequence and - wdirection of cleavage: BsmnBI Bsal*

T simultaneous cleavage with BsmBI and Bsal

FIG. 2. (1) Sequential insertion of the StyI (CCTTGG)-compatiblemodules into the assembly vector pNOMAD1. The vector is cut withBsmBI, BsaI, or BsmAI to produce sticky ends compatible with StyI(5'-CCTTGG-3'), and the first module is inserted (A). The secondmodule can be inserted either 5' or 3' to the first. When the assemblyvector is cut by BsmBI, the second module is inserted 5' to the first (B).Insertion of the third module 3' to the previously inserted ones (C) isperformed using BsaI to cut the vector. Subsequent modules can beadded 5' or 3' to the composite module. The composite module canbe released by cutting with BsmAI or by simultaneous cutting withBsmBI and BsaI (D). A modular construct can be disassembled intoindividual modules by digestion with StyI and BsmAI. Digestion withStyI alone will release all modules but the "outermost." Insertion ofmodules is directional. (2) Use of pNOMAD2 as the basis forconstruction of custom assembly vectors. "Structural" modules are

successively cloned into pNOMAD2 (A-C). eSIS is excised by simul-taneous digestion with BsaI and BsmBI (or withBsmAI alone) (D). AnSIS-containing module replaces the eSIS, producing a custom assem-bly vector (E). All structural modules (cloned before the SIS-containing module was inserted) are physically separated from the"experimental" modules, which are inserted into the SIS and can bereleased as a composite module that does not include any structuralcomponents. Note that any module can be structural as well as

experimental, depending on the details of a particular experiment.

should be planned in such a way as to maximize compositemodule reuse. For convenience, the insertion site of pNO-MAD1 is designed so that a third type IIS REase (BsmAI)recognizes both sequences flanking the insertion site and canrelease the insert by itself. Regardless of which SIS restrictionenzymes are used, all released fragments have the same endstructure and can be used as modules in subsequent assemblysteps.The second NOMAD series vector, pNOMAD2 (Fig. 1C),

is designed to serve as a basis for construction of customassembly vectors (see Discussion). pNOMAD2 uses the con-

cept of excisable cassettes. Other implementations of theconcept have been described (e.g., ref. 5). The important

B

C

.:Io!.;.! g..,<cf A.I....I.....NNNNC Iffiv..IE.; RD;

NNNNC Gdii4MM2.

10892 Genetics: Rebatchouk et al.

10-

Proc. Natl. Acad. Sci. USA 93 (1996) 10893

difference, however, is that the predecessor vectors could notbe used for sequential assembly because the excisable cassettecontained two divergently oriented recognition sequences fora single enzyme. In a manner similar to pNOMAD1, pNO-MAD2 permits sequential addition of modules (Fig. 2-2).The recognition sequence for the type II restriction enzyme

StyI (C/CTTGG) is used to bracket the modules. Cutting themodules with Styl produces sticky ends directionally compat-ible with pNOMAD vectors digested with any of the IISREases used in NOMAD. Having StyI sites at every modulejunction allows for convenient disassembly of composite mod-ules.The utility of NOMAD can be best realized if numerous

research groups cooperate in creating commonly used mod-ules. To facilitate the exchange of information on NOMADand reduce the duplication of effort, a World Wide Web(WWW) site has been set up (see Abstract) that providesinformation on NOMAD, as well as the interface to a data baseof available modules. We propose that the recognition site forStyI (CCTTGG) is adopted as a standard module linkingsequence. However, NOMAD assembly vectors are very flex-ible and can be easily modified to use four bp 5' overhangs ofany sequence (see Discussion), as required by particular ap-plications.

In this paper the applications of NOMAD to promoteranalysis and construction of fully modular vectors are pre-sented as examples of the potentially broad applicability ofNOMAD to manipulating DNA in vitro. The focus of ourcurrent research is transcriptional regulation of the genesinvolved in isoprenoid biosynthesis in tomato. These genesinclude the 3-hydroxy-3-methylglutaryl-CoA reductase 2(HMG2). HMG2 is highly expressed at specific stages intomato development. The promoter region ofHMG2 has beensequenced and preliminary data from in vitro DNaseI foot-printing experiments showed the existence of several protectedareas (J.O.N. and T. Manzara, unpublished work). In agree-ment with the footprinting data, transient expression (bom-bardment) assays using promoter-reporter constructs at var-ious stages of development showed that the 5' untranslatedleader region of HMG2 contains several elements importantfor high level expression (6). The effects of these regulatoryelements on the expression of the tomato HMG genes can beconveniently studied using NOMAD. This work was initiatedby making modules encompassing the entire promoter and 5'untranslated leader of the HMG2, recreating a wild-typemodule arrangement and testing the resulting constructs in thetransient expression assay. To conveniently test promotermodular constructs, as well as to demonstrate the generalutility of NOMAD in vector construction, a series of plantreporter vectors has been created. These vectors were con-structed by inserting general purpose modules-a constitutivepromoter, the luciferase reporter gene, and a terminatorfragment- into the minimal assembly vector, pNOMAD1.

MATERIALS AND METHODSDNA restriction and modification enzymes used in this studywere purchased from New England Biolabs and Life Technol-ogies (Gaithersburg, MD) and were used according to themanufacturer's instructions. Oligonucleotides were from Uni-versal DNA (Tigard, OR). KlenTaq and Pfu DNA polymeraseswere from AB Peptides (St. Louis) and Stratagene, respec-tively. A Sequenase v. 2.0 kit (United States Biochemical) wasused for sequencing. Propagation and transformation of Esch-erichia coli were performed by conventional methods (7).

Design ofAssembly Vectors pNOMAD1 and pNOMAD2. Allchanges to the parental plasmid pBluescript SK(+) (Strat-agene) to produce pNOMAD vectors were made with aPCR-based mutagenesis approach using divergently orientedprimers. To eliminate the recognition sites for the NOMAD

enzymes present in the parental plasmid, C at pBluescript SKposition 2117 was changed to A (GAGAC to GAGAA) and Gat position 2878 was changed to C (GTCTC to CTCTC). Next,the unwanted portion of pBluescript was substituted with thesequential insertion site, resulting in pNOMAD1, or with theexcisable sequential insertion site, resulting in pNOMAD2.pBluescript SK sequence from position 974 to position 2958,comprising the f3-lactamase gene (which determines resistanceto ampicillin) and the ColEI origin of replication, becameincorporated into pNOMAD1. The sequence GTCTCTCTT-GAGAGA, which comprises most of the SIS, was substitutedfor the rest of pBluescript SK(+). The eSIS was introduced atthe same site, except that the pBluescript SK sequence fromposition 984 to position 2951 was incorporated into pNO-MAD2. The sequence CCTTGAGAGACCGGCGCGC-CCGTCTCTCTTGG, which comprises the eSIS, was substi-tuted for the rest of pBluescript SK. Changes introduced bysite-directed mutagenesis were confirmed by dideoxy sequenc-ing. The above manipulations resulted in vectors with adeduced size of 2000 bp. PCR amplification may have resultedin more changes to the sequence of the parental vector.However, the ability of the vectors to confer resistance toampicillin onto the bacterial host, as well as their ability toreplicate in E. coli, remained apparently unchanged. Theplasmid yield from strains harboring pNOMAD1 and pNO-MAD2 is not significantly different from pBluescript SK.

Construction of pLucS. pUC119-based promoter-less lucif-erase reporter vector pLuc (8, 9) was modified to allow fordirectional insertion of modules. The XbaI site in the multiplecloning site of that vector was precisely replaced with an StyI(CCTTGG) site. The derivative vector was designated pLucS(for pLuc-Styl). All tomato HMG2 promoter constructs wereassayed using pLucS.

Creation of Modules. Two methods were used to createmodules: annealing of complementary synthetic phosphory-lated oligonucleotides having Styl (CCTTGG)-compatible 5'extensions and PCR amplification with primer-adaptors. To-mato HMG2 TATA box and transcriptional start-site modules(designated, respectively, [TATA] and [trx]) were made ofsynthetic oligonucleotides. [TATA] was produced by annealingoligonucleotide 1 (CTTGGTTCCTCTATAAATACATTTC)and oligonucleotide 2 (CAAGGAAATGTATTTATAGAG-GAAC), and [trx] by annealing oligonucleotide 3 (CTTG-GTCTTCTCTTCTCCTCACATC) and oligonucleotide 4(CAAGGATGTGAGGAGAAGAGAAGAC). Larger mod-ules were created by PCR using plasmid DNA as a template.Primer-adaptors contained a four-nucleotide GC-rich"clamp" and the StyI recognition site (CCTTGG orCCAAGG, depending on the orientation of the primer),followed by a region of exact homology to the template DNA.A PCR fragment produced with primer-adaptors was cut withStyI and inserted into pNOMAD1. To minimize the possibilityof PCR errors, the Long and Accurate PCR technique (10) wasused. The module [5'Reg], which contains regulatory regionsimportant for HMG2 high-level expression (6), and the firstnine triplets of the protein coding sequence, was created usingthe cloned HMG2 gene (J.O.N., unpublished work) as atemplate. Oligonucleotides 5 (GAGGCCTTGGACTCT-TCTTTTAACAATTATAC) and 6 (GAGGCCAAGGTCT-TCAGATCTCCGGCGAAC) were used as primer-adaptors.The module [TATA-5'Reg], encompassing the tomato HMG2TATA box, 5' untranslated region (UTR), and the first ninetriplets of the protein coding sequence, was created usingoligonucleotides 6 and 7 (GGAGCCTTGGTTCCTCTATA-AATACATTTCC) as primer-adaptors. The luciferase mod-ule [Luc+] was created using oligonucleotides 8 (GGAGC-CTTGGCATGGAAGACGCCAAAAAC; initiator ATG un-derlined) and 9 (GGAGCCAAGGTTACACGGCGA-TCTTTCCG; complement of the terminator TAA codonunderlined) as primer-adaptors. The [Luc+] module was

Genetics: Rebatchouk et al.

10894 Genetics: Rebatchouk et al.

created from a modified version of luciferase enzyme knownas luc+. The template vector pSP-luc+ was purchased fromPromega. The 1.6-kb [Luc+] was sequenced at the termini andshown to encode functional luciferase in the transient expres-sion assay. Note that the current version of [Luc+] containsthree BsmAI recognition sites. TheAgrobacterium tumefaciensTi plasmid nopaline synthase gene terminator was convertedinto a NOMAD module [nosT] by PCR amplification of acorresponding portion of the pLuc reporter plasmid witholigonucleotides 10 (GGAGCCTTGGATCGTTCAAA-CATTTGGC) and 11 (GGAGCCAAGGATCTAGTAA-CATAGATGAC) as primer-adaptors. To produce the [35S]module, 523 bp of the [35S] promoter of cauliflower mosaicvirus were surrounded by Styl (CCTTGG) sites using PCRwith primer-adaptors oligonucleotide 12 (GGAGCCTTG-GAGTCAAAAATTCAGATCGAGG) and 13 (GGAGC-CAAGGATCCTCTCCAAATGAAATG), and the plasmidpDO432 (10) as a template. At present [35S] contains twoBsmAI recognition sites. [nosT] and [35S] were fully se-quenced. Note that pDO432 is referred to descriptively as35S-Luc throughout the text.

Cloning of Modules into pNOMAD1. pNOMAD1 was cutwith either BsmAI, BsmBI, orBsal prior to insertion of the firstmodule. To clone additional modules into a modular construct,BsmBI was used to insert the new module 5', and BsaI 3' to thepreviously inserted module (Fig. 2-1). To prevent self-ligation,the linearized assembly vector was treated with calf intestinalphosphatase. Cloned modules were excised from the corre-sponding vectors by digestion with BsmAI or by simultaneousdigestion with BsaI and BsmBI, and agarose gel purified byconventional methods (7). To 20 ng (- 15 fmol) of dephos-phorylated vector, a gel-purified module (in the case of themodules being recloned and modules produced by PCR) or amixture of annealed phosphorylated oligonucleotides wasadded at a 5-fold molar excess, and ligation was performed ina total volume of 20 ,u using T4 DNA ligase, for 1-3 hr at roomtemperature. Competent DH5Ia cells were transformed usingstandard techniques (7), and bacteria were incubated over-night at 37°C. Recombinant colonies were screened by PCR.The [TATA][trx][5'Reg] composite module was assembled inpNOMAD1 and recloned into pLucS for use in the transientassay. The [TATA-5'Reg] module was directly cloned intopLucS. Component modules of the plant expression vectorpNPR1 were successively cloned into pNOMAD1. The finaltHMG2 promoter/5'Reg constructs were fully sequenced.Larger modular constructs created from previously character-ized modules were sequenced across module junctions.

Transient Expression Assay. Transient expression assaysusing the BioListic Particle Bombardment System (Bio-Rad)are described elsewhere (6). Bombardments were performedin triplicate, and all experiments were repeated at least twice.Young tomato fruits (-7 mm in diameter) and tomato leaveswere used in bombardment experiments with the HMG2 and35S-driven transient expression, respectively.

RESULTSConstruction of Modular Assembly Vectors pNOMAD1 and

pNOMAD2. Assembly vectors pNOMAD1 and pNOMAD2were derived from the phagemid pBluescript SK (Stratagene)so as to include only the f-lactamase gene (which confersresistance to ampicillin) and the ColEI origin of replication.The rest of pBluescript was substituted by the SIS in the caseof pNOMAD1 and by the eSIS in the case of pNOMAD2.pNOMAD1 SIS (Fig. 1B) consists of the BsmBI recognition

sequence (CGTCTC), a spacer (TCTTGA), and the BsaIrecognition sequence in the opposite orientation (GAGACC).Note that the BsmAI recognition sequence (GTCTC) is partof both the BsaI and BsmBI sites. Digestion of pNOMAD1with any of the three restriction endonucleases having recog-

nition sequences within the SIS (BsaI, BsmAI, and BsmBI)cuts the TCTTGA spacer and forms cohesive ends of the samestructure (3'-GAAC-5' and 5'-CTTG-3'). The sticky ends arerotationally nonequivalent and hence permit directional in-sertion of a module with complementary sticky ends into thevector (Fig. 2-1). Another module can be inserted 5' or 3' tothe first, by cutting the plasmid with BsmBI and BsaI, respec-tively. The procedure is repeated until a recombinant moleculeof the desired structure is assembled. When necessary, allinserted modules can be released from the assembly vector asa group by cutting with BsmAI, or by simultaneous cutting withBsmBI and BsaI.The eSIS of pNOMAD2 (Fig. 1C) consists of the following

parts, in 5' to 3' order: a spacer CCTTGA that producesStyI-compatible sticky ends, a BsaI recognition site oriented soas to cut at the spacer, an AscI/BssHII recognition site (notused in NOMAD), a BsmBI site, and an adjoining spacerTCTTGG that forms StyI-compatible sticky ends when cutwith BsmBI. Cleavage with BsaI orBsmBI allows for successiveinsertion of modules into pNOMAD2 (Fig. 2-2). Simultaneouscleavage of pNOMAD2-based vectors with BsaI and BsmBIreleases the eSIS, which can be replaced by any module,including a module containing the sequential insertion site.The primary role for pNOMAD2 is to serve as the foundationfor custom assembly vectors.Modular Assembly of the Tomato HMG2 Promoter/5'

Regulatory Region. The utility of NOMAD for promoteranalysis was demonstrated using the tomato HMG2 promot-er/5' regulatory region (5'Reg). The promoter was recon-structed from three modules (Fig. 3). The modules weredesigned so as to replace parts of the endogenous sequencewith Styl recognition sites, rather then to insert them. Thus, thespacing between the TATA box, transcription start site, andthe ATG initiation codon remained unchanged. Two of themodules ([TATA], which encompasses the HMG2 TATA boxand [trx], the gene's transcription start site region) are each 25bp long. These structural elements are both highly conservedin all of the tomato HMG genes (6). The third module([5'Reg]) is 138 bp long. [5'Reg] encompasses the entire 5'UTR, as well as the first nine triplets of the HMG2 codingregion. Functional characterization of this region is currentlyin progress. Available data indicate that it contains elementsthat are necessary and sufficient for high-level expression oftHMG2 in transient expression assays.To permit testing of modular promoter constructs prior to

creation of a fully modular plant reporter vector (pNPR1, seebelow), an Styl (CCTTGG)-compatible reporter vector pLucSwas derived from pLuc. All tomato HMG2 constructs aretranslational fusions with luciferase in the pLucS reportervector. The control construct, HMG2WT-Luc, is a transla-tional fusion of HMG2 to luciferase in pLuc, the parentalplasmid of pLucS. HMG2WT-Luc (6) includes the same regionof the tomato HMG2 gene as do the modular constructs

r- TATA I - trx ,mod CC?GGTTCCTCTATAAATACATTITCCTTGTCTTCTCTTCTCCTCACATCCTrGGACTCTTCTT

WT ACCGGGTTCCTCTATAAATACATTTCCTACATCTTCTCTTCTCCTCACATCCCATCACTCTTCTT

5 'Regmod TTAACAATTATACTTGTCAATCATCAATCCCACAAACAACACTTTTT(CTCTCCTCTTTTTCCTCA

I11111 I!IIIIIIIIIIIIIIIIIIIIIII111111111 1 11111111111 II 1111111WT TTAACAATTATACTTGTCAATCATCAATCCCACAAACAACACTTTTTCTCTCCTCTTTTTCCTCA

mod CCGGCCGGCAGACTTACCGGTGAAAAA ATG GAC GTT CGC CGC;G AGA TCT GAA GACCTTGG11111111|11 1 II 111 111 111 111 111 111 #1#1#1

WT CCGGCGGCAGACTrTACCGGTGAAAAA ATG GAC GTT CGC CGG AGA TCT CAA GAGCCTGT

FIG. 3. Alignment of the wild-type and modular reconstitution ofthe tomato HMG2 promoter/5'Reg. mod, sequence of the compositemodule [TATA][trx][5'Reg]; WT, wild-type HMG2 sequence.[TATA-5'Reg] is the same as WT except that it is bracketed with theStyI sites. Mismatches are highlighted by # signs. Styl (CCTTGG) sitesare shown on shaded background, the TATA box, the transcriptionalstart site (adenine at +1), and initiator ATG are in boldface type.

Proc. Natl. Acad. Sci. USA 93 (1996)

Proc. Natl. Acad. Sci. USA 93 (1996) 10895

[TATA-5'Reg]-LucS and [TATA][trx][5'Reg]-LucS. Intro-duction of StyI (CCTTGG) sites at the borders of the tomatoHMG2 promoter/5'Reg region did not change its ability todrive expression of a reporter vector compared with an anal-ogous construct not bracketed by StyI sites (compare [TATA-5'Reg]-LucS and HMG2WT-Luc in Fig. 4A). Furthermore, itwas shown that reconstruction of the tomato HMG2 promot-er/5'Reg region from modules containing the TATA box, thetranscriptional start site region, and the 5'Reg did not result inchanges in the expression of the luciferase reporter gene intransient expression assays (compare [TATA](trx][5'Reg]-LucS to HMG2WT-Luc on Fig. 4A). Removal of the TATAbox reduced expression of the luciferase reporter gene tobackground level (data not shown).

Construction of a Fully Modular Reporter Vector. Theutility of NOMAD in constructing useful vectors was demon-strated by creating a modular reporter vector for transientexpression in plants. pNPR1 (pNOMAD1 plant reporter 1)was created by inserting a modified luciferase (Luc+) reportergene and the nopaline synthase gene terminator modules intothe pNOMAD1 assembly vector. The luciferase module canaccommodate both N-terminal translational fusions and tran-scriptional fusions. In transcriptional fusions, the endogenousATG initiator codon of the luciferase gene is utilized. Thesequence around the initiator codon satisfies most require-ments of the Kozak consensus sequence (11); adenine ispresent in the position +4 and a purine (G) is in position -3(where A in the ATG codon is + 1). At the same time,N-terminal translational fusions with [luc+] can be conve-niently created, since the StyI (CCTTGG) site in front of theATG does not introduce a termination codon.To test the functionality of pNPR1, a module of a consti-

tutive promoter was constructed. The 35S promoter of cauli-flower mosaic virus is known to be highly active in many planttissues (12). Consequently, it is often used as a constitutivecontrol promoter in transient expression and stable transfor-mation experiments. PCR-based mutagenesis was used tointroduce StyI (CCTTGG) recognition sequences flanking a

523-bp 3' region of the 35 S promoter. The resulting modulewas designated [35S]. The [35S] module is at least as active indriving luciferase expression as the nonmodular full-length 35Spromoter (data not shown). [35S] was inserted in front of the

negative control A

IIMG 2WT-Luc

[1TATA][trx][5 Reg_

FI-ATA 5~RegILLICS

l) 20 30 40 50 00 70 80 90

Luciferase Activity, Arbitrary Light Units

135S]- pNPRI

35S-Luc

if1X 30 40 50 60 70 X(0 9

Luciferase Activity, Arbitrary Light Units

FIG. 4. Activity of modular constructs in transient expression (bom-bardment) experiments. Modular constructs [TATA][trx][5'Reg]-LucSand [TATA-5'Reg]-LucS show luciferase activity levels practically iden-tical to the nonmodular construct HMG2WT-Luc (A). A fully modularreporter construct [35S]-pNPR1, which contains the modules [35S],[Luc+], and [nosT] in the assembly vector pNOMAD1, is highly ex-

pressed in transient expression assays (B). Positive control: 35S-Luc(pDO432, Ref. 10). Negative control: pUC119, which does not have a

luciferase gene.

luciferase gene in pNPR1, which resulted in a modular tran-scriptional fusion construct designated [35S]-pNPR1. In tran-sient expression ("bombardment") experiments [35S]-pNPR1produced high-level expression (Fig. 4B; compare [35S]-pNPR1 and 35S-Luc). 35S-Luc (pDO432, Ref. 9) is the 1.6-kb35 S promoter region inserted in front of the luciferase genein the pUC119-Luc. The observed difference in expressionmay be due to better performance of the "original" luciferasegene compared with the modified Luc+ gene in transientexpression assay in tomato. It should be noted that pNPR1does not itself code for any extended 5' untranslated leader.This property is intentional and allows for insertion of anydesired 5' UTR in front of the luciferase gene.

DISCUSSIONNOMAD allows for rapid creation of DNA constructs fromcompatible modules, providing at the molecular level thedegree of flexibility in handling standardized "building blocks"that is reminiscent of Lego. The modules can be sequentiallyadded to a construct in any desired order (Fig. 2), and thegroups of modules (composite modules) can be released as awhole and recloned into another modular construct. Thecollection of modules will grow with the continued use ofNOMAD: any module need only to be created once, and thanit can be used in any construct. In effect, NOMAD has thepotential to eliminate in vitro DNA manipulation as therate-limiting step in many applications that require families ofconstructs composed of rearranged DNA fragments. Modularanalysis of regulatory regions, engineering of chimeric proteinsusing protein-coding DNA segments, and vector constructionwill be facilitated by NOMAD.

Application ofNOMAD to Promoter Analysis. To illustratethe applicability of NOMAD to promoter analysis we isolatedas individual modules the TATA box, the transcription startregion, and the 5' UTR of the tomato HMG2 gene, and thenreconstructed the HMG2 promoter/5' UTR from these mod-ules. The activity of the reconstructed promoter in the tran-sient expression assay did not differ from the nonmodular,wild-type promoter. This result shows that individual promoterelements apparently can reside in different modules (i.e., beseparated by StyI recognition sites), and still interact normally.

Ideally, selection of modules for the analysis of a regulatoryregion should be based upon the data obtained by methods,such as DNA footprinting, that allow for at least tentativeidentification of the important elements. Alternatively, inter-esting sequence elements such as palindromes or homologiesto known protein-binding elements may be isolated as modulesand tested in reporter constructs. A regulatory region underinvestigation can be recreated from synthetic modules or frommodules produced by PCR. Both of these methods wereexploited in this paper. An alternative, as yet untested, ap-proach would be to introduce the StyI sites by site-directedmutagenesis. The construct can then be disassembled (brokendown into component modules) by digestion with StyL. Indi-vidual modules would then be cloned for subsequent use inassembly of experimental constructs. Whatever the means oftheir isolation, individual elements isolated as modules can bejoined in any required combination and order to create alteredversions of the regulatory region under study. The overallstructure of a region, as well as the contribution of eachindividual component, can be rapidly analyzed by assessing theactivity of NOMAD reporter constructs.

Application of NOMAD to Vector Construction. NOMADwas also used to construct a fully modular transient expressionvector [35S]-pNPR1. A constitutive promoter, luciferase re-porter gene, and transcription termination signal were con-verted into modules and cloned into a minimal assembly vectorpNOMAD1. The resulting construct gave high-level expres-sion in transient expression assays. Creation of [35S]-pNPR1

Genetics: Rebatchouk et al.

Proc. Natl. Acad. Sci. USA 93 (1996)

shows that NOMAD can be used for flexible construction ofcloning vectors out of modules.pNOMAD1 and pNOMAD2 were created as alternative

foundations for creating custom modular vectors. Specifically,pNOMAD1 and pNOMAD2 allow for different treatment ofstructural and experimental modules. Structural modules suchas a replication origin or selection marker are only required toconfer the desired properties onto the vector. In contrast,experimental DNA segments such as promoter componentsare directly subjected to investigation. When pNOMAD1 isused as the basis for an experimental construct, both kinds ofmodules are cloned into the same SIS. The advantage of thisarrangement is that new modules can be added both 5' and 3'to the structural modules. In the case of pNPR1, experimentalmodules can be cloned in front of the luciferase reporter gene,as well as downstream from the nopaline synthase terminatormodule [nosT]. However, it is not possible to release onlyexperimental modules from pNPR1, because any compositemodule will also include [Luc+] and [nosT]. pNOMAD2 (Fig.1C) was designed to permit separable handling of structuraland experimental modules. The eSIS ofpNOMAD2 allows forsequential addition of modules in much the same way aspNOMAD1 does (Fig. 2-2). The crucial feature ofpNOMAD2is that after all the structural components of the vector havebeen added, the eSIS is removed by simultaneous digestionwith BsaI and BsmBI, and a module containing the SIS isinserted. From this moment on, all general purpose modulesare located outside the SIS. The new vector now permitssequential addition of experimental modules, as well as releaseof the composite experimental module for insertion into adifferent vector, without any structural vector componentsattached. Importantly, the difference between structural andexperimental modules is purely operational, and the samemodule can play either of these roles in different applications.Use ofNOMAD in the Assembly of Protein-Coding Regions.

Implementation of NOMAD in manipulating protein-codingDNA sequences will likely depend on the sensitivity of par-ticular experimental systems to amino acid sequence alter-ations. For instance, in joining domains originating in differentproteins, wherein substitution of a small number of aminoacids at the junctions may not be critical, a uniform DNA (andconsequently amino acid) junction sequence can be used. Theuse of a standard domain junction allows for maximal flexi-bility and decreased experimental variability.A more conservative approach to the introduction of the

StyI-based NOMAD module junctions in protein-coding re-gions would be to use endogenous two or three amino acidsequences at the domain junctions that approach most closelythe sequences that can be accommodated by CCTTGG. Forinstance, when the Styl (CCTTGG) module junction sequenceis used in reading frame 3, as in pLucS and pNPR1 (NNC CTTGGN, where N is any nucleotide), 15 combinations of 3 aminoacids at the junction site can be accommodated. These are(* Leu Gly), where the asterisk signifies any amino acid exceptGln, Glu, Lys, Met, and Trp. Therefore, most Leu-Gly se-quences are potential NOMAD junction sites; alternatively, ajunction can be built around an endogenous Leu or Gly.

In situations when absolutely no alterations to the aminoacid sequence are acceptable, NOMAD assembly vectors canbe modified as described below to incorporate a modulejunction sequence required by the particular application.NOMAD Vectors Can Be Easily Modified to Use Cohesive

Ends Other than CTTG 5' Overhang. In fact, any 4-nucleotide5' overhang can be used. This can be achieved by cutting anassembly vector with BsaI, BsmAI, or BsmBI and making thecohesive ends blunt. A blunt-ended double-stranded linker canbe ligated to the vector, and the sequence of this linker will

determine the structure of the cohesive ends that form upondigestion of the new vector by the enzymes flanking the SIS.Use of NOMAD Assembly Vectors for Seamless Gene As-

sembly. Combinatorial flexibility in manipulating DNA frag-ments is the ultimate goal of NOMAD. However, pNOMAD1can also be used for seamless gene assembly. To do this,blunt-ended DNA fragments that are to form a large constructare created with a 4-bp overlap that is unique for each junctionto be formed. On the next step, the fragments are individuallycloned into blunted pNOMAD1. Digestion of the resultingconstructs with NOMAD enzymes will result in creation ofDNA fragments having unique 4-nucleotide 5' overhangs.They can be joined to form a "seamless" DNA construct.Using this technique, a long DNA segment having a knownsequence can be assembled from shorter fragments.Adapting Existing DNA Constructs for Use with NOMAD.

The optimal strategy for making a particular assay systemcompatible with NOMAD depends upon whether the recog-nition sequences for the NOMAD enzymes (primarily BsaIand BsmBI) are present in the corresponding vectors. Ifelimination of the existing restriction sites is not practical ordesirable, a bipartite system can be used. In this implementa-tion of NOMAD, there is "division of labor" between anassembly vector such as pNOMAD1, where the modules areput together in the required order, and an assay vector such aspLucS, which allows for insertion of (composite) modules andtheir functional testing. The advantage of such a bipartitesystem is that minimal modification to the assay vector isnecessary.Data base of the Available Modules and Modular Con-

structs. The advantages of NOMAD can be exploited mosteffectively if there is coordination among laboratories workingin a particular field. Most of the commonly desired modules(e.g., reporter genes, enhancer elements, or antibiotic resis-tance genes) could be rapidly created if several groups split theeffort and then made their modules available to others. Tofacilitate this process, a World Wide Web site describingNOMAD in detail and providing access to the authors' database of the currently available modules ("NOMADbase") wasestablished (http://Lmbl.bios.uic.edu/NOMAD/NO-MAD.html). Researchers who use NOMAD in their projectsare encouraged to share new NOMAD modules, as well asgeneral information on the technique.

We wish to thank Drs. David Stone, Don Morrison, Lon Kaufman,and Thianda Manzara for helpful discussion and critical reading of themanuscript and Dr. Don Morrison for computer hardware.

1. Kim, S. C. & Szybalski, W. (1988) Gene 71, 1-8.2. Gayle, R. B., Auger, E. A., Gough, G. R., Gilham, P. T. &

Bennett, G. N. (1987) Gene 54, 221-228.3. Stahl, S., Sjolander, A., Hansson, M., Nygren, P. A. & Uhlen, M.

(1990) Gene 89, 187-193.4. Szybalski, W., Kim, S. C., Hasan, N. & Podhajska, A. J. (1991)

Gene 100, 13-26.5. Kegler-Ebo, D. M., Docktor, C. M. & DiMaio, D. (1994) Nucleic

Acids Res. 22, 1593-1599.6. Daraselia, N., Tarchevskaya, S. & Narita, J. 0. (1996) Plant

Physiol. 112, in press.7. Ausubel, F. M., Brent, R., Kingston, R., Moore, D., Seidman,

J. G., Smith, J. A. & Struhl, K., eds. (1995) Current Protocols inMolecular-Biology (Wiley, New York).

8. Ow, D. W., Wood, K. V., De Luca, M., deWet, J. R., Helinski,D. R. & Howell, S. H. (1986) Science 234, 856-859.

9. Montgomery, J., Goldman, S., Deikman, J., Margossian, L. &Fischer, R. L. (1993) Proc. Natl. Acad. Sci. USA 90, 5939-5943.

10. Barnes, W. M. (1994) Proc. Natl. Acad. Sci. USA 91, 2216-2220.11. Kozak, M. (1991) J. Biol. Chem. 266, 19867-19870.12. Odell, J. T., Nagy, F. & Chua, N. H. (1985) Nature (London) 313,

810-812.

10896 Genetics: Rebatchouk et al.