34
Mystery of the Matching Marks PART 2

Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

Embed Size (px)

Citation preview

Page 1: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

Mystery of the

Matching Marks

PART 2

Page 2: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

This time, Focus on their DIFFERENCES:What do you see in the

chimp chromosomes (on the right) that is DIFFERENT from

the human chromosomes (on the left)?

Page 3: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

3

What is the BIG difference?

Page 4: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

What could have happenedto cause those differences?

Let’s take a closer look at those chromosomes…

Page 5: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

5

ANY IDEAS that might EXPLAIN the

“missing” part of the chimp’s #2 chromosome,AND the chimp’s “extra”

chromosome?

“Missing” part “Extra” in chimps

Page 6: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

6

Maybe the chimp’s“extra” chromosomewas once part of its

short #2.

Could the “extra”chromosome match the upper part of

our #2?

LET’S TRY IT…

Page 7: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

7

Nope!They don’t seem

to match.What else could

we try?

Turn the “extra” oneupside down?!

Let’s try it…

Page 8: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

8

Page 9: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

9

WOW !IT WORKED! They DO

MATCH!NOW, the next question:“How could this happen?”

Was there ONE #2 in ourcommon ancestor, that splitto make TWO in chimps, OR

Were there TWO shortchromosomes in our ancestor that

fused (joined) to make ONE in humans?

Page 10: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

10

The Chromosomesof Humans and Apes

Compared

For each number,the chromosomesare arranged in

this order(left to right):

human, chimpanzee,gorilla, orangutan

What is moststriking?

Page 11: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

11

RIGHT! They are ALL

Strikingly Similar!

And what do we knowwhen we find identical

or very similar patternson different items?

RIGHT!They had to have aCOMMON ORIGIN

Or, in this case…COMMON ANCESTRY

Page 12: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

12

All the other apes had that“extra” chromosome, too?

This confirms that this isthe more PRIMITIVE (original)CONDITION, so our SINGLE#2 chromosome is the DERIVED CONDITION(the result of fusion)How can we TEST that hypothesis?

Page 13: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

13

We could look for evidence offusion in the middle of our

#2 chromosome…

But, what kind of evidence can we look for?

Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

Page 14: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

All Chromosomes have telomeres at both ends(like shoelace aglets!)

14

HeadTelomere

Centromere

TailTelomere

ttagggttagggttagggttagggttagggttaggg…||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatccc…

Telomeres have a special DNA sequence…

Page 15: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

DNA Sequence for Telomeres:ttagggttagggttaggg…||||||||||||||||||aatcccaatcccaatccc…

15

HeadTelomere

Centromere

TailTelomere

NOTICE:Tandem Repeats in Telomeres:ttagggttagggttaggg…||||||||||||||||||aatcccaatcccaatccc…

Did you notice the repeated sequence: ttaggg?

“ttaggg” is repeated 800-1600 times in each Telomere

Page 16: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

16

Here’s another view ofa chromosome,

showing the telomeresuntwisted, and their typical

DNA sequence

It also shows that theupper (shorter) arm

above the centromereis called the “p-arm”, andthe lower (longer) arm is

called the “q-arm”

Page 17: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

17

Here are ends of the upper

telomeres of thechimp’s “short”

chromosome (left)…

Short #2 “Extra”

and its “extra”chromosome (right)

TELOMERE DNA CLOSE-UP

Page 18: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

18

When we turn the “extra”chromosome upside-

down,and try to connect it to

the“short” chromosome, it

onlyFITS one way (left)…

They do NOT fitwhen one telomere istwisted 180

o (right)

NOTICE!

Page 19: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

19

FURTHERMORE…When we lay the fusion area on its side,

we can see more clearly how the DNA sequence

changes at the fusion point.

Reading the top strand only, see:

T T A G G G C C C T A A

Page 20: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

20

THAT’S WHAT YOU WILL BE LOOKING FOR

When you are searching the DNA for the

Fusion Point, you will be lookingat only one strand of DNA

(since the “lower” strand is the predictable

complement of the “upper” strand).Look for something like this:…

ttagggttagggttagggccctaaccctaaccctaa…

Read this like lines of text in a book…Do you see where the multiple g’s (and no c’s) END,

and multiple c’s (and no g’s) BEGIN?

Page 21: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

21

What would this point be called?(where multiple g’s stop, and

multiple c’s begin)

This would be the FUSION POINTRaise your hand when you see that point

in this actual DNA strand below:

On which line does the change happen?

Page 22: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

22

Maybe this will show itmore clearly:

GOT THE PICTURE?

THERE’S the FUSION POINT !

Page 23: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

23

NOW…WHERE should we LOOK

for theFUSION POINT?

YES!Right in the MIDDLE

of our chromosome #2,where the two matching

chimp chromosomesoverlap !

2a

2b

Page 24: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

24

This would be BELOW theCENTROMERE, in the

“q-arm” of the chromosome,in the region known as

“2q13”,shown in red.

(Can you figure out wherethe number “2q13”

comes from?)

2b

2a

Page 25: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

25

For “2q13”…2 = chromosome #2

q = the q-arm1 = region 1 of that arm

3 = sub-part 3 of that region

2b

2a

Page 26: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

26

I have gone to an online DNA databaseand printed out the DNA in that region.You could do this yourself, but, to save

time, I’ve done that for you…

So, where can we see the DNAfrom this region of our

#2 chromosometo examine?

Page 27: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

27

This 2q13 region gives us

52 pages of DNA!

This is what a page looks like…

On this page, thereare 57 lines, each line with

60 bases (letters),and that gives us…

3,420 bases per page!

Page 28: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

28

If these 52 pageswere attached

end-to-end,they would stretchabout 14 meters

(16 yards) aroundyour room!

AND… If ALL the DNA from ourENTIRE #2 chromosomewas printed out like this,

it would stretch about16 km (10 miles)!

Page 29: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

29

By the way…

Each number on the left edge equals the number of the first base (letter)

on that line.

And, a space has been inserted after every 10th base (letter)

to make counting easier.

Page 30: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

30

You may noticewhen you are searching, that

the “ttaggg” patternis not perfect!

An occasional “c”slips in here and there,and you will see other

minor “glitches.”WHY?

If you said“MUTATIONS,”

you would be right.

Page 31: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

31

NOW, it’s YOUR turn! You get to SEARCH those 52 pages!

Are you ready???Just kidding!

Actually, you will formteams of 3-4, and

each team gets thesame 4 pages (from the

“2q13” region)

Page 32: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

32

Each person looks forthat “Fusion Area” on

a different page.

When one of you findsit, show your partners.

Discuss your discovery with your partners, and answer the questions on your “SEARCH” worksheet

One of those 4 pagesshould have the“Fusion Area”

Page 33: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

33

RECAPPROBLEM: How did our #2 chromosome

come to look identical to two chromosomesin chimpanzees”

TEST: Look for fusion evidencein the form of telomere DNA

in the middle of our #2chromosome

PREDICTIONS: If hypothesis is true, we should find two telomeres there;

If NOT true, should be NO telomeres there.

HYPOTHESIS: our #2 chromosome

was formed by the fusion oftwo chromosomes in an

ancestor, after chimps branched off.

Chimp Us

<--Common Ancestor

Fusion?

Page 34: Mystery of the Matching Marks PART 2. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT

34

GOSEARCHfor the

Tell-Tale Telomeres !