Mutational analysis of X-linked amelogenesis imperfecta in multiple families

Mutational analysis of X-linked amelogenesis imperfecta inmultiple families

S. Harta, T. Harta, C. Gibsonb, J.T. Wrightc,*aDepartment of Pediatrics, Section on Medical Genetics, Wake Forest University School of Medicine, Winston-Salem, NC, USA

bDepartment of Anatomy and Histology, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA, USAcDepartment of Pediatric Dentistry, School of Dentistry, CB 7450, University of North Carolina, Chapel Hill, NC 27599-7450, USA

Accepted 8 July 1999

Abstract

Seven mutations in the amelogenin gene are associated with X-linked amelogenesis imperfecta. These mutationscan produce reductions in the amount of enamel and the degree of mineralization. Two families have been identi®ed

from western North Carolina exhibiting features of amelogenesis imperfecta, characterized by brown enamel ina�ected males and interposed vertical bands of normal appearing and brown enamel in presumably heterozygousfemales. Mutational analysis reveals a C±A mutation in exon 6 at codon 41 of the X-chromosomal amelogeningene, resulting in a pro±thr change in all individuals having the amelogenesis imperfecta phenotype. This mutation

was previously reported in a family with X-linked hypomaturation amelogenesis imperfecta. There is no knownrelationship between any of the three families but the presence of similar phenotypes and common mutationssuggests they may be distantly related. For individuals from all three families, the haplotype for six highly

polymorphic loci ¯anking the amelogenin gene was determined. A common haplotype was demonstrated among twoof the three families, suggesting that the mutation may have been inherited from a common ancestor. The ®ndingthat the third family had a distinct haplotype may indicate that the C±A mutation at codon 41 represents a

mutational hotspot that occurs with greater frequency than other known amelogenin gene mutations. Thephenotype resulting from this mutation was highly consistent in a�ected male members of the same family andbetween families. # 2000 Elsevier Science Ltd. All rights reserved.

Keywords: Amelogenin; Mutation; Amelogenesis; Enamel; Hypomaturation

1. Introduction

Amelogenesis imperfecta is a diverse group of her-

editary disorders characterized by developmental

abnormalities in the quantity and/or quality of

enamel in the absence of generalized or systemic

e�ects. It is currently classi®ed into 14 distinct sub-

types, based upon mode of inheritance and clinical

manifestations (Witkop, 1989). The current classi®-

cation relates phenotype to the perceived develop-

mental defect: hypoplastic amelogenesis imperfecta,

secretory defect; hypocalci®ed amelogenesis imper-

fecta, crystallite nucleation defect; hypomaturation

amelogenesis imperfecta, maturation-stage defect.

Archives of Oral Biology 45 (2000) 79±86

0003-9969/00/$ - see front matter # 2000 Elsevier Science Ltd. All rights reserved.

PII: S0003-9969(99 )00106-5

www.elsevier.com/locate/archoralbio

* Corresponding author. Tel.: +1-919-966-8822; fax: +1-

919-966-7992.

E-mail address: [email protected] (J.T.

Wright).

Abbreviations: PAGE, polyacrylamide gel electrophoresis;

PCR, polymerase chain reaction.

Because the pathogenesis of the defective enamel

formation remains unknown and the clinical pheno-types are diverse, the nosology for the amelogenesisimperfecta conditions is problematic and remains

controversial (Aldred and Crawford, 1995).Ultimately, identi®cation of the molecular defects as-sociated with amelogenesis imperfecta will provide

objective diagnostic criteria and insight into theabnormal developmental processes leading to enamel

defects.Both autosomal and X-linked forms of amelogen-

esis imperfecta have been described. Although the

autosomally inherited forms are believed to be themost common, none of their underlying molecular

defects are known. Autosomal-dominant local hypo-plastic amelogenesis imperfecta has been linked tothe 4q21 locus (Forsman et al., 1994). Genetic link-

age has been identi®ed for chromosome Xp22.1-p22.3 (site of the amelogenin locus), and the amelo-genin gene identi®ed as responsible for X-linked

amelogenesis imperfecta in certain families (Lau etal., 1989; Lagerstrom et al., 1990; Collier et al.,

1997). Genetic heterogeneity for X-linked amelogen-esis imperfecta has been reported, with evidence forthe existence of a second amelogenesis imperfecta

locus on the X chromosome at Xq24-q27.1 (Aldredet al., 1992a). To date, seven di�erent mutations in

the amelogenin gene have been described in eightfamilies with X-linked amelogenesis imperfecta (Table1) (Lagerstrom et al., 1991; Aldred et al., 1992b;

Lench et al., 1994; Lench and Winter, 1995; Collieret al., 1997). Only one mutation, a single base-pairdeletion in exon 5, has been reported in more than

one family (Aldred et al., 1992b; Lench et al., 1994).The phenotypes associated with amelogenin gene

defects are variable, with hypoplastic, hypominera-lized and hypomaturation defects all being described(Lagerstrom et al., 1991; Aldred et al., 1992b;

Crawford and Aldred, 1992; Lench and Winter,1995; Collier et al., 1997). In a�ected males, theenamel can be discoloured, range from normal thick-

ness to being extremely thin or pitted, lack a pris-matic structure, and have retention of protein that is

amelogenin-like in composition (Witkop, 1967;Aldred et al., 1992c; Wright et al., 1993; Lench andWinter, 1995; Wright et al., 1998). Heterozygous

(carrier) females typically have enamel with verticalgrooves and ridges or linearly arranged colour

changes as a result of X-chromosome inactivation(lyonization) (Witkop, 1967; Sauk et al., 1972;Wright et al., 1993).

Our purpose now was to identify the gene mu-tation in two di�erent families with a clinically simi-lar form of amelogenesis imperfecta and evaluate the

potential relatedness of families having the same mu-tation.T

able

1

Amelogenin

genemutations

Mutationtype

Mutation

Amelogenin

protein

Phenotype

Reference

Majordeletion

5kbdeletionincludingexon3±6,part

of7

Severelytruncatedifanyproduced

Hypomineralized

Lagerstrom

etal.(1991)

Single-base

deletion

Exon5

Truncatedatresidue74

Hypoplastic-H

ypomineralized

Aldredet

al.(1992)

Deletion9bp

Exon2

Lagerstrom

etal.(1995)

Single-base

substitution

Codon3in

exon5C±T

Thr21Ilu

Hypoplastic

Lench

etal.(1995)

Single-base

deletion

Codon96in

exon6


Hypomineralized

Lench

etal.(1995)

Single-base

substitution

Codon129in

exon6G±T


Hypoplastic

Lench

etal.(1995)

Single-base

substitution

Codon8ofexon6C±A

Pro41Thre

Hypomaturation

Collieret

al.(1997)

S. Hart et al. / Archives of Oral Biology 45 (2000) 79±8680

2. Materials and methods

The University of North Carolina InstitutionalReview Board approved this study and informed con-sent was obtained from all participants. Two families

were identi®ed as having amelogenesis imperfecta anddetailed family histories recorded. Family memberswere examined clinically and radiograpically to deter-

mined a�ected status. Blood was obtained by vene-puncture for genotyping and sequence analysis.

2.1. DNA isolation

Genomic DNA was extracted from peripheral bloodusing a QIAamp blood kit (Qiagen, Santa Clara CA)

according to the manufacturer's protocol.

2.2. Linkage analysis

To test support for/against genetic linkage with thetwo X-linked candidate intervals, genetic linkage was

performed with genetic STRP loci from chromosomeXp (DXS7107, DXS1223, DXS7100 and DXS996) andchromosome Xq (DXS1205, DXS1227, and DXS1232)

for each family. Each family member was genotypedfor each STRP marker using standard techniques forPCR ampli®cation with radioactively labelled, g32P pri-mers according to manufacturer's protocol in a PCR

9600 thermocycler (Applied Biosystems) as previouslyreported (Weissenbach et al., 1992; Hart et al., 1997).Following PCR ampli®cation, individual samples were

separated on a 6% PAGE urea gel (30 W, 1500 V).An M13 sequencing ladder (Sequenase kit, USB) wasloaded on to each gel to permit sizing of individual

alleles. Following electrophoresis, gels were wrapped incellophane, exposed in a phosphorimaging cassette andscanned (Molecular Dynamics, Inc.). Alleles were

scored and genotype data entered into a pedigree ®le

using Excel. LOD scores were generated assuming X-linked inheritance and an a�ected allele frequency of0.0001. Marker allele frequencies were assumed to beuniformly distributed. Calculations were also per-

formed using marker allele frequencies reported inavailable databases, but these changes had minimale�ects on LOD scores calculated. Two-point linkage

analysis was performed by use of the MLINK pro-gram version 5.1 from the LINKAGE computer pro-gram as previously described (Lathrop et al., 1986,

Hart et al., 1997). Precise values for maximum LODscores were calculated with the ILINK program fromthe same computer package.

2.3. PCR ampli®cation

The primers shown in Table 2 were used to amplify

the amelogenin gene from a�ected and control individ-uals. Primers Am 5±Am 10 are the same as primersAM1±AM6 described by Lagerstrom et al. (1991).

Primers Am 1±Am 4, Am 11, Am 12 were designedusing the Oligo program and synthesized using theGeneAssembler DNA synthesizer (Pharmacia,

Pistcataway NJ). Each product was ampli®ed by stan-dard methodology. In brief, PCR mixtures contained30 ng of DNA and 0.2 mM each of the sense and anti-sense primers speci®c for each exon in the presence of

10 mM Tris, pH 8.3, 1.5 mM MgCl2, 50 mM KCl,0.01% (w/v) glycerol, 50 mM dNTP, and 0.5 U TaqGold polymerase. Thermocycling pro®les were 958Cfor 1 min followed by annealing at 558C for 1 min, fol-lowed by extension for 30 s at 728C, for 30 cycles.Following ampli®cation, the products were electro-

phoresed through a 1% agarose gel containing ethi-dium bromide. The separated products were visualizedby illumination with ultraviolet light.

Table 2

Primers used to evaluate the amelogenin gene

Primer Sequence (5 '±3 ') Product (bp) Exon

Am 1 AGCGTGATGAAACTCTTT 1751 1

Am 2 GGTCCCATTTCTTGATG

Am 3 TGGGGACCTGGATTTTATTT 1878 2

Am 4 CAGGGTGCCCAGGATGAGGT

Am 5 AGGAGCTCCAGCCATAAGGCTATAACC 840 3

Am 6 GGCTCGAGGTTGAGGAGAACCTCAAAC

Am 7 ATACCCGGGTTTGAGGTTCTCCTCAAC 1230 4,5

Am 8 ATCCCGGGTACTGGTGAGAAACAGAGA

Am 9 ACAGCTGGTTGGAGTCACCTGAGCCAAT 935 6

Am 10 TCGACTACCTTTGTAGCCTGTTCAG

Am 11 ACGGGAAATCTCTTCAAAAA 1290 7

Am 12 TTCCCCTCTCATCTTCTGAT

S. Hart et al. / Archives of Oral Biology 45 (2000) 79±86 81

Fig. 1. Pedigrees of the two families show segregation of the amelogenesis imperfecta trait that is consistent with X-linked inheri-

tance. The haplotype analysis for families AIC17 and AIC23L and the family (family S) reported by Collier et al. (1997) are shown

with the microsatellite markers used in the analysis.


2.4. DNA sequencing

The sense and antisense strand of each PCR product

were directly sequenced in a Prism 377 DNA sequencer(Perkin Elmer), using dye-dideoxynucleotide chemistry.Primer (4 pmol) and product (50±125 ng) were added

to premixed reagents from the Prism Big DyeTerminator Cycle Sequencing Ready Reaction kit(Perkin Elmer) and underwent cycle sequencing in a

GeneAmp PCR 2400 (Perkin Elmer) thermocycler. Thelinear ampli®cation consisted of a 2-min denaturationat 968C, 5-s annealing at 508C, and 4-min extension at608C. The ¯uorescently labelled sequencing products

were separated from residual reaction products using aCentri-Sep spin column (Princeton Separations,Adelphia NJ) and electrophoresed on a 5% Long

Ranger polyacrylamide gel (FMC Bioproducts,Rockland ME) at 1680 V for 8 h. Sequencing datawere automatically collected and analysed by the

Prism 377 software.

2.5. Haplotype analysis

Haplotypes were constructed by genotyping ¯anking

microsatellite markers: DXS8051, DXS7103,DXS1060, DXS1043, DXS7108, and DXS7104.Individuals were genotyped for each marker using

standard techniques for PCR ampli®cation with radio-actively labelled primers, electrophoresis and radiogra-phy as described above.

3. Results

None of the family members investigated was found

Fig. 2. All a�ected males had teeth that were brown grading to a more normal, white opaque colour in the cervical third.

Fig. 3. All dentate females with the pro41thr AMELX mu-

tation displayed yellow±brown or opaque white mottling

(arrows) of their natural teeth.


to have signs or symptoms of systemic or generalized

conditions associated with enamel defects. Segregation

of the amelogenesis imperfecta trait in these families

was consistent with an X-linked mode of inheritance

(Fig. 1). The dental phenotype was essentially the same

in both families. All a�ected males showed a general-

ized brown discoloration of both the primary and per-

manent dentitions, with all teeth being a�ected (Fig.

2). Enamel in the cervical fourth of the permanentteeth typically appeared whiter than the coronal por-

tion of the crowns. The teeth were generally of normalsize and morphology. Individuals having the pro41thrmutation did not display normal-coloured enamel nor

did any family members not having the mutation exhi-bit enamel defects. Females that were heterozygous forthe pro41thr AMELX mutation showed variable dis-

coloration of the dentition, with areas of normalappearing enamel interposed with zones of yellow±brown enamel (Fig. 3).

Linkage analysis indicated several recombinant indi-viduals from each family for the chromosome Xq locitested, suggesting a gene in this genetic interval wasnot responsible for amelogenesis imperfecta in these

families. Genotype data for the markers on Xp wereconsistent with genetic linkage, with no evidence ofmeiotic recombination. Thus, we proceeded with muta-

tional analysis of the amelogenin gene. The primersshown in Table 2 were used to amplify the amelogeningene from a�ected and una�ected family members

(control). Analysis of PCR ampli®cation productsfrom a�ected individuals revealed products of theappropriate size (data not shown). Thus, gross altera-

tions (deletions or insertions) in the amelogenin genedo not account for amelogenesis imperfecta in thesetwo families. Sequence analysis of exon 6 using primerNo. 9 revealed a C±A mutation at codon 8 of exon 6

(Fig. 4), a mutation previously reported by Collier etal. (1997). This mutation results in a highly conservedproline residue being replaced by a threonine residue.

No mutations were found in the remaining exons.Haplotype analysis of the two North Carolina

families presented in this report and the family (family

S) reported by Collier et al. (1997), demonstrated thatfamily AIC23 had a distinct haplotype compared tothe other two families (Fig. 1). Families S and AIC17share a common haplotype, although the a�ected

grandmother in AIC17 was homozygous at DXS7108and DXS7104, making those markers uninformative.

4. Discussion

Two North Carolina families have been identi®edwith X-linked amelogenesis imperfecta resulting fromthe same mutation in the X-chromosomal amelogenin

gene, a C±A mutation in exon 6 that results in a con-served proline residue being replaced by a threonineresidue. Interestingly, this mutation is the same as that

reported by Collier et al. (1997). The phenotype in allthree families is virtually identical, with all males hav-ing brown teeth of relatively normal morphology. The

heterozygous females have variable expression of thetrait, consistent with lyonization (Witkop, 1967).Identi®cation of an identical and rare mutation in

Fig. 4. DNA sequence analysis of exon 6 of the amelogenin

gene using primer No. 9 (shown in Table 2). WT, wild-type

sequence; individual 46 (the mother of individual 45) from

family AIC23L. The arrow indicates the site of the mutation

that results in a conserved proline residue being replaced by a

threonine residue in males and females from the two North

Carolina families. AIC23L-46 is an a�ected female (mother

of-45) showing both the wild-type and mutant sequence.

AIC23L-45 is an a�ected male showing only the mutant

sequence. AIC17-16 is an a�ected male from a second North

Carolina family showing the same pro41thr AMELX mu-

tation.


three di�erent families suggests that they might be dis-

tantly related and that a�ected family members haveall inherited the same mutated amelogenin gene from acommon ancestor, although family histories do not

con®rm this. Alternatively, the common mutationobserved at this position of the X-chromosomal amelo-genin gene might represent a mutational hotspot.

Haplotype analysis was used in an attempt to deter-mine if the three families were in fact related. Based

upon the haplotype data, family AIC23 does notappear to be related to the other two families, butrelatedness between the family reported by Collier et

al. (1997) and family AIC17 could not be excluded onthe basis of haplotype analysis. One di�culty in using

¯anking markers to establish relatedness is the lack ofresolution between the physical and genetic maps.Examination of intragenic polymorphisms may be a

better method of determining relatedness. Given thatat least two of the families do not appear related toeach other, this position of the amelogenin gene

(codon 8 of exon 6) may represent a mutational hot-spot in the amelogenin gene.

This investigation identi®es only the second mu-tation in the amelogenin gene that has been describedin more than one family. Two families in the United

Kingdom have been identi®ed with the same single-base deletion in exon 5 (Aldred et al., 1992b; Lench

and Brook, 1997). Although a variety of mutationshave been described in the amelogenin gene, thereappears to be a relatively limited number of di�erent

mutations occurring in this highly conserved gene. Theacquisition and analysis of additional amelogenesisimperfecta families with X-linked inheritance is needed

to determine whether as yet unidenti®ed amelogeningene defects exist.

The dental phenotype associated with the amelo-genin gene mutation identi®ed in the North Carolinafamilies has been traditionally classi®ed as hypoma-

turation amelogenesis imperfecta (Witkop, 1967;Collier et al., 1997). This implies a defect in the matu-

ration stage of enamel development. Collier et al.(1997) suggested that change of the highly conservedproline at position 41 to a threonine might interfere

with two important proteolytic cleavage sites in proxi-mity to that amino acid. The enamel in all malesdescribed to date with this mutation appears markedly

brown, suggesting the possibility of protein retentionand defective mineralization. Previous biochemical stu-

dies of enamel from the North Carolina and Collierfamilies show retention of protein having an amelo-genin-like composition (Wright et al., 1998). The

amount of protein in these teeth is only slightly morethan in normal enamel, indicating that the majority ofamelogenin protein is indeed removed during enamel

development. However, retention of even smallamounts of amelogenin could signi®cantly alter crystal-

lite growth and enamel mineralization during thematuration stage of development, leading to the phe-

notype observed in these families. Recently, the regionof the amelogenin protein a�ected by the pro41thr mu-tation has been identi®ed as a tyrosyl motif that binds

N-acetyl-D-glucosamine (GlcNAc) and may be import-ant in the interaction between amelogenin and enamelmatrix glycoproteins (Ravindranath et al., 1999).

Analysis shows that this mutation results in a loss ofGlcNAc binding with amelogenin, potentially provid-ing another important pathological mechanism that

would result in altered enamel formation(Ravindranath et al., 1999).Consistency of the amelogenesis imperfecta pheno-

type seen in all three families with the pro41thr amelo-

genin defect is of diagnostic importance and suggeststhat individuals presenting with this clinical phenotypeshould be screened for this mutation. Detailed geno-

type±phenotype studies may help clarify the as yetpoorly de®ned role of amelogenin in enamel formation.The elucidation of the underlying mutation in ad-

ditional families with X-linked amelogenesis imperfectawill be helpful in determining the extent to which suchgenotype±phenotype correlations can be made. The

cumulative reports of amelogenin mutations to datesuggest that there are relatively few allelic mutations inthis gene that is critical for normal enamel formation.

References

Aldred, M.J., Crawford, P.J.M., 1995. Amelogenesis imper-

fecta-towards a new classi®cation. Oral Dis. 1, 2±5.

Aldred, M.J., Crawford, P.J.M., Roberts, E., Gillespie, C.M.,

Thomas, N.T., Fenton, I., Sandkuijl, L.A., Harper, P.S.,

1992a. Genetic heterogeneity in X-linked amelogenesis

imperfecta. Genomics 14, 567±573.

Aldred, M.J., Crawford, P.J.M., Roberts, E., Thomas,

N.S.T., 1992b. Identi®cation of a nonsense mutation the

amelogenin gene (AMELX) in a family with X-linked ame-

logenesis imperfecta (AIH1). Hum. Genet. 90, 413±416.

Aldred, M.J., Crawford, P.J.M., Rowe, W., Shellis, R.P.,

1992c. Scanning electron microscopic studies of deciduous

teeth in X-linked amelogenesis imperfecta. Journal Oral

Pathology Medicine 21, 186±190.

Collier, P.M., Sauk, J.J., Rosenbloom, J., Yuan, Z.A.,

Gibson, C.W., 1997. An amelogenin gene defect associated

with human x-linked amelogenesis imperfecta. Archs. Oral

Biol. 42, 235±242.

Crawford, P.J.M., Aldred, M.J., 1992. X-linked amelogenesis

imperfecta. Presentation of two cases and review of the lit-

erature. Oral Surgery, Oral Medicine, Oral Pathology 73,

449±455.

Forsman, K., Lind, L., Backman, B., Westermark, E.,

Holmgren, G., 1994. Localization of a gene for autosomal

dominant amelogenesis imperfecta (ADAI) to chromosome

4q. Human Mol. Genet. 3, 1621±1625.

Hart, T.C., Bowden, D., Bolyard, J., Kula, K., Hall, K.,


Wright, J.T., 1997. Genetic linkage of the tricho-dento-oss-

eous syndrome to chromosome 17q21. Hum. Mol. Genet.

6, 2279±2284.

Lagerstrom, M., Dahl, N., Iselius, L., Backman, B.,

Pettersson, U., 1990. Mapping of the gene for X-linked

amelogenesis imperfecta by linkage analysis. Am. J.

Human Genet. 46, 120±125.

Lagerstrom, M., Dahl, N., Nakahori, Y., Nakagome, Y.,

Backman, B., Landegren, U., Pettersson, U., 1991. A

deletion in the amelogenin gene (AMG) causes X-

linked amelogenesis imperfecta (AIH1). Genomics 10,

971±975.

Lathrop, G.M., Lalouel, J.M., White, R.L., 1986.

Construction of human genetic linkage maps: likelihood

calculations for multilocus analysis. Genet. Epidemiol. 3,

39±52.

Lau, E.C., Mohandras, T.K., Shapiro, L.J., Slavkin, H.C.,

Snead, M.L., 1989. Human and mouse amelogenin gene

loci are on the sex chromosomes. Genomics 4, 162±168.

Lench, N.J., Brook, A.H., 1997. DNA diagnosis of X-linked

amelogenesis imperfecta (AIH1). J. Oral Pathol. Med. 26,

135±137.

Lench, N.J., Brook, A.H., Winter, G.B., 1994. SSCP detec-

tion of a nonsense mutation in exon 5 of the amelogenin

gene (AMGX) causing X-linked amelogenesis imperfecta.

Human Mol. Genet. 3, 827±828.

Lench, N.J., Winter, G.B., 1995. Characterisation of molecu-

lar defects in X-linked amelogenesis imperfecta (AIH1).

Human Mut. 5, 251±259.

Ravindranath, R.M.H., Moraidan-Oldak, J., Fincham, A.G.,

1999. Tyrosyl motif in amelogenins binds N-acetyl-D-glu-

cosamine. J. Biol. Chem. 274, 2464±2471.

Sauk, J., Lyon, H., Witkop, C.J., 1972. Electron optic microa-

nalysis of two gene products in enamel of female heterozy-

gous for X-linked hypomaturation amelogenesis

imperfecta. Am. J. Human Genet. 24, 267±276.

Weissenbach, J., Gyapay, G., Dib, C., Vignal, A., Morissette,

J., Millasseau, P., Vayseix, G., Lathrop, M., 1992. A sec-

ond-generation linkage map of the human genome. Nature

359, 794±801.

Witkop, C.J., 1967. Partial expression of sex-linked amelogen-

esis imperfecta in females compatible with the Lyon hy-

pothesis. Oral Surgery, Oral Medicine, Oral Pathology 23,

174±182.

Witkop, C.J., 1989. Amelogenesis imperfecta, dentinogenesis

imperfecta and dentin dysplasia revisited, problems in

classi®cation. J. Oral Pathol. 17, 547±553.

Wright, J.T., Aldred, M.J., Crawford, P.J.M., Kirkham, J.,

Robinson, C., 1993. Enamel ultrastructure and protein

content in X-linked amelogenesis imperfecta. Oral Surg.

Oral Med. Oral Pathol. 76, 192±200.

Wright, J.T., Fleming, E.R., Ravassipour, D.B., Gibson, C.,

1998. Amelogenin gene mutation results in enamel compo-

sitional and structural changes. J. Dent. Res. 77 (SI), 977.


Documents

Mutational analysis of X-linked amelogenesis imperfecta in multiple families