HUMAN MUTATION 8:262-264 (1996)

MUTATION IN BRIEF

Mutation Analysis of Phenyketonuria in South Brazil Belen Perez, Lourdes R. Desviat, Marisel De Lucca, Benjamin Schmidt, Nicole Loghin-Grosso, Roberto Giugliani, Ricardo F. Pires, and Magdalena Ugarte’ Centro de Biologia Mokcular “Sever0 Ochoa” CSIC-UAM. Univewdad Authoma de Madnd, 28049 Mad&, Spain (B.D., L. R. D., M. D. L., M. U. ), APAE, Sao Pado (B. S., N.L. -G.) and Hospital de Clinicas de Porto Akgre, Purto Akgre (R. G., R. F. P. ) , Brazil; Fax: 34 1-7347797

Communicated by Charles R. Scriver

INTRODUCTION

Phenylketonuria (PKU) is caused by a defi- ciency of the liver-specific enzyme phenylalanine hydroxylase (PAH). PKU is highly heterogeneous; to date, > 170 different mutations in the PAH gene have been described associated with different geographical and ethnic groups. Extensive popula- tion genetics studies in Europe and Asia have re- vealed the existence of some major mutations on the background of specific RFLP haplotypes, prob- ably each arising from a single founding event (Eisensmith et al., 1992a; Okano et al., 1992). However, relatively little is known about the mo- lecular basis of PKU in Central and South Amer- ica. Recently, we reported on the identification of the Mediterranean mutation IVS lOnt546 in high frequency in Chile, Argentina, and Mexico (Perez et al., 1993).

The neonatal mass screening program for PKU in Sao Paulo was established in June 1976. The frequency calculated for classical PKU is 1/10,900 newborns (PCrez et al., 1994a). In Porto Alegre, the frequency of classical PKU has been described as 1/12500 (Jardim et al., 1994). The population in Brazil is highly heterogeneous. In South Brazil there is a high proportion of Western European descendents (mostly Iberians and also Germans and Italians). In order to investigate the molecular basis of PKU in South Brazil, we have screened 79 patients from Sao Paulo and 17 from Porto Alegre for the most frequent mutations in Europe. We have analyzed the three most common mutations described in the Iberian peninsula (IVSlOnt546, I65T, and V388M) (Perez et al., 199413; Leandro et al., 1994) and also the two prevalent mutations in North and Eastern Europe (IVS12ntl and R408W) (Eisensmith et al., 1992a). With this

0 1996 WILEY-LISS, INC.

analysis, we have identified 35-40% of the mutant alleles in the two defined samples. The results re- veal an underlying stratification of the PKU alleles in South Brazil. The present study gives further insight into the genetic basis of PKU in Latin America and provides evidence that mutant PAH alleles can be used as migration traces.

MATERIALS AND METHODS

The study included 96 unrelated PKU patients from South Brazil, 79 from Sao Paulo, and 17 from Porto Alegre. We have evidence of consanguinity among parents only in four patients from Porto Alegre. The source of DNA was dried blood spots from routine screening and follow-up. In Sao Paulo, the screening is universal. The samples from Porto Alegre do not come from universal screening and may not be representative of the demographic profile of this region.

The IVSlOnt546 and V388M mutations were detected by digestion of amplified exon 11 with DdeI and BsaAI, respectively. I65T was detected by TaqI digestion after creating the restriction site in the amplification (ACRS). The primer used to create the target was 5‘ AACGAGAAGGTCTA- GATTCG 3’. The primers and PCR conditions have been described previously (Perez et al., 1993). In some cases a multiplex PCR was per- formed to amplify both exons 3 and 11 of the PAH gene. Exon 12 was amplified with a 5’ primer (5’CGTAAGGTGTAAATTACGTA 3’), which creates an RsaI site used to detect the IVSl2ntl mutation. The R408W mutation was detected by

Received April 3, 1995; accepted April 28, 1995. *To whom reprint requestsicorrespondence should be ad-

dressed.

PHENYLKETONURIA IN SOUTH BRAZIL 263

TABLE 1. Relative Frequencies (positive alleles/n, total alleles studied) and Associated Haplotypes of the Five PKU

Mutations Screened for in Sao Paulo and Porto Alegre' Relative frequency (X)

Sao Paulo Porto Alegre Mutation Haplotype (n = 158) (n = 34) IVSlOnt546 6.7, non-6 16 0 165T 9.8 5 20 V388M 1.7 9 6 R408W 2.3 2 6 IVS 12nt 1 3.8 2.5 6

'Siblings with identical PAH genotype were regarded as one pa- tient. The haplotypes were defined taking into account the poly- morphisms examined and the most frequent mutation-haplotype associations.

digestion of exon 12 with Sty I. The standard xz test was used to compare the frequencies of the mutations in the two samples studied.

RFLP haplotypes (Eisensmith and Woo, 199213) were studied in patients completely genotyped. The RFLP analysis was performed by PCR and resnic- tion enzyme digestion (for BglII, PvuII(a), PvuII( b), MspI, and XmnI polymorphisms), and PCR and electrophoretic examination of the VNTR alleles in the 3' end of the PAH gene (Goltsov et al., 1992). Only dried blood spots from the proband and in some cases from the family were available, excluding the examination of the EcoRI and EcoRV polymorphisms. The haplotypes were defined taking into account the polymorphisms ex- amined and the most frequent mutation-haplotype associations described in other populations.

RESULTS

A total of 79 unrelated PKU patients from Sao Paulo and 17 from Porto Alegre were screened for IVSlOnt546, I65T, V388M, R408W, and IVSl2ntl. The results are summarized in Table 1.

In Sao Paulo we found four patients homozygous for IVSlOnt546, one for I65T, and two for V388M. The rest of the patients were heterozygous for one of the five mutations. We have identified - 35% of the total mutant alleles.

In Port0 Alegre we found two homozygous pa- tients for I65T, one of them born to consanguin- eous parents. The rest of the patients were het- erozygous for one of the five mutations. All the patients bearing R408W and IVSlZntl were of German and Polish descent. In patients with I65T, Portuguese (two cases) or German (three cases), ancestry could be demonstrated. In this small group of patients, we defined close to 40% of the mutant chromosomes.

In the homozygous patients and also in those heterozygous for two of these five mutations, we

analyzed the haplotype associations. The results are summarized in Table I. We detected two chro- mosomes with nonhaplotype 6 in an homozygous patient for IVS 10nt546. The haplotype sequence was (- + + ND + - - ND). EcoRI and EcoRV polymorphisms could not be determined (ND).

DISCUSSION In this first genetic analysis of the Brazilian PKU

population, we screened 158 mutant alleles from Sao Paulo and 34 from Porto Alegre for IVSlOnt546, I65T, and V388M, frequent in the Iberian peninsula, and IVS12ntl and R408W, the two most common mutations in North and Central Europe (Eisensmith et al., 1992a; Leandro et al., 1994; Perez et al., 1994b). The homozygosity rate in both populations is < 12%, which appears to be lower than the average European rate of - 25%. The different mutation frequencies observed in Sao Paulo and Porto Alegre could be due to a number of factors. In Porto Alegre, the mutation frequencies are relative, because of the small size of the sample analyzed. Moreover, in Sao Paulo, the patients come from universal screening so the in- formation obtained is representative of the demo- graphic profile. There are also differences in the geographic origins of the European ancestors in these two groups of probands.

The most common PKU mutation found in Sao Paulo, IVSlOnt546, which is also found in high frequency in other Latin American countries (Perez et al., 1993), is absent in Porto Alegre. The x2 (6.1847) test estimated between these two samples is significant (O.Ol<P<O.O2). IVSlOnt546 is the prevalent Mediterranean mutation and is infre- quent in the rest of Europe (Eisensmith and Woo, 1994; Leandro et al., 1994). The high proportion of German, Polish, and Portuguese descendents in Porto Alegre could explain these results. This could also account for the higher frequency of I65T, R408W and IVS12ntl observed in Porto Alegre.

IVSlOnt546 was found associated with hap- lotype 6.7 and with a different haplotype that could correspond to haplotype 39 or 60. The IVSlOnt546 mutation has been described on other nonhaplotype 6 chromosomes such as haplotypes 10, 36 (Dworniczak et al., 1991) or 34 (Tyfield et al., 1993), which may have originated from hap- lotype 6 by recombination events or point muta- tions. In this case, the association of IVSlOnt546 with haplotype 39 or 60 could be explained by a single recombination event occurring between the PvuIIa and PvuIIb sites of the mutant haplotype 6.7 and the corresponding normal haplotype.

264 PERUETAL.

Up to now, the second most frequent mutation in Sao Paulo is V388M, which has been described in 17% of the mutant alleles in Portugal (Leandro et al., 1994) and 8% of the mutant alleles in Spain (Perez et al., 1994b). In Spain V388M is associ- ated with haplotype 1.7. In Brazil, all the chromo- somes with V388M were found on the background of haplotype 1.7. In those cases where the RFLP haplotypes could not be determined, the chromo- somes bearing V388M were associated to the seven repeats VNTR allele. According to these data, V388M would have migrated to Brazil with Portu- guese and Spanish settlers. In other Latin Ameri- can countries, V388M also has been detected on other haplotype backgrounds, with presumably a different origin (Desviat et al., 1995).

The frequency of the I65T mutation in Sao Paulo and in Porto Alegre is significantly different (x2 = 9.3637, O.OOl<P<O.O05). Consanguinity appears not to be the reason for this high frequency in Porto Alegre. Only one patient homozygous for I65T was consanguineous. There are other factors such as genetic drift that could account for it. We cannot exclude a biased ascertainment of the cases as the sample analyzed is small and does not come from universal screening. To date, I65T has been detected in high frequency in Spain (Perez et al., 1994b), Ireland (Zschocke et al., 1994), and En- gland (Tyfield et al., 1993), but is infrequent in other European countries, and the origin of the mutation is yet unclear. The patients from Porto Alegre with I65T have German ancestry, which contrasts with the very low frequency of this mu- tation reported in Germany (Treacy et al., 1993).

The association between mutations and haplo- types found in this study reflects the European or- igin of the PKU mutations identified, further dem- onstrated by genealogical data. These mutations with a clear founder effect in specific European regions spread to the New World in various waves of human migrations. The distribution of the prev- alent mutations provide evidence for genetic strat- ification. Considering the complex ethnic mixture of the Brazilian population, the PKU mutation fre- quencies will vary in each region, depending on the demographic profile.

ACKNOWLEDGMENTS

We thank Drs. T.M. Carvalho, P. Vargas, and M.M.R. Costa from Sao Paulo and L. Bannach Jardim from Porto Alegre for providing informa- tion on the patients, and L. Perez for her help with statistics. The financial support of the Fundacidn Ram& Areces to the Centro de Biologia Molecu-

lar “Severo Qchoa” is gratefully acknowledged. This work was supported by grant (SAF-93-0076) from the CICYT (Comisibn Interministerial de Ciencia y Tecnologia).

REFERENCES Desviat LR, Perez B, De Lucca M, Cornejo V, Schmidt B, Ugarte

M (1995) Evidence in Latin America of recurrence of V388M, a phenylketonuria mutation with high in vitro residual activ- ity. Am J Hum Genet 57:337-342.

Dworniczak B, Aulehla-Scholz C, Kalaydjieva L, Bartholome K, Grudda K, Horst J (1991) Aberrant splicing of phenylalanine hydroxylase mRNA: The major cause for phenylketonuria in parts of Southern Europe. Genomics 11:242-246.

Eisensmith RC, Okano Y, Dasovich M, Wang T, Guttler F, Lou H, Guldberg P, Lichter-Konecki U, Konecki DS, Svensson E, Hagenfeldt L, Rey F, Munnich A, Lyonnet S, Cockburn F, Connor JM, Pembrey ME, Smith I, Gitzelmann R, Steinmann B, Apold J, Eiken HG, Giovannini M, Riva E, Longhi R, Romano C, Cerone R, Naughten ER, Mullins C, Cahalane S, &alp 1, Fekete (3, Schuler D, Berencsi GY, NBsz I, Brdicka R, Kamaryt J , Pijackova A, Cabalska B, Boszkowa K, Schwartz E, Kalinin VN, ]in L, Chakraborty R, Woo SLC (1992a) Multi- ple origins for phenylketonuria in Europe. Am J Hum Genet

Eisensmith RC, Woo SLC (1992b) Updated listing of haplotypes at the human phenylalanine hydroxylase (PAH) locus. Am J Hum Genet 51: 1445-1448.

Eisensmith RC, Woo SLC (1994) Population genetics of phe- nylketonuria. Acta Pediatr Suppl407: 19-26.

Goltmv AA, Eisensmith RC, Konecki DS, Lichter-Konecki U, Woo SLC (1992) Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene. Am J Hum Genet 51:627-636.

Jardim LB, Giugliani R, Coelho JC, Dutra-Filho, Blau N (1994) Possible high frequency of tetrahydrobiopterin deficiency in South Brazil. J Inh Metab Dis 17:223-229.

Leandro P, Rivera 1, Ribeiro V, Tavares de Almeida I, da Silveira C, Lechner MC (1995) Mutation analysis of phenylketonuria in South and Central Portugal: Prevalence of V388M muta- tion. Hum Mutat 6:192-194.

Okano Y, Hase Y, Lee DH, Furuyama JI, Shintaku H, Oura T, Isshiki G (1992) Frequency and distribution of phenylketo- nuria mutations in Orientals. Hum Mutat 1:216-220.

P&ez B, Desviat LR, Die M, Cornejo V, Chamoles NA, Nicolini H, Ugarte M (1993) Presence of the Mediterranean PKU mu- tation IVSlO in Latin America. Hum Molec Genet 2:1289- 1290.

Perez B, Desviat LR, De Lucca M, Carvalho P, Vargas P, costa MMR, Loghin-Orom N, Schmidt, Ugarte M (1994a) Mass screening of PKLl in Sao Paul0 and analysis of IVSlO mutation. VI International Congress on Inborh Errors of Metabolism, Milan, Italy.

Perez B, Desviat LR, Ugarte M (1994b) Spectrum and origin of PKU mutations in Spain. Acta Paedriat Suppl407:34-36.

Treacy E, Byck S, Clow C, Scriver CR (1993) ‘Celtic’ phenylke- tonuria chromosomes found? Evidence in two regions of Que- bec. Eur J Hum Genet 1:220-228.

Tyfield LA, Osborn MJ, King SK, Jones MM, Holton JB (1993) Molecular basis of phenylketonuria in the English population. Dev Brain Dyshnct 6:60-67.

Zschocke J, Graham CA, Stewart FJ, Carson DJ, Nevin NC (1994) Automated sequencing detects all mutations in North- ern Irish patients with phenylketonuria and mild hyperphe- nylalaninemia. Acta Pediatr Suppl 407:37-38.

51:1355-1365.