Mutagens and their actionsMutagens and their actions

Chan Ho Yin, Aurora (02690763)Chen Yiwei, Echo (01790443)Co Ngai Na, Chloe (02715283)Lam Kit Ming, Germaine (02770293)

MutationSpontaneous Mutation & Induced Mutation

MutagenChemical MutagensRadiationBiological Mutagens

Conclusion

Introduction Introduction

The process that produces an inheritable alteration in

DNA StructureChromosome Structure

There are two types of mutationsSpontaneous MutationInduced Mutation

MutationMutation

Spontaneous MutationSpontaneous MutationNatural error during DNA replication or recombinationCaused by background radiationArise randomly as a result in cellsNO ARTIFICIAL TREATMENT

Spontaneous Mutation vs. Induced MutationSpontaneous Mutation vs. Induced Mutation

Spontaneous Mutation vs. Induced MutationSpontaneous Mutation vs. Induced Mutation

Induced MutationInduced MutationCaused by exposure to known mutagenic agents

-- Mutagens

MutagenMutagen

A natural or human-made agent which can alter the structure or sequence of genetic material and induce

Mutation

There are three main types ofmutagens classifying by their sources

Chemical MutagensRadiationBiological Mutagens

• Transposable element

• Ionizing Radiation

• UV Radiation

• Base analogs• Chemical

modification agents

• Intercalating agents

BiologicalMutagensRadiationChemical

Mutagens

Chemicals structurally resemble normal bases, purines and pyrimidinesIncorporate into DNA during replicationLead to incorrect insertion of nucleotides opposite them in replication

Chemical Mutagens -Base analogs

5-Bromouracil (5-BU)

2-Aminopurine (2-AP)

For Example

resembles Thymine (T) has Br atom at C-5 instead of methyl group as in T can incorporate into DNA and pair with either A or G due to tautomerization

5-Bromouracilanalog of a pyrimidine

* TAUTOMERIZATION – spontaneous structural alternations between 2 forms, keto form and enol form

5-Bromouracilanalog of a pyrimidine

Mechanism of 5-Bromouracil

Mechanism of 5-Bromouracil

Mechanism of 5-Bromouracil

Mechanism of 5-Bromouracil

Chemicals which alter structure and pairing properties of normal basesActive on both replicating and non-replicating DNAResult in mutation upon DNA replication by forming baseless sites or mispairTwo common chemical modification agents

Alkylating agentsDeaminating agents

Chemical Mutagens-Chemical Mutagens-Chemical modification agentsChemical modification agents

Modify the normal bases by adding alkyl groupsCommon alkylating agents

Ethylmethane sulfonate (EMS) Nitrosoguanidine (NG)Di-(2-chloroethyl) sulfide (Sulfur mustard)Di-(2-chloroethyl) methylamine (Nitrogen mustard)

Alkylating agentsAlkylating agents

Ethylmethane sulfonate (EMS)

Alkylating agentsAlkylating agents

Ethylate base’s 7-N & 6-O positions

Mechanism ofMechanism ofEthylmethane sulfonate (EMS)Ethylmethane sulfonate (EMS)

Ethylate base’s 7-N & 6-O positions

Mechanism ofMechanism ofEthylmethane sulfonate (EMS)Ethylmethane sulfonate (EMS)

Oxidative deamination of amino group in Adenine (A), Guanine (G) and Cytosine (C)

Deaminating agentsDeaminating agents

Nitrous acid (HNO2) is one of common deaminating agents

Convert the amino group (-NH2) into ketogroup (=O)Change H-bonding potential of the modified bases

Deaminating agentsDeaminating agents

Adenine (A) → Hydroxanthine

Mechanism of Nitrous acidMechanism of Nitrous acid

Cytosine (C) → Urail

Mechanism of Nitrous acidMechanism of Nitrous acid

Guanine (G) → Xanthine

Mechanism of Nitrous acidMechanism of Nitrous acid

A group of aromatic organic moleculesRoughly the same dimensions as a nitrogenous base pairIntercalate or wedge between the base pair

Chemical Mutagens-Intercalating agentsChemical Mutagens-Intercalating agents

Cause addition or deletion of base pairs of intact DNAAlter reading frame of gene Result in non-functional gene product

Chemical Mutagens-Intercalating agentsChemical Mutagens-Intercalating agents

Mechanism of Intercalating agents

Mechanism of Intercalating agents

Mechanism of Intercalating agents

Mechanism of Intercalating agentsCommon intercalating agents

2,8-Diamino acridine (proflavin)Acridine orange

Ionising radiatione.g. x rays, γrays,

cosmic rays

Non-ionising radiatione.g. UV radiation

Physical MutagensPhysical Mutagens

Natural Sources:Sunlight, outer space

Artificial Sources:Medical diagnostic, powerplant

Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)

MechanismProduction of highly reactive free radicals (OH• radicals)Interaction between the radicals and DNA, proteins, lipids in cell membrane etc.

Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)

EffectsOrganelle failureCell division blockageCell death

Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)

Breaks in one or both strands(can lead to rearrangements, deletions, chromosome loss death if unrepaired)

Damage to/loss of bases (mutation)

Crosslinking of DNA to itself or proteins

Interaction with DNAInteraction with DNA

Interaction with DNAInteraction with DNA

CATCACCTGTACCAGTAGTGGACATGGT

deletion

CATTCACCTGTACCAGTAAGTGGACATGGT

normal sequence

Base pair mutation

Take UV radiation as an exampleIts wavelengths are preferentially absorbed by bases of DNA and by aromatic amino acids of proteins

Normally classified in terms of its wavelengths:UV-A, UV-B, UV-C (in decreasing order of wavelengths)

Non-Ionizing RadiationNon-Ionizing Radiation(Less energy, Non-penetrating)(Less energy, Non-penetrating)

Non-Ionizing RadiationNon-Ionizing Radiation(Less energy, Non-penetrating)(Less energy, Non-penetrating)

MechanismFormation of Thymine dimers

These dimers cause the strand to buckle, disrupting normal base pairing

Prevent normal replication and transcription

Formation of Thymine-thymine dimer

Transposable element

Insertions result in dysfunction of genes

Common biological mutagensRubella virusCytomegalovirusHepatitis B virus

Biological MutagensBiological Mutagens

Biological agents

Biological MutagensBiological Mutagens

Conclusion Conclusion

MutationSpontaneous Mutation & Induced Mutation

MutagenChemical MutagensRadiationBiological Mutagens

Exposure to mutagen may induce mutation!

References References

Principles of GeneticsAn Introduction of Genetic AnalysisDNA replicationhttp://pharmacology.unmc.edu/cancer/antibio.htm

Thank YouThank You

Chan Ho Yin, Aurora (02690763)Chen Yiwei, Echo (01790443)Co Ngai Na, Chloe (02715283)Lam Kit Ming, Germaine (02770293)