PHYSIOLOGIA PLANTARUM 97; 499-506. 1996 CopynghlOFhysiotosiaFlamaruml996

Pruned in Dammrti - all ri.s/ui reserved tSSN 0031-9)17

Multiple transcripts of a cakiym-binding protein gene fromAtriplex nummularia are differentially regulated by developmentaland environmental stimuli

Jian-Kang Zhu, Paul M, Hasegawa, Ray A, Bressan and Xiaomu Niu

Zhu, J.-K., Hasegawa, P. M. , Bressan, R. A. and Niu, X. 1996. Multiple transcripts ofa calcium-binding protein gene from .Atriplex nummularia are differentially regulatedby developmental and environmental stimuli. - Physiol. Plant. 97; 499-506.

H6 is an Atriplex nummularia gene having high sequence homology with the algalcaltractin (a basal-body-associated calcium-binding protein) gene. Recombinant H6was expressed at high levels in Escherichia coli. The recombinant protein exhibitedan ethylene glycol-bis(/i-aminoeEhyl ether)-A',A'A",A''-teU'aacetic acid-induced mobil-ity shift durinj: sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and it wasable to bind ""ta-". .An H6 cDN.A probe detected three RNA transcripts of 1.3, 2,2 and2.4 kb, respectivelv. The levels of these transcripts were regulated by different envi-ronmental cues and during developmental stages. The steady state levels of the 1.3-kbmRiN'A decreased after touch and heat treatments. Expression of the 2.2-kb messagecorrelated with cell proliferation activity. In cultured cells, the highest level of the 2.2-kb message preceeded the peak of mitotic cell division activity. In plants, the 2.2-kbmessage was detected only in shoot tips that contained meristematic tissues. The 2.4-kb message was detected exclusively in heai-shocked cells. The relationship amongthe three transcripts is discussed in the context of the possible role of H6 in mediatingdevelopmental and environmental signals.

Key words - Atriplex nummularia, calcium-binding protein, cell division, gene ex-pression, heat shock, touch.

J.-K. Zhu (corresponding author, e-mail jkzhu@ag.arizona.edu). Depi of Plant Sci-ences. Univ. of Arizona. Tucson, ,4Z 85721, USA; P. M. Hasegawa. R. .4. Bressan andX. Niu, Center for Plant Environmental Stress Physiology, Purdue Univ.. 1165 Horti-culture Building. West Lafayette, IN 47907-1165, USA.

concentration elicited by diverse environmental and de-Introduction velopmental stimuli.Calcium-binding proteins (CaBPs) are importattt com- In addition to mediating changes in intracelluiar freeponents of signal transduction pathways (Allan and Hep- calcium concentration, the levels of some of the CaBPsler 1989, Roberts and Harmon 1992, Braam 1992b, themselves are thought to be regulated by environmentalPoovaiah and Reddy 1993). These proteins contain two cues (Braatti and Davis 1990, Perera and Zieiinskior more copies of the helix-loop-helix calcium-binding 1992), Several mechanical stimuli such as touch, winddomain known as an EF-hand structure. The EF-hand and rain were found to elicit substantial changes in thestructure allows these proteins to bind calcium revers- gene expression of calmoduiin and two calmodulin-ibly with high affinities. Calcium binding leads to a pro- related CaBPs in Afabidopsis (Braam and Davis 1990,tein conformation change resulting in an alteration of ac- Sistrunk et a], 1994).tivity. This change of activity is reflected in the stimula- Interestingly, the touch induction of CaBP gene ex-tion of other cellular enzymes by these CaBPs (Allan pression appeared to be mediated by calcium fluxes be-and Hepler 1989), Thus, CaBPs are able to sense and re- cause the touch stimulus is known to result in cytoplas-spond to small, transient changes in intraceUular calcium mic calcium increase (Knight etal, 1991), and high con-

Received 17 October, 1995; revised 1 March, 1996

Physiol. Plant. 97, 1996 '*""

centrations of calcium in external medium also inducedthe expression of these genes (Braam i992a). In additionto mechanical stimuli, heat shock was also able to in-duce tlie expression of CaBP genes in cultured Arabi-dopsis cells (Braam 1992a).

Caltractin/centnn is a 20-kDa CaBP isolated from thebasal body complexes of the unicellular green alga,Chlamydomonas reitthardtii (Huang et al, 1988a,b, We-ber et al, 1994). The basal body complex is the major mi-crotubule organizing center (MTOC) in Chlamydomonas.Caltractin has been proposed to function in the regulationof MTOC duplication during ceil division. Consistentwith this proposal, caltractin shares highest sequencesimilarity with the 19-kDa yeast Saceiratvmyces cerevl-siae cell-division-cycle-related gene product CDC31(Baum et al, 1986). The CDC31 protein is required forthe duplication of spindle pole body, the MTOC of yeast(Baum et al. 1986, Btggins and Rose 1994). MTOC du-plication and other indices of cell cycle progression, in-cluding DNA synthesis, are precisely coordinated in nor-mal yeast cells. However, a defect in CDC31 results inthe failure of MTOC duplication and uncoupling of cellcycle control from MTOC formation (Baum et al, ! 986).Recently, human and mouse homologs of caltractin havealso been identified by molecular cloning (Lee andHuang 1993, Ogawa and Shimizu 1993),

We have previously cloned a cDNA (H6) that encodesa putative 20-kDa CaBP from the higher plant Atriplexnummutaria (Zhu et al. 1992). The predicted H6 proteincontains four putative EF-hands for calcium binding, andis most related to the algal caitractm. We demonstratehere that H6 is indeed a calcium-binding protein. Expres-sion analyses revealed that three major RNA transcriptswere detected with the H6 probe. Expression of eacbRNA transcript is regulated by different environmentaland developmental stimuli. We show that, in contrast tothe induction of certain CaBP messages observed by oth-ers (Braam and Davis 1990, Braam 1992b), one H6 tran-script is down-regulated by touch and heat treatments, Asecond H6 message is predominantly expressed in ac-tively proliferating cells consistent with a role of H6 incell division. Heat stress may cause mal-splicing of H6messages as evidenced by the appearance of a larger tran-script concomittant with the decrease in the levels ofother transcripts upon heat treatment. These observationsadd more complexity to the regulation of CaBPs andtheir role in diverse signal transduction pathways.

Abbreviations — CaBP, calcium-binding-protein; EGTA, ethyl-ene glycol-bis(/?-aminoethyl ether)-/V,A'A''A'-tetraacetic acid;IPTG, isopropylthio-/i-D-galactoside; MTOC, miciotubule orga-nizing center; SSC, saline sodium citrate.

Materials and methodsPlant materials and treatments

Suspension-cultured cells (lines SO and S20) and plantsof Atriplex nummularia were grown as described (Casaset al. 1991), Heat treatments of cultured cells and plants

were as described (Zhu et al, 1993). Touch treatmentswere according io Braam and Davis (1990), Briefly, A.numnudaria shoots were subjected to 20 strokes of touchwith gloved hands. Leaves from untreated shoots (time0) and shoots 10, 15, 30, 60 and 120 min after touchwere harvested and frozen in liquid nitrogen for RNAextraction.

RNA isolation and analyses

Total RNA was isolated from cultured cells and plants ofA. numtnularia as described (Zhu et al. 1993). Poly(.^)*RNA was purified from the total RNA by affinity chro-malography using oligo(dT)-ceilulose (Sambrook et al.1989)',

RNA was separated on formaldehyde-agarose gelsand blotted onto nitrocellulose membrane (Zhu et al,1993), Blots were hybridized with gel-purified entirecDNA insert of pH6, or a 3' portion that was labelledwith ''"P by random primed labelling. Unless specifiedotherwise, blots were washed at 45°C with 2x saline so-dium citrate (SSC), lx SSC, 0,2x SSC, O,lx SSC, plus0,17e (w/v) sodium dodecyl sulfate (SDS), each for 30titin. Blots were also re-probed with a Drosophila actin5c probe (Fyrberg et al. 1983) as controls for loading,transfer, and RNA integrity (not shown).

Genomic DN.4 isolation aod analyses

Genomic DNA was extracted from cultured ,4. nummu-laria cells as described (Casas et al, 1992), GetiomicDNA was digested with restriction endonucleases, sepa-rated on 0,8% (w/v) agarose gels, and transferred to ni-trocellulose by capillary blotting. Blots were hybridizedwith "'^P-labelled entire cDNA insert of pH6, Hybridiza-tion and washing conditions were according to Casas elal, (1992).

Mitotic activity measurements

Mitotic activity analyses of cultured/I. tmmmularia cellsduring the growth cycle were done according to Berlynand Miksche (1976), Cells were fixed overnight in etha-noi;acetic acid (3;L v/v), hydrolyzed for 40 min in 5 MHCl at room temperature, stained for 90 min withSchiffs reagent, and washed with SO, water (0,05 MHCl, 0,5% K2S2O5), Squash preparations of the stainedcells were viewed under a microscope. More than I 000cells from each time point were scored for percentage ofcells in mitotic division (mitotic Index),

Expression of H6 In bacteria

The entire open reading frame of H6 cDNA was isolatedfrom clone pH6 (Zhu et al, 1993) by polymerase chainreaction with a sense primer 5'CCCGGGATCCATATGTCAAGTGCTAGGACG3' and an antisense primer 5'GAATTCGGATCCGGTTCATTTTCAGTATGCG3', The

500 Physiol. Planl. 97. 1996

amplified DNA was digested with Nde\ and BamHi andinserted between the Ndel and BamUl sites of the bacte-rial expression vector pET9c (Studier et al. 1990) to gen-erate construct pETH6. The plasmid was transformedinto the E. coii strain B L 2 ] ( D E ; 3 ) for protein expression.AHquots of 0,5 ml of the bacterial overnight culturescontaining either pET9c or pETH6 were subculturedinto 5 ml of fresh Luria-Bertani medium plus kanamycin(250 mg mL') and allowed to grow for 1.5 h at 37°C.The cultures were then induced for 2,5 h by addition ofIPTG to 0.4 mM. Aliquots of the cultures were taken,bacteria! cells pelleted by centrifugation, and resus-pended in sample buffer (Zhu et al. 1993) for sodiumdodecyl sulphate-polyacrylamide gel electrophoresis(SDS-PAGE) analysis,

SDS-PAGE and immunoblottiog

SDS-PAGE and immunoblol analyses were carried outas described (Zhu et al. 1993), Rabbit polyclonal serumagainst the algal caltractin (generous gift from Dr Vin-cent D. Lee, Depl of Molecular Biology, Research Inst.of Scripps Clinic, La Jolla, CA, USA) was ttsed at a dilu-tion of 1 ;500 ovemiaht.

1 2 3 4 5 6 7 8 9 10

B 1 2 3 4 5 6 7 8 9 10

Calcium binding .assays

Binding to "''Ca"* was done essentially as described inMamyama et al. (1984). Briefly, proteins were separatedby SDS-PAGE and transferred onto nitrocellulose byeiectroblotting. After transfer, the membrane was soakedin a solution containing 10 mM imidazole-HCI (pH 6,8),60 mM KCl and 5 mM MgCL, and the buffer was ex-changed three times during a L5-h period. The mem-brane was then incubated in the same buffer containing37 kBq mr ' of *Ca'" (296.7 MBq mr ' ^'Ca-CaC!,: ICNBiochemicals, Irv'ine, CA, USA) for 10 min. The mem-brane was rinsed with distilled water for 20 min and airdried before autoradiography for 12 h.

ResultsH6 is a CaBP

To obtain recombinant H6 for Ca"* binding assays, theopen reading frame of H6 was subcloned into theprokaryotic expression vector pET9c under the controlof the T7-<J>10 promoter. The construct was expressed inthe E. coli strain BL21(DE3) which contains the T7polymerase gene under control of the lacUV5 promoter(Studier et al. 1990). Upon induction with IPTG, H6 be-came the predominant protein in E. coli (Fig, 1, lane 4),EGTA added to the sample was able to decrease the mo-bility of H6 (Fig, 1, lane 6) consistent with the inferencethai it is a CaBP, To demonstrate directly that H6 is aCaBP, we showed that the recombinant protein boundspecifically to ""'Ca'* (Fig, IB), The calcium binding as-say was not sensitive enough to detect any CaBPs in thecell extracts from >!. nummularia plants (Fig, 1, lanes 9

Eia. I. H6 is a calcium-bindine protein. Lane 1, moleculai- masssla'ndards (97, 66, 45, 31, 2L5'", 14.4 kDa); lane 2, E. coli strainBL21(DE 3) containing vector pET9c (control), IFTG induced;lane 3, E. coli strain BL21(DE 3) containing pETH6; lane 4,same as lane 3, but with IPTG induction; lane 5, same as lane 4,plus 5 mM CaCL; lane 6. same as lane 4, plus 5 mM EGTA; lane7, gel-purified H6, plus 5 niM CaCl,; lane 8. gel-purified H6,plus 5 mM EGT.4; lane 9, .4. nummularia shoot tip; lane 10, A.nummularia leaf A, Coomassie-Blue-stamed gel; B, radiogramof blot of gel in A, probed with ^ Ca^'.

and 10), The results revealed that H6 is indeed a CaBPas predicted from its amino acid sequence (Zhu et ai,1992),

H6 may be a caltractin homolog

H6 has the highest sequence similarity with the algal cal-tractin (Zhu et al. 1992). Similarity between the two se-quences is not limited to the putative calcium bindingdomains but extends to their N-tenninal extensions thatare not present in calmodulins (data not shown). Consis-tent with the high sequence homology, recoinbinant H6was able to react with polycionai antibodies against cal-tractin (Fig, 2), These data suggest that H6 may be a cai-tractin homolog,

H6 detects three transcripts

The H6 cDNA is 970 bp in length, containing a longestopen reading frame of 501 bp. RNA blot analyses re-vealed that H6 hybridized to three transcripts in both to-

Physiol. Planl. 97. 1996 501

B 0 10 30 60 120 min

1 2Eig. 2. H6 reacts with anti-caltractin. Lane 1, E. coli strainBL2I(DE3) containing pETH6; lane 2, same as lane 1 but withIPTG induction. A, Coomassie-Blue-stained gel; B, blot probedwith polyclonal ariti-caltractin.

tal and poly(A)" RNA samples (Fig. 3). Estimated sizesof the three transcripts were 1,3, 2,2 and 2,4 kb. Identicalresults were obtained when the blots were hybridizedwith a probe consisting of the 3' untranslated sequenceonly (data not shown). Washing blots at 25, 35, 45, 55 or65 °C did not affect the relative hybridization intensitiesof the three transcripts (data not shown). The three sig-nals always decreased similarly in intensity upon wash-ing with more stringent solutions. These data indicatethat all three transcripts are probably derived from onegene and contain the entire sequence of H6.

A. Total B. Poly(A)+

1.3 kb

Eig. 4. Regulation of the 1,3-kb mRNA expression in leaves bytouch U-eatment. Time (min) after touch treatment is indicated.

The 1,3-kb message is down-regnlated by touch treatment

Since H6 has substantial sequence homology with thetouch inducible CaBPs from Arabidopsis, we testedwhether H6 messages are induced by touch stimulus inA. nummularia leaves. In the leaves, only the 1,3-kbmessage was detectable (Fig, 4), The 1.3-kb messagewas not induced by touch treattnent. Instead, the abun-dance of this message decreased immediately after touchtreatment (Fig, 4), One hour after the treatment, the levelof the 1.3-kb message started to recover. There was alsono induction of the 2,2- and 2,4-kb transcripts by touch.

The 2,2-kb message correlates with cell proliferation

When stationary phase cells are transferred to fresh cul-ture medium, celis become transiently synchrooized(Conia et al, 1990), A. numtnularia cells were similarlysynchronized early in the growth cycle, resulting in apeak of mitotic activity 3 days after inoculation (Fig. 5),H6 detected two transcripts of 1,3 and 2,2 kb in thegrowth cycle of cultured A. nummutaria cells (Figs 3and 6), The larger one (2,2-kb) was most abundant earlyafter inoctilation (Fig. 6A), More detailed analyses re-vealed that the 2,2-kb message was induced as early as

,2 .4 kb-2.2 kb

-1.3 kb

Fig, 3, H6 detects three mRNA transcripts. Lane 1, cells 1 dayaft'er inoculation; lane 2, heat shock (37°C) treated cells (4 daysafter inoculation). For untreated control cells 4 days after inocu-lation see Figs 6A and 7A. A, Total RNA; B, poly(A)* RNA.

•a

coo

Days After Inoculation

Fig, 5. Mitotic activity analysis of A. nummularia cells during agrowth cycle.

502 PhysioL Plant. 97, 1996

A 1 4 7 10 13 16 Days Time at 37°C

-1,3 kb- 2,4 kb• 2,2 kb

,3 kb

B 0 0,S 2 8 12 24 Hours

- 2.2 kb B

Is -1,3 kb - 2,4 kb

I I 3K « J

W *"' W • -^L3kbEig. 7. Regulation of the 2.4-kb mRNA expression by beat(37°C) treatment. A, Cultured cells 4 days after inoculationwere treated with heat for various durations; B, leaves.

• 2,2 kb

1,3 kb

Eig. 6. Expression of the 2.2-kb mRNA during a cell culturegrowth cycle (A and B) and in plants (C). Note that the relativeintensities of the 1.3-kb and 2.2-kb mRNAs are not comparablebetween (A) and (B) because samples in (A) and (B) were fromtvi o independent experinsents (see text).

30 min after inoculation (Fig, 6B), Accumulation of thismessage peaked 12 h after inoculation. The 2,2-kb mes-sage was also detected in the shoot tips of A. nummu-taria plants where cell proliferation is active (Fig, 6C),

The experiments presented in Fig, 6A and B were re-peated five times. The expression pattern of the 2,2-kbtranscript was consistent and similar in ail experiments.However, for unknown reasons, the expression patternof the 1,3-kb transcript in the cultured cells was ex-tremely variable. As a consequence, the relative intensi-ties of the 2,2-kb and 1.3-kb mRNAs were not compara-ble between different experiments (Fig. 6A,B),

Tbe 2,4-kb message is induced by heat shock

Several CaBP messages in Arabidopsis cells have beenshown to be induced by heat treatment (Braam 1992a),We were interested to know whether H6 messages are

regulated by heat stress. Upon 37°C heat-shock treat-ment of cultured cells, the 2,2-kb transcript disappeared,and a 2.4-lcb message was induced (Fig. 7A), The levelof the induced message decreased after longer heat treat-ment. The 2,4-kb message was also induced by heatshock in plant leaves (Fig. 7B) and stems (not shown). Itshould also be noted that the level of the 1,3-kb messagedecreased in heat-treated cells (Fig. 7A) and this de-crease can be seen more clearly in heat-treated leaves(Fig, 7B),

H6 is a member of a multigene family

Figure 8 shows that multiple bands were detected in A,nummularia genomic DNA blots. The data indicate thatH6 belongs to a multigene family. In contrast, the algalcaltractin is encoded by a single gene (Huang et al,1988b). Interestingly, a polymorphism was detected be-tween the two cell lines examined (Fig, 8, lanes 3 and 4),Cell line S20 was derived from line SO, but is nowadapted to high salt (Casas et ai, 1991),

Discussion

The capacity of recombinant H6 to bind to '' ^Ca"* con-firmed that it is a CaBP as predicted from its cDNA se-quence (Zhu et al, 1992), Sequence comparison as wellas antibody cross reaction indicated that H6 is a caltrac-tin homolog. The intracellular location of H6 is not

Physio!. Plant. 97, t99'6 503

1 2 3 4 5 6

23.1 -

9 4 -

6 . 6 -

4 . 4 -

2 .2 -

0 . 6 -

Eig. 8. Genomic DNA blot analysis of H6 in A. nummulariacells. Genomic DNA from cultured cells iine SO (lanes I, 3 and5) and line S20' (lanes 2, 4 and 6) was digested with either Hin-din (lanes 1 and 2) or Xba\ (lanes 3 and 4) or EcoR\ (lanes ,5 and6), fractionated in an agarose gel, transferred to a nitrocellulosemembrane, and hybridized to a randomly primed ['"P]-!abelledH6 cDNA insert. Numbers on the left indicate positions, of mo-lecular weight (kb) standards.

known. If it is localized in the MTOC similar to the algalhomolog, this novel CaBP may play a role in regulatingMTOC duplication coordinated with the cell cycle byCa"* fltixes.

It is not uncommon to observe that one probe can de-tect more than one transcript in RNA blot analyses,Zhou et al, (1992) detected multiple RNA transcripts intomato with an extensin gene probe. Multiple transcriptsranging from 0,8 to 5 kb have been detected in Arabi-dopsis with a probe encoding a 40-kDa cold-regulatedgene (Lin et al, 1990, Houde et al, 1992), In eei elec-Iroplax, fotir species of RNAs at 0,8, Ll, 2,0 and 5,5 kbhybridized to a calmodulin cDNA probe (Lagace et al.1983), The largest one was present only io the nucleus.The 0,8- and 1,1-kb transcripts were proposed to be de-rived from a single nuclear transcript by differentialpolyadenylation during processing. Two RNA tran-scripts, at 1,4 and 3,5 kb, were detected in rat liver witha 0.9-kb cDNA encoding a mannan-binding protein(Wada et al, 1990). The 3,5-kb message contained anopen reading frame identical to that of the 1,4-kb mes-

sage. The 3,5-kb message had a longer 3' untranslatedregion. These two messages were derived from one genewith the difference in size being accounted for by utili-zation of different polyadenylation sites of a precursortranscript. We hypothesize that the L3-kb and 2,2-kbtranscripts detected with 116 also resulted from differen-tia! polyadenylation. The 2,2-kb transcript may have alonger 3" untranslated sequence. This longer "tail" se-quence may make the mRNA a better template for pro-tein synthesis. Alternative polyadenylation of an amy-loid protein precursor mRNA generates two transcripts.The longer one was able to produce more protein thanthe short mRNA (Sauvage et al, 1992).

Microtubule organizing centers duplicate during earlyS phase of the cell division cycle (Brown et al. 1988),This duplication in higher plant cells may require a largesupply of caltractin-like CaBP, Thus increased produc-tion of easily translatable messages may be necessary foractive cell division. Although we have not determined inwhich stage of the cell division cycle maximal H6 ex-pression occurs, based on data shown in Figs 5 and 6, wehypothesize that the 2.2-kb mRNA has a peak level ofexpression in early S phase.

It was unexpected that the ievel of H6 message de-creased after touch treatment. Recently, it has beetidemonstrated that touch induction of the CaBP geneswas probably mediated by calcium ion fluxes. It wasproposed that calcium ion regulation of genes encodingcalcium-binding proteins, ensures the efficacy of cal-cium ion as a transient secondary' messenger and themaintenance of cellular calcium homeostasis (Braam1992b). Some touch induced CaBPs have been sug-gested to sequester or transport excessive cytoplasmiccalcium caused by touch treatment (Sistrunk et al,1994), If H6 does play a positive roie in controlling celldivision (by regulating MTOC duplication), the de-creased H6 expression may enable the cells to slowdown division in response to mechanical and heatstresses.

The 2,4-kb message probably resulted from incom-plete mRNA processing during heat shock. Severe heatstress has been known to inhibit intron splicing of someRNAs in animals and yeast (Yost and Lindquist 1986),In plants, splicing failure caused by heat shock has notbeen previously reported. However, a variety of incom-pletely spliced transcripts has been observed in plants atcertain developmental stages or exposed to heavy metalstress or hypoxia (Nash and Walbot 1992), Heat treat-ment did not inhibit the processing of RNAs of actin,plasma membrane ATPase and the heat shock proteinhsp70 or ANJ] (a DnaJ homolog) in A. nummularia(data not shown). If heat stress does inhibit H6 mRNAprocessing, it will be of interest to know why the pro-cessing of this particular RNA is more sensitive to heatstress than others.

Alternatively, the 2,4- and 2,2-kb messages may bederived from genes related to but different from U6.This possibility is less likely because (1) a probe consist-

504 Physiol. Plant. 97, 1996

ing only of the 3" untranslated sequence of H6 (i,e, gene-specific probe) hybridized with all of the three RNAtranscripts; (2) under all conditions tested, the probe ei-ther hybridized with all tltree messages or did nol hy-bridize with any of these, and (3) the levels of the threeRNA transcripts are regulated by different environmen-tal and developmental cues; when the 2,4-kb messageappears, the 2,2-kb message disappears. Present evi-dence does not definitively resolve the relationshipamong the three messages. We suggest that the 1.3-kbmessage corresponds lo the cloned H6 cDNA, Se-quences of the other two messages are needed to resolvetheir identities. Repeated attempts have failed to isolatecDNAs corresponding to the 2,2-kb message by screen-ing with the H6 probe a cDNA library made frompoly(A)* RNA from cultured cells 1 day after inocula-tion (when the 2,2-kb message is most abundant). Futurecloning of the genomic sequence of H6 may shed somelight on the identities of the messages.

.Acknim-ledgments - The authors would like to thank Drs Vin-cent D. Lee and Bessie Huang for the anti-callractin serum. Theauthors also thank Glenda McClatchey for excellent technicalassistance.

References

Allan, E. & Hepler, F. K. 1989. Caimodulin andcalcium-binding pioteins. - In The Biochemistry' of Plants(P. K. Stumpf and E. E. Conn, eds). Vol. ]5. pp. 455-484.Academic Press. Inc., San Diego, CA. ISBN 0-12-675402-0.

Baum, P., Furlong, C. & Byers. B. 1986. Yeast gene required forspindle pole body duplication; homology of its product withCa-'-bindinE proteins. - Proc. Natl. .Acad. Sci. USA 83;,5,'>12-,5,516."'

Berlyn, G. P. & Miksche, J. P. 1976. Botanical Microtechniqueand Cytochemistry. - The Iowa State University Press,Ames,"lA. ISBN 0-8138-0220-2.

Biggins, S. & Rose, M. D. 1994, Direct interaction betweenyeast spindle poie body components; Karlp is required forcdc31 localization to spindle pole body. - .1. Cell Bid. 125;843-852.

- & Davis, R. W. 1990. Rain-, wind- and touch-induced ex-pression of calmodulin and calmodulin-related genes in .4ra-bidopsls. - Cell 60; 357-364.

Braam, J. i992a. Regulated expression of the calmodulm-re-lated TCH genes in cultured Arabidopsis cells; Induction bycalcium and heat shock. - Proc. Natt. Acad. Sci. USA 89:3213-3216,

- , 1992b. Regulation of expression of calmodulin andcalmodulin-related genes by environmenlal stimuli in plants.- Cell Calcium 13; 4 5 7 ^ 6 3 .

Brown, D. L. et al. 1988. - In The Cytoskeleton m Plant Growthand Development (C. W. Lloyd, ed.), pp. 54-S3. AcademicPress, Inc., New York, NY, ISBN 0-12-4537S0-4.

Casas, A. M., Bressan, R. A, & Hasegawa, P. M. 1991. Cellgrowth and water relations of the halophyte, Atriple.x tium-Tnularla L,, in response to NaCl, - Plant Cell Rep. 10; 8 1 -84.

- , Nelson, D. E., Raghothama, K. G., D'Urzo, M. P., Singh,N, K., Bressan, R. A. & Hasegawa, P M. 1992. Expressionof osmotin-like genes in tlie halophyte .4 (rip/er nummulariaL. - Planl Physiol. 99; 329-,337.

Conia, J., Alexander, R. G., Wilder, M. E., Richards, K. R.,Rice, M. E. & Jackson, P. J. 1990. Reversible accumulation

of plant suspension cell cultures in G1 phase and subsequentsynchronous traverse of the cell cycle. - Plant Physiol. 94;1568-1574.

Eyrberg, E. A., Mahaffey, J, W., Bond, J. & Davidson, N. 1983.Transcripts of the six Drosophita aclin genes accumulate ina stage- and tissue-specific manner. - Cell 33: 115-123.

Houde, M., Danyluk, J., Laliberte, J.-F.. Rassart, E,, Dhindsa, R.S. & Sarhan, E. 1992. Cloning, characterization, and expres-sion of a cDN.A encoding a 50-kilodalton protein specifi-cally induced by cold acclimation in wheat. - Plant Physiol.99;'1381-1387."

Huang, B., Watterson. D. ,M.. Lee, V. D. & Schibler, M. 1988a.Purification and characterization of a basal body-associatedCa=--binding protein.-J. Cell Biol. 107: 121-131.

- . Mengersen, A. & Lee, L. D. r988b. Molecular cloning ofcDNA for caltractin, a basal body-associated Ca"-bindingprotein; homology in its protein sequence with calmodulinand the yeast CDC31 gene product. - J. Cell Biol. 107; 13,3-140.

Knight, M. R., Campbell, A. K., Smith, S. M. & Trewavas, A. J.1991. Transgenic plants aequorin reports the effects of touchand cold-shock and elicitors on cyloplasmic calcium. - Na-ture 352; 524-526.

Lagace, L., Chandra, T.. Woo. S. L. C. & Means, A. R. 1983.Identification of multiple species of calmodulin messengerRN,A usine a full length eomplementary DK.A. - J. Biol.Chem. 258" 1684-1688.

Lee, V. D. & Huang. B. 1993. Molecular cloning and cenp-oso-mal localization of human caltractin. - Pioc. Natl. Acad. Sci.USA 90; 11039-11043.

Lin, C . Quo, W. W., Everslon, E. & Thomashow, M. E 1990.Cold acclimation in Arabidopsis and wheat. - Plant Physiol.94; 1078-1083.

Maruyama, K., Mifcawa. T. & Eba.shi, S. 1984. Detection of cal-cium binding proteins by "'Ca autoradiography on nitrocel-lulose membrane after sodium dodecyl sulfate gel electro-phoresis. - J. Biochem. 95; 511-519.

Nash. J. & Walbot. V. 1992. Bronze-2 gene expression and in-tron splicinc pattems in cells and tissues of Zeo mavs L. -Plant Physiol. 100; 464-471.

Oaawa, K. & Shimizu, T. 1993. cDN,\ sequence lor mouse cal-traclin. -Biochim. Biophys. Acta 1216; 126-128.

Perera, I. Y. & Zieiinski. R. E. 1992, Structure and expression ofthe Arabidopsis CaM-3 calmodulin gene. - Plant Mol. Biol.19; 649-664.

Poovaiah, B. W. & Reddy, A. S. N. 1993. Calcium and signaltransduction in plants. - CRC Crit. Rev. Plant Sci. 12; 185-211.

Roberts, D, M. & Harmon, A. C. 1992. Calcium-modulated pro-teins; targets of intracellular calcium sianals in higherplants. - Annu. Rev. Plant Physiol. Plant Mol. Biol. 43: 37,5-414.

Sambrook, J., Eritsch, E. E & Maniatis, T. 1989. MolecularCloning. - Cold Spring Harbor Laboratory Press, New York.NY. ISBN 0-87969-309-6.

SauN'age. E, Kmys, V., Marinx, O.. Huez, G. & Octave, J. N.1992. Alternative polyadenylation of the amyloid proleinprecursor mRNA reeulates translation. - EMBO J. 11;3099-3103.

Sistrunk. M. L., Antosiewicz, D. M., Purugganan, M. M. &Braam, J. 1994. Arabidopsis TCH3 encodes a novel calciumbinding protein and shows en\'ironmentally induced andtissue-specific regulation, -Plant Cell 6; 1553-1565.

Studier, E. W., Rosenberg, A. H.. Dunn. J. J. & Dubendorff, J.W. 1990. Use of T7 RNA polymerase to direct expression ofcloned genes. - Methods Enzymol. 185; 60-89.

Wada, .M., Ozaki. K,, Itoh, N., Yamashina, I. & Kawasaki, T.1990. Two fomis of messenger RNA encoding rat livermannan-binding protein are generated by differential utiliza-tion of polyadenylation sites of one transcript. - J. Biochem.iO8; 914-917.

Weber, C , Lee, V, D., Chazin. W. J. & Huang, B. 1994. Highlevel expression in Escherichia coli and characterization of

Physiol. Plant. 97, 19% 505

the EF-hand calcium-bindin" protein caltractin, - L Biol. Zhu, J. K., Bressan, R. A. & Hasegawa, R M. 1992. An AtriplexChem. 269; 15795-15802. " nummularia cDNA with sequence relatedness to the algal

Yost, H. J. & Lindquist, S, 1986, RNA splicing is interrupted by caltractin gene, - Planl Physiol. 99; 1734-1735.heat shock and is rescued by heat shock protein synthesis. - - , Shi, L, Bressan, R. A. & Hasegawa, P, M. 1993 ExpressionCell 45" 185-193 " of ixn Atriplex nummularia gene encoding a protein homolo-

Zhou, J,, Rumeau, D. & Showalter, ,A. M. 1992. Isolation and gous to the bacterial molecular chaperone DnaJ. - PUmt Cellcharacterization of two wound-regulated tomatO' extensin 5; 341—349.genes. -Plant Mol. Biol. 20: 5-17.

Edited by J. G. Scandalios

enr Physiol. Plant. 97. 1996