MpkA-Dependent and -Independent Cell Wall Integrity ... · cell wall-related genes is important to secure cell wall biogen-esis. The objective of the present study was to examine

EUKARYOTIC CELL, Aug. 2007, p. 1497–1510 Vol. 6, No. 81535-9778/07/$08.00�0 doi:10.1128/EC.00281-06Copyright © 2007, American Society for Microbiology. All Rights Reserved.

MpkA-Dependent and -Independent Cell Wall IntegritySignaling in Aspergillus nidulans�†

Tomonori Fujioka,1 Osamu Mizutani,1 Kentaro Furukawa,1 Natsuko Sato,1 Akira Yoshimi,2Youhei Yamagata,1 Tasuku Nakajima,1 and Keietsu Abe1,2*

Laboratory of Enzymology, Department of Molecular and Cell Biology, Graduate School of Agricultural Science,Tohoku University, 1-1 Amamiya, Tsutsumi-dori, Sendai 981-8555,1 and New Industry Creation Hatchery Center,

ABE Project, Tohoku University, 6-6-10 Aoba, Aramaki, Aoba-ku, Sendai 980-8579,2 Japan

Received 3 September 2006/Accepted 11 June 2007

Cell wall integrity signaling (CWIS) maintains cell wall biogenesis in fungi, but only a few transcriptionfactors (TFs) and target genes downstream of the CWIS cascade in filamentous fungi are known. Because amitogen-activated protein kinase (MpkA) is a key CWIS enzyme, the transcriptional regulation of mpkA andof cell wall-related genes (CWGs) is important in cell wall biogenesis. We cloned Aspergillus nidulans mpkA;rlmA, a TF gene orthologous to Saccharomyces cerevisiae RLM1 that encodes Rlm1p, a major Mpk1p-dependentTF that regulates the transcription of MPK1 besides that of CWGs; and Answi4 and Answi6, homologous to S.cerevisiae SWI4 and SWI6, encoding the Mpk1p-activating TF complex Swi4p-Swi6p, which regulates CWGtranscription in a cell cycle-dependent manner. A. nidulans rlmA and mpkA cDNA functionally complementedS. cerevisiae rlm1� and mpk1� mutants, respectively, but Answi4 and Answi6 cDNA did not complement swi4�and swi6� mutants. We constructed A. nidulans rlmA, Answi4 and Answi6, and mpkA disruptants (rlmA�,Answi4� Answi6�, and mpkA� strains) and analyzed mpkA and CWG transcripts after treatment with a�-1,3-glucan synthase inhibitor (micafungin) that could activate MpkA via CWIS. Levels of mpkA transcriptsin the mutants as well as those in the wild type were changed after micafungin treatment. The �-glucuronidasereporter gene controlled by the mpkA promoter was expressed in the wild type but not in the mpkA� strain.Thus, mpkA transcription seems to be autoregulated by CWIS via MpkA but not by RlmA or AnSwi4-AnSwi6.The transcription of most CWGs except �-1,3-glucan synthase genes (agsA and agsB) was independent of RlmAand AnSwi4-AnSwi6 and seemed to be regulated by non-MpkA signaling. The transcriptional regulation ofmpkA and of CWGs via CWIS in A. nidulans differs significantly from that in S. cerevisiae.

The cell wall of filamentous fungi is a complex structure thatis essential for the maintenance of a cell’s shape and integrity,for the prevention of cell lysis, and for protection against ad-verse environmental conditions. Since the morphologies of fila-mentous fungi differ significantly from those of yeasts such asSaccharomyces cerevisiae, cell wall architecture and its biogen-esis are thought to reflect differences in types of cell wall-related genes and their transcriptional regulation through cellsignaling in response to external stimuli or stresses as well as tothe cell cycle in the two groups of eukaryotes. However, fewstudies of cell wall biogenesis in filamentous fungi and itsregulation via signaling, in particular by transcription factorsthat control the transcription of cell wall-related genes as thetargets of the putative signaling pathways, have been reportedpreviously (5, 8, 41, 64).

Cell wall biogenesis and its regulation by cell signaling in theyeast S. cerevisiae have been well studied (37, 55). Fungal cells,including those of yeasts, constantly remodel their rigid struc-ture during growth and development and under environmentalstress (55). Maintaining a proper cell wall architecture in S.

cerevisiae requires cell wall components such as �-1,3-glucan,�-1,6-glucan, chitin, and mannoproteins (28, 31). A signaltransduction process in S. cerevisiae that monitors and pro-motes the remodeling of the cell wall has been described indetail previously (19). The sensing of cell wall perturbationsrequires surface sensors. Findings from genetic studies placeone group of cell wall integrity and stress response genes(WSC1 to WSC4) upstream of the intracellular signal trans-duction pathway responsible for maintaining cell wall integrityin this yeast (10, 65). Additional cell wall stress sensors includethe partially redundant Mid2p and Mlt1p cell surface proteins(48). These proteins act as mechanosensors of cell wall stressduring growth or pheromone-induced morphogenesis, expo-sure to high temperatures, or other cell wall perturbations andtransmit signals to the downstream signaling pathway (18, 30,49, 61). The activation of the cell wall integrity signaling(CWIS) pathway proceeds through the small G protein Rho1pvia Pkc1p (38) and a downstream mitogen-activated proteinkinase (MAPK) cascade. Rho1p is a small GTPase upregu-lated by the GDP/GTP exchange factors Rom1p and Rom2p(45, 47) and downregulated by the GTPase-activating proteinsSac7p and Bem2p (46, 53). In addition to its other functions,Rho1p binds with and activates Pkc1p (27, 44), which in turnactivates the MAPK cascade. The MAPK cascade is a linearpathway that is composed of a MAPK kinase kinase (encodedby BCK1) (6, 36), a pair of redundant MAPK kinases (encodedby MKK1 and MKK2) (21), and a MAPK (encoded by MPK1/SLT2) (35). CWIS is induced in response to several environ-

* Corresponding author. Mailing address: New Industry CreationHatchery Center, ABE Project, Tohoku University, 6-6-10 Aoba, Ara-maki, Aoba-ku, Sendai 980-8579, Japan. Phone and fax: 81-22-795-3205. E-mail: [email protected].

† Supplemental material for this article may be found at http://ec.asm.org/.

� Published ahead of print on 29 June 2007.

1497

on Decem

ber 13, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/EC.00281-06&domain=pdf&date_stamp=2007-08-01

http://ec.asm.org/

mental stimuli, resulting in increased levels of expression ofnumerous genes, many of which encode integral cell wall pro-teins (glycosylphosphatidylinositol proteins, Pir [protein withinternal repeats] family proteins, and others) or enzymes in-volved in cell wall biogenesis, including �-1,3-glucan synthases(Fks1p and Fks2p) and chitin synthase (Chs3p) (25). Mpk1p,which is activated by means of CWIS, phosphorylates andactivates the transcription factor Rlm1p, which regulates thetranscription of at least 25 genes involved in cell wall biogen-esis in S. cerevisiae (25). These 25 genes include MPK1, whichmeans that the transcription of MPK1 is autoregulated in anMpk1p-Rlm1p-dependent manner. Mpk1p has another target:the Swi4p-Swi6p complex (SBF) transcription factor. SBF alsocontrols the transcription of cell wall-related genes in additionto that of cell cycle-related genes in the G1/S phase (23).

In filamentous fungi, including Aspergillus nidulans, A.oryzae, and Magnaporthe grisea, several genes that encodeMAPKs of CWIS have been isolated (5, 41, 64). In A. nidulans,mpkA, which is a counterpart of the yeast MPK1 (SLT2), hasbeen cloned and characterized previously (5). An A. nidulansmpkA deletion mutant (mpkA�) has been constructed, and itsmorphological defects suggested that the kinase encoded bympkA is involved in the germination of conidial spores and inpolarized growth (5). Mizutani et al. (41) reported that thedisruption of kexB, which encodes a subtilisin-like processingenzyme in A. oryzae, results in an increased level of expressionof several cell wall-related genes and of an mpkA gene con-comitant with high levels of phosphorylated MpkA. They fur-ther suggested the autoregulation of mpkA expression throughCWIS via MpkA. During the course of the present study,Damveld et al. (8) found an A. niger rlmA gene homologous toS. cerevisiae RLM1 and reported that rlmA is involved in re-sponses to cell wall stress. Recently, the genome databases for

three Aspergillus species (A. nidulans [14], A. oryzae [39], and A.fumigatus [43]) have become available, and we searched thesedatabases for gene homologs involved in cell wall biogenesis.In the in silico reconstruction depicted in Fig. 1, most ho-mologs involved in yeast cell wall biogenesis in A. nidulans andthe other two Aspergillus species appear to be well conserved(see Table S1 in the supplemental material). However, the insilico assignment of transcription factors is generally difficult,because conserved regions in transcription factors are oftenrestricted to DNA-binding domains such as a zinc finger do-main and a leucine zipper motif or other limited motifs. Thus,the functionality of transcription factors must be examined invivo. Although most genes orthologous to the yeast CWISgenes are conserved in the genomes of the three Aspergillusspecies (14, 39, 43) and the signaling pathway seems to main-tain cell wall biogenesis in these fungi as described above (5,41), the target genes for transcription factors downstream ofthe CWIS via MpkA remain unclear except for those identifiedin a few studies, such as a study of the constitutive autoregu-lation of mpkA expression in an A. oryzae kexB disruptant (41)and a study of the RlmA-dependent expression of agsA, whichencodes �-1,3-glucan synthase, in A. niger (8).

Because MpkA is a key enzyme in CWIS via the MAPKpathway, the transcriptional regulation of mpkA itself and ofcell wall-related genes is important to secure cell wall biogen-esis. The objective of the present study was to examine whetherand how putative transcription factors downstream of MpkAregulate the transcription of mpkA and of cell wall-relatedgenes in A. nidulans. We show that the transcription of mpkAis autoregulated by CWIS via MpkA but not by RlmA or byAnSwi4-AnSwi6. Moreover, the transcription of most cell wall-related genes except �-1,3-glucan synthase genes is indepen-dent of RlmA or AnSwi4-AnSwi6 and rather seems to depend

FIG. 1. In silico reconstruction of the Aspergillus CWIS pathway based on Aspergillus and S. cerevisiae genome information. The putativeorthologous proteins involved in CWIS in Aspergillus and S. cerevisiae are represented; An, Ao, and Af indicate the number of BLAST hits for A.nidulans, A. oryzae, and A. fumigatus, respectively. Most genes for CWIS are nonredundant and are well conserved among the Aspergillus fungi andS. cerevisiae. Shaded circles represent transcription factors. Rectangles with rounded edges represent components of the MAPK signaling pathway.Ellipses represent signals that are not part of the MAPK signaling pathway. MAPKK, MAPK kinase; MAPKKK, MAPK kinase kinase.

1498 FUJIOKA ET AL. EUKARYOT. CELL

on Decem


.org/D

ownloaded from

http://ec.asm.org/

on non-MpkA signaling. The transcriptional regulation ofmpkA and of cell wall-related genes in A. nidulans thus differssignificantly from that in S. cerevisiae.

MATERIALS AND METHODS

Strains, media, and growth conditions. We used the A. nidulans biotin andarginine auxotroph FGSC A89 (biA1 argB2) for all genetic manipulations. Thisstrain was grown in potato dextrose medium (Nissui, Tokyo, Japan) or Czapek-Dox(CD) medium [0.6% NaNO3, 0.052% KCl, 0.152% KH2PO4, 0.0001%FeSO4 � 7H2O, 0.00088% ZnSO4 � 7H2O, 0.00004% CuSO4 � 5H2O, 0.000015%MnSO4 � 4H2O, 0.00001% Na2B4O7 � 10H2O, 0.000005% (NH4)6Mo7O24 � 4H2O,0.059% MgSO4 � 7H2O, and 2% glucose] supplemented with 0.02 �g of biotin/mland 200 �g of arginine/ml. In the present study, we refer to A. nidulans FGSC A89cells transformed with the A. nidulans argB gene as the wild-type strain (13), and weused this strain as a control for phenotype analyses of rlmA, mpkA, Answi4, andAnswi6 knockout derivatives.

Genomic DNA isolation. Genomic DNA was extracted from mycelia frozen inliquid nitrogen and ground into a fine powder with a mortar and pestle. Thepowder was then resuspended in a lysing buffer (2% sodium dodecyl sulfate[SDS], 10 mM Tris � HCl [pH 7.0], 1 mM EDTA) and incubated for 2 h at 60°C.Next, an equal volume of buffer-saturated phenol was added and the mixture wascentrifuged at 3,000 � g for 10 min. The supernatant was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and then with chloroform-isoamyl alcohol(24:1), followed by ethanol precipitation.

Molecular cloning and sequencing of the rlmA gene. For subcloning, we usedEscherichia coli XL1-Blue (hsdR17 supE44 recA1 endA1 gryA46 thi relA1 lac [F�proAB� lacIqZ�M15::Tn10 Tetr]) cells and the pBluescript II KS� plasmid(Toyobo Inc., Tokyo, Japan) as the host and vector, respectively, for DNAmanipulation. We used the vector pGEM-T Easy (Promega Co., Tokyo, Japan)for TA cloning of PCR products. All basic molecular biology procedures werecarried out as described by Sambrook and Russell (52). To clone the A. nidulansrlmA gene, we searched the A. nidulans genome database (http://www.broad.mit.edu/annotation/genome/aspergillus_nidulans/BLAST.html) for the S. cerevisiaeRLM1 gene and found a sequence containing Rlm1p-like signatures such as aMADS box motif (56), a MAPK docking site (26), and an acidic amino acidregion (62). DNA fragments containing the open reading frame (ORF) homol-ogous to the yeast RLM1 gene were amplified by PCR using A. nidulans genomicDNA and the primers rlmA-1-F and rlmA-1-R. (All primers described in thispaper are shown in Table 1.) The amplified fragments were subcloned intopGEM-T Easy, and DNA sequences of the cloned fragments were determinedusing an ABI PRISM BigDye Terminator cycle sequencing ready reaction kit,version 3.0 (Applied Biosystems Japan Ltd., Tokyo, Japan), and an ABI PRISM377 sequencer (Applied Biosystems Japan). Then we amplified a cDNA frag-ment from an A. nidulans cDNA library (13) by using PCR primers (rlmA-2-Fand rlmA-2-R) designed from the genomic DNA. Each primer was designed tointroduce either a HindIII site or an XhoI site. The amplified cDNA fragmentwas subcloned into pGEM-T Easy, and the DNA sequences of the clonedfragments were determined as described above.

Complementation analysis of rlmA and its derivatives in an rlm1 deletionmutant. We used an S. cerevisiae strain (GMY63-5D; MATa rlm1�::LEU2 ura3leu2 trp1 his4 can1) that exhibits the caffeine-sensitive phenotype for comple-mentation analysis. Expression plasmids used in this experiment were con-structed with the expression vector pYES2 (Invitrogen Co., Tokyo, Japan), inwhich expression is under the control of the galactose-inducible GAL1 promoter(24). A fragment containing the complete ORF of the rlmA cDNA was digestedwith HindIII and XhoI and ligated into the corresponding sites in pYES2,resulting in the rlmA expression vector pYESrlmA. To construct the plasmidspYESrlmA-M1 and pYESrlmA-M2, which produced mutant RlmA proteins inthe MAPK docking site, we generated nucleotide substitutions in pYESrlmA byusing a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA)with the primers rlmA-3-F and rlmA-3-R for M1 (Leu [CTG] and Val [GTC]were each replaced by Ala [GCT]) and the primers rlmA-4-F and rlmA-4-R forM2 (Ile [ATA] and Pro [CCG] were each replaced by Ala [GCT]). Each muta-tion was confirmed by DNA sequencing. YEp195-RLM1 was used for the con-stitutive expression of yeast RLM1 as the positive control (62). We amplified anA. nidulans AN8676.3 cDNA fragment from an A. nidulans cDNA library byusing PCR primers AN8676.3-F and AN8676.3-R. The amplified cDNA frag-ment was then subcloned into the pGEM-T Easy vector, resulting in pGEM-AN8676.3, and DNA sequences of the cloned fragments were determined asdescribed above. We constructed plasmid pYES-AN8676.3 by the insertion of a

TABLE 1. Primers used in this study

Primer name Sequence (5� to 3�)

agsA-RT-F GCTTTCCAAATCCCACAGTTGGagsA-RT-R GTGAAGCAGATATGCATCCGTGagsB-RT-F ATCGGACACTACCTTCCCTGagsB-RT-R GACTTGGCTGACGATCAACGAN8676.3-F CACTAAGCTTATACAATTCTGCTCGTCGCCAN8676.3-R GTTGCTCGAGGAGCTACAACTTGAGCTCCAnswi4-1-F GCAGATCTTATAAGGCTATCGGTGCTACCGAnswi4-1-R AGTGGTACCTCCCTTGGAAGTGTGAGGAnswi4-2-F CCACTGCGCAATTGCTCTCACAGATTGGAGAnswi4-2-R ATTCTAGATGCACTCGTTAAGCCTGCCGTGAnswi6-1-F CTGCGGGCCCGTAACGGAAAATTCGCCAnswi6-1-R ATTATCGCATATGACGCTTTCCCCGTCGACAnswi6-2-F GGGGCATTCAACGGTACCTACCAGCAATCAnswi6-2-R GATTGCTGGTAGGTACCGTTGAATGCCCCchsA-RT-F TGCAGTACGGACGTATATGGchsA-RT-R CAGATACAGAACTGCATACGCchsB-RT-F CTTGAACGTTTACGCCTTCAGCchsB-RT-R TCGTCCAGACTCTTCTCTTCCchsC-RT-F GCGATGTGGTTTTTGGTTGTGCchsC-RT-R CATTGCGATATGCTGAACCTGCchsD-RT-F ATGGAGCTGGTCTTGGTTCGchsD-RT-R CCAAGAATAAGGGCGAGCAAGcsmA-RT-F CCGACGAAGGAAAATTCGACCcsmA-RT-R GAGACATCCGAGACATATGCCcsmB-RT-F ACAGATAACCTTCTTCGACCcsmB-RT-R CGTCGTCTGAAGTCGTTGTTCfksA-RT-F CTCAGCAGACTTCGTCATTGGfksA-RT-R CAGAATAGCGAAACGGACCACgelA-RT-F CTACGGTCTTCCCCTTTTCCgelA-RT-R GCTCAGTAACCTTGCCGTTCgelB-RT-F TCGTCGACTTTGACAACCTGCgelB-RT-R TGATCAAGTCCTGGACACCAGgfaA-RT-F TCCTATCTGCACTGTGAAGCCgfaA-RT-R CGTTGAGAAGTCCTTGAAGGCHistone-P-F CTTTTAAAATGCCTCCCAAAGCTGCCGHistone-P-R CGAGAAAAGCCTATTTGGCAGATGAGGHistone-RT-F CACCCGGACACTGGTATCTCHistone-RT-R GAATACTTCGTAACGGCCTTGGMLP1-RT-F GGTCAACAGGCTGTATCTMLP1-RT-R GGATTAGCACCAGGTAGTmpkA-1-F AGTCTCAAGCTTCCGGCATGTCTGACTTACmpkA-1-R CCAACGCTCGAGTAATTACGCATCCATCCmpkA-2-F TCTGCCTTTCACTATATCTACTAGGAGGCGmpkA-2-R TCGGTAAGGACGGACGAAGGTTGAGGmpkA-3-F GTCTCACGCGCCCCAATTGTCTGACTTACmpkA-3-R GTAAGTCAGACAATTGGGGCGCGTGAGACmpkA-4-F GCTGTTTCGAACTGGTACCAAGCTGACGTGmpkA-4-R CACGTCAGCTTGGTACCAGTTCGAAACAGCmpkA-RT-F GAACGCCGGTTACATGACTGmpkA-RT-R CCAGGTAGTGCAAGATCTGGP-mpkA-F TCTGCCTTTCACTATATCTACTAGGAGGCGP-mpkA-R GCCGGGCGCGTGAGACTGAGATTCrlmA-1-F GTCTCGGTCTTTATCGTTCCCAAGGrlmA-1-R AGACGTCCTGAAGTAGAGTACCATACCCrlmA-2-F CTCGCAAGCTTTCTCCCTCATGGGTCGAAGrlmA-2-R AGGGACTCGAGGCGGATGTCATGTTTTTGCrlmA-3-F CGACCACAAGCTAAAGCTCAGATACCGAGCrlmA-3-R GCTCGGTATCTGAGCTTTAGCTTGTGGTCGrlmA-4-F CTGAAAGTCCAGGCTGCTAGCGAGAATTCrlmA-4-R GAATTCTCGCTAGCAGCCTGGACTTTCAGrlmA-5-F CATGAGCTAGCCTGATCAAGCAGTGACCrlmA-5-R TTGGCACTTAATACATGGTACTTCGGCACCrlmA-6-F CGAACCTGACTTCAATTGGATCGGTAGACCrlmA-6-R GGTCTACCGATCCAATTGAAGTCAGGTTCGrlmA-7-F CTTCTGCAAAACTGGTACCGAGTCATCCGGrlmA-7-R CCGGATGACTCGGTACCAGTTTTGCAGAAGRPL28-RT-F GACTAGAAAGCACAGAGGTCRPL28-RT-R GTCCAAGTTCAAGACTGG

VOL. 6, 2007 CELL WALL INTEGRITY SIGNALING IN A. NIDULANS 1499

on Decem


.org/D

ownloaded from

http://ec.asm.org/

NotI fragment containing the complete ORF from pGEM-AN8676.3 into theNotI site of pYES2.

Plasmids containing rlmA cDNA, its derivatives, yeast RLM1, and AN8676.3cDNA were used to transform S. cerevisiae GMY63-5D by the lithium acetatemethod (22), and we performed complementation analyses with the transfor-mants and the wild type (GMY63-5B; MATa ura3 leu2 trp1 his4 can1) maintainedon YPD medium (1% yeast extract, 2% polypepton, 2% glucose) or YPGmedium (in which the glucose in YPD medium was replaced with 2% galactose)containing 7 mM caffeine at 30°C for 3 or 6 days.

Complementation analysis of mpkA in an mpk1 deletion mutant. We amplifiedan A. nidulans mpkA cDNA fragment from an A. nidulans cDNA library by usingPCR primers mpkA-1-F and mpkA-1-R. The amplified cDNA fragment was thensubcloned into the pGEM-T Easy vector, resulting in pGEMmpkA, and DNAsequences of the cloned fragments were determined as described above.

An S. cerevisiae strain (TNP46; MATa mpk1�::HIS3 ura3 leu2 trp1 his3 ade2can1) that displays an autolytic lethal phenotype at 37°C was used for thecomplementation analysis. The expression plasmids used in this experiment wereconstructed with the multicopy expression vector YEpGAP, in which expressionis under the control of the constitutive GAPDH promoter. We constructedplasmid YEpGAPmpkA by inserting a NotI fragment containing the completeORF from pGEMmpkA into the NotI site of YEpGAP. We used YCplac33-MPK1 for the constitutive expression of yeast MPK1 as the positive control (62).

Plasmids containing mpkA cDNA and yeast MPK1 were used to transform S.cerevisiae TNP46 by the lithium acetate method (22), and a complementationanalysis with the transformants maintained on YPD medium at 23 and 37°C for3 days was performed.

Construction of an A. nidulans rlmA-argB gene disruptant. A fragment con-taining the full length of rlmA was amplified by PCR using genomic DNA of A.nidulans FGSC A89 and the primers rlmA-5-F and rlmA-5-R and was subclonedinto pGEM-T Easy, resulting in pGEMrlmA. Next, MfeI and KpnI sites wereintroduced into pGEMrlmA by using a QuikChange site-directed mutagenesiskit with the primers rlmA-6-F and rlmA-6-R for MfeI and rlmA-7-F and rlmA-7-R for KpnI, resulting in pTMKrlmA. A fragment of A. oryzae argB, whichcomplements the argB2 mutant of A. nidulans, was obtained from pAORB (13)by digestion with EcoRI and KpnI. The AoargB fragment was ligated into theEcoRI and KpnI sites of pTMKrlmA, resulting in pGEMrlmA::argB. An SphI-PstI fragment bearing rlmA::argB was ligated into the SphI and PstI sites ofpSOF31, containing the A. nidulans oliC31 gene, resulting in pSOFrlmA::argB.We transformed A. nidulans FGSC A89 by the protoplast method (17) with thelinear form of pSOFrlmA::argB by SphI digestion. We used A. nidulans oliC31 asa selection marker for homologous recombinants, which allowed the eliminationof ectopic integration of the targeting vector into chromosomes (58). A. nidulansoliC31 encodes a mutant subunit 9 of F1Fo-ATPase, and the expression of theoliC31 gene in A. nidulans indicates phenotypes that show resistance to oligo-mycin and hypersensitivity to triethyltin. When the targeting vector is integratedinto the target site by means of homologous recombination, the fragment ofoliC31 is excised and, thus, the homologous recombinants exhibit triethyltinresistance. On the other hand, when the targeting vector is integrated into anectopic site by means of nonhomologous recombination, the fragment of oliC31remains on the chromosome and the remaining fragment causes hypersensitivityto triethyltin. We used the following medium for positive selection: CD mediumsupplemented with a mixture of 0.02 �g of biotin/ml, 1% succinic acid, and0.000025% triethyltin (Strem Chemicals, Inc., Newburyport, MA) and in whichthe glucose was replaced with 0.3% sucrose (58). We confirmed rlmA disruptionand the integration of a single copy of rlmA::argB at the rlmA locus by Southernblot analysis. The construction of the disruptant is summarized in Fig. S1 in thesupplemental material, where confirmation of the success of this disruption isalso presented.

Construction of an A. nidulans mpkA-argB gene disruptant. A fragment con-taining the full length of mpkA was amplified by PCR using the primers mpkA-2-F and mpkA-2-R and was subcloned into pGEM-T Easy, resulting inpGEMmpkA. Next, MfeI and KpnI sites were introduced into pGEMmpkA byusing a QuikChange site-directed mutagenesis kit with the primers mpkA-3-Fand mpkA-3-R for MfeI and mpkA-4-F and mpkA-4-R for KpnI, resulting inpTMKmpkA. The AoargB fragment was ligated into the EcoRI and KpnI sites ofpTMKmpkA, resulting in pGEMrlmA::argB. We transformed A. nidulans FGSCA89 by the protoplast method (17) with the linear form of pGEMmpkA::argB byApaI digestion. We confirmed mpkA disruption and the integration of a singlecopy of mpkA::argB at the mpkA locus by Southern blot analysis. The construc-tion of the disruptant is summarized in Fig. S1 in the supplemental material,where confirmation of the success of this disruption is also presented.

Construction of an A. nidulans Answi4::argB gene disruptant. 5�- and 3�-flanking region fragments of Answi4 were amplified by PCR using the primers

Answi4-1-F (BglII), Answi4-1-R (KpnI), Answi4-2-F (MunI), and Answi4-2-R(XbaI) and digested by the indicated restriction enzymes. The two fragments andthe AoargB fragment were simultaneously ligated into the BglII and XbaI sitesof pSOF31, resulting in pSOFswi4::argB. We transformed A. nidulans FGSC A89by the protoplast method (17) with the linear form of pSOFswi4::argB by ApaIdigestion. We confirmed Answi4 disruption and the integration of a single copyof Answi4::argB at the Answi4 locus by Southern blot analysis. The constructionof the disruptant is summarized in Fig. S1 in the supplemental material, whereconfirmation of the success of this disruption is also presented.

Construction of an A. nidulans Answi6::argB gene disruptant. A fragmentcontaining the full length of Answi6 was amplified by PCR using the primersAnswi6-1-F and Answi6-1-R and was subcloned into pGEM-T Easy, resulting inpGEMswi6. Next, a KpnI site was introduced into pGEMswi6 by using aQuikChange site-directed mutagenesis kit with the primers Answi6-2-F andAnswi6-2-R, resulting in pTKswi6. The AoargB fragment (digested by KpnI-XbaI) was ligated into the KpnI and NheI sites of pTKmpkA, resulting inpGEMswi6::argB. An ApaI-SpeI fragment bearing Answi6::argB was ligated intothe ApaI and BlnI sites of pSOF31, resulting in pSOFswi6::argB. We trans-formed A. nidulans FGSC A89 by the protoplast method (17) with the linearform of pSOFswi6::argB by ApaI digestion. We confirmed Answi6 disruption andthe integration of a single copy of Answi6::argB at the Answi6 locus by Southernblot analysis. The construction of the disruptant is summarized in Fig. S1 in thesupplemental material, where confirmation of the success of this disruption isalso presented.

Fluorescence microscopy. We inoculated conidiospores (ca. 4 � 108) of thewild-type and rlmA� strains of A. nidulans into 200 ml of CD liquid medium andcultured the cells for 24 h at 30°C with shaking at 160 rpm. The cells from eachculture were dried onto the glass slides for fixation. The glass slides were trans-ferred into 3.5% formaldehyde containing a mixture of 50 mM PIPES [pipera-zine-N,N�-bis(2-ethanesulfonic acid)], 5 mM MgSO4, and 25 mM EGTA (PEMbuffer; pH 7.0) for fixation and were incubated at room temperature for 45 min.The glass slides were washed three successive times in PEM buffer for 10 mineach and further incubated in PEM buffer containing 10 �g of calcofluor white(CFW)/ml for 10 min at 25°C. After being stained with CFW, the glass slideswere washed three successive times in PEM buffer for 5 min each time. Cellswere observed using an FV1000 confocal laser scanning microscope (Olympus,Tokyo, Japan).

Preparation of cell extracts from A. nidulans and immunoblot analysis. Conid-iospores (ca. 4 � 108) of the wild-type and mpkA� strains of A. nidulans wereinoculated into 200 ml of CD liquid medium, and the cells were cultured at 30°Cwith shaking at 180 rpm. After 24 h, we added micafungin (Fujisawa Pharma-ceutical, Osaka, Japan), which is a �-1,3-glucan synthase inhibitor, at a concen-tration of 0.01 �g/ml. We carried out the isolation of total protein samples andimmunoblot analysis as described previously (14). Each sample (40 �g of pro-tein) was subjected to SDS-polyacrylamide gel electrophoresis. The dual phos-phorylation of MpkA was detected using an anti-phospho-p44/42 MAPK (CellSignaling Technology, Inc., Beverly, MA). To detect MpkA, we used the anti-extracellular signal-regulated kinase 2 antibody (Sigma, St. Louis, MO).

Preparation of cell extracts from S. cerevisiae and immunoblot analysis. StrainW303-1A (MATa ura3 leu2 trp1 his3 ade2 can1) was grown to an A600 of 0.7 inYPD medium at 30°C, and then micafungin was added to the medium to a finalconcentration of 1 �g/ml. Cells were suspended in protein extraction buffer (120mM Tris � HCl [pH 8.8], 5% SDS, 5% mercaptoethanol, 10% glycerol, and 1 mMsodium vanadate). The suspension was immediately boiled for 10 min, and thencell debris was removed by centrifugation for 10 min at 15,000 � g. Each sample(50 �g of protein) was subjected to SDS-polyacrylamide gel electrophoresis. Thedual phosphorylation of Mpk1p was examined by immunoblot analysis using ananti-phospho-p44/42 MAPK (Cell Signaling Technology, Inc., Beverly, MA). Todetect Mpk1p, we used the anti-Mpk1p antibody (Santa Cruz Biotechnology,Santa Cruz, CA). Antibody binding was visualized using an ECL kit (Amersham)after the binding of a horseradish peroxidase-conjugated second antibody.

Preparation of total RNA from S. cerevisiae. Wild-type (GMY63-5B) andrlm1� (GMY63-5D) strains were grown to an A600 of 0.7 in YPD medium at30°C, and then micafungin was added to the medium to a final concentration of1 �g/ml. We prepared total RNA from the collected cells by using Sepasol-RNAI Super according to the instructions of the manufacturer (Nacalai Tesque,Kyoto, Japan).

Northern hybridization. We inoculated conidiospores (ca. 4 � 108) of thewild-type, Answi4�, and Answi6� strains of A. nidulans into 200 ml of CD liquidmedium and cultured the cells at 30°C with shaking at 180 rpm. After 24 h, weadded 0.01 �g of micafungin/ml. We collected the mycelia and quickly frozethem in liquid nitrogen. The frozen mycelia were ground into a fine powder witha mortar and pestle chilled with liquid nitrogen. We prepared total RNA from


on Decem


.org/D

ownloaded from

http://ec.asm.org/

the powdered cells by using Sepasol-RNA I Super according to the instructionsof the manufacturer (Nacalai Tesque). We isolated mRNA from the total RNAby using an Oligotex-dT30 (Super) mRNA purification kit (TaKaRa Bio Inc.,Tokyo, Japan) according to the manufacturer’s instructions.

We electrophoresed mRNAs (500 ng each) through an agarose-formaldehydegel and transferred them onto Hybond-N� nylon membranes (Amersham Bio-sciences Inc., Tokyo, Japan) by using 7.5 mM NaOH. Blotted membranes werehybridized with the probes for mpkA of A. nidulans. The probe for the histoneH2B gene was used as a quantitative control.

We prepared the mpkA probe by PCR amplification with two primers (mpkA-1-F and mpkA-1-R) by using the A. nidulans cDNA library as the template. Aprobe for the histone H2B gene was prepared by PCR using the primers Histone-P-F and Histone-P-R against A. nidulans genomic DNA. These probes werelabeled with [�-32P]dCTP by using a Rediprime II kit (Amersham Biosciences).We then hybridized each blot at 60°C with either of the [�-32P]dCTP-labeledprobes, as described above. We washed the blots in a mixture of 2� SSC (1�SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and 0.1% SDS at roomtemperature for 20 min and then twice in 1� SSC–0.1% SDS at 65°C for 15 mineach time and detected the results by means of autoradiography.

Quantitative reverse transcription-PCR (RT-PCR). We reverse transcribed250 ng of mRNA (A. nidulans) or 5 �g of total RNA (S. cerevisiae) and amplifiedcDNA samples by PCR. The histone H2B (A. nidulans) or RPL28 (S. cerevisiae)gene was used to standardize the mRNA levels of the target genes. QuantitativePCR analysis was performed using the DNA Engine Opticon 2 system (Bio-Rad)and the DyNAmo SYBR green quantitative PCR kit (Finnzymes, Espoo, Fin-land). We used the following primers: mpkA-RT-F and mpkA-RT-R for mpkA,agsA-RT-F and agsA-RT-R for agsA, agsB-RT-F and agsB-RT-R for agsB,fksA-RT-F and fksA-RT-R for fksA, gelA-RT-F and gelA-RT-R for gelA, gelB-RT-F and gelB-RT-R for gelB, chsA-RT-F and chsA-RT-R for chsA, chsB-RT-Fand chsB-RT-R for chsB, chsC-RT-F and chsC-RT-R for chsC, chsD-RT-Fand chsD-RT-R for chsD, csmA-RT-F and csmA-RT-R for csmA, csmB-RT-F andcsmB-RT-R for csmB, gfaA-RT-F and gfaA-RT-R for gfaA, Histone-RT-F andHistone-RT-R for the histone H2B gene, MLP1-RT-F and MLP1-RT-R for MLP1,and RPL28-RT-F and RPL28-RT-R for the RPL28 gene.

Construction of a plasmid containing an mpkA-�-glucuronidase (GUS) genefusion. A fragment containing E. coli uidA (from pNGAG1; kindly provided byK. Gomi of Tohoku University), which has an NotI site in the 5� upstream region,was ligated into the PstI and XbaI sites of pUC142 (12), resulting in pUC(N)GUS.We constructed pAURGUS, which contains the E. coli uidA gene and the A.oryzae agdA terminator and is an autonomously replicating plasmid, as follows.The fragment containing uidA and the agdA terminator was obtained frompUC(N)GUS by digestion with BamHI and was ligated into the BamHI site ofpAUR316 (TaKaRa), which has the AMA1 replication origin (1, 15) and theaureobasidin A resistance gene (33), resulting in pAURGUS. We amplified thempkA promoter fragment from A. nidulans genomic DNA using two PCR prim-ers (P-mpkA-F and P-mpkA-R). We subcloned the amplified promoter fragmentinto the pGEM-T Easy vector, resulting in pGEMmpkA(P). We then obtainedthe fragment containing the mpkA promoter from pGEMmpkA(P) by digestionwith NotI and ligated the fragment into the NotI site of pAURGUS, resulting inpAURGUSmpkA.

GUS assay. We transformed the A. nidulans wild-type and mpkA� strains withpAURGUS or pAURGUSmpkA by the protoplast method (17). We selected thetransformants on CD medium supplemented with 0.02 �g of biotin/ml and 2 �gof aureobasidin A/ml. We inoculated conidiospores (ca. 4 � 108) of the trans-formants into 200 ml of CD liquid medium and cultured the cells at 30°C withshaking at 180 rpm. After 48 h, we added 0.01 �g of micafungin/ml. We collectedthe mycelia and quickly froze them in liquid nitrogen. We ground the frozenmycelia into a fine powder with a mortar and pestle chilled with liquid nitrogenand immediately resuspended the mycelia in a protein extraction buffer (50 mMsodium phosphate [pH 7.0], 10 mM EDTA, 0.1% [wt/vol] Triton X-100, and 10mM 2-mercaptoethanol). We placed the suspension on ice for 30 min and thenremoved cell debris by centrifugation for 10 min at 15,000 � g. We assayed theGUS activity of the cell extract in a buffer (50 mM sodium phosphate [pH 7.0],0.1% Triton X-100, and 1 mM p-nitrophenyl-�-D-glucuronide). Reactionsoccurred in 200-�l volumes at 37°C and were terminated by the addition of 80�l of 1 N NaOH. We measured p-nitrophenol absorbance at 415 nm anddefined 1 U as the amount of enzyme that produced 1 nmol of p-nitrophenol/minat 37°C. We determined the protein concentration of the supernatant by using abicinchoninic acid protein assay reagent kit (Pierce).

Nucleotide sequence accession number. We have submitted the sequence datafor the rlmA gene of A. nidulans to the DDBJ and the EMBL and GenBankdatabases under accession number AB110208.

RESULTS

Isolation of rlmA cDNA. We used the BLAST networkservice (Blast2; http://www.broad.mit.edu/annotation/genome/aspergillus_nidulans/Blast.html) to search the A. nidulans ge-nome database for genes homologous to S. cerevisiae RLM1,which encodes Rlm1p, a member of the MADS box family oftranscription factors that functions downstream of Mpk1pMAPK in the CWIS system. We found two cDNA sequences(AN2984.3 and AN8676.3) that encode putative proteins con-taining motifs with high degrees of identity (76 and 46%, re-spectively) to the MADS domain of Rlm1p. We isolated thetwo putative genes from an A. nidulans cDNA library by meansof PCR and determined the entire nucleotide sequences. TheAN2984.3 cDNA fragment contains an 1,818-bp ORF thatencodes a single polypeptide of 605 amino acid residues with apredicted molecular mass of 65 kDa. This AN2984.3 productcontains a 59-amino-acid MADS domain with an N-terminalregion highly homologous to the N-terminal region of theMADS domain of yeast Rlm1p; however, the rest of the re-gions did not show any significant similarity to the yeast Rlm1p(�13%), except for one region that is highly homologous tothe Mpk1p docking site of yeast Rlm1p (Fig. 2A). On the otherhand, the AN8676.3 cDNA fragment contains a 675-bp ORFthat encodes a single polypeptide of 224 amino acid residues,and that putative protein has only a 58-aa MADS domain.Therefore, we designated the AN2984.3 fragment rlmA andtreated it as the counterpart of S. cerevisiae RLM1. By searchingother fungal genome databases (those for A. fumigatus [http://tigrblast.tigr.org/ufmg/index.cgi?databasea_fumigatus] andNeurospora crassa [http://www.broad.mit.edu/annotation/fungi/neurospora_crassa_7/index.html]) with the nucleotide se-quence of rlmA, we found several orthologs of rlmA in otherfungi, and the alignment of the amino acid sequences of theirtranscripts with that of RlmA indicated that only their MADSdomains and MAPK docking sites are highly conserved.

A. nidulans rlmA complements an S. cerevisiae rlm1 mutant.Because RlmA is structurally related to the yeast Rlm1p, weinvestigated the in vivo function of RlmA using yeast rlm1mutants. S. cerevisiae rlm1 mutants are sensitive to caffeine (7mM), as are mpk1 mutants in which the functioning of theMAPK Mpk1p in the CWIS system has been lost, although themechanism for the sensitivity of the rlm1 and mpk1 mutants tocaffeine remains unknown (19). We introduced the rlmAcDNA into the S. cerevisiae rlm1 mutant under the control ofthe galactose-inducible GAL1 promoter to examine the func-tionality of RlmA. The overexpression of the rlmA cDNAsuppressed the caffeine sensitivity of the rlm1 mutant in thepresence of galactose (Fig. 2B). MAPKs are known to bind totheir target proteins (for instance, transcription factors) atMAPK docking sites that differ from the phosphorylation sitesin the target proteins (60). The MAPK docking site in eachtarget protein is thought to determine the specificity of bindingto the corresponding MAPK. In the yeast Rlm1p, the site(L324 to P329) is the docking site for Mpk1p, which is shownby the fact that the replacement of the amino acids in thedocking site for Rlm1p resulted in a loss of transcription acti-vation (Fig. 2A). We found a putative docking site in A. nidu-lans RlmA (L432 to P437), and the replacement of the aminoacids of the putative docking site with alanine resulted in failed


on Decem


.org/D

ownloaded from

http://ec.asm.org/

complementation of the yeast rlm1� mutant. Additionally, wecarried out complementation analysis of AN8676.3 in an rlm1�strain, but AN8676.3 failed to complement the rlm1� mutant(Fig. 2C).

A. nidulans mpkA complements an S. cerevisiae mpk1 mutant.In S. cerevisiae, Rlm1p is phosphorylated and consequentlyactivated by the MAPK Mpk1p, which belongs to the cell wallintegrity pathway, resulting in the transcriptional regulation ofgenes coding for cell wall biogenesis by the phosphorylatedRlm1p. Bussink and Osmani (5) isolated a putative mpkA genehomologous to the yeast MPK1 gene based on the homology ofthe predicted amino acid sequences and constructed an mpkAgene disruptant. However, it has not yet been demonstratedwhether the putative mpkA possesses the same function asMPK1. We reported previously that the A. oryzae mpkA gene,homologous to MPK1, complements the yeast mpk1 mutant(41). We examined whether the mpkA homolog would com-plement an S. cerevisiae mpk1 mutant that is thermosensitive at37°C. The S. cerevisiae mpk1 mutant was transformed with thempkA cDNA, and the mpkA gene was expressed under thecontrol of the yeast GAPDH promoter. The mpkA gene com-plemented the yeast mpk1 mutant (Fig. 3). This result suggeststhat A. nidulans mpkA has in vivo functionality similar to thatof yeast MPK1.

Isolation of an A. nidulans rlmA disruptant (rlmA�) and itsphenotype. To investigate the in vivo function of rlmA, weconstructed an A. nidulans rlmA� strain in which part of thenative rlmA gene was replaced by the A. oryzae argB selectablemarker, which complements the argB2 mutation in A. nidulans.The A. nidulans rlmA� strain produced conidiophores in CD

liquid medium (in a 24-h culture at 30°C), but the wild type didnot (see Fig. S2 in the supplemental material). The rlmA�mutant grew normally on CD agar plates, as did the wild-typestrain, and showed no major differences in morphological phe-notypes on the plates. The rlmA� strain was sensitive to apotent inhibitor of chitin synthesis (CFW) at 30 �g/ml on CDagar plates (Fig. 4), but the rlmA� and wild-type strains exhib-ited almost the same level of sensitivity to the �-1,3-glucansynthase inhibitor micafungin (data not shown).

MpkA phosphorylation by micafungin treatment. In S.cerevisiae, treatment with inhibitors of cell wall biosynthesis hasbeen shown to activate CWIS, resulting in the activation of theMAPK Mpk1p by phosphorylation (10, 51). The activatedMpk1p then phosphorylates and activates the transcription

FIG. 2. A. nidulans rlmA complements an S. cerevisiae rlm1� mutant, while rlmA derivatives and AN8676.3 do not. (A) The mutation of residuesL432 and V434 into Ala yielded mutant M1, and the mutation of residues I436 and P437 into Ala yielded mutant M2. (B and C) Serial fivefolddilutions of rlm1 mutants harboring the following plasmids were spotted onto plates supplemented with 7 mM caffeine and 2% glucose or 2%galactose at 30°C for 3 days (Glc or Gal alone) or 6 days (Glc-caffeine or Gal-caffeine): pYES2 (vector), YEp195-RLM1 (RLM1 wild type; Rlm1p),pYESrlmA (rlmA wild type; RlmA), pYESrlmA-M1 (rlmA mutant M1; RlmA-M1), pYESrlmA-M2 (rlmA mutant M2; RlmA-M2), and pYES-AN8676.3 (AN8676.3). A. nidulans rlmA, its derivatives, and AN8676.3 were transcribed by the yeast GAL1 promoter, which is inducible andrepressible in the presence of galactose and glucose, respectively. The yeast rlm1 mutant is sensitive to caffeine, and the expression of the wild-typerlmA or yeast RLM1 gene, but not that of rlmA derivatives and AN8676.3, suppressed the caffeine sensitivity of the yeast rlm1 mutant.

FIG. 3. Complementation of the mpk1 mutant by expression ofthe mpkA cDNA. Serial fivefold dilutions of mpk1 mutants harbor-ing the following plasmids were spotted onto YPD plates at 23 and37°C for 3 days: YEpGAP (vector), YCplac33-MPK1 (Mpk1p), andYEpGAPmpkA (MpkA). A. nidulans mpkA was transcribed by theconstitutive GAPDH promoter. The yeast mpk1 mutant displays anautolytic lethal phenotype at 37°C, and the expression of the mpkAor yeast MPK1 gene suppressed the thermosensitivity of the yeastmpk1 mutant.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

factor Rlm1p, which subsequently regulates the levels of tran-scription of 25 cell wall-related genes, including MPK1 (25). Toexamine whether RlmA regulates the transcription of cell wall-related genes in A. nidulans, we investigated the effect of theactivation of CWIS on the levels of transcripts of mpkA andcell wall-related genes in the rlmA� and wild-type strains. In S.cerevisiae and Cryptococcus neoformans, caspofungin, a typical�-1,3-glucan synthase inhibitor belonging to the echinocandingroup, perturbs cell wall biosynthesis and activates CWIS, re-sulting in increases in the phosphorylation levels of Mpk1pin S. cerevisiae or its ortholog in C. neoformans (32, 51).Micafungin is the latest echinocandin compound and exhibitsa strong inhibitory effect on fungal �-1,3-glucan synthases, in-cluding those of aspergilli. The phosphorylation of S. cerevisiaeMpk1p was induced by micafungin (Fig. 5A). Caspofungintreatment is known to upregulate the level of transcription ofMLP1, which encodes a paralog of Mpk1p, in the S. cerevisiaewild-type strain but not in the rlm1� strain (25, 51). Micafungintreatment also upregulated the level of MLP1 transcription inthe wild type but not in the rlm1� strain (Fig. 5B). Therefore,micafungin treatment activated CWIS in S. cerevisiae viaRlm1p as well as caspofungin treatment. When cells of the A.nidulans wild-type strain were treated with micafungin, thephosphorylation of MpkA was detected using the anti-phos-pho-p44/42 MAPK antibody. Levels of phosphorylation ofMpkA in the wild-type strain increased within 10 min after theaddition of micafungin (Fig. 5C), suggesting that micafungintreatment can activate CWIS in A. nidulans and S. cerevisiae.We analyzed the time course of levels of mpkA transcriptionwhen MpkA was phosphorylated by CWIS triggered by themicafungin treatment. Transcription levels of mpkA reached aplateau by 30 min after micafungin treatment, then decreased(Fig. 6A).

Transcriptional analysis of mpkA and of the cell wall-relatedgenes in the rlmA� strain. After cells of the wild-type andrlmA� strains were treated with micafungin for 0, 30, 60, or 120min, we analyzed the levels of transcription of mpkA and of thecell wall-related genes agsA and agsB (two �-1,3-glucan syn-thase genes); fksA (a �-1,3-glucan synthase gene); gelA andgelB (two �-1,3-glucanosyl transferase genes orthologous to A.fumigatus GEL1 and GEL2); chsA, chsB, chsC, chsD, csmA,and csmB (chitin synthase genes); and gfaA (the glutamine–fructose-6-phosphate amidotransferase gene) by quantitativeRT-PCR. Levels of transcription of mpkA, fksA, gelA, gelB,gfaA, and all the chitin synthase genes in the two strains were

upregulated within 30 min by treatment with micafungin (Fig.6A and D to M). Levels of gfaA transcription in the A. nidulansrlmA� strain after micafungin treatment were lower than thosein the wild-type strain (P � 0.009) (Fig. 6M). Levels of agsAtranscripts were significantly lower in the wild-type strain withor without micafungin treatment. However, levels of agsA tran-scription in the rlmA� strain increased in a time-dependentmanner after micafungin treatment (Fig. 6B). On the otherhand, the transcription of agsB in the wild type but not in therlmA� strain was markedly enhanced after micafungin treat-ment, suggesting that the transcription of agsB depends onRlmA (Fig. 6C).

FIG. 4. The rlmA� strain exhibited sensitivity to CFW. A wild-typestrain and an rlmA� strain were inoculated (as a suspension of ca. 104

conidiospores) onto minimal-medium plates containing CFW, a potentinhibitor of chitin synthesis, and were cultured at 30°C for 6 days.

FIG. 5. Micafungin-activated CWIS of S. cerevisiae and A. nidulans.(A) The S. cerevisiae wild-type strain was grown to an A600 of 0.7 inYPD medium at 30°C and then treated with 1 �g of micafungin/ml(final concentration). The upper panel shows the results of immuno-blotting with anti-phospho-p44/42 MAPK antibodies (anti-p44/42).The lower panel shows the results of immunoblotting with anti-Mpk1pantibodies (anti-Mpk1) as a loading control. (B) The S. cerevisiaewild-type and rlm1� strains were grown to an A600 of 0.7 in YPDmedium at 30°C and then treated with 1 �g of micafungin/ml (finalconcentration). Levels of transcription of MLP1 were determined byquantitative RT-PCR using specific primers (Table 1). As an internalcontrol, the RT-PCR mixture contained a primer pair specific for theRPL28 gene. The y axis displays relative mRNA levels. t, time. (C) TheA. nidulans wild-type strain was cultured at 30°C for 24 h in CD liquidmedium and treated with 0.01 �g of micafungin/ml (final concentra-tion). The upper panel shows the results of immunoblotting with anti-phospho-p44/42 MAPK antibodies. The lower panel shows the resultsof immunoblotting with anti-extracellular signal-regulated kinase 2antibodies (anti-ERK-2) as a loading control.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

The rlmA� and wild-type strains had similar levels of tran-scripts of mpkA, gelA, gelB, and all chitin synthase genes beforeand after micafungin treatment (Fig. 6A, E, and F). The twostrains exhibited similar changes in levels of fksA transcripts

after micafungin treatment (i.e., an initial increase, followed bya decrease), but the levels in the rlmA� strain were lower thanthose in the wild type during the time course analysis (Fig. 6D).These observations differ significantly from those in a previous

FIG. 6. Analysis of expression of cell wall-related genes and mpkA in rlmA� and mpkA� strains. Levels of transcription of the indicated geneswere determined by means of quantitative RT-PCR using specific primers (Table 1) for each gene. As an internal control, each RT-PCR mixturealso contained a primer pair specific for a histone H2B gene. The y axes display relative mRNA levels. Cells of the wild-type, rlmA�, and mpkA�strains were precultured to the logarithmic growth phase at 30°C and further incubated with 0.01 �g of micafungin/ml (final concentration) at 30°Cfor 0, 30, 60, or 120 min. Total RNAs were extracted from the cells. t, time.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

report that the S. cerevisiae rlm1� strain lost transcriptionalregulation of at least 25 cell wall-related genes, includingMPK1 (25). Hence, these results suggest that RlmA is not amajor transcription factor regulated by the CWIS pathway inA. nidulans.

Transcriptional analysis of mpkA and cell wall-related genesin the mpkA� strain. Since the rlmA� mutation did not alterthe levels of transcription of mpkA or of the cell wall-relatedgenes that we examined (except gfaA, agsA, and agsB), other,unknown transcription factors may be involved in the tran-scriptional regulation of mpkA and the cell wall-related genes.We propose the following two possibilities. First, MpkA that isactivated by CWIS may phosphorylate unidentified transcrip-tion factors that would then regulate the transcription of mpkAand other genes involved in cell wall biogenesis. Second, tran-

scription factors that are not under the control of MpkA CWISmay regulate the levels of transcription of mpkA and some ofthe other cell wall-related genes. To examine these possibili-ties, we constructed an mpkA� mutant and analyzed the levelsof transcription of other cell wall-related genes. Bussink andOsmani (5) reported that the A. nidulans mpkA� mutant showssignificant defects in the germination of conidiospores and inthe polarized growth of mycelia, and we observed similar re-sults with our A. nidulans mpkA� strain. Our mpkA� strainexhibited sensitivity to micafungin (10 ng/ml) and CFW (10�g/ml) (Fig. 7). After 0, 30, 60, and 120 min of micafungintreatment, we compared the levels of transcription of thempkA, agsA, agsB, fksA, gelA, gelB, chsA, chsB, chsC, chsD,csmA, csmB, and gfaA genes in the wild-type and mpkA�strains (Fig. 6).

Levels of transcripts of fksA, gelA, gelB, and gfaA and of allthe chitin synthase genes increased within 30 min after mica-fungin treatment in both the wild-type and mpkA� strains (Fig.6D to F and M). However, levels of gfaA transcription in thempkA� strain after micafungin treatment were apparentlylower than those in the wild-type strain (P � 0.003) (Fig. 6M).Levels of the ags transcripts differed most obviously betweenthe mpkA� and wild-type strains. As described above, agsAtranscripts in the wild type remained at low levels regardless ofmicafungin treatment but the transcription of agsB in the wildtype was apparently upregulated after micafungin treatment.In contrast, the transcription of agsA in the mpkA� strain wasupregulated regardless of micafungin treatment and the tran-scription of agsB was maintained at low levels with or withoutmicafungin treatment (Fig. 6B and C). Changes in the levels oftranscription of the other cell wall-related genes in the mpkA�and wild-type strains after micafungin treatment were similar.

Transcription of mpkA is autoregulated by MpkA. To exam-ine whether the mpkA promoter is autoregulated by CWIS viaMpkA, we constructed an mpkA promoter fused with the E.coli uidA gene, which encodes GUS, as a reporter gene andintroduced the reporter into the wild-type and mpkA� strains.We then analyzed the expression of GUS in the presence orabsence of micafungin. As shown in Fig. 8, high basal levels ofGUS activity in the wild-type strain were found and micafungin

FIG. 7. The mpkA� strain exhibited sensitivity to CFW and mica-fungin. A wild-type strain and an mpkA� strain were inoculated (as asuspension of ca. 104 conidiospores) onto minimal-medium plates con-taining CFW, a potent inhibitor of chitin synthesis (A), and a �-1,3-glucan synthase inhibitor, micafungin (B), and were cultured at 30°Cfor 6 days.

FIG. 8. Assay of GUS activity with mpkA-GUS gene fusion in the mpkA� strain. (A) Construction of the plasmid used for the reporter assay.uidA, T-agdA, aurAR, and AMA1 represent (respectively) the E. coli GUS gene as the reporter, the terminator region of the A. oryzae agdA gene,the A. nidulans aureobasidin A resistance gene as a selectable marker, and the A. nidulans replication origin. The plasmid containing the mpkApromoter (up to 995 bp upstream of the translation initiation codon) was designated pAURGUSmpkA. (B) GUS activities of the transformantswith the mpkA promoter (P-mpkA)-GUS gene fusion. GUS activity was measured as described in Materials and Methods.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

treatment increased GUS activity. However, the mpkA� strainshowed little GUS activity, with or without micafungin treat-ment. These results indicate that the transcription of mpkA isautoregulated by MpkA that has been activated by CWIS.

Northern blot analysis of the Answi4� and Answi6� strains.In S. cerevisiae, Mpk1p is known to activate another transcrip-tion regulatory complex (SBF, composed of Swi4p and Swi6p)in a manner that depends on the stage of the cell cycle.Because RlmA was not a major transcription factor for A.nidulans mpkA, there are two other possibilities for a putativetranscription factor that would control the transcription ofmpkA through CWIS: (i) orthologs (AnSwi4 and AnSwi6) of S.cerevisiae SBF (Swi4p-Swi6p) or (ii) other, unknown transcrip-tion factors. S. cerevisiae Swi4p possesses an APSES (Asm-1,Phd1, StuA, Efg1, and Sok2) DNA-binding domain (2, 48) andankyrin (ANK) repeats that are thought to be involved inprotein-protein interactions (54), whereas Swi6p has only ANKrepeats (63). We searched the A. nidulans genome database forgenes encoding proteins homologous to S. cerevisiae Swi4p andSwi6p and found two genes (AN3154.3 and AN6715.3) thatencode proteins with similarity scores (E [expect] values) of1020 for Swi4p and 1036 for Swi6p. The two putative pro-teins contained both APSES domains and ANK repeats. Wealso searched the S. cerevisiae genome database for genes en-coding proteins homologous to the two putative A. nidulansproteins, and these two putative proteins had the highest Evalues for Swi4p and Swi6p. Therefore, we designatedAN3154.3 Answi4 and AN6715.3 Answi6. Since we could iso-late cDNA of Answi4 and Answi6 from A. nidulans cDNAlibraries, the two genes were expressed in A. nidulans (data notshown). To examine whether AnSwi4 and AnSwi6 regulate thetranscription of mpkA, we constructed Answi4 and Answi6disruptants (Answi4� and Answi6� strains). We deleted mostof the ORFs, including those corresponding to the N termini,DNA-binding APSES domains, and ANK repeats, by replacingthem with the A. oryzae argB gene. Both the Answi4� andAnswi6� strains formed conidiospores that were lighter incolor than those of the wild type but exhibited no other obviousphenotypic changes. When we treated the two disruptants withmicafungin to activate CWIS, levels of mpkA transcription inthe two mutants and in the wild type were similarly upregu-lated (Fig. 9). The levels of mpkA transcription in Answi4� andAnswi6� strains appeared to be higher than those in the wildtype, especially at 120 min, but the reason was not clear.Double mutants in which both Answi4 and Answi6 were dis-rupted also grew normally and did not show any significantphenotypic changes except the previously mentioned color ofthe conidiospores (data not shown). These results suggest thatthe transcription of mpkA is not regulated by Answi4 or An-swi6 through CWIS and depends on other, unknown transcrip-tion factors.

DISCUSSION

The recent progress of genome research on aspergilli, in-cluding A. nidulans, has demonstrated that the aspergilli pos-sess approximately twice as many genes as S. cerevisiae andgenomes approximately three times larger than that of S.cerevisiae (16). The genome research also suggests that theorganization of cell wall-related genes involved in cell wall

biogenesis (biosynthesis and/or degradation) of �-1,3-glucan,�-1,3-glucan, and chitin in the filamentous fungi differs fromthat in S. cerevisiae. Moreover, the organization of upstreamsensing and signaling machineries (G protein-coupled recep-tors, G protein � subunits, and two-component signaling pro-teins) in the aspergilli appears to be more complex than thatfound in S. cerevisiae (39). Although the filamentous fungi aremorphologically and developmentally distinctive from S. cer-evisiae, the comparative in silico reconstruction of the systemof genes for CWIS revealed that most homologs of the genescoding for the proteins organizing the Mpk1p-dependentCWIS in S. cerevisiae are well conserved in the three Aspergillusspecies examined, including A. nidulans (Fig. 1). The transcrip-tion factor Rlm1p activated by the MAPK Mpk1p via CWISplays a central role in the maintenance of cell wall integrity inS. cerevisiae. Taken together, the conservation of the genescoding for CWIS components and the diversity of cell wall-related genes in the aspergilli raise the following questions:which cell wall-related genes are under the control of theMpkA MAPK cascade and whether (and/or how) the con-served RlmA and MpkA proteins are physiologically crucialfor cell wall integrity in the aspergilli. In the present study, weconsidered the potentially critical role of CWIS in A. nidulansfrom the viewpoints of comparative transcriptional analyses ofcell wall-related genes in the wild-type, rlmA�, and mpkA�strains.

A. nidulans rlmA and mpkA are functional orthologs of S.cerevisiae RLM1 and MPK1. Although the A. niger rlmA (8) andA. nidulans mpkA (5) genes were isolated previously, it has notbeen shown whether the two genes are indeed functional or-thologs of S. cerevisiae RLM1 and MPK1, respectively. In thepresent study, we first carried out complementation experi-ments with rlm1 and mpk1 null mutants and A. nidulans rlmAand mpkA cDNA. The A. nidulans rlmA gene suppressed thecaffeine sensitivity of the yeast rlm1 mutant, but the rlmAmutated genes encoding RlmA derivatives in which amino acidresidues inside the MpkA docking site were replaced withalanine did not (Fig. 2B), suggesting the in vivo functionality ofA. nidulans RlmA in S. cerevisiae. Although the amino acid

FIG. 9. Expression of mpkA in response to micafungin in theAnswi4� and Answi6� disruption mutants. The expression of thempkA gene in the Answi4� strain (A) and the Answi6� strain (B) wasanalyzed by Northern blotting and compared with that in the wild type.A histone H2B gene was used as a control. Cells of all three strainswere precultured to the logarithmic growth phase at 30°C and furtherincubated with 0.01 �g of micafungin/ml (final concentration) at 30°Cfor 0, 30, 60, or 120 min. Total RNAs were extracted from the cells.Probes were prepared as described in Materials and Methods. t, time.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

sequence of RlmA shows low similarity to that of Rlm1p (only13%), except in the MADS domain, the small docking site inRlmA is required and is sufficient for CWIS in vivo. We alsocloned the A. nidulans mpkA gene (cDNA) and confirmed thatits expression suppressed the temperature sensitivity of the S.cerevisiae mpk1 mutant (Fig. 3), suggesting the in vivo func-tionality of A. nidulans MpkA in S. cerevisiae. The complemen-tation analyses clearly demonstrate that A. nidulans rlmA andmpkA are functional orthologs of RLM1 and MPK1, respec-tively.

In vivo functionalities of rlmA and mpkA in A. nidulansmarkedly differ from those of their orthologs in S. cerevisiae. Inorder to investigate the functionalities of rlmA and mpkA in A.nidulans, we further analyzed the transcriptional responsesof mpkA and other cell wall-related genes to treatment withmicafungin in the wild-type, rlmA�, and mpkA� strains (Fig. 6and 8). These transcriptional analyses suggested the followingfour major principles of the transcriptional regulation of mpkAand other cell wall-related genes (Fig. 10): (i) mpkA is MpkAdependent but not RlmA dependent; (ii) agsA and agsB areMpkA dependent and partly dependent on RlmA; (iii) gfaA ispartly dependent on both MpkA-RlmA and unidentified non-MpkA systems; and (iv) fksA, gelA, gelB, chsA, chsB, chsC,chsD, csmA, and csmB are independent of the MpkA system.In S. cerevisiae, the transcription of 25 cell wall-related genes(including MPK1, CHS3, and FKS1) is known to depend onRlm1p activated by Mpk1p (25), suggesting that Rlm1p is themajor transcription factor under the control of CWIS viaMpk1p. Since the prominent role of Rlm1p in the transcrip-tional regulation of cell wall-related genes is critical in themodel of CWIS and cell wall biogenesis in S. cerevisiae, itshould be considered whether RlmA and MpkA occupy posi-tions comparable to those of the yeast orthologs in respect toCWIS and cell wall biogenesis in A. nidulans. The in vivofunctionalities of rlmA and mpkA in A. nidulans with respect totranscriptional analyses of cell wall-related genes are furtherdiscussed in detail below.

�-1,3-Glucan synthase genes. �-1,3-Glucan is one of themajor cell wall polysaccharides in A. fumigatus (3, 40) andprobably in other aspergilli, including A. niger (9). A. nigerpossesses five �-1,3-glucan synthase genes (agsA to agsE) (9),and A. fumigatus is reported to have three �-1,3-glucan syn-thase genes (AGS1, AGS2, and AGS3) (3, 40) corresponding toA. niger agsE, agsD, and agsA, respectively. According to the A.nidulans genome database, A. nidulans has only two putative�-1,3-glucan synthase genes (agsA and agsB), which are thecounterparts of A. niger agsD and agsE, respectively (9). A.nidulans does not possess the ortholog of A. niger agsA, thetranscription of which depends partly on the transcription fac-tor RlmA (8). A. niger agsA disruptants (agsA�) and A. fumiga-tus disruptants mutated in AGS3 (the ortholog of A. niger agsA)were generated, but the disruptants did not show obviouslydifferent phenotypes under normal growth conditions, and the�-1,3-glucan contents were the same as those of the wild-typestrains (3, 9). Since an A. fumigatus AGS1 disruptant formshyperbranched hyphal tips and has a lower �-1,3-glucan con-tent than the wild type (3), the AfAGS1 class of genes seems tobe important for the biosynthesis of �-1,3-glucan. Levels oftranscripts of A. nidulans agsB were increased by micafungintreatment (Fig. 6C), just as levels of transcripts of A. niger agsE

were increased by CFW treatment (9). Although the levels oftranscription of agsB were upregulated after micafungin treat-ment, those in the rlmA� strain were significantly decreasedbefore and after micafungin treatment, and the transcription ofagsB was more severely diminished in the mpkA� strain (Fig.6C). These results suggest that the transcription of A. nidulansagsB depends mainly on MpkA-RlmA signaling. A. nidulansagsA is an ortholog of A. niger agsD and A. fumigatus AGS2.Because the disruption of A. fumigatus AGS2 causes hyper-branched hyphal tips (as does the disruption of AfAGS1), thisclass of ags genes also seems to be important for morphogen-esis in Aspergillus species (3). agsA transcripts were maintainedat low levels in the wild type even after micafungin treatment.However, the levels of transcripts of A. nidulans agsA in therlmA� strain increased in a time-dependent manner after mi-cafungin treatment, and the levels of agsA transcripts in thempkA� strain were upregulated regardless of micafungin treat-ment (Fig. 6B). The transcriptional analyses of agsA and agsBamong the wild-type, rlmA�, and mpkA� strains suggest thatagsB is involved in the response to cell wall stress throughMpkA-RlmA signaling whereas agsA functions in cells in whichMpkA-dependent CWIS is suppressed. CWIS seems to beimportant for the biosynthesis of �-1,3-glucan through thetranscriptional regulation of agsA and agsB in a reciprocalfashion. However, it remains unclear why the transcription ofagsA was not enhanced even when MpkA was activatedthrough CWIS by micafungin treatment, and thus, it remains

FIG. 10. Schematic model of transcriptional regulation of mpkAand of cell wall-related genes via cell wall stress signaling in A. nidu-lans. Based on the study results, we hypothesize that A. nidulans hasthe following transcriptional regulation system: (i) mpkA, MpkA de-pendent but not RlmA dependent; (ii) agsA and agsB, MpkA depen-dent and partly dependent on RlmA; (iii) gfaA, dependent on bothMpkA-RlmA and an unidentified non-MpkA system; and (iv) fksA,gelA, gelB, chsA, chsB, chsC, chsD, csmA, and csmB, independent of theMpkA-RlmA system. The cell wall integrity pathway regulates mainlythe transcription of �-1,3-glucan biogenesis-related genes. The tran-scripts of �-1,3-glucan and chitin biogenesis-related genes are regu-lated mainly by other, unknown signaling that may be activated by acell wall stress such as micafungin treatment. X, unknown factor; ,downregulated; �, upregulated.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

unclear whether RlmA is directly or indirectly involved in thetranscriptional regulation of agsA.

gfaA gene. In S. cerevisiae, levels of transcription of GFA1,which encodes a probable rate-limiting enzyme of chitin bio-synthesis, are regulated by Rlm1p (34, 59). When the myceliaof A. niger are treated with caspofungin, CFW, or SDS, thetranscription of gfaA (an ortholog of S. cerevisiae GFA1) isupregulated, and consequently, chitin biosynthesis is stimu-lated (50). Since the levels of transcripts of gfaA in the mpkA�strain were significantly lower than those in the wild type aftermicafungin treatment and those in the rlmA� strain were mod-erately lower than those in the wild type (P � 0.015) (Fig. 6M),we hypothesize that the transcription of gfaA depends onMpkA-RlmA as well as on other, unknown transcription fac-tors.

The 5� untranslated regions (ca. 1,000 bp) of A. niger gfaAand agsA contain consensus sequences [TA(A/T)4TAG] thatare similar to S. cerevisiae Rlm1p-binding sequences, and theconsensus sequences are thought to be involved in the tran-scriptional regulation of the two genes of A. niger throughRlmA (8). However, we could not identify such Rlm1p-bindingconsensus sequences in the 5� untranslated regions of A. nidu-lans gfaA, agsA, or agsB that seem to be regulated by CWISthrough RlmA. RlmA-binding consensus sequences in A. nidu-lans may thus differ from those in S. cerevisiae or A. niger.Another possibility is that RlmA is indirectly involved in thetranscriptional regulation of the three genes.

Chitin synthase genes. The levels of transcription of all sixchitin synthase genes (chsA, chsB, chsC, chsD, csmA, andcsmB) in the wild-type cells increased after micafungin treat-ment (Fig. 6G to L). The basal levels of transcripts of all chitinsynthase genes and changes in their levels after micafungintreatment were similar in the wild-type, rlmA�, and mpkA�strains. These results suggest that the basal levels of transcrip-tion of these genes and the increases in the transcription of thegenes after micafungin treatment are independent of CWIS viaMpkA and RlmA.

�-1,3-Glucan-related genes. The fksA, gelA, and gelB genesare involved in �-1,3-glucan biogenesis in Aspergillus species(11, 42). The transcription of S. cerevisiae FKS1 and FKS2genes, which encode subunits of �-1,3-glucan synthase, ispartly regulated by Rlm1p activated via CWIS (25). In A.nidulans, fksA is the only gene that encodes �-1,3-glucan syn-thase (29). Levels of fksA, gelA, and gelB transcription changedin the rlmA� and mpkA� strains after micafungin treatment,and the changes were similar to those observed in the wild type(Fig. 6D to F). These results suggest that the regulation of thetranscription of fksA, gelA, and gelB is independent of CWISvia MpkA and RlmA. Overall, the transcriptional regulation ofmost genes involved in the biosynthesis of �-1,3-glucan andchitin (except gfaA, the transcriptional levels of which weredecreased in the mpkA� strain) seems to be regulated by anunknown signaling mechanism activated by micafungin treat-ment rather than by CWIS via MpkA.

Autoregulation of mpkA transcription. The finding that thelevels of transcripts of mpkA were almost the same in thewild-type and rlmA� strains (Fig. 6A) suggests that the tran-scriptional upregulation of the gene is independent of RlmA,even under conditions in which MpkA is phosphorylated viaCWIS as a result of micafungin treatment (Fig. 5C). In contrast

to the production of GUS under the control of the mpkApromoter in the wild type, GUS activity in the mpkA� strainwas detected at very low levels and did not increase, even aftermicafungin treatment (Fig. 8); thus, the expression of mpkAseems to be autoregulated by CWIS via MpkA. We hypothe-size that transcription factors other than RlmA are required asthe targets of MpkA for the transcription of mpkA.

In S. cerevisiae, SBF (Swi4p-Swi6p), which is activated byMpk1p, is a G1/S-specific transcription complex for cell wallbiogenesis, but the details of SBF activation by the cell cycleremain unclear (20). Answi4 and Answi6 disruption mutantsboth grew as well as the wild type and did not exhibitsignificantly different phenotypes, with the exception thatthe mutants formed lighter-colored conidiospores. Whenthe two mutants and the wild type were treated with mica-fungin to activate CWIS, changes in mpkA transcriptionlevels were similar among the three strains (Fig. 9). Theresults of single and double mutations of Answi4 and Answi6suggest that unknown transcription factors other thanRlmA, AnSwi4, and AnSwi6 regulate the transcription ofmpkA in A. nidulans.

As shown in Fig. 1, the Crz1p protein of S. cerevisiae isanother transcription factor controlling the �-1,3-glucan syn-thase gene FKS2 and other cell wall-related genes throughCa2� signaling in response to several environmental stimuli (7,57). We previously isolated an A. nidulans crzA gene that is thecounterpart of CRZ1 and constructed a crzA� disruptant (A.Kondo, T. Fujioka, O. Mizutani, K. Furukawa, Y. Yamagata,and K. Abe, unpublished data). The crzA� mutant exhibitedthe same pattern of changes in mpkA transcripts after mica-fungin treatment as the wild-type strain, suggesting that CrzAis not a transcription factor that controls the levels of tran-scription of mpkA.

Recently, Bruno et al. (4) reported that Cas5 is a majortranscription factor involved in the cell wall damage responsein Candida albicans. However, there seems to be no genehomologous to CAS5 included in the A. nidulans genome da-tabase.

Overall view of CWIS via MpkA-dependent and -indepen-dent mechanisms. In conclusion, and in contrast to the prom-inent roles of Rlm1p and Swi4p-Swi6p in the maintenance ofcell wall integrity in S. cerevisiae, we propose that neitherRlmA nor Swi4-Swi6 in A. nidulans is a major transcriptionfactor in the control of the expression of mpkA or most cellwall-related genes (except the �-1,3-glucan synthase genesagsA and agsB) as the target of MpkA and that the expressionof mpkA seems to be autoregulated by CWIS via an unidenti-fied transcription factor as the target of MpkA (Fig. 10). A.nidulans RlmA activated by MpkA via CWIS seems to beinvolved in the transcriptional regulation of agsA and agsB in areciprocal fashion. In A. nidulans, the transcriptional regula-tion of most genes (except gfaA) involved in the biosynthesis of�-1,3-glucan and chitin seems to be regulated by an unknownsignaling mechanism that is activated by a cell wall stress suchas micafungin treatment rather than by CWIS via MpkA. Theidentification of the unknown transcription factor for mpkAand of a potential signaling pathway other than CWIS is now inprogress.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

ACKNOWLEDGMENTS

We thank Kunihiro Matsumoto of Nagoya University, Kenji Irie ofTsukuba University, Dai Hirata of Hiroshima University, Brenda An-drews of the University of Toronto, and Kim Nasmyth of the Univer-sity of Vienna for their kind gifts of S. cerevisiae mutants and plasmids.We also thank Fujisawa Pharmaceutical for providing micafungin.

This study was supported by a grant from the Bio-oriented Tech-nology Research Advancement Institution. The work was also sup-ported in part by a grant-in-aid for scientific research on a priority area(applied genome; no. 17019001) from the Ministry of Education, Cul-ture, Sports, Science and Technology of Japan.

REFERENCES

1. Aleksenko, A., I. Nikolaev, Y. Vinetski, and A. J. Clutterbuck. 1996. Geneexpression from replicating plasmids in Aspergillus nidulans. Mol. Gen.Genet. 253:242–246.

2. Aramayo, R., Y. Peleg, R. Addison, and R. Metzenberg. 1996. Asm-1�, aNeurospora crassa gene related to transcriptional regulators of fungal devel-opment. Genetics 144:991–1003.

3. Beauvais, A., D. Maubon, S. Park, W. Morelle, M. Tanguy, M. Huerre, D. S.Perlin, and J. P. Latge. 2005. Two �(1–3) glucan synthases with differentfunctions in Aspergillus fumigatus. Appl. Environ. Microbiol. 71:1531–1538.

4. Bruno, V. M., S. Kalachikov, R. Subaran, C. J. Nobile, C. Kyratsous, andA. P. Mitchell. 2006. Control of the C. albicans cell wall damage response bytranscriptional regulator Cas5. PLoS Pathog. 2:e21.

5. Bussink, H. J., and S. A. Osmani. 1999. A mitogen-activated protein kinase(MPKA) is involved in polarized growth in the filamentous fungus, Aspergil-lus nidulans. FEMS Microbiol. Lett. 173:117–125.

6. Costigan, C., S. Gehrung, and M. Snyder. 1992. A synthetic lethal screenidentifies SLK1, a novel protein kinase homolog implicated in yeast cellmorphogenesis and cell growth. Mol. Cell. Biol. 12:1162–1178.

7. Cyert, M. S. 2003. Calcineurin signaling in Saccharomyces cerevisiae: howyeast go crazy in response to stress. Biochem. Biophys. Res. Commun.311:1143–1150.

8. Damveld, R. A., M. Arentshorst, A. Franken, P. A. vanKuyk, F. M. Klis, C. A.van den Hondel, and A. F. Ram. 2005. The Aspergillus niger MADS-boxtranscription factor RlmA is required for cell wall reinforcement in responseto cell wall stress. Mol. Microbiol. 58:305–319.

9. Damveld, R. A., P. A. vanKuyk, M. Arentshorst, F. M. Klis, C. A. van denHondel, and A. F. Ram. 2005. Expression of agsA, one of five 1,3-alpha-D-glucan synthase-encoding genes in Aspergillus niger, is induced in response tocell wall stress. Fungal Genet. Biol. 42:165–177.

10. de Nobel, H., C. Ruiz, H. Martin, W. Morris, S. Brul, M. Molina, and F. M.Klis. 2000. Cell wall perturbation in yeast results in dual phosphorylation ofthe Slt2/Mpk1 MAP kinase and in an Slt2-mediated increase in FKS2-lacZexpression, glucanase resistance and thermotolerance. Microbiology 146:2121–2132.

11. Firon, A., A. Beauvais, J. P. Latge, E. Couve, M. C. Grosjean-Cournoyer, andC. D’Enfert. 2002. Characterization of essential genes by parasexual geneticsin the human fungal pathogen Aspergillus fumigatus: impact of genomicrearrangements associated with electroporation of DNA. Genetics161:1077–1087.

12. Furukawa, K., Y. Hoshi, T. Maeda, T. Nakajima, and K. Abe. 2005. Aspergil-lus nidulans HOG pathway is activated only by two-component signallingpathway in response to osmotic stress. Mol. Microbiol. 56:1246–1261.

13. Furukawa, K., Y. Katsuno, T. Urao, T. Yabe, T. Yamada-Okabe, H.Yamada-Okabe, Y. Yamagata, K. Abe, and T. Nakajima. 2002. Isolationand functional analysis of a gene, tcsB, encoding a transmembrane hybrid-type histidine kinase from Aspergillus nidulans. Appl. Environ. Microbiol.68:5304–5310.

14. Galagan, J. E., S. E. Calvo, C. Cuomo, L. J. Ma, J. R. Wortman, S. Batzo-glou, S. I. Lee, M. Basturkmen, C. C. Spevak, J. Clutterbuck, V. Kapitonov,J. Jurka, C. Scazzocchio, M. Farman, J. Butler, S. Purcell, S. Harris, G. H.Braus, O. Draht, S. Busch, C. D’Enfert, C. Bouchier, G. H. Goldman, D.Bell-Pedersen, S. Griffiths-Jones, J. H. Doonan, J. Yu, K. Vienken, A. Pain,M. Freitag, E. U. Selker, D. B. Archer, M. A. Penalva, B. R. Oakley, M.Momany, T. Tanaka, T. Kumagai, K. Asai, M. Machida, W. C. Nierman,D. W. Denning, M. Caddick, M. Hynes, M. Paoletti, R. Fischer, B. Miller, P.Dyer, M. S. Sachs, S. A. Osmani, and B. W. Birren. 2005. Sequencing ofAspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae.Nature 438:1105–1115.

15. Gems, D., I. L. Johnstone, and A. J. Clutterbuck. 1991. An autonomouslyreplicating plasmid transforms Aspergillus nidulans at high frequency. Gene98:61–67.

16. Goffeau, A., B. G. Barrell, H. Bussey, R. W. Davis, B. Dujon, H. Feldmann,F. Galibert, J. D. Hoheisel, C. Jacq, M. Johnston, E. J. Louis, H. W. Mewes,Y. Murakami, P. Philippsen, H. Tettelin, and S. G. Oliver. 1996. Life with6000 genes. Science 274: 546:563–567.

17. Gomi, K., Y. Iimura, and S. Hara. 1987. Integrative transformation of

Aspergillus oryzae with a plasmid containing the Aspergillus nidulans argBgene. Agric. Biol. Chem. 51:2549–2555.

18. Gray, J. V., J. P. Ogas, Y. Kamada, M. Stone, D. E. Levin, and I. Herskowitz.1997. A role for the Pkc1 MAP kinase pathway of Saccharomyces cerevisiaein bud emergence and identification of a putative upstream regulator.EMBO J. 16:4924–4937.

19. Heinisch, J. J., A. Lorberg, H. P. Schmitz, and J. J. Jacoby. 1999. The proteinkinase C-mediated MAP kinase pathway involved in the maintenance ofcellular integrity in Saccharomyces cerevisiae. Mol. Microbiol. 32:671–680.

20. Hohmann, S. 2002. Osmotic stress signaling and osmoadaptation in yeasts.Microbiol. Mol. Biol. Rev. 66:300–372.

21. Irie, K., M. Takase, K. S. Lee, D. E. Levin, H. Araki, K. Matsumoto, and Y.Oshima. 1993. MKK1 and MKK2, which encode Saccharomyces cerevisiaemitogen-activated protein kinase-kinase homologs, function in the pathwaymediated by protein kinase C. Mol. Cell. Biol. 13:3076–3083.

22. Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation ofintact yeast cells treated with alkali cations. J. Bacteriol. 153:163–168.

23. Iyer, V. R., C. E. Horak, C. S. Scafe, D. Botstein, M. Snyder, and P. O.Brown. 2001. Genomic binding sites of the yeast cell-cycle transcriptionfactors SBF and MBF. Nature 409:533–538.

24. Johnston, M. 1987. A model fungal gene regulatory mechanism: the GALgenes of Saccharomyces cerevisiae. Microbiol. Rev. 51:458–476.

25. Jung, U. S., and D. E. Levin. 1999. Genome-wide analysis of gene expressionregulated by the yeast cell wall integrity signalling pathway. Mol. Microbiol.34:1049–1057.

26. Jung, U. S., A. K. Sobering, M. J. Romeo, and D. E. Levin. 2002. Regulationof the yeast Rlm1 transcription factor by the Mpk1 cell wall integrity MAPkinase. Mol. Microbiol. 46:781–789.

27. Kamada, Y., H. Qadota, C. P. Python, Y. Anraku, Y. Ohya, and D. E. Levin.1996. Activation of yeast protein kinase C by Rho1 GTPase. J. Biol. Chem.271:9193–9196.

28. Kapteyn, J. C., H. Van Den Ende, and F. M. Klis. 1999. The contribution ofcell wall proteins to the organization of the yeast cell wall. Biochim. Biophys.Acta 1426:373–383.

29. Kelly, R., E. Register, M. J. Hsu, M. Kurtz, and J. Nielsen. 1996. Isolation ofa gene involved in 1,3-beta-glucan synthesis in Aspergillus nidulans and pu-rification of the corresponding protein. J. Bacteriol. 178:4381–4391.

30. Ketela, T., R. Green, and H. Bussey. 1999. Saccharomyces cerevisiae Mid2p isa potential cell wall stress sensor and upstream activator of the PKC1-MPK1cell integrity pathway. J. Bacteriol. 181:3330–3340.

31. Klis, F. M. 1994. Review: cell wall assembly in yeast. Yeast 10:851–869.32. Kraus, P. R., D. S. Fox, G. M. Cox, and J. Heitman. 2003. The Cryptococcus

neoformans MAP kinase Mpk1 regulates cell integrity in response to anti-fungal drugs and loss of calcineurin function. Mol. Microbiol. 48:1377–1387.

33. Kuroda, M., T. Hashida-Okado, R. Yasumoto, K. Gomi, I. Kato, and K.Takesako. 1999. An aureobasidin A resistance gene isolated from Aspergillusis a homolog of yeast AUR1, a gene responsible for inositol phosphorylcer-amide (IPC) synthase activity. Mol. Gen. Genet. 261:290–296.

34. Lagorce, A., V. Le Berre-Anton, B. Aguilar-Uscanga, H. Martin-Yken, A.Dagkessamanskaia, and J. Francois. 2002. Involvement of GFA1, whichencodes glutamine-fructose-6-phosphate amidotransferase, in the activationof the chitin synthesis pathway in response to cell-wall defects in Saccharo-myces cerevisiae. Eur. J. Biochem. 269:1697–1707.

35. Lee, K. S., K. Irie, Y. Gotoh, Y. Watanabe, H. Araki, E. Nishida, K. Matsu-moto, and D. E. Levin. 1993. A yeast mitogen-activated protein kinasehomolog (Mpk1p) mediates signalling by protein kinase C. Mol. Cell. Biol.13:3067–3075.

36. Lee, K. S., and D. E. Levin. 1992. Dominant mutations in a gene encoding aputative protein kinase (BCK1) bypass the requirement for a Saccharomycescerevisiae protein kinase C homolog. Mol. Cell. Biol. 12:172–182.

37. Levin, D. E. 2005. Cell wall integrity signaling in Saccharomyces cerevisiae.Microbiol. Mol. Biol. Rev. 69:262–291.

38. Levin, D. E., F. O. Fields, R. Kunisawa, J. M. Bishop, and J. Thorner. 1990.A candidate protein kinase C gene, PKC1, is required for the S. cerevisiae cellcycle. Cell 62:213–224.

39. Machida, M., K. Asai, M. Sano, T. Tanaka, T. Kumagai, G. Terai, K.Kusumoto, T. Arima, O. Akita, Y. Kashiwagi, K. Abe, K. Gomi, H. Horiuchi,K. Kitamoto, T. Kobayashi, M. Takeuchi, D. W. Denning, J. E. Galagan,W. C. Nierman, J. Yu, D. B. Archer, J. W. Bennett, D. Bhatnagar, T. E.Cleveland, N. D. Fedorova, O. Gotoh, H. Horikawa, A. Hosoyama, M. Ichi-nomiya, R. Igarashi, K. Iwashita, P. R. Juvvadi, M. Kato, Y. Kato, T. Kin, A.Kokubun, H. Maeda, N. Maeyama, J. Maruyama, H. Nagasaki, T. Nakajima,K. Oda, K. Okada, I. Paulsen, K. Sakamoto, T. Sawano, M. Takahashi, K.Takase, Y. Terabayashi, J. R. Wortman, O. Yamada, Y. Yamagata, H.Anazawa, Y. Hata, Y. Koide, T. Komori, Y. Koyama, T. Minetoki, S.Suharnan, A. Tanaka, K. Isono, S. Kuhara, N. Ogasawara, and H. Kikuchi.2005. Genome sequencing and analysis of Aspergillus oryzae. Nature 438:1157–1161.

40. Maubon, D., S. Park, M. Tanguy, M. Huerre, C. Schmitt, M. C. Prevost,D. S. Perlin, J. P. Latge, and A. Beauvais. 2006. AGS3, an �(1–3)glucansynthase gene family member of Aspergillus fumigatus, modulates mycelium


on Decem


.org/D

ownloaded from

http://ec.asm.org/

growth in the lung of experimentally infected mice. Fungal Genet. Biol.43:366–375.

41. Mizutani, O., A. Nojima, M. Yamamoto, K. Furukawa, T. Fujioka, Y.Yamagata, K. Abe, and T. Nakajima. 2004. Disordered cell integritysignaling caused by disruption of the kexB gene in Aspergillus oryzae.Eukaryot. Cell 3:1036–1048.

42. Mouyna, I., W. Morelle, M. Vai, M. Monod, B. Lechenne, T. Fontaine, A.Beauvais, J. Sarfati, M. C. Prevost, C. Henry, and J. P. Latge. 2005. Deletionof GEL2 encoding for a beta(1–3)glucanosyltransferase affects morphogen-esis and virulence in Aspergillus fumigatus. Mol. Microbiol. 56:1675–1688.

43. Nierman, W. C., A. Pain, M. J. Anderson, J. R. Wortman, H. S. Kim, J.Arroyo, M. Berriman, K. Abe, D. B. Archer, C. Bermejo, J. Bennett, P.Bowyer, D. Chen, M. Collins, R. Coulsen, R. Davies, P. S. Dyer, M. Farman,N. Fedorova, N. Fedorova, T. V. Feldblyum, R. Fischer, N. Fosker, A. Fraser,J. L. Garcia, M. J. Garcia, A. Goble, G. H. Goldman, K. Gomi, S. Griffith-Jones, R. Gwilliam, B. Haas, H. Haas, D. Harris, H. Horiuchi, J. Huang, S.Humphray, J. Jimenez, N. Keller, H. Khouri, K. Kitamoto, T. Kobayashi, S.Konzack, R. Kulkarni, T. Kumagai, A. Lafon, J. P. Latge, W. Li, A. Lord, C.Lu, W. H. Majoros, G. S. May, B. L. Miller, Y. Mohamoud, M. Molina, M.Monod, I. Mouyna, S. Mulligan, L. Murphy, S. O’Neil, I. Paulsen, M. A.Penalva, M. Pertea, C. Price, B. L. Pritchard, M. A. Quail, E. Rabbinowitsch,N. Rawlins, M. A. Rajandream, U. Reichard, H. Renauld, G. D. Robson, S.Rodriguez de Cordoba, J. M. Rodriguez-Pena, C. M. Ronning, S. Rutter,S. L. Salzberg, M. Sanchez, J. C. Sanchez-Ferrero, D. Saunders, K. Seeger,R. Squares, S. Squares, M. Takeuchi, F. Tekaia, G. Turner, C. R. Vazquez deAldana, J. Weidman, O. White, J. Woodward, J. H. Yu, C. Fraser, J. E.Galagan, K. Asai, M. Machida, N. Hall, B. Barrell, and D. W. Denning. 2005.Genomic sequence of the pathogenic and allergenic filamentous fungusAspergillus fumigatus. Nature 438:1151–1156.

44. Nonaka, H., K. Tanaka, H. Hirano, T. Fujiwara, H. Kohno, M. Umikawa, A.Mino, and Y. Takai. 1995. A downstream target of RHO1 small GTP-bindingprotein is PKC1, a homolog of protein kinase C, which leads to activation ofthe MAP kinase cascade in Saccharomyces cerevisiae. EMBO J. 14:5931–5938.

45. Ozaki, K., K. Tanaka, H. Imamura, T. Hihara, T. Kameyama, H. Nonaka, H.Hirano, Y. Matsuura, and Y. Takai. 1996. Rom1p and Rom2p are GDP/GTP exchange proteins (GEPs) for the Rho1p small GTP binding protein inSaccharomyces cerevisiae. EMBO J. 15:2196–2207.

46. Peterson, J., Y. Zheng, L. Bender, A. Myers, R. Cerione, and A. Bender. 1994.Interactions between the bud emergence proteins Bem1p and Bem2p andRho-type GTPases in yeast. J. Cell Biol. 127:1395–1406.

47. Philip, B., and D. E. Levin. 2001. Wsc1 and Mid2 are cell surface sensors forcell wall integrity signaling that act through Rom2, a guanine nucleotideexchange factor for Rho1. Mol. Cell. Biol. 21:271–280.

48. Primig, M., S. Sockanathan, H. Auer, and K. Nasmyth. 1992. Anatomy of atranscription factor important for the start of the cell cycle in Saccharomycescerevisiae. Nature 358:593–597.

49. Rajavel, M., B. Philip, B. M. Buehrer, B. Errede, and D. E. Levin. 1999. Mid2is a putative sensor for cell integrity signaling in Saccharomyces cerevisiae.Mol. Cell. Biol. 19:3969–3976.

50. Ram, A. F., M. Arentshorst, R. A. Damveld, P. A. vanKuyk, F. M. Klis, andC. A. van den Hondel. 2004. The cell wall stress response in Aspergillus niger

involves increased expression of the glutamine: fructose-6-phosphate amido-transferase-encoding gene (gfaA) and increased deposition of chitin in thecell wall. Microbiology 150:3315–3326.

51. Reinoso-Martin, C., C. Schuller, M. Schuetzer-Muehlbauer, and K.Kuchler. 2003. The yeast protein kinase C cell integrity pathway mediatestolerance to the antifungal drug caspofungin through activation of Slt2pmitogen-activated protein kinase signaling. Eukaryot. Cell 2:1200–1210.

52. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

53. Schmidt, A., M. Bickle, T. Beck, and M. N. Hall. 1997. The yeast phos-phatidylinositol kinase homolog TOR2 activates RHO1 and RHO2 via theexchange factor ROM2. Cell 88:531–542.

54. Sedgwick, S. G., and S. J. Smerdon. 1999. The ankyrin repeat: a diversity ofinteractions on a common structural framework. Trends Biochem. Sci. 24:311–316.

55. Smits, G. J., J. C. Kapteyn, H. van den Ende, and F. M. Klis. 1999. Cell walldynamics in yeast. Curr. Opin. Microbiol. 2:348–352.

56. Sommer, H., J. P. Beltran, P. Huijser, H. Pape, W. E. Lonnig, H. Saedler,and Z. Schwarz-Sommer. 1990. Deficiens, a homeotic gene involved in thecontrol of flower morphogenesis in Antirrhinum majus: the protein showshomology to transcription factors. EMBO J. 9:605–613.

57. Stathopoulos, A. M., and M. S. Cyert. 1997. Calcineurin acts through theCRZ1/TCN1-encoded transcription factor to regulate gene expression inyeast. Genes Dev. 11:3432–3444.

58. Takahashi, T., O. Hatamoto, Y. Koyama, and K. Abe. 2004. Efficient genedisruption in the koji-mold Aspergillus sojae using a novel variation of thepositive-negative method. Mol. Genet. Genomics 272:344–352.

59. Terashima, H., N. Yabuki, M. Arisawa, K. Hamada, and K. Kitada. 2000.Up-regulation of genes encoding glycosylphosphatidylinositol (GPI)-attached proteins in response to cell wall damage caused by disruption ofFKS1 in Saccharomyces cerevisiae. Mol. Gen. Genet. 264:64–74.

60. Treisman, R. 1996. Regulation of transcription by MAP kinase cascades.Curr. Opin. Cell Biol. 8:205–215.

61. Verna, J., A. Lodder, K. Lee, A. Vagts, and R. Ballester. 1997. A family ofgenes required for maintenance of cell wall integrity and for the stressresponse in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 94:13804–13809.

62. Watanabe, Y., K. Irie, and K. Matsumoto. 1995. Yeast RLM1 encodes aserum response factor-like protein that may function downstream of theMpk1 (Slt2) mitogen-activated protein kinase pathway. Mol. Cell. Biol. 15:5740–5749.

63. Wijnen, H., A. Landman, and B. Futcher. 2002. The G(1) cyclin Cln3 pro-motes cell cycle entry via the transcription factor Swi6. Mol. Cell. Biol.22:4402–4418.

64. Xu, J. R., C. J. Staiger, and J. E. Hamer. 1998. Inactivation of the mitogen-activated protein kinase Mps1 from the rice blast fungus prevents penetra-tion of host cells but allows activation of plant defense responses. Proc. Natl.Acad. Sci. USA 95:12713–12718.

65. Zu, T., J. Verna, and R. Ballester. 2001. Mutations in WSC genes for putativestress receptors result in sensitivity to multiple stress conditions and impair-ment of Rlm1-dependent gene expression in Saccharomyces cerevisiae. Mol.Genet. Genomics 266:142–155.


on Decem


.org/D

ownloaded from

http://ec.asm.org/

Documents

MpkA-Dependent and -Independent Cell Wall Integrity ... · cell wall-related genes is important to secure cell wall biogen-esis. The objective of the present study was to examine