Embed Size (px)
Citation preview
M(r
MAa
b
c
d
a
ARRA
KSGPMN
0d
Veterinary Parasitology 186 (2012) 289– 300
Contents lists available at SciVerse ScienceDirect
Veterinary Parasitology
jo u rn al hom epa ge : www.elsev ier .com/ locate /vetpar
orphological and molecular characterisation of Gyrodactylus salmonisPlatyhelminthes, Monogenea) isolates collected in Mexico fromainbow trout (Oncorhynchus mykiss Walbaum)
iguel Rubio-Godoya,∗, Giuseppe Paladinib, Mark A. Freemanc, Adriana García-Vásquezd,ndrew P. Shinnb
Instituto de Ecología, A.C., Red de Biología Evolutiva, km 2.5 Ant. Carretera a Coatepec, Xalapa, Veracruz 91070, MexicoInstitute of Aquaculture, University of Stirling, Stirling FK9 4LA, UKInstitute of Biological Sciences & Institute of Ocean and Earth Sciences, University of Malaya, Kuala Lumpur 50603, MalaysiaInstituto de Biología, Universidad Nacional Autónoma de México, A.P. 70-153, 04510 Mexico, D.F., Mexico
r t i c l e i n f o
rticle history:eceived 14 July 2011eceived in revised form 19 October 2011ccepted 1 November 2011
eywords:almonidaeyrodactylidaearasiteonogeneanorth America
a b s t r a c t
Gyrodactylus salmonis (Yin et Sproston, 1948) isolates collected from feral rainbow trout,Oncorhynchus mykiss (Walbaum) in Veracruz, southeastern Mexico are described. Morpho-logical and molecular variation of these isolates to G. salmonis collected in Canada and theU.S.A. is characterised. Morphologically, the marginal hook sickles of Mexican isolates of G.salmonis closely resemble those of Canadian specimens – their shaft and hook regions alignclosely with one another; only features of the sickle base and a prominent bridge to the toepermit their separation. The 18S sequence determined from the Mexican specimens wasidentical to two variable regions of SSU rDNA obtained from a Canadian population of G.salmonis. Internal transcribed spacer (ITS) regions (spanning ITS1, 5.8S and ITS2) of Mexicanisolates of G. salmonis are identical to ITS sequences of an American population of G. salmo-nis and to Gyrodactylus salvelini Kuusela, Zietara et Lumme, 2008 from Finland. Analyses ofthe ribosomal RNA gene of Mexican isolates of G. salmonis show 98–99% similarity to thoseof Gyrodactylus gobiensis Gläser, 1974, Gyrodactylus salaris Malmberg, 1957, and Gyrodacty-lus rutilensis Gläser, 1974. Mexican and American isolates of G. salmonis are 98% identical,as assessed by sequencing the mitochondrial cox1 gene. Oncorhynchus mykiss is one of themost widely-dispersed fish species in the world and has been shown to be an importantvector for parasite/disease transmission. Considering that Mexican isolates of G. salmonis
were collected well outside the native distribution range of all salmonid fish, we discuss thepossibility that the parasites were translocated with their host through the aquaculturaltrade. In addition, this study includes a morphological review of Gyrodactylus species col- lected from rainbow trouoccur throughout North A∗ Corresponding author. Tel.: +52 228 842 1800; fax: +52 228 818 7809.E-mail addresses: [email protected], [email protected] (M.
304-4017/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.vetpar.2011.11.005
t and from other salmonid fish of the genus Oncorhynchus whichmerica.
© 2011 Elsevier B.V. All rights reserved.
Rubio-Godoy).
ary Para
290 M. Rubio-Godoy et al. / Veterin1. Introduction
The native distribution range of rainbow trout,Oncorhynchus mykiss (Walbaum), in North Americaspans from the Aleutian Islands in Alaska to near theU.S.A.–Mexico border in Baja California (Froese and Pauly,2010). The latter region is also the northernmost distribu-tion of unambiguously native Mexican trouts, which rangesouthwards to at least the Río Culiacán, Sinaloa, Mexico(Hendrickson et al., 2002). Several salmonid fish occureither in sympatry or in close vicinity in this extendedterritory, which practically encompasses the whole west-ern seaboard of North America (i.e., Canada, the U.S.A. andMexico). Rainbow trout is one of the most widely translo-cated fish species in the world, and has been introducedto numerous countries for sport and commercial aquacul-ture (Froese and Pauly, 2010; ISSG, 2010). Oncorhynchusmykiss was first introduced to central Mexico (i.e., southernNorth America) for aquacultural purposes in the late 1880s(Hendrickson et al., 2002). Different varieties of O. mykissand other salmonids were subsequently introduced duringthe 20th century, and the following were recorded by Rosas(1976) as in use in Mexican fish culture in the 1970s: O.mykiss; Mexican golden trout, Oncorhynchus chrysogaster(Needham et Gard); cutthroat trout, Oncorhynchus clarkiiclarkii (Richardson); and brook trout, Salvelinus fontinalis(Mitchill).
Apart from the recognised ecological impact of intro-duced rainbow trout, including negative effects on nativefish species through predation and competition (ISSG,2010), several factors potentially make O. mykiss a majorvector for disease/parasite transmission and/or introduc-tion: first, a variety of diseases and infections affect rainbowtrout, caused by viral, bacterial, protistan and metazoanpathogens (Buchmann et al., 1995; F.A.O., 2005); sec-ond, the occurrence of sympatric salmonid fish specieswithin the vast natural distribution range of O. mykiss inNorth America raises the possibility that rainbow troutacquired several parasite species through host transfers;similarly, O. mykiss may have acquired low specificity par-asites from other fish host families; finally, the widespreadanthropogenic introduction of rainbow trout might havefacilitated dispersal of several of these pathogens – e.g., thedecline of various wild salmonid populations in the U.S.A.has been linked to whirling disease caused by the introduc-tion of the myxozoan parasite Myxobolus cerebralis (Höfer,1903) with translocated O. mykiss (see Granath et al., 2007).
Monogenean flatworms of the genus Gyrodactylus vonNordmann, 1832 include important fish pathogens thataffect aquaculture and potentially endanger the survivalof wild fish stocks; examples include Gyrodactylus salarisMalmberg, 1957 infecting salmonids (Bakke et al., 2007)and Gyrodactylus cichlidarum Paperna, 1968 infecting cich-lids (García-Vásquez et al., 2010). Eleven Gyrodactylusspecies have been described from Mexican fish (Table 1),although several more are likely to be found as many unde-scribed gyrodactylids have been recorded from different
teleost fish families (Salgado-Maldonado, 2006; Pérez-Ponce de León et al., 2010; Rubio-Godoy et al., 2010).Previously, Gyrodactylus sp. have been collected from O.mykiss in central Mexico, from fish farms located in Distritositology 186 (2012) 289– 300
Federal (Mexico City) and Estado de México (Armijo, 1980;Flores-Crespo and Flores, 1993). Worldwide, fourteen validGyrodactylus species have been recorded from O. mykiss(Table 2). Salmonid fish in North America are parasitisedby at least five species of Gyrodactylus: G. avalonia Haneket Threlfall, 1969; G. brevis Crane et Mizelle, 1967; G.colemanensis Mizelle et Kritsky, 1967; G. nerkae Cone,Beverley-Burton, Wiles et McDonald, 1983; and, G. salmonis(Yin et Sproston, 1948). Of these five species, G. colemanen-sis and G. salmonis are the most geographically widespreadin North America, occurring in fish farms across the U.S.A.and Canada (Gilmore et al., 2010).
In this paper, Mexican isolates of G. salmonis collectedfrom feral rainbow trout in the State of Veracruz, southeast-ern Mexico are described. In addition, this study includesa morphological review of Gyrodactylus species collectedfrom rainbow trout and from other salmonid fish of thegenus Oncorhynchus which occur naturally throughoutNorth America.
2. Materials and methods
2.1. Specimen collection
Forty feral rainbow trout, O. mykiss fingerlings (meanstandard length ± 1 S.D., 4.8 ± 0.35 cm; mean weight ± 1S.D., 1.8 ± 0.43 g) and six 1+ fish (mean standard length ± 1S.D., 17.4 ± 2.01 cm; mean weight ± 1 S.D., 56.1 ± 16.9 g)were collected by electrofishing in May 2007 in the RíoPixquiac around Xalapa, Veracruz, Mexico (19◦28′39′′N,96◦57′00′′W), and transported live to the laboratory. Fishwere killed by pithing and inspected under a dissectionmicroscope. Ectoparasites were detached from the fish sur-face and preserved in 80% ethanol until analysed.
2.2. Specimen preparation
Ten representative gyrodactylid specimens were pre-pared as whole mounts in ammonium picrate glycerinefollowing the procedure detailed by Malmberg (1970) tostudy taxonomic features of the haptor, male copulatoryorgan (MCO) and pharynx. Further specimens had theirhaptors excised using a scalpel and were subjected to pro-teolytic digestion as described previously (Paladini et al.,2009), to release the attachment hooks from enclosing tis-sue. The corresponding bodies were stored in 96% ethanolfor subsequent molecular sequencing. The hooks weremounted in a 1:1 formalin: glycerine mix and the edges ofthe coverslip were then sealed with the permanent mount-ing medium Pertex (Histolab Products AB, Gothenburg,Sweden).
2.3. Morphological analysis
For the morphological study, images of the haptoralattachment hooks were captured using a Zeiss AxioCamMRc digital camera interfacing with an Olympus BH2 com-
pound microscope using a ×0.75 lens and MRGrab 1.0.0.4(Carl Zeiss Vision GmbH, 2001) software. Each gyrodactylidspecimen was subjected to morphometric analysis taking22 point–to–point measurements on the haptoral hooks
M. Rubio-Godoy et al. / Veterinary Parasitology 186 (2012) 289– 300 291
Table 1Gyrodactylids recorded in Mexican fish.
Gyrodactylus spp. Host (Family) Reference
G. bullatarudis Turnbull, 1956 Poecilia mexicana (Poeciliidae) Rubio-Godoy et al. (2010)G. cichlidarum Paperna, 1968 Oreochromis mossambicus (Cichlidae) García-Vásquez et al. (2010)
Oreochromis niloticus (Cichlidae) García-Vásquez et al. (2010)G. elegans von Nordmann, 1832a Girardinichthys multiradiatus (Goodeidae) Salgado-Maldonado et al. (2001);
Sánchez-Nava et al. (2004)G. jarocho Rubio-Godoy, Paladini, García-Vásquez et Shinn,
2010Xiphophorus hellerii (Poeciliidae) Rubio-Godoy et al. (2010)
G. lamothei Mendoza-Palmero, Sereno-Uribe etSalgado-Maldonado, 2009
Girardinichthys multiradiatus (Goodeidae) Mendoza-Palmero et al. (2009)
G. mexicanus Mendoza-Palmero, Sereno-Uribe etSalgado-Maldonado, 2009
Girardinichthys multiradiatus (Goodeidae) Mendoza-Palmero et al. (2009)
G. neotropicalis Kritsky et Fritts, 1970 Astyanax fasciatus (Characidae) Mendoza-Franco et al. (1999)G. niloticus Cone, Arthur et Bondad-Reantaso, 1995 Oreochromis niloticus (Cichlidae) López-Jiménez (2001)
Oreochromis mossambicus (Cichlidae) Salgado-Maldonado et al. (2005)Oreochromis aureus (Cichlidae) Salgado-Maldonado et al. (2005)
G. spathulatus Mueller, 1936 Catostomus nebuliferus (Catostomidae) Pérez-Ponce de León et al. (2010)Gila conspersa (Cyprinidae) Pérez-Ponce de León et al. (2010)Ictalurus cf. pricei (Ictaluridae) Pérez-Ponce de León et al. (2010)
G. xalapensis Rubio-Godoy, Paladini, García-Vásquez etShinn, 2010
Heterandria bimaculata (Poeciliidae) Rubio-Godoy et al. (2010)
G. yacatli García-Vásquez, Hansen, Christison, Bron etShinn, 2011
Oreochromis niloticus (Cichlidae) García-Vásquez et al. (2011)
a These species were identified by Salgado-Maldonado et al. (2001) and by Sánchez-Nava et al. (2004) as Gyrodactylus cf. elegans von Nordmann, 1832;however, later analysis of the samples indicates these are in fact two undescribed species (Salgado-Maldonado, 2006). Valid fish names checked in FishBase,July 2011.
Table 2Gyrodactylus species recorded from Oncorhynchus mykiss and other Oncorhynchus species.
Oncorhynchus sp. Gyrodactylus sp. Localities
O. mykiss Walbaum G. avalonia Hanek et Threlfall, 1969a Newfoundland1 and Nova Scotia2, CanadaG. bohemicus Ergens, 1992 South Bohemia, Czech Republic3
G. brachymystacis Ergens, 1978 China4
G. brevis Crane et Mizelle, 1967 California, USA5
G. colemanensis Mizelle et Kritsky, 1967 California6, Arkansas2 and Colorado7, USA;Newfoundland2 and Nova Scotia8, Canada
G. derjavinoides Malmberg, Collins,Cunningham et Jalali, 2007
Tidaholm, Sweden9; Denmark9
G. gobii Schulman, 1953 Brandenburg and Thuringia, Germany10
G. lavareti Malmberg, 1957 Sweden11; Baltic Sea, Finland12; Arctic Ocean12 and KolaPeninsula13, Russia
G. lenoki Gussev, 1953 China14
G. masu Ogawa, 1986 Japan15
G. salaris Malmberg, 1957 e.g., Sweden11; Norway16; Denmark17; Finland18;Germany10; Russia12; Spain18; Poland19; Italy20
G. salmonis (Yin et Sproston, 1948) British Columbia2 and Nova Scotia2, Canada; Montana2,Idaho2 and Arkansas2, USA
G. teuchis Lautraite, Blanc, Thiery, Daniel etVigneulle, 1999
Brittany and Western Pyrenees, France21
G. truttae Gläser, 1974 Czech Republic22
Gyrodactylus sp. Morph 8 Shinn et al., 1995 UK23
O. aguabonita Jordan G. salmonis (Yin et Sproston, 1948) California2, USAO. clarkii clarkii Richardson G. salmonis (Yin et Sproston, 1948) British Columbia2, CanadaO. keta Walbaum G. somnaensis Ergens et Yukhimenko, 1990 Amur river basin, Russia24
O. kisutch Walbaum G. salmonis (Yin et Sproston, 1948) British Columbia2, CanadaO. masou masou Brevoort G. masu Ogawa, 1986 Japan15
O. nerka Walbaum G. masu Ogawa, 1986 Japan25
G. nerkae Cone, Beverley-Burton, Wiles etMacDonald, 1983
British Columbia2, Canada
O. rhodurus Jordan et McGregor G. masu Ogawa, 1986 Japan13
References: 1 Hanek and Threlfall, 1969; 2 Cone et al., 1983; 3 Ergens, 1992; 4 You et al., 2006; 5 Crane and Mizelle, 1967; 6 Mizelle and Kritsky, 1967; 7
Hathaway and Herlevich, 1973; 8 Cone and Wiles, 1989; 9 Malmberg et al., 2007; 10 Lux, 1990; 11 Malmberg, 1957; 12 Koski and Malmberg, 1995; 13 Karasevet al., 1997; 14 Wang et al., 1997; 15 Ogawa, 1986; 16 Johnsen and Jensen, 1991; 17 Buchmann and Bresciani, 1997; 18 Malmberg, 1993; 19 Rokicka et al.,2007; 20 Paladini et al., 2009; 21 Lautraite et al., 1999; 22 Gläser, 1974; 23 Shinn et al., 1995; 24 Ergens and Yukhimenko, 1990; 25 Ogawa, 1994.
a Gyrodactylus avalonia Hanek et Threlfall, 1969 is suspected to be a junior synonym of Gyrodactylus arcuatus Bychowsky, 1933, but this species isconsidered as valid until molecular characterisation of G. avalonia is conducted (J. Lumme and S.D. King, pers. comm.).
292M
. R
ubio-Godoy
et al.
/ V
eterinary Parasitology
186 (2012) 289– 300Table 3Morphological measurements of the haptoral structures of Mexican isolates of Gyrodactylus salmonis from rainbow trout, Oncorhynchus mykiss, and of other Gyrodactylus species collected from the same host.Values shown in �m are means ± 1 S.D., and ranges in parentheses.
Measurement Mexican isolates of G.salmonis (Yin etSproston, 1948) Thisstudy (n = 10)
G. avalonia Hanek etThrelfall, 1969Holotype USNPC 70439(n = 1)1
G. bohemicusErgens, 1992(n = 20)2
G. brachymystacisErgens, 1978(n = ?)3
G. brevis Crane et Mizelle,1967 USNPC 61635paratypes (951–4;1169–15; 1171–4/8)(n = 3)4
G. colemanensis Mizelleet Kritsky, 1967 fromShinn et al. (1995) andShinn (1993) (n = 10)5
G. derjavinoidesMalmberg, Collins,Cunningham et Jalali,2007 (n = 20)
G. gobiiSchulman,1953 (n = 1)6
HamulusTotal length 64.4 ± 1.7 39.1 87–91 90–96 38.4 ± 1.5 47.2 ± 1.0 56.1 ± 3.5 52.3
(61.3–67.7) (37.1–40.1) (45.3–48.2) (50.3–60.9)Shaft length 43.5 ± 0.8 25.4 63–66 66–69 20.9 ± 1.3 32.3 ± 0.9 33.7 ± 2.0 34.5
(42.5–44.7) (19.6–22.1) (30.5–33.0) (30.9–37.3)Point length 35.7 ± 0.7 25.4 42–43 42–45 17.4 ± 0.4 22.9 ± 0.7 30.8 ± 1.1 27.2
(34.5–36.6) (17.0–17.8) (21.5–23.8) (28.6–33.0)Root length 22.1 ± 1.2 11.8 30–32 31–36 13.5 ± 1.0 17.8 ± 0.8 19.4 ± 1.7 15.7
(19.9–24.0) (12.7–14.6) (16.6–19.0) (16.1–21.7)Proximal shaft width 11.0 ± 0.6 7.8 – – 6.2 ± 0.3 7.0 ± 0.2 9.2 ± 0.4 8.1
(10.3–12.1) (6.1–6.6) (6.8–7.3) (8.2–9.7)Distal shaft width 6.5 ± 0.3 3.9 – – 3.0 ± 0.1 – 6.0 ± 0.4 5.3
(6.1–6.8) (2.9–3.2) (5.2–6.8)Aperture angle (◦) 35.8 ± 2.1 46.3 – – 37.2 ± 1.9 – 29.9 ± 1.7 32.8
(31.5–39.2) (35.9–39.4) (27.2–34.4)Hamulus aperture 24.0 ± 1.3 17.8 – – 12.4 ± 0.3 17.5 ± 0.7 16.8 ± 1.5 18.6
(21.6–25.9) (12.2–12.8) (16.5–18.5) (14.7–20.7)Ventral bar
Total length 23.2 ± 2.1 28.1 10–11 10–12 18.4 – 23.4 ± 1.4 22.2(20.2–26.0) (21.1–25.9)
Total width 25.5 ± 1.1 23.6 32–36 31–34 13.3 – 31.6 ± 2.3 21(24.1–27.1) (26.2–34.9)
Process to mid-length 2.2 ± 0.6 8.9 – – 1.7 – 2.8 ± 1.1 3.4(1.3–2.9) (1.1–4.6)
Median length 8.5 ± 0.9 5.0 – – 5.6 – 8.2 ± 1.1 5.9(7.0–10–1) (6.4–10.1)
Process length 2.1 ± 0.3 5.6 – – 0.8 – 3.5 ± 0.6 2.6(1.7–2.6) (2.9–4.8)
Membrane length 13.4 ± 1.4 14.8 20–22 22–24 11.1 – 13.2 ± 1.5 13.1(11.6–15.1) (11.2–16.8)
Marginal hooksTotal length 44.6 ± 0.8 23 43–45 42–46 20.9 ± 1.1 31.1 ± 0.5 32.5 ± 1.7 42.8
(43.8–46.5) (20.1–21.7) (30.3–31.9) (28.8–36.6)Shaft length 37.0 ± 0.6 – – – 15.4 ± 1.2 25.8 ± 0.6 26.2 ± 1.3 34.6
(36.3–38.4) (14.5–16.2) (24.9–26.8) (22.9–28.6)Sickle length 7.9 ± 0.2 4 9–10 8–9 6.8 ± 0.0 6.0 ± 0.2 6.5 ± 0.3 8.4
(7.7–8.3) (6.8–6.8) (5.7–6.3) (5.9–7.0)Sickle proximal width 4.8 ± 0.2 – – – 4.6 ± 0.1 4.2 ± 0.1 5.1 ± 0.4 5.7
(4.5–5.0) (4.5–4.6) (4.0–4.4) (4.4–5.8)Toe length 1.8 ± 0.1 – – – 2.4 ± 0.1 1.6 ± 0.1 1.8 ± 0.3 2.0
(1.5–2.0) (2.3–2.4) (1.3–1.7) (1.3–2.7)Sickle distal width 6.0 ± 0.2 – – – 3.1 ± 0.3 4.1 ± 0.3 5.0 ± 0.3 5.6
(5.7–6.3) (2.9–3.3) (3.6–4.5) (4.5–5.6)Aperture 6.0 ± 0.2 – – – 5.5 ± 0.1 4.6 ± 0.2 5.0 ± 0.4 7.1
(5.7–6.3) (5.5–5.6) (4.2–4.8) (4.4–5.8)Instep/arch height 0.8 ± 0.1 – – – 0.6 ± 0.1 – 0.5 ± 0.1 0.4
M.
Rubio-G
odoy et
al. /
Veterinary
Parasitology 186 (2012) 289– 300
293Table 3(continued)
Measurement G. lavareti Malmberg,1957 (n = ?)6
G. lenoki Gussev,1953 (n = ?)7
G. masu Ogawa,1986This study (n = 5)
G. salarisMalmberg, 1957This study (n = 31)
G. salmonis (Yin etSproston, 1948)This study (n = 3)8
G. teuchis Lautraite, Blanc, Thiery,Daniel et Vigneulle,1999 This study (n = 13)
G. truttae Gläser,1974This study (n = 41)
Gyrodactylus sp. Morph 8(from Shinn et al., 1995)(n = 2)9
HamulusTotal length 84 82–91 75.4 ± 1.5 76.0 ± 2.3 65.7 ± 1.7 67.5 ± 2.1 64.8 ± 1.8 –
(73.3–77.3) (72.0–81.7) (63.7–66.8) (64.7–72.4) (60.3–68.8)Shaft length 58–59 65–72 46.2 ± 1.9 47.0 ± 1.9 44.5 ± 1.5 44.1 ± 1.1 39.7 ± 0.9 –
(42.9–47.6) (42.2–51.0) (42.7–45.5) (42.3–46.4) (37.9–41.7)Point length 36 41–45 40.0 ± 1.1 39.5 ± 1.3 35.6 ± 0.9 34.7 ± 0.9 33.2 ± 0.9 –
(38.9–41.8) (37.1–41.9) (35.1–36.6) (34.9–38.5) (30.2–34.5)Root length 26–27 26–33 27.0 ± 1.8 26.2 ± 2.1 21.0 ± 1.4 20.2 ± 1.0 21.6 ± 1.1 –
(25.0–28.7) (22.2–30.6) (20.1–22.7) (18.6–22.3) (19.2–23.6)Proximal shaft width – – 13.6 ± 0.8 11.7 ± 0.8 11.4 ± 0.3 10.8 ± 1.0 9.8 ± 0.6 –
(12.8–14.7) (9.9–13.3) (11.1–11.7) (8.7–11.8) (8.7–11.0)Distal shaft width – – 8.0 ± 1.4 7.3 ± 0.8 6.1 ± 0.1 6.2 ± 0.8 5. 9 ± 0.3 –
(6.5–9.5) (6.0–9.8) (6.0–6.2) (4.4–7.2) (5.3–6.7)Aperture angle (◦) – – 33.0 ± 2.2 36.4 ± 1.9 33.2 ± 1.7 33.2 ± 1.2 31.6 ± 1.3 –
(30.6–36.2) (33.7–41.5) (31.2–34.5) (30.3–34.6) (28.5–34.6)Hamulus aperture – – 24.9 ± 1.3 27.7 ± 1.7 24.0 ± 1.5 23.2 ± 0.9 20.1 ± 0.8 –
(22.9–26.3) (24.5–32.9) (23.0–25.8) (21.1–24.5) (18.5–22.3)Ventral bar
Total length – 9–14 28.7 ± 0.8 31.7 ± 2.1 25.5 ± 1.0 27.7 ± 2.7 27.2 ± 1.6 –(28.0–29.8) (27.4–36.6) (24.7–26.7) (23.6–33.4) (23.6–31.1)
Total width 29 26–33 36.3 ± 2.8 31.0 ± 3.7 32.8 ± 4.5 29.4 ± 2.4 31.9 ± 1.9 –(32.9–39.8) (27.0–40.7) (27.8–36.3) (22.8–31.6) (27.6–35.2)
Process to mid-length – – 4.1 ± 0.6 3.1 ± 0.9 2.2 ± 0.4 2.9 ± 0.8 3.8 ± 0.9 –(3.3–4.8) (1.1–4.6) (2.0–2.8) (1.2–4.2) (2.2–6.3)
Median length 8.4 – 7.6 ± 1.2 10.3 ± 1.4 9.3 ± 1.1 11.0 ± 1.5 8.9 ± 0.9 –(6.5–9.4) (7.6–13.9) (8.1–10.1) (8.8–12.9) (7.4–10.8)
Process length – – 4.7 ± 0.3 2.0 ± 1.1 1.8 ± 0.3 2.8 ± 0.8 3.8 ± 1.0 –(4.3–5.0) (0.24–4.7) (1.6–2.2) (1.3–4.9) (2.4–7.0)
Membrane length 18 23–26 16.9 ± 0.3 18.3 ± 2.0 13.5 ± 1.1 14.9 ± 2.3 15.2 ± 1.6 –(16.5–17.1) (14.2–22.0) (12.4–14.5) (12.1–19.6) (12.3–21.0)
Marginal hooksTotal length 40 43–45 41.0 ± 0.6 39.1 ± 2.1 37.5 ± 4.7 35.8 ± 1.0 32.1 ± 1.2 26.9 ± 0.6
(40.2–41.4) (33.6–43.0) (33.1–42.4) (34.5–37.6) (29.8–36.1) (26.5–27.3)Shaft length 33 – 33.4 ± 0.5 32.2 ± 1.6 29.8 ± 4.6 28.5 ± 0.9 25.7 ± 1.0 21.1 ± 0.6
(32.7–33.8) (29.6–34.5) (25.4–34.6) (27.5–30.3) (23.6–29.1) (20.6–21.5)Sickle length 7.7 10–11 7.8 ± 0.4 7.9 ± 0.3 8.0 ± 0.1 7.7 ± 0.3 6.9 ± 0.2 6.0 ± 0.03
(7.3–8.2) (7.3–8.6) (7.9–8.2) (7.2–8.3) (6.5–7.3) (6.0–6.01)Sickle proximal width – – 5.3 ± 0.4 5.7 ± 0.3 5.1 ± 0.2 5.4 ± 0.2 5.1 ± 0.3 3.4 ± 0.04
(4.9–5.8) (4.9–6.2) (4.9–5.2) (5.0–5.6) (4.5–5.6) (3.3–3.4)Toe length – – 2.2 ± 0.2 2.1 ± 0.2 2.2 ± 0.3 2.2 ± 0.2 1.6 ± 0.2 1.4 ± 0.08
(1.9–2.4) (1.6–2.5) (1.9–2.4) (1.8–2.6) (1.2–2.1) (1.3–1.4)Sickle distal width – – 5.7 ± 0.3 6.3 ± 0.3 5.6 ± 0.2 7.0 ± 0.4 5.5 ± 0.3 4.4 ± 0.4
(5.5–6.1) (5.9–7.2) (5.4–5.7) (6.3–7.6) (4.9–6.1) (4.1–4.6)Aperture – – 7.2 ± 0.3 6.5 ± 0.3 6.4 ± 0.2 6.5 ± 0.5 5.3 ± 0.3 4.6 ± 0.1
(6.7–7.5) (6.0–7.4) (6.3–6.6) (6.0–7.9) (4.5–6.0) (4.5–4.6)Instep/arch height – – 0.7 ± 0.2 0.8 ± 0.2 0.6 ± 0.1 0.6 ± 0.2 0.7 ± 0.1 –
(0.4–0.8) (0.5–1.1) (0.5–0.7) (0.4–1.0) (0.5–1.1)
Notes: 1, Marginal hooks not visible in holotype; figures in bold taken from Hanek and Threlfall, 1969; 2, Measurements taken from Ergens, 1992; 3, Measurements taken from Ergens, 1983; 4, Ventral bar notvisible in paratypes; illustrative figures shown in bold measured from USNPC 73549 paratype 1169–16/17, collected from California roach, Hesperoleucus symmetricus Baird et Girard; marginal hooks visible intwo paratypes only; 5, Measurements are based on 10 hamuli and 10 marginal hooks released by proteolytic digestion from a pooled sample of gyrodactylids; 6, Measurements extrapolated from drawing inPugachev et al., 2009. 6, Taken from Kuusela et al., 2008; samples obtained from Coregonus lavaretus (L.) in Finland; 7, Measurements taken from Ergens, 1983; 8, samples obtained from Salvelinus fontinalis(Mitchill) in Nova Scotia, Canada; 9, Morph 8 was identified on the basis of marginal hook sickles released by proteolytic digestion from a pooled sample of gyrodactylids.
ary Para
294 M. Rubio-Godoy et al. / Veterinusing a JVC KY–F30B 3CCD video camera mounted on anOlympus BH2 microscope using a ×2.5 interfacing lens at×100 oil immersion and the gyrodactylid–specific Point–Rmacro (Bron & Shinn, University of Stirling) written withinthe KS300 (ver.3.0) (Carl Zeiss Vision GmbH, 1997) imageanalysis software. The 22 point–to–point measurements(shown in Table 3) are given in micrometres as the mean±1 standard deviation followed by the range in parenthe-ses, and were selected from those described in Shinn et al.(2004).
The following Gyrodactylus type material and speci-mens were obtained for the current study: G. avaloniaholotype (USNPC 70439); G. brevis four paratypes (USNPC061635 – three slides; 073549 – one slide); G. colemanensistwo paratypes (USNPC 061691); ethanol fixed specimensof G. masu Ogawa, 1986 were provided by Kazuo Ogawafrom Tokyo University, Japan; photographs of the G. nerkaeholotype (NMCIC(P)1983–0168) deposited in the NationalMuseum of Natural Sciences, Ottawa, Canada made byJudith Price; photographs of specimens of G. lavaretiMalmberg, 1957 and of G. salvelini Kuusela, Zietara etLumme, 2008 from the private collection of Jaakko Lummefrom the University of Oulu, Finland were sent for evalua-tion; ethanol fixed specimens of G. salmonis were donatedby Stanley King from Dalhousie University, Canada andDavid Cone from St Mary’s University, Canada. Additionalspecimens of Gyrodactylus parasitising O. mykiss were col-lected by the authors from several sites across Europe; thedetails and measurements of the identified specimens arelisted in Tables 3 and S1. When no material was availablefor morphological analysis, additional measurements notgiven in original descriptions were extrapolated from pub-lished images.
2.4. Molecular analysis
DNA extractions were performed on four individualethanol-fixed gyrodactylid monogeneans that had beenremoved from four different feral O. mykiss specimens col-lected near Xalapa, Mexico. All PCRs were performed inquadruplicate (amplifications from four different worms)and all PCR products were sequenced in both forward andreverse directions. DNA was extracted using a GeneMA-TRIX kit (EURx Poland) following the tissue protocol. Threegene regions were targeted using previously describedoligonucleotide primers with additional more specificprimers designed during this study. The small subunitribosomal DNA (SSU rDNA) was amplified using the uni-versal primers 18e, 390f, 870f, 870r and 18gM, for whichprimers sequences and PCR conditions have been previ-ously described (Freeman and Ogawa, 2010; Morris andFreeman, 2010). In addition to the universal SSU rDNAprimers, an additional specific forward primer, Gyro-300f5′ CTTGTTGTCGGCGACGGATC 3′ was used with the reverseprimer 870r to confirm the initial sequence reads. Theinternal transcribed spacer 1 (ITS1), 5.8S ribosomal DNAand internal transcribed spacer 2 (ITS2) regions of the
ribosomal RNA gene were amplified using the primersITS1F and ITS2R (Zietara et al., 2002). The cytochrome coxidase subunit I (cox1) gene was amplified using theprimers and PCR conditions described by Kuusela et al.sitology 186 (2012) 289– 300
(2008), as well as the newly designed primer pair Gyro-coxF 5′ TCCAAGGGTAGGTACCGAC 3′ and Gyro-coxR 5′
TATACCAGTAGGCACTGC 3′ that utilised the same PCR con-ditions. All PCR bands of the expected sizes were recoveredfrom the PCR products using a GeneMATRIX PCR productsextraction kit (EURx Poland). Sequencing reactions wereperformed using BigDyeTM Terminator Cycle Sequencingchemistry utilising the same oligonucleotide primers thatwere used for the original PCRs. Individual sequence readswere each confirmed as monogenean using nucleotideBLAST searches in GenBank (Altschul et al., 1990). Contigu-ous sequences were obtained manually using CLUSTAL X(Thompson et al., 1997) and BioEdit (Hall, 1999). For phy-logenetic analyses, taxa were chosen from BLAST searchesthat had high similarities to the novel sequence. CLUSTAL Xwas used for the initial sequence alignments and manu-ally edited using the BioEdit sequence alignment editor andpercentage divergence matrices constructed in CLUSTAL Xusing the neighbor-joining method (Saitou and Nei, 1987).Phylogenetic analyses were performed using maximumparsimony methodologies in PAUP*4.0 beta10 (Swofford,2002).
3. Results
Forty-six feral rainbow trout were collected. Eighteengyrodactylids were found on the fins of 5 out of the 6 1+ yearold fish (mean abundance ± 1 S.D., 3.0 ± 1.67 worms/host;range, 0–5 worms/host).
Gyrodactylids collected in Mexico exhibited limitedbut constant morphological and molecular variation whencontrasted to G. salmonis from Canada. In the followingsections, we present the morphological and moleculardescription of Mexican isolates of G. salmonis. Marginalhook sickle morphology is the key to the separation and dis-crimination of all the gyrodactylids parasitising salmonids,and we provide graphical (Figs. 1 and 2 and S1) andmorphological data (Table 3) to distinguish between thefourteen previously recorded gyrodactylid species from O.mykiss (Table 2) and Mexican isolates of G. salmonis. We alsoprovide a graphical comparison of the marginal hook sicklemorphology of Mexican isolates of G. salmonis and otherGyrodactylus species recorded from other native and intro-duced salmonids which occur throughout North America(Fig. S2).
3.1. Taxonomic description
Gyrodactylus salmonis (Mexican isolates)(Figs. 1 and 2, S1 and S2; Table 3)Host: Oncorhynchus mykiss Walbaum (“rainbow trout”,
“trucha arcoíris”).Site of infection: Fins.Locality: Río Pixquiac, Xalapa, Veracruz, Mexico
(19◦28′39′′N, 96◦57′00′′W).Reference material: Ten specimens were prepared for
light microscopical analyses. Five voucher specimens are
deposited in the Colección Nacional de Helmintos (CNHEreg. no. 7541), Instituto de Biología, Universidad NacionalAutónoma de México, Mexico City. An additional fivevoucher specimens are deposited in the Parasitic Worm
M. Rubio-Godoy et al. / Veterinary Parasitology 186 (2012) 289– 300 295
Fig. 1. The haptoral armature and male copulatory organ of Mexican isolates of Gyrodactylus salmonis from Oncorhynchus mykiss (Walbaum). (a) Centralh d a ventc ar; (e ang
C2
ddIacu
motd
aptoral hook complex of two hamuli (h) linked by a dorsal bar (db) anopulatory organ showing a 1 + 8 arrangement of spination; (d) ventral b–j = 10 �m; b–c, e–f = 5 �m.
ollection at The Natural History Museum (BMNH reg. no.011.10.19.1-5), London, UK.
DNA reference sequences: Three sequences areeposited in GenBank: 1) partial 18S gene (1914 bp)eposited under accession number JN230350; 2) partial
TS1 (656 bp), 5.8S (157 bp), partial ITS2 (417 bp) underccession number JN230351; and, 3) partial cytochrome
oxidase subunit I (cox1) mitochondrial gene (1718 bp)nder accession number JN230352.
Description: Whole body measurements, given as the
ean and the range in parentheses, taken from 6 specimensnly. Body 507 (410–590) long; 159 (100–210) wide athe level of the uterus. Haptor longitudinally ovate, clearlyelineated from the body, 97.1 (87.5–105) long × 116.7
ral bar (vb); (b) developing male copulatory organ; (c) developed maled f) marginal hook sickle proper; (g–j), marginal hooks. Scale bars: a, d,
(100–132) wide. Anterior pharynx bulb 27.5 (23.3–34.0)long × 38.0 (28.8–45.7) wide; posterior pharynx bulb 20.8(17.2–23.0) long × 63.5 (54.7–75.1) wide. Intestinal cruraextending below the testes. Male copulatory organ (MCO),observed on 3 specimens, ventro-lateral, posterior to theposterior pharyngeal bulb, 18.7 (17.6–20.5) long × 19.0(17.7–20.7) wide, spherical, armed with one large principalhook 4.3–5.3 long and a single ring of 6–8 spines 3.2–4.3long (Figs. 1 and 2b, c, c). Measurements of the haptoralarmature (mean only) are based on ten specimens (see
Table 3 for full measurement details). Hamulus total length64.4; shaft length 43.5; point 35.7 long with a 35.8◦ aper-ture; proportionately short straight roots 22.1 long. Dorsalbar simple, attaching close to the anterior edge of the dorsal
296 M. Rubio-Godoy et al. / Veterinary Parasitology 186 (2012) 289– 300
Fig. 2. Species of Gyrodactylus von Nordmann, 1832 recorded from Oncorhynchus mykiss (Walbaum). (a) Mexican isolate of G. salmonis; (b) G. avaloniaHanek et Threlfall, 1969 (redrawn from Hanek and Threlfall, 1969); (c) G. bohemicus Ergens, 1992 (redrawn from Ergens, 1992); (d) G. brachymystacisErgens, 1978 (redrawn from Ergens, 1983); (e) G. brevis Crane et Mizelle, 1967 (original); (f) G. colemanensis Mizelle et Kritsky, 1967 (original); (g) G.derjavinoides Malmberg, Collins, Cunningham et Jalali, 2007 (original); (h) G. gobii Shulman, 1954 (redrawn from Gusev, 1985); (i) G. lavareti Malmberg,1957 (image courtesy of J. Lumme, University of Oulu, Finland); (j) G. lenoki Gussev, 1953 (redrawn from Ergens, 1983); (k) G. masu Ogawa, 1986 (original);
948) (imiginal);
(l) G. salaris Malmberg, 1957 (original); (m) G. salmonis (Yin et Sproston, 1Wiley Blackwell); (n) Gyrodactylus sp. Morph 8 sensu Shinn et al., 1995 (or(p) G. truttae Gläser, 1974 (original). Scale bar = 2.5 �m.
bar attachment point on each hamulus, 27.1 long, 2.2 wide.Dorsal bar attachment points large, covering one third ofthe width of the hamulus. Ventral bar 23.2 long; 25.5 wide.Ventral bar processes small. Median portion of the ventralbar, stout, slightly curved, length representing approxi-mately half the total length of the ventral bar. Ventral barmembrane triangular, 13.4 long. Marginal hook 44.6 long;
shaft length 37.0; sickle proper length 7.9. Sickle proxi-mal width 4.8. Toe pointed, triangular, steeply faced, 1.8long. Toe point below the lower level of the heel. Bridgeof the toe with prominent peak, which slopes towardsage reproduced courtesy of S. R. Gilmore, C. L. Abbott and D. K. Cone, and(o) G. teuchis Lautraite, Blanc, Thiery, Daniel et Vigneulle, 1999 (original);
the base of the sickle shaft. Heel not pronounced, gentlycurved. Sickle shaft, broad, gently curving into a broad tipof moderate length that terminates beyond the limit of thetoe. Distal width 6.0. Line described by inner curve of themarginal hook sickle, trapezoid. Sickle aperture 6.0 long.Instep height 0.8.
Comments: Of the marginal hook sickles presented in
Fig. 2, the Canadian isolate of G. salmonis (Fig. 2m) is theclosest morphologically to that of the Mexican isolate ofG. salmonis (Fig. 2a). Although the size of these is similar inboth cases (7.9 �m Mexican isolate of G. salmonis vs. 8.0 �m
ary Parasitology 186 (2012) 289– 300 297
ChiisdcatsinTteet
3
dfou
ssr(sth1gGtffISimbTafuis9a(
AtMvcdg
G. salmonis-s1 GQ368224
G. salmonis-Mexico
G. salmonis-d4 GQ368223
G. salmonis-d1 GQ368222
G. salvelini EF524572
G. lavare� EF446765
G. pomeraniae EF446766
G. lucii EF446749
G. salaris 50 changes
100
100
90
91
92
49
Fig. 3. Maximum parsimony phylogenetic tree based on an alignment
M. Rubio-Godoy et al. / Veterin
anadian isolate of G. salmonis), when the invariantly sizedooks of both are overlaid one another (Fig. S1d–f), then
t is evident that sickle base features permit their discrim-nation from each other. The sickle heel of the Canadianpecimen of G. salmonis is larger but has a shorter, rounded,ownward projecting toe (Fig. S1e, f). The toe of the Mexi-an isolate of G. salmonis by comparison, is larger, pointednd steeply sloped with a characteristic peak to the top ofhe top bridge which then slopes down towards the sicklehaft (Fig. S1b, d). The shape of the inner curve, therefore,s distinctly trapezoid in the Mexican isolate of G. salmo-is and rectangular in the Canadian isolate of G. salmonis.he approximate shape and size of the sickle shaft andip regions for both gyrodactylids coincide closely withach other. The approximate dimensions of all the features,xcept the ventral bar total width, extracted from the hap-oral hard parts for both gyrodactylids are closely matched.
.2. Molecular characterisation
PCR amplification and gene sequencing for the threeifferent gene regions were successfully achieved for allour individual Mexican isolates of G. salmonis. Contigu-us sequences were constructed and deposited in GenBanknder the accession numbers JN230350-52.
Due to 18S data being currently unavailable for G.almonis, the 18S sequence determined from the Mexicanpecimens were compared with two variable regions of SSUDNA obtained from a Canadian population of G. salmonisGilmore, Abbott and Cone, unpublished data). The regionspanned bases 422–864 and 1252–1740 from the submit-ed 18S sequence for the Mexican specimens and had 100%omology over all bases. The SSU (18S) rDNA sequence of914 base pairs (JN230350) was also similar to Gyrodactylusobiensis Gläser, 1974 (99.1%) and Gyrodactylus rutilensisläser (1974) (98.3%). The ITS1, 5.8S and ITS2 region of
he rDNA (1230 bp; JN230351) was identical to sequencesrom Gyrodactylus salmonis isolate s1 (GQ368233) collectedrom Washington, U.S.A. and Gyrodactylus salvelini isolatenari (EF113106) collected from Lake Inarijarvi, Barentsea basin, Finland with 1230/1230 identities and no gapsn both cases. The cox1 gene of 1718 bp (JN230352) was
ost similar to the American isolates of G. salmonis rangingetween 98% and 99.5% identities depending on the isolate.able 4 shows a percentage identity matrix based on cox1lignments of 1527 nucleotides for the Mexican isolaterom the present study and 8 other gyrodactylids identifiedsing blast searches. The highest sequence identity to Mex-
can isolates of G. salmonis was American G. salmonis isolate1, with an identity of 99.48%; G. salvelini had an identity of7.25%. The other American strains of G. salmonis also had
similar percentage identity (96.92–97.38%) to G. salvelinisee Table 4).
The phylogenetic tree (Fig. 3) shows that the knownmerican isolates of G. salmonis (s1, d4 and d1) group
ogether with the sequence from the present study fromexico. This grouping is well supported with a bootstrap
alue of 91. The Mexican isolate forms a well-supportedlade with the isolate s1, which is a sister clade to isolate4, with isolate d1 as the basal isolate of the G. salmonisroup. The next known most related species is G. salvelini.
of 1527 nucleotides of mitochondrial gene cox 1 sequence data. Boot-strap values were obtained from 1000 resamplings; scale bar represents50 nucleotide base changes.
4. Discussion
The isolate of G. salmonis described here is the first gyro-dactylid to be formally identified from O. mykiss in Mexicousing both morphological and molecular data. Prevalenceand abundance of the Mexican G. salmonis isolate was low,and infected fish did not show evident damage; further,there are no reports of fish morbidity or mortality asso-ciated to gyrodactylid infection in rainbow trout farms inVeracruz, which would suggest a stable host-parasite inter-action.
Gyrodactylus salmonis and G. colemanensis have virtu-ally pan-North American distributions, as both specieshave been recorded from farmed O. mykiss across boththe U.S.A. and Canada (Cone et al., 1983; Shinn et al.,2011) (Table 1). Gyrodactylus salmonis has low host speci-ficity, as it has also been recorded in the same regionon farmed salmonid fish introduced from Europe, suchas Salmo trutta fario L. (see Malmberg, 1993), Salmo salarL. (see Cone and Cusack, 1988; Malmberg, 1993) and S.fontinalis (see Cone and Cusack, 1988; Wells and Cone,1990; Malmberg, 1993); as well as on native Oncorhynchusspecies like golden trout Oncorhynchus aguabonita (Jor-dan) (see Cone et al., 1983), coho salmon Oncorhynchuskisutch (Walbaum) (see Cone et al., 1983) and O. clarkiiclarkii (see Cone et al., 1983), whose distribution rangesoverlap with the ancestral distribution range of O. mykiss.However, Gilmore et al. (2010) proposed that G. salmo-nis is a natural parasite of fish of the genus Salvelinus; aproposal strengthened by the recent observation in theSouth River watershed in Nova Scotia, Canada, that thisgyrodactylid mostly parasitised brook trout, S. fontinalis,despite the fact that three other salmonids (O. mykiss,
S. trutta and S. salar) occurred in the same river (Youet al., 2011). A further gyrodactylid parasite that has beenfound on sympatric salmonids in the northern Pacific isG. masu, which has been recovered from O. mykiss, masu
298 M. Rubio-Godoy et al. / Veterinary Parasitology 186 (2012) 289– 300
Table 4Percentage identity matrix of selected Gyrodactylus spp., based on an alignment of 1527 nucleotides of mitochondrial cox1 gene sequence data.
Taxa 1 2 3 4 5 6 7 8 9
1. G. salmonis (Mexican isolates) 100 99.48 98.82 98.56 97.25 87.43 82.51 79.24 79.042. G. salmonis-s1 99.48 100 98.82 98.69 97.25 87.23 82.51 79.57 79.113. G. salmonis-d4 98.82 98.82 100 98.62 97.38 87.16 82.19 79.76 79.114. G. salmonis-d1 98.56 98.69 98.62 100 96.92 87.10 82.84 79.83 79.505. G. salvelini 97.25 97.25 97.38 96.92 100 87.03 81.60 79.37 78.656. G. lavareti 87.43 87.23 87.16 87.10 87.03 100 82.06 79.31 79.767. G. pomeraniae 82.51 82.51 82.19 82.84 81.60 82.06 100 79.37 79.63
79.76
79.11
8. G. lucii 79.24 79.57
9. G. salaris 79.04 79.11
salmon Oncorhynchus masou masou (Brevoort) (see Ogawa,1986), and amago salmon Oncorhynchus rhodurus Jordanet McGregor (see Ogawa, 1994). Considering that rainbowtrout is also sympatric with chum salmon Oncorhynchusketa (Walbaum) and sockeye salmon Oncorhynchus nerka(Walbaum), it is plausible that G. salmonis infects thesetwo salmonids; and, conversely, that O. mykiss and othersympatric Oncorhynchus species harbour G. somnaensisErgens et Yukhimenko, 1990 found on O. keta (see Ergensand Yukhimenko, 1990) and G. nerkae found on O. nerka(see Cone et al., 1983). In brief, it is possible that allOncorhynchus species whose distribution range overlapswith that ancestral of O. mykiss (i.e., O. aguabonita, O. chryso-gaster, O. kisutch, O. keta, O. clarkii clarkii and O. nerka)exchange gyrodactylids.
Rainbow trout and other non-native salmonids wereintroduced in the late 19th century to central Mexico(Hendrickson et al., 2002), where they did not occur nat-urally. Although there are native trouts in Mexico, theseare distributed in the northwest of the country, mainly inriver systems west of the continental divide of the SierraMadre Occidental mountain range, which drain into the Seaof Cortés and the Pacific Ocean (Hendrickson et al., 2002;Camarena-Rosales et al., 2008). In the Pleistocene, the dis-tribution range of native salmonid fish extended some400 km further south of today’s range, as illustrated by theoccurrence of the fossil species Salmo australis Cavenderet Miller in Lake Chapala, Jalisco, at nearly 20◦ N lati-tude (Cavender and Miller, 1982); but salmonid fish neveroccurred naturally in central Mexico, i.e., southern NorthAmerica. Therefore, the most plausible explanation for theoccurrence of G. salmonis on rainbow trout in Veracruz(southeastern Mexico, on the Gulf of Mexico slope) is thatthe parasite was originally introduced with its translocatedfish host. The question whether rainbow trout acquiredthe parasite from other salmonids (possibly of the genusSalvelinus) prior to translocation or once in Mexico remainsopen – and will probably not be solved given the extensiveanthropogenic movement of fish stocks and presumablytheir parasites.
Mexican isolates of G. salmonis are both morphologicallyand molecularly very similar to the American and Canadianspecimens of G. salmonis. Morphological analysis showsthat features of the sickle base of the marginal hooks permit
the discrimination of Mexican G. salmonis from CanadianG. salmonis specimens. Molecular analysis indicated thatalignment of the partial 18S sequence from the Mexicanisolate of G. salmonis with those determined by Gilmore79.83 79.37 79.31 79.37 100 78.9879.50 78.65 79.76 79.63 78.98 100
et al. (unpublished data) from a Canadian population ofG. salmonis are identical. An alignment with the Mexican18S sequence with other Gyrodactylus species listed in Gen-Bank indicated that it was very similar (98–99%) to that ofG. gobiensis and other gyrodactylids such as G. salaris andG. rutilensis. Similarly, the ITS regions of the Mexican andAmerican isolates of G. salmonis were found to be identicalto each other and also to those of G. salvelini [1230/1230bases]. Considering the general lack of suitability of 18S fordiscriminating Gyrodactylus species, and the 100% homol-ogy found across the ITS regions, the mitochondrial markercox1 was also sequenced. Cox1 of the Mexican isolate ofG. salmonis shows higher variability compared to the ITSregion, with 1589/1597 bases identical with no gaps to theAmerican isolate of G. salmonis, i.e. 99.5% similar. There isless similarity to G. salvelini with 1635/1684 bases identi-cal with no gaps (97% similarity). The American isolate of G.salmonis is also 97% similar to G. salvelini with 1554/1597(no gaps) of comparable sequence data. Cox1 sequences ofthe American isolates of G. salmonis exhibit a range of vari-ation; as Mexican isolates fit into this range of variation,their identity as G. salmonis is confirmed.
Acknowledgments
We thank Norman Mercado-Silva (University of Ari-zona) for help in collecting fish. Thanks are due to PatriciaPilitt at the U.S. National Parasite Collection, Beltsville, USAand Judith Price from the Canadian Museum of Nature,Ottawa, Canada for arranging the loan and photograph-ing of type material. We would also like to thank StanleyKing (Dalhousie University, Halifax, Nova Scotia, Canada),David Cone (St Mary’s University, Halifax, Nova Scotia,Canada), Kazuo Ogawa (Tokyo University, Japan), GöranMalmberg (University of Stockholm, Sweden), and JaakkoLumme (University of Oulu, Finland) for providing ethanolfixed specimens and photographs from their private Gyro-dactylus collections for our use; and Scott Gilmore andCathryn Abbott (Department of Fisheries and Oceans,British Columbia, Canada) and David Cone (St Mary’sUniversity, Halifax, Canada) for providing unpublishedG. salmonis 18S sequence data for molecular analyses.This study was partly supported by grants from ConsejoNacional de Ciencia y Tecnología (CONACyT) FOMIX 32679,
SNI 52765 & CB 58050, and by INECOL institutional fundsawarded to MRG. Fish were collected under SAGARPA sci-entific collection permit No. DGOPA/01173/120208.0107.Morphological studies were conducted during the tenure
ary Para
orFlUSamf
A
cj
R
A
A
B
B
B
C
C
C
C
C
C
E
E
E
F
F
F
F
M. Rubio-Godoy et al. / Veterin
f a PhD scholarship from the Department of the Envi-onment, Food and Rural Affairs (Defra), UK (project no.C1183) awarded to APS and conducted by GP. Molecu-ar studies were conducted in Malaysia and supported byniversity of Malaya HIR grant No: UMC/625/1/HIR/027.ponsors had no role in the study design, in the collection,nalysis and interpretation of data; in the writing of theanuscript; nor in the decision to submit the manuscript
or publication.
ppendix A. Supplementary data
Supplementary data associated with this articlean be found, in the online version, at doi:10.1016/.vetpar.2011.11.005.
eferences
ltschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basiclocal alignment search tool. J. Mol. Biol. 215, 403–410.
rmijo, O.A., 1980. Algunas enfermedades que se presentan en los centrosacuícolas de México. In: II Simposio Latinoamericano de Acuicultura,México, D.F, pp. 1607–1618.
akke, T.A., Cable, J., Harris, P.D., 2007. The biology of gyrodactylid mono-geneans: the “Russian-doll killers. Adv. Parasitol. 64, 161–376.
uchmann, K., Bresciani, J., 1997. Parasitic infections in pond-reared rain-bow trout Oncorhynchus mykiss in Denmark. Dis. Aquat. Org. 28,125–138.
uchmann, K., Uldal, A., Lyholt, H., 1995. A checklist of metazoan para-sites from rainbow trout (Oncorhynchus mykiss). Acta Vet. Scand. 36,299–318.
amarena-Rosales, F., Ruiz-Campos, G., De La Rosa-Velez, J., Mayden, R.L.,Hendrickson, D.A., Varela-Romero, A., García de León, F.J., 2008. Mito-chondrial haplotype variation in wild trout populations (Teleostei:Salmonidae) from northwestern Mexico. Rev. Fish Biol. Fish 18,33–45.
avender, T.M., Miller, R.R., 1982. Salmo australis, a new species of fossilsalmonid from southwestern Mexico. Contrib. Mus. Paleontol. Univ.Mich. 26, 1–17.
one, D.K., Beverley-Burton, M., Wiles, M., MacDonald, T.E., 1983. Thetaxonomy of Gyrodactylus (Monogenea) parasitizing certain salmonidfishes of North America, with a description of Gyrodactylus nerkae n.sp. Can. J. Zool. 61, 2587–2597.
one, D.K., Cusack, R., 1988. A study of Gyrodactylus colemanensis Mizelleand Kritsky, 1967 and Gyrodactylus salmonis (Yin and Sproston,1948) parasitizing captive salmonids in Nova Scotia. Can. J. Zool. 66,409–415.
one, D.K., Wiles, M., 1989. Ultrastructural study of attachment of Gyro-dactylus colemanensis (Monogenea) to fins of fry of Salmo gairdneri.Proc. Helminth. Soc. Wash. 56, 29–32.
rane, J.W., Mizelle, J.D., 1967. Studies on monogenetic trematodes XXXIFive new species of Gyrodactylus from California fishes. J. Parasitol. 53,270–273.
rgens, R., 1983. Gyrodactylus from Eurasian freshwater Salmonidae andThymallidae. Folia Parasitol. 30, 15–26.
rgens, R., 1992. Gyrodactylus bohemicus sp. n. (Monogenea: Gyrodactyl-idae) from Oncorhynchus mykiss (Walbaum) and Salvelinus fontinalis(Mitchill) (Clupeiformes: Salmonidae) in Czechoslovakia. Folia Para-sitol. 39, 391–394.
rgens, R., Yukhimenko, S.S., 1990. Gyrodactylus somnaensis sp. n. (Mono-genea: Gyrodactylidae), a new fish parasite from the basin of the RiverAmur. Folia Parasitol. 37, 313–314.
AO, 2005. Cultured Aquatic Species Information Programme. FAO Fish-eries and Aquaculture Department, Rome.
lores-Crespo, J., Flores, C.R., 1993. Principales tremátodos y céstodos deimportancia económica en acuicultura. In: Tópicos de parasitologíaanimal; céstodos y tremátodos. Universidad Autónoma del Estado deMorelos, Cuernavaca, pp. 13–36.
reeman, M.A., Ogawa, K., 2010. Variation in the small subunit ribo-somal DNA confirms that Udonella (Monogenea: Udonellidae) is aspecies-rich group. Int. J. Parasitol. 40, 255–264.
roese, R., Pauly, D., 2010. FishBase, Froese, R., Pauly, D. (Eds.)(www.fishbase.org), World Wide Web electronic publication.
sitology 186 (2012) 289– 300 299
García-Vásquez, A., Hansen, H., Christison, K.W., Bron, J.E., Shinn, A.P.,2011. Description of three new species of Gyrodactylus Nordmann1832 (Monogenea) from oreochromids (Oreochromis, Cichlidae). ActaParasitol. 56, 20–33.
García-Vásquez, A., Hansen, H., Christison, K.W., Rubio-Godoy, M., Bron,J.E., Shinn, A.P., 2010. Gyrodactylids (Gyrodactylidae Monogenea)infecting Oreochromis niloticus niloticus (L.) and O. mossambi-cus (Peters) (Cichlidae): a pan-global survey. Acta Parasitol. 55,215–229.
Gilmore, S.R., Abbott, C.L., Cone, D.K., 2010. The placement of Gyrodacty-lus salmonis (Yin & Sproston) in the molecular phylogeny of studiedmembers of the Gyrodactylus wageneri-group parasitizing salmonids.J. Fish Dis. 33, 461–467.
Gläser, H.J., 1974. Sechs neue Arten der Gyrodactylus-wageneri Gruppe(Monogenea, Gyrodactylidae) nebst Bemerkungen zur Präparation,Determination, Terminologie und Wirtsspezifität. Zool. Anz. 192,56–76.
Granath, W.O., Gilbert, M.A., Wyatt-Pescador, E.J., Vincent, E.R., 2007. Epi-zootiology of Myxobolus cerebralis, the causative agent of salmonidwhirling disease in the Rock Creek drainage of West-Central Montana.J. Parasitol. 91, 104–119.
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignmenteditor and analysis program for Windows 95/98/NT. Nucleic AcidsSymp. 41, 95–98.
Hanek, G., Threlfall, W., 1969. Monogenetic trematodes from Newfound-land Canada. 1. New species of the genus Gyrodactylus Nordmann,1832. Can. J. Zool. 47, 951–955.
Hathaway, R.P., Herlevich, J.C., 1973. Gyrodactylus stableri sp. n., with newhost and locality records for species of Gyrodactylus. J. Parasitol. 59,801–802.
Hendrickson, D.A., Espinoza Pérez, H., Findley, L.T., Forbes, W., Tomel-leri, J.R., Mayden, R.L., Nielsen, J.L., Jensen, B., Ruiz Campos, G., VarelaRomero, A., van der Heiden, A., Camarena, F., García de León, F.J., 2002.Mexican native trouts: a review of their history and current systematicand conservation status. Rev. Fish Biol. Fish. 12, 273–316.
ISSG, 2010. Global Invasive Species Database (Invasive Species SpecialistGroup, www.issg.org),World Wide Web electronic publication.
Johnsen, B.O., Jensen, A.J., 1991. The Gyrodactylus story in Norway. Aqua-culture 98, 289–302.
Karasev, A.B., Mitenev, V.K., Kalinina, N.R., 1997. Parasite fauna ofcage-reared rainbow trout Oncorhynchus mykiss (Walbaum): researchin freshwater farms (Kola Peninsula Russia). Bull. Eur. Assoc. FishPathol. 17, 177–179.
Koski, P., Malmberg, G., 1995. Occurrence of Gyrodactylus (Monogenea)on salmon and rainbow trout in fish farms in Northern Finland. Bull.Scan. Soc. Parasitol. 5, 76–88.
Kuusela, J., Zietara, M.S., Lumme, J., 2008. Description of three new Euro-pean cryptic species of Gyrodactylus Nordmann, 1832 supported bynuclear and mitochondrial phylogenetic characterization. Acta Para-sitol. 53, 120–126.
Lautraite, A., Blanc, G., Thiery, R., Daniel, P., Vigneulle, M., 1999. Gyro-dactylids parasitizing salmonids in Brittany and Western Pyreneeswater basins: Epidemiological features of infection and species com-position. Bull. Fr. Pêche Piscic. 355, 305–325.
López-Jiménez, S., 2001. Estudio parasitológico de los peces de aguas dul-ces del estado de Tabasco. In: Gaceta Sigolfo Sistema de Investigacióndel Golfo de México, pp. 8–10.
Lux, E., 1990. Gyrodactylus salaris-Parasitierung von Salmoniden, eindiagnostisch-taxonomisches Problem. In: Bernoth, E.-M., Hoffmann,R. (Eds.), Tagung der Fachgruppe “Fischkrankheiten” in Verbindungmit der EAFP/-deutsche Sektion European Association of Fish Pathol-ogists. Deutsche Veterinärmedizinische Gesellschaft e. V, Giessen, pp.87–98.
Malmberg, G., 1957. Om förekomsten av Gyrodactylus på svenska fiskar.Särtryck ur Skrifter Utgivna av Södra Sveriges Fiskeriförening Årsskrift1956, 19–76.
Malmberg, G., 1970. The excretory systems and the marginal hooks asa basis for the systematics of Gyrodactylus (Trematoda Monogenea).Ark. Zool. 23, 1–235.
Malmberg, G., 1993. Gyrodactylidae and Gyrodactylosis of Salmonidae.Bull. Fr. Pêche Piscic. 328, 5–46.
Malmberg, G., Collins, C.M., Cunningham, C.O., Jalali, B.J., 2007. Gyrodacty-lus derjavinoides sp. nov. (Monogenea, Platyhelminthes) on Salmotrutta trutta L. and G. derjavini Mikailov, 1975 on S. t. caspius Kessler,
two different species of Gyrodactylus – combined morphological andmolecular investigations. Acta Parasitol. 52, 89–103.Mendoza-Franco, E.F., Scholz, T., Vivas-Rodríguez, C., Vargas-Vázquez, J.,1999. Monogeneans of freshwater fishes from cenotes (sinkholes) ofthe Yucatan Peninsula. Mexico. Folia Parastol. 46, 267–273.
ary Para
manensis and G. salmonis parasitizing salmonids in the South River
300 M. Rubio-Godoy et al. / Veterin
Mendoza-Palmero, C.A., Sereno-Uribe, A.L., Salgado-Maldonado, G., 2009.Two new species of Gyrodactylus von Nordmann, 1832 (Monogenea:Gyrodactylidae) parasitizing Girardinichthys multiradiatus (Cyprin-odontiformes: Goodeidae), an endemic freshwater fish from centralMexico. J. Parasitol. 95, 315–318.
Mizelle, J.D., Kritsky, D.C., 1967. Studies on monogenetic trematodesXXXIII New species of Gyrodactylus and a key to the North Americanspecies. Trans. Am. Microscop. Soc. 86, 390–401.
Morris, D.J., Freeman, M.A., 2010. Hyperparasitism has wide-rangingimplications for studies on the invertebrate phase of myxosporean(Myxozoa) life cycles. Int. J. Parasitol. 40, 357–359.
Ogawa, K., 1986. A monogenean parasite Gyrodactylus masu sp. n. (Mono-genea: Gyrodactylidae) of salmonid fish in Japan. Bull. Jap. Soc. Sci.Fish. 52, 947–950.
Ogawa, K., 1994. Monogenean parasites of freshwater fishes of Hokkaido.Sci. Rep. Hokk. Fish Hatch. 48, 59–67.
Paladini, G., Gustinelli, A., Fioravanti, M.L., Hansen, H., Shinn, A.P.,2009. The first report of Gyrodactylus salaris Malmberg, 1957 (Platy-helminthes, Monogenea) on Italian cultured stocks of rainbow trout(Oncorhynchus mykiss Walbaum). Vet. Parasitol. 165, 290–297.
Pérez-Ponce de León, G., Rosas-Valdez, R., Aguilar-Aguilar, R.,Mendoza-Garfias, B., Mendoza-Palmero, C., García-Prieto, L.,Rojas-Sánchez, A., Briosio-Aguilar, R., Pérez-Rodríguez, R.,Domínguez-Domínguez, O., 2010. Helminth parasites of fresh-water fishes Nazas River basin, northern Mexico. Check List 6,26–35.
Pugachev, O.N., Gerasev, P.I., Gusev, A.V., Ergens, R., Khotenowsky, I., 2009.Guide to Monogenoidea of freshwater fish of Palaeartic and Amurregions. Ledizioni, p. 564.
Rokicka, M., Lumme, J., Zietara, M.S., 2007. Identification of Gyrodactylusectoparasites in Polish salmonid farms by PCR-RFLP of the nuclear ITSsegment of ribosomal DNA (Monogenea Gyrodactylidae). Acta Para-sitol. 52, 185–195.
Rosas, M.M., 1976. Peces dulce-acuícolas que se explotan comercialmenteen México y datos sobre su cultivo. Instituto Nacional de Pesca, Méx-ico, D.F, 135 p.
Rubio-Godoy, M., Paladini, G., García-Vásquez, A., Shinn, A.P., 2010.Gyrodactylus jarocho sp. nov. and Gyrodactylus xalapensis sp. nov.(Platyhelminthes: Monogenea) from Mexican poeciliids (Teleostei:Cyprinodontiformes), with comments on the known gyrodactylidfauna infecting poeciliid fish. Zootaxa 2509, 1–29.
Saitou, N., Nei, M., 1987. The Neighbour-joining method: A new methodfor reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Salgado-Maldonado, G., 2006. Checklist of helminth parasites of freshwa-
ter fishes from Mexico. Zootaxa 1324, 1–357.Salgado-Maldonado, G., Aguilar-Aguilar, R., Cabanas-Carranza, G.,Soto-Galera, E., Mendoza-Palmero, C., 2005. Helminth parasites infreshwater fish from the Papaloapan river basin Mexico. Parasitol.Res. 96, 69–89.
sitology 186 (2012) 289– 300
Salgado-Maldonado, G., Cabanas-Carranza, G., Soto-Galera, E.,Caspeta-Mandujano, J.M., Moreno-Navarrete, R.G., Sánchez-Nava,P., Aguilar-Aguilar, R., 2001. A checklist of helminth parasites offreshwater fishes from the Lerma-Santiago river basin Mexico. Comp.Parasitol. 68, 204–218.
Sánchez-Nava, P., Salgado-Maldonado, G., Soto-Galera, E., Cruz, B.J., 2004.Helminth parasites of Girardinichthys multiradiatus (Pisces: Goodei-dae) in the upper Lerma River sub-basin. Mexico. Parasitol. Res. 93,396–402.
Schulman, S.S., 1953. New species of monogenetic trematodes oncyprinids (In Russian). Akad. Nauk SSSR. Rab. Gelmint. 75,778–780.
Shinn, A.P., Hansen, H., Olstad, K., Bachmann, L., Bakke, T.A., 2004.The use of morphometric characters to discriminate specimens oflaboratory-reared and wild populations of Gyrodactylus salaris and G.thymalli (Monogenea). Folia Parasitol. 51, 239–252.
Shinn, A.P., Harris, P.D., Cable, J., Bakke, T.A., Paladini, G., Bron, J.E., 2011.GyroDb. (www.gyrodb.net), World Wide Web electronic publication.
Shinn, A.P., Sommerville, C., Gibson, D.I., 1995. Distribution and charac-terization of species of Gyrodactylus Nordmann, 1832 (Monogenea)parasitizing salmonids in the UK, and their discrimination from G.salaris Malmberg, 1957. J. Nat. Hist. 29, 1383–1402.
Swofford, D.L., 2002. PAUP*Phylogenetic analysis using parsimony (*andother methods), v 4. 0 beta10. Sinauer Associates, Sunderland, MA,USA.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G.,1997. The CLUSTAL-X windows interface: flexible strategies for mul-tiple sequence alignment aided by quality analysis tools. Nuc. AcidsRes. 24, 4876–4882.
Wang, Z.M., Wang, B.Q., Li, J.X., Wang, X.J., Liu, G., Wang, X.J., Zhao, E.Y.,1997. The experiment on the prevention and cure of the salmonidgyrodactylosis (Gyrodactylus lenoki). Chin. J. Fish. 10, 28–37.
Wells, P.R., Cone, D.K., 1990. Experimental studies on the effect of Gyro-dactylus colemanensis and G. salmonis (Monogenea) on the density ofmucous cells in the epidermis of fry of Oncorhynchus mykiss. J. FishBiol. 37, 599–603.
Yin, W.Y., Sproston, N.G., 1948. Studies on the monogenetic trematodesof China. Sinensia 19, 57–85.
You, P., Yuan, B., Yang, J., Easy, R., Dong, Z., Cone, D., 2006. Pathogenic infec-tions of Gyrodactylus brachymystacis (Monogenea) on Oncorhynchusmykiss (Walbaum) at a fish farm in the Qinling Mountain region ofChina. J. Fish Dis. 29, 313–316.
You, P., MacMillan, J., Cone, D., 2011. Local patchiness of Gyrodactylus cole-
watershed, Nova Scotia, Canada. Dis. Aquat. Org. 96, 137–143.Zietara, M.S., Huyse, T., Lumme, J., Volckaert, F.A., 2002. Deep divergence
among subgenera of Gyrodactylus inferred from rDNA ITS region. Par-asitology 124, 39–52.
