Molecular Medicine - Sid Italia · 513 D iabetes mellitus is a growing health problem throughout the world. The prevalence of diabetes mellitus was estimated to be 171 million people

513

Diabetes mellitus is a growing health problem throughout the world. The prevalence of diabetes mellitus was estimated

to be 171 million people in the year 2000 and is predicted to more than double to over 366 million people by the year 2030.1 Largely unknown in the early 20th century, type 2 diabetes mel-litus is now the 7th leading cause of death in the United States.2

Cardiovascular disease is the main cause of death in type 2 diabetes mellitus.3 One of the mechanisms linking diabetes mellitus to increased cardiovascular risk may be accelerated arterial stiffening that is frequently observed in diabetic pa-tients.4 In fact, arterial stiffness predicts the development of cardiovascular disease and mortality in the general population and in type 2 diabetes mellitus.5,6

Arterial stiffening may occur as an adaptive response to hypertension, maintaining vascular mechanical stress homeo-stasis.7 Conversely, the lack of Windkessel function associated with aortic stiffening may generate elevated pulse pressure, thereby contributing to hypertension.8 Because of the high prevalence of coexistent hypertension in the diabetic popula-tion (≈70%),9 it is difficult to discern whether aortic stiffening is primarily caused by hypertension or occurs as an indepen-dent pathology and should therefore be diagnosed and treated independently. To this end, animal models may help study the relationship between arterial stiffness and hypertension.

The mechanical properties of the aorta, being a conduit vessel, are largely defined by its passive (structural) stiffness,

Molecular Medicine

© 2015 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.115.306341

Rationale: Accelerated arterial stiffening is a major complication of diabetes mellitus with no specific therapy available to date.

Objective: The present study investigates the role of the osteogenic transcription factor runt-related transcription factor 2 (Runx2) as a potential mediator and therapeutic target of aortic fibrosis and aortic stiffening in diabetes mellitus.

Methods and Results: Using a murine model of type 2 diabetes mellitus (db/db mice), we identify progressive structural aortic stiffening that precedes the onset of arterial hypertension. At the same time, Runx2 is aberrantly upregulated in the medial layer of db/db aortae, as well as in thoracic aortic samples from patients with type 2 diabetes mellitus. Vascular smooth muscle cell–specific overexpression of Runx2 in transgenic mice increases expression of its target genes, Col1a1 and Col1a2, leading to medial fibrosis and aortic stiffening. Interestingly, increased Runx2 expression per se is not sufficient to induce aortic calcification. Using in vivo and in vitro approaches, we further demonstrate that expression of Runx2 in diabetes mellitus is regulated via a redox-sensitive pathway that involves a direct interaction of NF-κB with the Runx2 promoter.

Conclusions: In conclusion, this study highlights Runx2 as a previously unrecognized inducer of vascular fibrosis in the setting of diabetes mellitus, promoting arterial stiffness irrespective of calcification. (Circ Res. 2015;117:513-524. DOI: 10.1161/CIRCRESAHA.115.306341.)

Key Words: arterial stiffness ■ diabetes mellitus ■ extracellular matrix ■ oxidative stress ■ smooth muscle cell

Original received February 27, 2015; revision received July 23, 2015; accepted July 24, 2015. In June 2015, the average time from submission to first decision for all original research papers submitted to Circulation Research was 12.31 days.

From the Division of Cardiovascular Medicine (U.R., I.N.S., Y.K., W.H.Z., M.A., A.J., F.N., R.T., K.T., A.D., J.M.S., P.S.T.), and Cardiovascular Institute (U.R., Y.K., K.P., J.K.H., F.C.E., M.A., A.J., F.N., K.T., J.M.S., P.S.T.), Stanford University School of Medicine, Stanford, CA; VA Palo Alto Health Care System, Palo Alto, CA (U.R., I.N.S., Y.K., W.H.Z., M.A., A.J., K.T., A.D., J.M.S., P.S.T.); Heart Center, Georg-August-University Göttingen, Göttingen, Germany (U.R., G.H.); Departments of Medicine (E.C., S.E., L.M.) and Cell and Molecular Biology (F.S.), Karolinska Institute, Stockholm, Sweden; Department of Nephrology and Hypertension, Friedrich-Alexander-Universität Erlangen-Nürnberg (FAU), Erlangen, Germany (C.W.); and Division of Cardiovascular Medicine and Intensive Care Medicine, Saint Mary’s Hospital, Siegen, Germany (M.B.).

*These authors contributed equally to this article.The online-only Data Supplement is available with this article at http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.

115.306341/-/DC1. Correspondence to Dr Philip S. Tsao, VA Palo Alto Health Care System, 3801 Miranda Ave, Bldg 101 No. A2-141, Palo Alto, CA 94304. E-mail

[email protected]

Transcription Factor Runx2 Promotes Aortic Fibrosis and Stiffness in Type 2 Diabetes Mellitus

Uwe Raaz,* Isabel N. Schellinger,* Ekaterina Chernogubova, Christina Warnecke, Yosuke Kayama, Kiril Penov, Jan K. Hennigs, Florian Salomons, Suzanne Eken,

Fabian C. Emrich, Wei H. Zheng, Matti Adam, Ann Jagger, Futoshi Nakagami, Ryuji Toh, Kensuke Toyama, Alicia Deng, Michael Buerke, Lars Maegdefessel, Gerd Hasenfuß,

Joshua M. Spin, Philip S. Tsao

at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from

http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.115.306341/-/DC1

http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.115.306341/-/DC1

mailto:[email protected]

mailto:[email protected]

http://circres.ahajournals.org/














514 Circulation Research August 28, 2015

which in turn is mainly determined by the extracellular matrix (ECM) components of the vessel wall.10–12 Fibrillar collagen (type 1 and type 3) and elastin represent the major ECM pro-teins of the aorta. Although elastin is a relatively inert protein, collagen is readily remodeled in response to various stimuli.

The osteogenic transcription factor runt-related tran-scription factor 2 (Runx2; Cbfa1) may qualify as a mediator of ECM remodeling and aortic stiffening in the context of diabetes mellitus. Runx2 was initially identified as an activa-tor of osteoblast differentiation during embryonic develop-ment.13 In postnatal life, however, it serves as a physiological transcriptional regulator of bone matrix protein deposition (such as type I collagen) in osteogenic tissues.14 More re-cently, Runx2 received attention in vascular biology, emerg-ing as a marker of vascular smooth muscle cell (VSMC) transdifferentiation toward an osteogenic phenotype and contributing to the active vascular calcification found in athero- and arteriosclerosis.15–17 VSMC-specific knockout experiments demonstrated functional involvement of Runx2 in murine atherosclerotic calcification.17 However, the im-mediate function of Runx2 in the vascular system—in par-ticular as a potential regulator of matrix protein expression and arterial stiffness—is unknown.

This study tests the hypothesis that structural aortic stiff-ening occurs independently from arterial hypertension in a murine model of type 2 diabetes mellitus. We further use a VSMC-specific transgenic approach to investigate the po-tential of Runx2 to induce aberrant aortic matrix production, resulting in increased stiffness and hypertension. Finally, we delineate a novel signaling mechanism potentially leading to enhanced Runx2 expression in VSMC under diabetic condi-tions (reactive oxygen species [ROS]–nuclear factor kappa beta [NF-κB]–Runx2 pathway).

MethodsAn expanded Methods section is available in the Online Data Supplement.

AnimalsMale db/db mice (BKS.Cg-Dock7m +/+Leprdb/J) and their age-matched heterozygous nondiabetic controls (+/db) were purchased from the Jackson Laboratory (Bar Harbor, ME).

Transgenic mice with VSMC-specific Runx2 overexpression (Runx2-smTg; C57Bl/6 background) were generated at our institu-tion by pronuclear injection of a transgene cassette consisting of the entire coding region of mouse type 1 Runx2 driven by the 445 bp form of the SM22α promoter.

Pressure MyographyPressure myography was performed to directly assess the passive aor-tic mechanics according to adapted protocols.18 In brief, murine tho-racic aortae were explanted and placed on specially designed stainless steel cannulas. Subsequently, the artery was pressurized from 0 to 180 mm Hg in 18 mm Hg increments, and the vessel’s outer diameter was simultaneously tracked by continuous computer video analysis.

RNA QuantificationTotal aortic RNA was isolated and processed for real-time quantita-tive reverse transcription polymerase chain reaction using standard protocols and methods.

Histology, Immunofluorescence, and In Situ Dihydroethidium StainingStandardized protocols were used, with details available in the Online Data Supplement.

Elastin ImagingElastin autofluorescence was visualized in 30-μm-thick aortic cross sections using confocal microscopy, and 3D structure was recon-structed from 28 layers using ImageJ (National Institutes of Health, Bethesda, MD). Elastin fragmentation was quantified in the histologi-cal images using elastin fluorescence morphometric analysis (ImageJ).

Aortic Collagen QuantificationTotal aortic collagen was quantified using a hydroxyproline detec-tion–based assay (QuickZyme Total Collagen Assay; Quickzyme) as per manufacturer’s protocol.

Western BlotsStandardized protocols were used, with details available in the Online Data Supplement.

Transfection of Cultured CellsTransfection of human aortic smooth muscle cells (AoSMCs) was performed using Lipofectamine RNAiMAX (Invitrogen) reagent and siRNA targeting Runx2 or NF-κB subunits RelA (p65) and Nfkb1 (p50; all from Ambion).

Chromatin Immunoprecipitation AssayAoSMC chromatin immunoprecipitation analysis was performed us-ing the ChIP-IT High-Sensitivity Kit (Active Motif) as per manufac-turer’s protocol.

NF-κB Activation AssayTo quantify cellular NF-κB activation in aortic tissue and cultured AoSMCs, nuclear extracts were obtained using the Nuclear Extract Kit (Active Motif) as per the manufacturer’s protocol. Subsequently, NF-κB activation (p65 DNA-binding activity) was measured using the TransAM NF-κB activation Kit ELISA (Active Motif).

RelA (p65)/DNA–Binding AssayTo analyze the NF-κB–binding capacity of the predicted RelA (p65)-binding motif within the Runx2 promoter, we used a DNA-binding ELISA approach (TransAM Flexi NF-κB p65 Kit; Active Motif) as previously described.19

Luciferase AssayThe functional relevance of direct NF-κB binding for the Runx2 promoter activity was tested by transfecting high glucose (HG)-stimulated AoSMCs with SwitchGear GoClone luciferase constructs.

StatisticsData are presented as mean±SEM. For comparison of 2 groups, Student’s t test (2-tailed) was performed; multiple groups (≥3 groups) comparison was accomplished by ANOVA with Bonferroni’s post test. For pressure myography analysis, 2-way repeated measures ANOVA followed by Bonferroni’s post test was used. Normality and homosce-dasticity was tested to ensure that parametric testing was appropriate. A value of P<0.05 (2-sided) was considered statistically significant.

Nonstandard Abbreviations and Acronyms

AoSMCs aortic smooth muscle cells

COL1A1 collagen, type 1, alpha 1

COL1A2 collagen, type 1, alpha 2

ECM extracellular matrix

FN1 fibronectin 1

HG high glucose

NF-ĸB nuclear factor kappa beta

ROS reactive oxygen species

Runx2 runt-related transcription factor 2

VSMC vascular smooth muscle cells

at UNIVSTUDI PADOVA on October 22, 2015http://circres.ahajournals.org/Downloaded from


Raaz et al Runx2 Induces Aortic Fibrosis and Stiffness 515

ResultsStructural Aortic Stiffening Precedes the Onset of Hypertension in db/db MiceTo characterize the mechanical properties of db/db aortae, we first performed ex vivo mechanical testing of thoracic aortic segments using pressure myography. Aortic tissues de-rived from 20-week-old hyperglycemic db/db mice (Online Figure I) exhibit significantly increased aortic stiffness com-pared with those from nondiabetic +/db controls (Figure 1A). Concomitantly, we found statistically significant elevations of systolic and mean blood pressure levels by noninvasive tail volume–pressure recording (Figure 1B). Importantly, pulse pressure, an indirect measure of aortic stiffness, was also in-creased in diabetic conditions (Figure 1B).

Further, investigating the temporal course of passive aor-tic stiffening and its relation to the onset of hypertension in diabetic db/db mice, we performed serial pressure myography measurements. Starting our measurements at 4 weeks of age (when db/db mice were mildly hyperglycemic; Online Figure I), we found progressive aortic stiffening at 10 and 20 weeks of age (Figure 1C). Blood pressure levels monitored at cor-responding time points showed statistically significant eleva-tions of systolic, diastolic, and mean blood pressure levels only at 20 weeks of age in db/db mice, but not at 10 weeks (Figure 1D). Pulse pressure was also increased only at 20 weeks of age (Figure 1D). Taken together, these results sug-gest that db/db mice display progressive mechanical stiffening of the aorta before development of hypertension.

db/db Mice Exhibit Enhanced Medial Collagen Production and Deposition Associated With Increased Runx2 ExpressionPassive aortic stiffness largely depends on the matrix com-position within the vessel’s medial layer. Thus, we next fo-cused on structural ECM alterations as the putative basis for the observed aortic stiffening in db/db mice. Histological examination of aortic sections (by Picrosirius Red, Masson’s Trichrome, Figure 2A; as well as HE staining, Online Figure II) revealed increased collagen deposition in the media from db/db aortae compared with controls. Additional immunofluo-rescence analysis confirmed enhanced Collagen I expression in the aortic medial layer (Figure 2A). These observations were reflected by an increased collagen content measured in db/db aortae (Figure 2B).

Runx2 is known as a transcriptional regulator of collagen deposition in bone. Investigating the potential contribution of Runx2 in the profibrotic response in db/db aortae, we detected increased protein expression of Runx2 that was largely con-fined to the medial layer of the aorta (Figure 2A). This was accompanied by significantly increased gene expression of Runx2 and several of its ECM target genes (collagen, type 1, alpha 1 [Col1a1], collagen, type 1, alpha 2 [Col1a2], fibro-nectin 1 [Fn1], and Spp1) in 10- and 20-week-old db/db mice compared with age-matched controls (Figure 2C–2G).

Aortic RUNX2 Expression Is Increased in Type 2 Diabetes Mellitus PatientsWe sought to confirm the translational relevance of the in-creased aortic Runx2 expression found in our murine model.

Therefore, we analyzed the gene expression in thoracic aor-tic samples that were collected during aorto-coronary bypass surgery (aortic plugs) from patients with type 2 diabetes mel-litus (n=8; mean age 61.0±2.9 years) and from nondiabetic patients (n=10; mean age 61.2±4.1 years; P=ns versus diabet-ic patients). All patients were male, white, and nonsmokers. Although the patients (diabetic and nondiabetic) taking part in this study were not systematically screened for vascular cal-cification as a predefined category, there was no macroscopic evidence of gross thoracic aortic calcification that would com-plicate bypass anastomosis. We found RUNX2 and the target genes COL1A1, COL1A2, and FN1 to be significantly upreg-ulated in aortae from diabetic patients compared with those from nondiabetic patients (Figure 2H; Online Figure III).

Runx2 Overexpression Induces Aortic Media Fibrosis, Increased Aortic Stiffness, and Elevated Pulse PressureTo discern the functional impact of enhanced medial Runx2 expression on aortic stiffness, we generated Runx2-smTg mice expressing the entire coding region of murine Runx2 under control of the SM22α/transgelin promoter, thereby achieving VSMC-specific overexpression of Runx2. VSMCs constitute the predominant cell type of the aortic medial layer that in turn largely defines the vessel’s mechanical stiffness. Runx2-smTg mice are viable and fertile and develop normally with-out any obvious phenotypic abnormalities. No differences in body weights were identified between Runx2-smTG mice and wild-type littermates in both genders (data not shown). Runx2-smTg mice exhibit uniform ≈15-fold upregulation of Runx2 gene expression that is similar to that in db/db mice compared with nondiabetic controls at 20 weeks of age. This is accom-panied by significantly increased expression of matrix-related target genes (such as Col1a1, Col2a1, Fn1, Spp1, and Bglap3; Figure 3A). Induction of Runx2 protein expression in the aor-tic media was confirmed via fluorescent immunohistochemis-try (Figure 3B) and Western blot (Figure 3C). According to its SM22α promoter–dependent regulation, Runx2 overexpres-sion was not confined to the aorta, but was comparably ex-pressed in carotid and femoral arteries (Online Figure IV). We further analyzed the expression levels of the matrix genes that are not under direct control of Runx2 as a transcription fac-tor, such as Col3a1, Col5a1, as well as Eln. Expectedly, those genes were not upregulated in Runx2-Tg aortae (Online Figure VA). Similarly, diabetic aortae did not exhibit significant dys-regulation of these aforementioned genes (Online Figure VB).

We next confirmed increased collagen expression histologi-cally in the aortic medial layer of Runx2-smTg mice (Figure 3B; Online Figure VI), which was additionally reflected by increased total amounts of aortic collagen (Figure 3D). Further char-acterization of Runx2-smTg aortae revealed normally devel-oped medial elastin lamellae without increased elastin breaks (Figure 3E and 3F; Online Video), as well as normal appearance of the smooth muscle layer positively stained with alpha-smooth muscle actin (Online Figure VII) without evidence of increased apoptosis (Online Figure VIII). Of note, Runx2-smTg mice ex-hibit normal blood glucose levels (Online Figure I).

Mechanical testing revealed markedly enhanced stiffness of Runx2-smTg aortae as compared with C57Bl/6 controls




(Figure 3G). At the hemodynamic level, enhanced stiffness was paralleled by increased arterial pulse pressure levels (Figure 3H; Online Figure IX).

Given the known association between enhanced Runx2 expression and osteogenic transdifferentiation in VSMCs, we determined whether increased Runx2 expression per se was

A

B

D

C

Figure 1. db/db mice exhibit increasing aortic stiffness that precedes blood pressure elevations. A, Passive pressure–diameter curves derived from pressure myography of 20-week-old db/db and +/db aortae. Values are mean±SEM. *P<0.05 vs +/db controls for pressure levels ≥36 mm Hg. n=5/group. B, Systolic, diastolic, mean, and pulse pressure levels of 20-week-old db/db mice and +/db controls. n=10/group. Values are mean±SEM. *P<0.05. C, Pressure–diameter curves of 4-, 10-, and 20-week-old db/db aortae. Values are mean±SEM. *P<0.05 vs db/db – 4wks (for pressure levels ≥36 mm Hg); #P<0.05 vs db/db – 10wks (for pressure levels ≥72 mm Hg). D, Systolic, diastolic, mean, and pulse pressure levels of aging db/db mice. n=10/group. Values are mean±SEM. *P<0.05. BP indicates blood pressure.




sufficient to induce medial calcification in vivo, potentially augmenting arterial stiffness. However, we were unable to detect any substantial deposition of calcium (by Alizarin Red staining; Figure 3I) or inorganic phosphate (by von Kossa staining; Figure 3J) in the thoracic aortae of the Runx2 trans-genic mice. Further, we assessed whether subtle calcification precursors, such as microcalcifications or enhanced CD63-postive exosome/matrix vesicle formation as a first nidus for mineralization,20 are present in Runx2-smTG aortae. Here, neither bisphosphonate-based microcalcification staining

(OsteoSense; Online Figure X) nor CD63 immunofluorescence (Online Figure XI) was able to detect differences between Runx2-smTG aortic sections compared with the wild-type.

Antioxidant Treatment Reduces Aortic Runx2 Expression, Medial Fibrosis, Aortic Stiffness, and Pulse Pressure in db/db MiceDiabetes mellitus is associated with increased generation of ROS in the vasculature. To determine whether diabetes mellitus–associated Runx2 expression is redox-sensitive, db/db mice were

A

C D E

B

F G H

Figure 2. Expression of Runx2 and target genes is increased in db/db aortae and in aortae from type 2 diabetes mellitus patients. A, Aortic cross section from 20-week-old mice. Representative images of aortic cross section stained with Picrosirius Red (PR; collagen red and muscle yellow) and Masson’s Trichrome (MT; collagen blue and muscle red). Representative immunofluorescent images of aortic cross section stained for collagen I (red) or Runx2 (red). Green depicts the autofluorescence of the elastic lamella. Nuclei are Hoechst stained (blue). Original magnifications are 400× and scale bars 50 μm. In the upper left panel, L indicates the aortic lumen; I, intimal layer; M, aortic media; and Ad, adventitia. B, Total collagen content per aortic dry weight. n=4/group. *P<0.05. C–G, Expression levels of Runx2 (C), Col1a1 (D), Col1a2 (E), Fn1 (F), and Spp1 (G) in thoracic aortae of 10-week- and 20-week-old db/db mice compared with age-matched +/db controls. Values are expressed as fold changes relative to the mean expression level of +/db controls (=1; dotted line). *P<0.05 vs +/db controls. n=5/group. H, Expression levels of RUNX2, COL1A1, COL1A2, FN1, and SPP1 in thoracic aortae of diabetic patients (n=8) compared with nondiabetic patients (n=10). Values are expressed as fold changes relative to the mean expression level in nondiabetic patients (=1; dotted line). *P<0.05 vs nondiabetic patients. COL1A1 indicates collagen, type 1, alpha 1; COL1A2, collagen, type 1, alpha 2; FN1, fibronectin 1; Runx2, runt-related transcription factor 2; and SPP1, secreted phosphoprotein 1.




treated with the antioxidant agent TEMPOL (4-hydroxy-2,2,6,6-tetramethylpiperidine 1-oxyl) between 10 and 20 weeks of age.

We performed in situ dihydroethidium staining to monitor ROS formation in aortic sections. TEMPOL treatment resulted in a significant decrease in 2-hydroxyethidium generation in db/db mice, indicative of reduced oxidative stress (Figure 4A and 4B). TEMPOL, however, had no effect on blood glucose levels in db/db mice (Online Figure I).

Gene expression analysis revealed that TEMPOL treat-ment dramatically attenuated Runx2 upregulation in db/db

mice (Figure 4C). This was accompanied by downregulation of ECM target genes Col1a1 and Col1a2 (Figure 4C). We further detected decreased protein levels of Runx2 (by im-munofluorescence and Western blot; Figure 4D and 4E) and collagen deposition (Figure 4D and 4F) in the aortic media of TEMPOL-treated db/db mice.

At the functional level, antioxidant treatment counteracted passive aortic stiffening as monitored by pressure myography and reduced pulse pressure in db/db mice (Figure 4G and 4H; Online Figure XII).

A B

C

D

E

F G H

I J

Figure 3. Vascular smooth muscle cell (VSMC)-specific Runx2 overexpression (Runx2-smTg mice) induces aortic medial fibrosis, stiffness, and hypertension. A, Expression levels of Runx2, Col1a1, Col1a2, Fn1, Spp1, and Bglap3 in thoracic aortae of 20-week-old Runx2-smTg mice compared with age-matched wild-type (WT) controls. Values are expressed as fold changes relative to the mean expression level in WT controls (=1; dotted line). #P<0.001 vs WT controls and *P<0.05 vs WT controls (n=5/group). B, Aortic cross section from 20-week-old mice. Representative images of aortic cross section stained with Picrosirius Red (PR; collagen red and muscle yellow) and Masson’s Trichrome (MT; collagen blue and muscle red). Representative immunofluorescent images of aortic cross section stained for collagen I (red) or Runx2 (red). Green depicts the autofluorescence of the elastic lamella. Nuclei are Hoechst stained (blue). Original magnifications are 400× and scale bars 50 μm. C, Aortic Runx2 protein expression in Runx2-smTg mice and WT controls. D, Total collagen content per aortic dry weight. n=4/group. *P<0.05. E, Representative images of aortic elastin lamellae (3D reconstruction of 28 individual layers). F, Elastin fragmentation index quantified from 3 high-power fields of 3 different aortas per group. G, Aortic pressure–diameter curves from 20-week-old mice. Values are mean±SEM. #P<0.05 vs control for pressure levels ≥36 mm Hg. H, Pulse pressure derived from 20-week-old mice. *P<0.05. n=10/group. I and J, Representative images of thoracic aortic cross sections stained for calcium (Alizarin Red; I) and inorganic phosphate (von Kossa; J). Original magnifications are 100× (left panels; scale bars 200 μm) and 400× (right panels; scale bars 50 μm). Bglap3 indicates bone gamma-carboxyglutamate protein 3; Col1a1, collagen, type 1, alpha 1; Col1a2, collagen, type 1, alpha 2; Fn1, fibronectin 1; Runx2, runt-related transcription factor 2; and Spp1, secreted phosphoprotein 1.




Runx2 Mediates a Profibrotic Response of Human AoSMCs to HG StimulationWe investigated Runx2-dependent profibrotic mechanisms in vitro by exposing human AoSMCs to HG conditions. We found that HG (25 mmol/L) increased the expression of RUNX2 and target genes, including COL1A1, COL1A2, FN1, and SPP1. Also, ACTA2—a smooth muscle cell dif-ferentiation marker—was downregulated in HG conditions (Figure 5A). Focusing on the requirement of Runx2 in me-diating HG-induced ECM gene upregulation, we found that siRNA-mediated knockdown of Runx2 abolished HG-induced upregulation of COL1A1 and COL1A2 (Figure 5B). Further, siRNA-mediated knockdown of Runx2 eliminated HG-enhanced production of soluble collagen in the superna-tant of AoSMCs (Figure 5C).

NF-κB Is Activated in db/db Aortae and in AoSMCs Under HG Conditions and Serves as a Transcription Factor for Runx2Given that aortic tissue from db/db mice display elevated ROS production, we next investigated the role of the redox-sensitive transcription factor, NF-κB, in the enhanced expres-sion of Runx2. Indeed, we found increased Rela expression (Figure 6A), as well as increased NF-κB activation (by RelA (p65)/DNA–binding assay; Figure 6B), in db/db mice aortae, both of which are sensitive to antioxidant (TEMPOL) treatment. Similarly, we observed increased expression (Figure 6C) and nuclear translocation (Figure 6D) of RelA (p65) in AoSMCs in response to HG stimulation. Functionally, this resulted in in-creased NF-κB activity under HG stimulation that was revers-ible by antioxidant (TEMPOL) treatment (Figure 6E).

A B

C

E

F G H

D

Figure 4. Antioxidant treatment (TEMPOL) reduces aortic Runx2 expression, medial fibrosis, aortic stiffness, and pulse pressure in db/db mice. A, In situ dihydroethidium (DHE) staining of thoracic aortic section from 20-week-old db/db mice, with and without 10 weeks of prior TEMPOL treatment. Reactive oxygen species (ROS) production was indicated by red fluorescence. Original magnification 400× and scale bar 50 μm. B, Average DHE intensity was quantified from 3 high-power fields of 3 different aortas per group. *P<0.05. C, Expression levels of Runx2 and its profibrotic target genes Col1a1 and Col1a2 in thoracic aortae of 20-week-old db/db mice with and without addition of TEMPOL treatment. Values are expressed as fold changes relative to the mean expression level of +/db controls (=1; dotted line). *P<0.05. n=5/group. D, Representative images of aortic cross section stained with Masson’s Trichrome (MT; collagen blue and muscle red). Representative immunofluorescent images of aortic cross section stained for collagen I (red) or Runx2 (red). Green depicts the autofluorescence of the elastic lamella. Nuclei are Hoechst stained (blue). Original magnifications are 400× and scale bars 50 μm. E, Aortic Runx2 protein expression in db/db mice with and without TEMPOL treatment as well as in +/db controls. F, Total collagen content per aortic dry weight. n=4/group. *P<0.05. G, Aortic pressure–diameter curves from 20-week-old db/db mice±TEMPOL treatment. #P<0.05 vs control for pressure levels ≥90 mm Hg. n=5 to 7/group. H, Pulse pressure derived from 20-week-old db/db mice with and without TEMPOL treatment. *P<0.05. n=10/group. Col1a1 indicates collagen, type 1, alpha 1; Col1a2, collagen, type 1, alpha 2; and Runx2, runt-related transcription factor 2.




Knockdown of the NF-κB subunits RelA (p65) and Nfkb1 (p50) via siRNA completely inhibited the HG-stimulated upregulation of RUNX2, COL1A1, and COL1A2 in human AoSMCs (Figure 6F). To further delineate the mechanism behind NF-κB–dependent regulation of RUNX2, we searched for potential NF-κB–binding sites within the human RUNX2 promoter using TRANSFAC and JASPAR core databases via the ConTra v2 web server (http://bioit.dmbr.ugent.be/con-trav2/). We identified a potential RelA (p65) recognition motif (5′-GGAAAGGCCT-3′) 198 bp upstream of the transcription start site (Figure 6G).

To verify binding of the RelA (p65) subunit to the Runx2 promoter, we performed a quantitative chromatin immunopre-cipitation assay detecting complexes between specific proteins and DNA sequences. Here, after immunoprecipitation with an anti-p65 antibody, we found significant (≈10-fold) enrichment of the Runx2 promoter under HG conditions relative to the IgG control (Figure 6H).

To further corroborate these findings, we tested the RelA (p65)-binding capacity of the predicted RelA (p65) recognition motif within the Runx2 promoter using a quantitative protein/solid-phase oligonucleotide–binding assay in HG-stimulated AoSMCs (TransAM assay). Immobilized oligos containing the predicted RelA (p65)-binding site were able to capture signifi-cantly more RelA (p65) protein compared with corresponding oligos with various sequence mutations (Figure 6G; Online Table I) of the RelA (p65)-binding motif (Figure 6I).

Finally, luciferase reporter constructs containing either the intact Runx2 promoter or mutations of the predicted RelA (p65)-binding site (Figure 6G; Online Table II) demonstrat-ed that this binding site is critical for NF-κB–mediated ac-tivation of the Runx2 promoter in HG-stimulated AoSMCs (Figure 6J).

DiscussionArterial stiffness has long been recognized as a feature of arte-rial aging.21 Over the last decade, arterial stiffness has received increasing attention in cardiovascular medicine, emerging as an independent risk factor for cardiovascular disease and mor-tality.5 This insight is particularly relevant in diabetic popula-tions, which exhibit accelerated arterial stiffening and carry some of the highest risks of death from cardiovascular dis-ease.6 Thus, there is a pressing need to characterize the mecha-nisms leading to arterial stiffness in diabetes mellitus, which may then help to establish targets for prophylactic or thera-peutic intervention.

In the realm of clinical medicine, diabetes mellitus is in-extricably linked to arterial hypertension.9 Hypertension per se induces aortic stiffening, both acutely (by increasing the aortic diameter and thereby shifting the load from disten-sible elastin to rigid collagen) and chronically (through ac-tive structural vascular remodeling processes).7,11 Therefore, from a pathomechanistic point of view, it is essential to elu-cidate whether structural aortic stiffening in diabetes mellitus

A B

C

Figure 5. Runx2 mediates a profibrotic response of human aortic smooth muscle cells (AoSMCs) to high glucose stimulation. A, Expression of RUNX2 and targets COL1A1, COL1A2, FN1, SPP1, and SMC differentiation marker ACTA2 after high glucose treatment. *P<0.05 vs normal glucose+osmotic control. B, Expression of COL1A1 and COL1A2 under high glucose treatment with and without additional siRNA-mediated knockdown of Runx2. Values are expressed as fold changes relative to the mean expression level of normal glucose controls (=1; dotted line).*P<0.05 vs corresponding normal glucose condition and Runx2-knockdown condition. C, Soluble collagen content in supernatant from HG-treated cells±additional Runx2 knockdown.*P<0.05 vs normal glucose control (+osmotic control); §P<0.05 vs HG+control siRNA. Data from n=3 to 4 independent experiments. COL1A1 indicates collagen, type 1, alpha 1; COL1A2, collagen, type 1, alpha 2; FN1, fibronectin 1; HG, high glucose; NG, normal glucose; Runx2, runt-related transcription factor 2; SMC, smooth muscle cell; and SPP1, secreted phosphoprotein 1.


http://bioit.dmbr.ugent.be/contrav2/

http://bioit.dmbr.ugent.be/contrav2/



is primarily a function of concomitant hypertension or con-stitutes a distinct pathology—that may then require separate treatment. We addressed this question with the help of a mu-rine model of diabetes mellitus, longitudinally screening aor-tic mechanical stiffness and blood pressure levels of diabetic db/db mice at different ages. Because the stiffness of con-duit arteries is largely determined by their passive, structural properties,10–12 we performed ex vivo pressure myography to directly test the aortic mechanical properties under physi-ologically relevant loading conditions. We found that struc-tural aortic stiffening in diabetic mice preceded the onset of arterial hypertension (Figure 1). In particular, aortic stiffening

occurred before augmentation of pulse pressure (ie, the dif-ference between systolic and diastolic blood pressure), which is frequently used as an indirect marker of aortic stiffness.22 These findings demonstrate that passive aortic stiffening may occur independently of hypertension in this model of diabetes mellitus and are consistent with previous studies that highlight early aortic stiffness in association with decreased nitric oxide bioavailability that precedes arterial hypertension in a murine model of diet-induced obesity.23

Delineating the structural basis for the observed passive aortic stiffening, we found enhanced medial fibrosis to be a prominent feature of aged db/db aortae (Figure 2A). This

A B C

FED

G

H I J

Figure 6. Nuclear factor kappa beta (NF-κB) is activated under high glucose (HG) conditions in aortic smooth muscle cells (AoSMCs) and induces transcription of Runx2. A, Rela expression levels in thoracic aortae of 20-week-old +/db mice as well as db/db mice with and without addition of TEMPOL treatment. Values are expressed as fold changes relative to the mean expression level of +/db controls (=1; dotted line). *P<0.05. n=5/group. B, NF-κB activity in nuclear extracts isolated from db/db aortae with and without prior TEMPOL treatment as well as +/db controls. *P<0.05. n=5/group. C, RELA expression levels after HG treatment. Values are expressed as fold changes relative to the mean expression level of normal glucose (NG) controls (=1; dotted line). *P<0.05. n=3 independent experiments. D, AoSMCs stained for RelA (p65) (red) under HG and NG+osmotic control conditions. Nuclei are Hoechst stained (blue). E, NF-κB activity in nuclear extracts isolated from AoSMCs after stimulation with tumor necrosis factor (TNF)-a (positive control), HG, and HG with additional TEMPOL treatment. *P<0.05. F, Expression of RUNX2, COL1A1, and COL1A1 under HG treatment with and without additional siRNA-mediated knockdown of the NF-κB subunits RelA (p65) and NF-κB (p50). Values are expressed as fold changes relative to the mean expression level of NG controls (=1; dotted line).*P<0.05. G, Predicted NF-κB (RelA; p65) binding site (underlined) within the human Runx2 promoter (Runx2); custom mutants of the NF-κB binding site with deletion of a base triplet (Runx2-mut1) and mutation of 5 consecutive bases (Runx2-mut2). H, Chromatin immunoprecipitation (ChIP) analysis of Runx2 promoter enrichment after anti-p65 antibody immunoprecipitation. Values are fold enrichment relative to IgG control. *P<0.05 vs IgG control. I, Quantification of NF-κB (RelA, p65) binding capacity of DNA oligos containing the predicted p65-binding motif located within the Runx2 promoter (Runx2), 2 custom mutants (Runx2-mut1 and Runx2-mut2), or a scrambled sequence (negative control). Solid phase–bound oligos were incubated with nuclear extracts from HG-stimulated AoSMCs. *P<0.05 vs Runx2. J, Luciferase activity in HG-stimulated AoSMCs transfected with the intact promoter of Runx2 (Runx2), Runx2 promoter mutants (Runx2-mut1 and Runx2-mut2), or with a scrambled promoter (negative control). *P<0.05 vs Runx2. Data from n=5 independent experiments. COL1A1 indicates collagen, type 1, alpha 1; COL1A2, collagen, type 1, alpha 2; and Runx2, runt-related transcription factor 2.




observation is consistent with enhanced aortic collagen depo-sition found in other models of diabetes mellitus.24–26

We next investigated the potential role of the transcription factor Runx2 as a central regulator of aberrant ECM accumu-lation and aortic stiffness in the setting of diabetes mellitus. Although not significantly expressed in the vasculature under normal conditions, Runx2 has recently emerged as a marker of pathological osteogenic VSMC transdifferentiation in the context of vascular calcification.27,28 However, the immediate transcriptional potential of Runx2 to induce vascular fibrosis resulting in arterial stiffness had never before been addressed experimentally.

Gene expression analysis revealed that Runx2 and ECM target genes were progressively upregulated in aging db/db animals compared with age-matched +/db controls (Figure 2C–2G). Further, we detected markedly upregulated expression of Runx2 protein in the aortic media of 20-week-old diabetic db/db mice as analogously reported in a strep-tozotocin-induced model of diabetes mellitus.29 Importantly, consistent with these animal model–derived data, we also found increased expression of RUNX2 and downstream genes COL1A1, COL1A2, and FN1 in thoracic aortic samples from patients with type 2 diabetes mellitus (Figure 2H).

To assess the functional impact of Runx2 on vascular ma-trix homeostasis, we generated Runx2-smTg mice expressing the entire coding region of murine Runx2 under control of the SM22α promoter, achieving VSMC-specific overexpression of Runx2.30,31 This approach enabled us to dissect direct down-stream effects of increased Runx2 function in the VSMC-dominated aortic media. Runx2 overexpression histologically translated into marked collagen I accumulation in the aortic media (Figure 3). These structural alterations accompanied significantly increased material stiffness of the thoracic aorta, as well as increased arterial blood/pulse pressure levels.

Although we did not study Runx2 expression during em-bryonic development of Runx2-smTg mice directly, it is known that the SM22α promoter—regulating Runx2 expression in our mouse model—exhibits embryonic aortic activation (as early as E9.0).31 Consequently, we cannot exclude developmental ab-normalities in our model per se. Therefore, it is important to exclude structural developmental defects of the aorta that may result in increased aortic stiffness unrelated to the profibrotic mechanisms under investigation. In contrast to the collagen matrix that readily undergoes lifelong remodeling in response to various stimuli, elastic fibers, being another major structural determinant of the mechanical properties of conduit arteries, are almost exclusively assembled during tissue development and function for the entire lifespan of the organism with low poten-tial for postnatal repair.11 Therefore, elastin function is particu-larly susceptible to developmental defects. In this regard, we were unable to detect any irregularities of the medial elastin ar-chitecture in the Runx2-smTg by histological elastin 3D recon-struction and elastin break quantification (Figure 3E and 3F).

Further, in vitro experiments demonstrated that HG condi-tions lead to Runx2-dependent enhanced collagen production in human AoSMCs (Figure 5). Taken together, the data iden-tify Runx2 as an inducer of aberrant medial fibrosis and aortic stiffening in the context of diabetes mellitus.

Interestingly, Runx2 overexpression per se did not induce enhanced mineralization/calcification in the aortic specimens taken from Runx2-smTg mice (Figure 3I and 3J; Online Figures X and XI). This was somewhat unexpected because Runx2 is not only considered a marker of osteogenic VSMC transdiffer-entiation in calcifying vascular disorders,15,17,28 but also shown to be of mechanistic significance for atherosclerotic calcifica-tion in a murine Runx2 knockout model.17 Thus, Runx2 may be necessary but not sufficient to promote vascular calcification, underlining the complex, multifactorial nature of vascular cal-cification processes.32,33 In this context, Runx2-smTg aortae do not exhibit increased elastin breakdown (Figure 3E and 3F) or VSMC apoptosis (Online Figure VIII), both factors associated with vascular (medial) calcification.32,33

Diabetes mellitus is generally associated with increased abundance of ROS in the cardiovascular system.34 We found increased ROS (superoxide) production in aortic sections from db/db mice (Figure 4A and 4B), consistent with other reports.35,36 Aberrant ROS-mediated signaling contributes to pathological vascular remodeling in various diseases (eg, atherosclerosis, arteriosclerosis, hypertension, and abdominal aortic aneurysm)37 and moreover has been shown to induce Runx2 expression in vitro.38 A recent study reported the utility of the antioxidant TEMPOL in preventing age-related arterial stiffening.39 In line with those findings, we demonstrated that 10 weeks of antioxidant treatment (TEMPOL) reduces ROS abundance in the aortic wall of db/db mice and reduces expres-sion of Runx2 and the downstream collagen isoforms Col1a1 and Col1a2 (Figure 4C). Functionally, this results in decreased aortic stiffness and reduced pulse pressure in 20-week-old db/db mice (Figure 4G and 4H). Although TEMPOL is known to reduce blood pressure via multiple functional, vaso-dilatatory mechanisms (including interference with nitric oxide me-tabolism and through sympatholytic properties),40 this study provides evidence for TEMPOL’s additional antihypertensive effects via modulation of diabetic arterial remodeling.

In contrast to a previous report,35 we did not find a signifi-cant effect of TEMPOL treatment on blood glucose levels in db/db mice, possibly because of the lower dose used in the present study (1 mmol/L versus 2 mmol/L).

To elucidate a mechanistic link between increased ROS abundance in the diabetic aorta and the enhanced expression of Runx2, we focused on the role of the oxidative stress-sen-sitive transcription factor, NF-κB.41,42 Indeed, previous stud-ies have demonstrated increased aortic NF-κB expression and activation in diabetic mouse models43,44 and indicated that hyperglycemia can activate NF-κB in VSMCs.45–47 In line with those data, we find that NF-κB expression and activa-tion is increased in a redox-sensitive fashion in db/db aortae (Figure 6A and 6B) and in human AoSMCs under HG condi-tions (Figure 6C and 6D).

In silico analysis revealed a potential RelA (p65)-binding site within the human Runx2 promoter, suggesting that Runx2 might be a direct transcriptionally activated target of NF-κB. Through an NF-κB–binding assay, we demonstrated that RelA (p65) binds to the predicted binding site within the Runx2 pro-moter (Figure 6I). Luciferase reporter constructs containing mutations of the RelA (p65)-binding site further confirm the




functional relevance of the NF-κB–Runx2 interaction for the Runx2 promoter activity (Figure 6J).

There is ample evidence that vascular and systemic in-flammation are associated with (or precede) increased arterial stiffness.48–51 In light of the present study, the NF-κB–Runx2 interaction might provide a fundamental molecular mecha-nism linking inflammatory processes with arterial fibrosis/stiffening and hypertension.

In conclusion, the present study identifies the transcription factor Runx2, which is significantly expressed in human type 2 diabetic aortae, as an inducer of aortic fibrosis and stiffening. Of note, Runx2 may exert its effects on arterial stiffness inde-pendently of calcification processes. We delineate a redox-sen-sitive pathway of HG-induced Runx2 expression via a direct interaction of the NF-κB subunit RelA (p65) with the human Runx2 promoter (Online Figure XIII). Given that Runx2 may have no physiological role in the vasculature, the results from our study highlight the ROS–NF-kB–Runx2 pathway as a target to counteract pathological aortic collagen deposition and stiffening in the context of diabetes mellitus. Moreover, the characterized direct NF-κB–Runx2 interaction may be of mechanistic importance in numerous additional pathologies that involve inflammatory remodeling of the collagen matrix.

AcknowledgmentsWe thank Michelle Ramseier, Brian Deng (Stanford University), Vladana Vukojevic, Albert Busch, Yuhuang Li, Hong Jin, Alexandra Bäcklund, Silvia Aldi, Ljubica Perisic, Joelle Magné, Valentina Paloschi, Fariba Foroogh, Shohreh Maleki, Olivera Werngren, Peter Gustafsson, Fanny Saidoune (Karolinska Institute), and Katrin Schiebel (University of Erlangen, School of Medicine) for expert assistance.

Sources of FundingThis work was supported by research grants from the National Institute of Health (1R01HL105299 to P.S. Tsao), the Deutsche Forschungsgemeinschaft (RA 2179/1-1 to U. Raaz, He 6855/1-1 to J.K. Hennigs, and AD 492/1-1 to M. Adam), the Boehringer Ingelheim Fonds and the International Scholarship for Medical Students, Medical School of the University Erlangen, Germany (both to I. N. Schellinger), and the Stanford Cardiovascular Institute (to J.M. Spin).

DisclosuresNone.

References 1. Wild S, Roglic G, Green A, Sicree R, King H. Global prevalence of diabe-

tes: estimates for the year 2000 and projections for 2030. Diabetes Care. 2004;27:1047–1053. doi: 10.2337/diacare.27.5.1047.

2. Centers for Disease Control and Prevention. National Diabetes Statistics Report: Estimates of Diabetes and Its Burden in the United States, 2014. Atlanta, GA: US Department of Health and Human Services; 2014.

3. Rydén L, Standl E, Bartnik M, et al; Task Force on Diabetes and Cardiovascular Diseases of the European Society of Cardiology (ESC); European Association for the Study of Diabetes (EASD). Guidelines on diabetes, pre-diabetes, and cardiovascular diseases: executive summary. The Task Force on Diabetes and Cardiovascular Diseases of the European Society of Cardiology (ESC) and of the European Association for the Study of Diabetes (EASD). Eur Heart J. 2007;28:88–136. doi: 10.1093/eurheartj/ehl260.

4. Stehouwer CD, Henry RM, Ferreira I. Arterial stiffness in diabetes and the metabolic syndrome: a pathway to cardiovascular disease. Diabetologia. 2008;51:527–539. doi: 10.1007/s00125-007-0918-3.

5. Laurent S, Cockcroft J, Van Bortel L, Boutouyrie P, Giannattasio C, Hayoz D, Pannier B, Vlachopoulos C, Wilkinson I, Struijker-Boudier

H; European Network for Non-invasive Investigation of Large Arteries. Expert consensus document on arterial stiffness: methodological issues and clinical applications. Eur Heart J. 2006;27:2588–2605. doi: 10.1093/eurheartj/ehl254.

6. Cruickshank K, Riste L, Anderson SG, Wright JS, Dunn G, Gosling RG. Aortic pulse-wave velocity and its relationship to mortality in diabetes and glucose intolerance: an integrated index of vascular function? Circulation. 2002;106:2085–2090. doi: 10.1161/01.CIR.0000033824.02722.F7.

7. Hoefer IE, den Adel B, Daemen MJ. Biomechanical factors as triggers of vascular growth. Cardiovasc Res. 2013;99:276–283. doi: 10.1093/cvr/cvt089.

8. Cavalcante JL, Lima JA, Redheuil A, Al-Mallah MH. Aortic stiff-ness: current understanding and future directions. J Am Coll Cardiol. 2011;57:1511–1522. doi: 10.1016/j.jacc.2010.12.017.

9. Lago RM, Singh PP, Nesto RW. Diabetes and hypertension. Nat Clin Pract Endocrinol Metab. 2007;3:667. doi: 10.1038/ncpendmet0638.

10. Wolinsky H, Glagov S. Structural basis for the static mechanical Properties of the Aortic Media. Circ Res.1964;14:400–413.

11. Wagenseil JE, Mecham RP. Vascular extracellular matrix and arterial me-chanics. Physiol Rev. 2009;89:957–989. doi: 10.1152/physrev.00041.2008.

12. Wagenseil JE, Mecham RP. Elastin in large artery stiffness and hy-pertension. J Cardiovasc Transl Res. 2012;5:264–273. doi: 10.1007/s12265-012-9349-8.

13. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a tran-scriptional activator of osteoblast differentiation. Cell. 1997;89:747–754. doi: 10.1016/S0092-8674(00)80257-3.

14. Ducy P, Starbuck M, Priemel M, Shen J, Pinero G, Geoffroy V, Amling M, Karsenty G. A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev. 1999;13:1025–1036.

15. Steitz SA, Speer MY, Curinga G, Yang HY, Haynes P, Aebersold R, Schinke T, Karsenty G, Giachelli CM. Smooth muscle cell phenotypic transition associated with calcification: upregulation of Cbfa1 and downregulation of smooth muscle lineage markers. Circ Res. 2001;89:1147–1154.

16. Trion A, van der Laarse A. Vascular smooth muscle cells and calcifica-tion in atherosclerosis. Am Heart J. 2004;147:808–814. doi: 10.1016/j.ahj.2003.10.047.

17. Sun Y, Byon CH, Yuan K, Chen J, Mao X, Heath JM, Javed A, Zhang K, Anderson PG, Chen Y. Smooth muscle cell-specific runx2 deficiency inhibits vascular calcification. Circ Res. 2012;111:543–552. doi: 10.1161/CIRCRESAHA.112.267237.

18. Amin M, Le V, Wagenseil J. Mechanical testing of mouse carotid arteries: from newborn to adult. J Vis Exp. 2012;60:3733.

19. Boyle JJ, Johns M, Kampfer T, Nguyen AT, Game L, Schaer DJ, Mason JC, Haskard DO. Activating transcription factor 1 directs Mhem atheroprotec-tive macrophages through coordinated iron handling and foam cell protec-tion. Circ Res. 2012;110:20–33. doi: 10.1161/CIRCRESAHA.111.247577.

20. Kapustin AN, Chatrou ML, Drozdov I, et al. Vascular smooth muscle cell calcification is mediated by regulated exosome secretion. Circ Res. 2015;116:1312–1323. doi: 10.1161/CIRCRESAHA.116.305012.

21. O’Rourke MF, Hashimoto J. Mechanical factors in arterial aging: a clinical perspective. J Am Coll Cardiol. 2007;50:1–13. doi: 10.1016/j.jacc.2006.12.050.

22. Safar ME, Levy BI, Struijker-Boudier H. Current perspectives on arterial stiffness and pulse pressure in hypertension and cardiovas-cular diseases. Circulation. 2003;107:2864–2869. doi: 10.1161/01.CIR.0000069826.36125.B4.

23. Weisbrod RM, Shiang T, Al Sayah L, Fry JL, Bajpai S, Reinhart-King CA, Lob HE, Santhanam L, Mitchell G, Cohen RA, Seta F. Arterial stiffen-ing precedes systolic hypertension in diet-induced obesity. Hypertension. 2013;62:1105–1110. doi: 10.1161/HYPERTENSIONAHA.113.01744.

24. Reddy GK. AGE-related cross-linking of collagen is associated with aortic wall matrix stiffness in the pathogenesis of drug-induced diabetes in rats. Microvasc Res. 2004;68:132–142. doi: 10.1016/j.mvr.2004.04.002.

25. Song W, Ergul A. Type-2 diabetes-induced changes in vascular extracel-lular matrix gene expression: relation to vessel size. Cardiovasc Diabetol. 2006;5:3. doi: 10.1186/1475-2840-5-3.

26. Sun H, Zhong M, Miao Y, Ma X, Gong HP, Tan HW, Zhang Y, Zhang W. Impaired elastic properties of the aorta in fat-fed, streptozotocin-treated rats. Vascular remodeling in diabetic arteries. Cardiology. 2009;114:107–113. doi: 10.1159/000219211.

27. Engelse MA, Neele JM, Bronckers AL, Pannekoek H, de Vries CJ. Vascular calcification: expression patterns of the osteoblast-specific gene core binding factor alpha-1 and the protective factor matrix gla protein in human atherogenesis. Cardiovasc Res. 2001;52:281–289.




28. Tyson KL, Reynolds JL, McNair R, Zhang Q, Weissberg PL, Shanahan CM. Osteo/chondrocytic transcription factors and their target genes exhibit distinct patterns of expression in human arterial calcification. Arterioscler Thromb Vasc Biol. 2003;23:489–494. doi: 10.1161/01.ATV.0000059406.92165.31.

29. Heath JM, Sun Y, Yuan K, Bradley WE, Litovsky S, Dell’Italia LJ, Chatham JC, Wu H, Chen Y. Activation of AKT by O-linked N-acetylglucosamine induces vascular calcification in diabetes mellitus. Circ Res. 2014;114:1094–1102. doi: 10.1161/CIRCRESAHA.114.302968.

30. Solway J, Seltzer J, Samaha FF, Kim S, Alger LE, Niu Q, Morrisey EE, Ip HS, Parmacek MS. Structure and expression of a smooth muscle cell-specific gene, SM22 alpha. J Biol Chem. 1995;270:13460–13469.

31. Li L, Miano JM, Mercer B, Olson EN. Expression of the SM22alpha pro-moter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells. J Cell Biol. 1996;132:849–859.

32. Sage AP, Tintut Y, Demer LL. Regulatory mechanisms in vascular calcifi-cation. Nat Rev Cardiol. 2010;7:528–536. doi: 10.1038/nrcardio.2010.115.

33. Lanzer P, Boehm M, Sorribas V, Thiriet M, Janzen J, Zeller T, St Hilaire C, Shanahan C. Medial vascular calcification revisited: review and perspec-tives. Eur Heart J. 2014;35:1515–1525. doi: 10.1093/eurheartj/ehu163.

34. Jay D, Hitomi H, Griendling KK. Oxidative stress and diabetic cardio-vascular complications. Free Radic Biol Med. 2006;40:183–192. doi: 10.1016/j.freeradbiomed.2005.06.018.

35. San Martín A, Du P, Dikalova A, Lassègue B, Aleman M, Góngora MC, Brown K, Joseph G, Harrison DG, Taylor WR, Jo H, Griendling KK. Reactive oxygen species-selective regulation of aortic inflammatory gene expression in Type 2 diabetes. Am J Physiol Heart Circ Physiol. 2007;292:H2073–H2082. doi: 10.1152/ajpheart.00943.2006.

36. Wong WT, Tian XY, Xu A, Ng CF, Lee HK, Chen ZY, Au CL, Yao X, Huang Y. Angiotensin II type 1 receptor-dependent oxidative stress me-diates endothelial dysfunction in type 2 diabetic mice. Antioxid Redox Signal. 2010;13:757–768. doi: 10.1089/ars.2009.2831.

37. Raaz U, Toh R, Maegdefessel L, Adam M, Nakagami F, Emrich FC, Spin JM, Tsao PS. Hemodynamic regulation of reactive oxygen species: impli-cations for vascular diseases. Antioxid Redox Signal. 2014;20:914–928. doi: 10.1089/ars.2013.5507.

38. Byon CH, Javed A, Dai Q, Kappes JC, Clemens TL, Darley-Usmar VM, McDonald JM, Chen Y. Oxidative stress induces vascular calcification through modulation of the osteogenic transcription factor Runx2 by AKT sig-naling. J Biol Chem. 2008;283:15319–15327. doi: 10.1074/jbc.M800021200.

39. Fleenor BS, Eng JS, Sindler AL, Pham BT, Kloor JD, Seals DR. Superoxide signaling in perivascular adipose tissue promotes age-related artery stiffness. Aging Cell. 2014;13:576–578. doi: 10.1111/acel.12196.

40. Wilcox CS, Pearlman A. Chemistry and antihypertensive effects of tem-pol and other nitroxides. Pharmacol Rev. 2008;60:418–469. doi: 10.1124/pr.108.000240.

41. Schreck R, Albermann K, Baeuerle PA. Nuclear factor kappa B: an oxida-tive stress-responsive transcription factor of eukaryotic cells (a review). Free Radic Res Commun. 1992;17:221–237.

42. Morgan MJ, Liu ZG. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 2011;21:103–115. doi: 10.1038/cr.2010.178.

43. Brasacchio D, Okabe J, Tikellis C, Balcerczyk A, George P, Baker EK, Calkin AC, Brownlee M, Cooper ME, El-Osta A. Hyperglycemia induces a dynamic cooperativity of histone methylase and demethylase enzymes associated with gene-activating epigenetic marks that coexist on the lysine tail. Diabetes. 2009;58:1229–1236. doi: 10.2337/db08-1666.

44. Guo R, Liu B, Wang K, Zhou S, Li W, Xu Y. Resveratrol ameliorates dia-betic vascular inflammation and macrophage infiltration in db/db mice by inhibiting the NF-κB pathway. Diab Vasc Dis Res. 2014;11:92–102. doi: 10.1177/1479164113520332.

45. Yerneni KK, Bai W, Khan BV, Medford RM, Natarajan R. Hyperglycemia-induced activation of nuclear transcription factor kappaB in vascular smooth muscle cells. Diabetes. 1999;48:855–864.

46. Hattori Y, Hattori S, Sato N, Kasai K. High-glucose-induced nuclear fac-tor kappaB activation in vascular smooth muscle cells. Cardiovasc Res. 2000;46:188–197.

47. Jeong IK, Oh da H, Park SJ, Kang JH, Kim S, Lee MS, Kim MJ, Hwang YC, Ahn KJ, Chung HY, Chae MK, Yoo HJ. Inhibition of NF-κB prevents high glucose-induced proliferation and plasminogen activator inhibitor-1 expression in vascular smooth muscle cells. Exp Mol Med. 2011;43:684–692. doi: 10.3858/emm.2011.43.12.079.

48. Booth AD, Wallace S, McEniery CM, Yasmin, Brown J, Jayne DR, Wilkinson IB. Inflammation and arterial stiffness in systemic vasculitis: a model of vascular inflammation. Arthritis Rheum. 2004;50:581–588. doi: 10.1002/art.20002.

49. Vlachopoulos C, Dima I, Aznaouridis K, Vasiliadou C, Ioakeimidis N, Aggeli C, Toutouza M, Stefanadis C. Acute systemic inflamma-tion increases arterial stiffness and decreases wave reflections in healthy individuals. Circulation. 2005;112:2193–2200. doi: 10.1161/CIRCULATIONAHA.105.535435.

50. Roman MJ, Devereux RB, Schwartz JE, Lockshin MD, Paget SA, Davis A, Crow MK, Sammaritano L, Levine DM, Shankar BA, Moeller E, Salmon JE. Arterial stiffness in chronic inflammatory diseases. Hypertension. 2005;46:194–199. doi: 10.1161/01.HYP.0000168055.89955.db.

51. Park S, Lakatta EG. Role of inflammation in the pathogenesis of arterial stiffness. Yonsei Med J. 2012;53:258–261. doi: 10.3349/ymj.2012.53.2.258.

What Is Known?

• Arterial stiffness is significantly increased in patients with diabetes mellitus (DM) and contributes to high cardiovascular morbidity and mortality.

• Collagen content is increased in diabetic blood vessels.• Runt-related transcription factor 2 (RUNX2) regulates extracellular

matrix deposition in osteogenic tissue.• RUNX2 also regulates vascular calcification processes.

What New Information Does This Article Contribute?

• Aortic fibrosis and stiffness precedes the onset of hypertension in a mouse model (db/db) of DM.

• RUNX2 is upregulated under high glucose conditions in vitro and in vivo via a redox-sensitive activation of nuclear factor kappa beta.

• RUNX2 induces aortic medial fibrosis and thereby increases aortic stiffness.

• Vascular smooth muscle cell–specific overexpression of RUNX2 is insufficient to induce vascular calcification in vivo.

Arterial stiffening is a significant complication of DM with no spe-cific therapy available to date. The present study identifies the osteogenic transcription factor Runx2 as an inducer of arterial fi-brosis and stiffness. We find RUNX2 expression to be upregulated in vascular smooth muscle cells under high glucose conditions in vitro and in vivo and delineate a redox-sensitive mechanism of Runx2 upregulation with nuclear factor kappa beta serving as a transcription factor of Runx2. Interestingly, although RUNX2 has been previously identified as a marker and regulator of vascu-lar calcification, we demonstrate that vascular smooth muscle cell–specific overexpression of RUNX2 per se is unable to induce calcification in vivo. The results of this study reveal a novel mech-anism of arterial stiffening with RUNX2 as a profibrotic vascular regulator. The findings might provide new targets for therapeuti-cal intervention in patients with DM.

Novelty and Significance



1

SUPPLEMENTAL MATERIAL Detailed Methods Animals All animal protocols were approved by the Administrative Panel on Laboratory Animal Care at Stanford University (http://labanimals. stanford.edu/) and followed the National Institutes of Health and U.S. Department of Agriculture Guidelines for Care and Use of Animals in Research. Male db/db mice (BKS.Cg-Dock7m +/+Leprdb/J) and their age-matched heterozygous non-diabetic controls (+/db) were purchased from the Jackson Laboratory (Bar Harbor, ME). Antioxidant treatment of 10 week-old db/db mice was performed with TEMPOL (1mmol/l; Sigma Aldrich) in drinking water freshly prepared every other day over a course of 10 weeks.

Transgenic mice with vascular smooth muscle cell (VSMC)-specific Runx2-overexpression (Runx2-smTg; C57Bl/6 background) were generated at our institution. Specifically, a transgene cassette consisting of the entire coding region of mouse type 1 Runx2 (a gift from Dr. Toshihisa Komori; Japan) driven by the 445 bp form of the SM22α promoter (a gift from Dr. Michael Parmacek, University of Pennsylvania) was initially produced and protein expression was confirmed in cultured VSMC. Among the two major Runx2 isoforms (type 1 and type 2) type 1 was studied as the relevant isoform whose expression (in contrast to type 2) is not restricted to osseous tissues1,2. Pronuclear injection and generation of founder mice was performed by the Stanford Transgenic Core Facility. Transgenic animals were screened by standard PCR of tail DNA and confirmed by Southern blotting. A single founder line that demonstrated modest Runx2 overexpression was used for the experiments pertaining to this study. Runx2-smTg mice are viable in normal litter sizes and have normal growth patterns compared to C57Bl/6 control mice. Pressure myography Pressure myography was performed to directly assess the passive aortic mechanics according to adapted protocols 3. In brief, murine thoracic aortae were explanted, placed on specially designed stainless steel cannulas and secured with silk surgical suture (10-0). The vessel was mounted in the heated chamber of a pressure arteriograph system (Model 110P, Danish Myotechnology, Copenhagen, Denmark) and stretched to in vivo length. Physiological saline solution (PSS) at 37°C, aerated with 5% CO2/ 95% O2 was used to fill the vessel chamber and for aortic perfusion. After 3 preconditioning cycles, the aortic passive pressure-diameter relationship was determined by an automated protocol. The artery was pressurized from 0 to 180 mmHg in 18 mmHg increments, and the vessel’s outer diameter was simultaneously tracked by continuous computer video analysis (MyoVIEW software, Danish Myotechnology, Copenhagen, Denmark). The resting diameter d0 was quantified under 0 mmHg intraluminal (transmural) pressure and was not significantly different between the experimental groups tested (d0 ~1000 µm) and comparable to previous reports4. Blood pressure measurements Blood pressure measurements were performed using non-invasive VPR (Volume-Pressure Recording) tail cuff sensor technology (CODA System; Kent Scientific). All mice were acclimated to the restrainer for 10–20 min per day for at least 3 consecutive days before starting the study. Following this acclimation period, mice typically remained calm and still in the restrainer on the day of testing. To facilitate the acclimation process, the mice were handled gently and not forced to enter the restrainer, and the ambient temperature was maintained at warm room temperature (25–30°C). Blood glucose measurements Blood glucose levels were monitored from tail bleeds taken between 10 AM and noon using a glucometer (Accu-Check, Roche Diagnostics). Preparation of mouse aortic tissue for RNA extraction

2

Mice were sacrificed with an inhalation overdose of isoflurane (Vet One, Meridian, ID, USA). Immediately following sacrifice the thoracic aorta was transected and flushed via the left ventricle with ice cold phosphate buffered saline (PBS; pH 7.4). The aorta was then dissected from fat and connective tissue under a microscope (Leica, Wetzlar, Germany). Specimens were snap-frozen individually in liquid nitrogen and stored at -80°C before further processing. Human tissue sample acquisition and preparation. Human thoracic aortic samples from patients who underwent aorto-coronary bypass surgery (aortic plugs derived from aortic punching) were collected during surgery, snap-frozen and stored at - 80 °C. RNA quantification Total RNA was isolated using a TRIzol-based (Invitrogen) RNA isolation protocol. RNA was quantified by Nanodrop (Agilent Technologies), and RNA quality was verified using an Agilent 2100 Bioanalyzer (Agilent Technologies). Samples required 260/280 ratios >1.8, and sample RNA integrity numbers >9 for inclusion. The iScript cDNA synthesis kit (Bio-Rad) was used to synthesize first-strand cDNA according to the manufacturer’s protocol. TaqMan qRT-PCR assay was performed using mouse and human specific primers (Life Technologies). All probes were normalized to 18S as internal control. Amplification took place on a QuantStudio12K Flex (Applied Biosystems). All fold changes were calculated by the method of ΔΔCt. Tissue preparation for histological analysis Mice were euthanized and perfused at a constant pressure of 100 mmHg via the left ventricle with saline followed by warm (37°C) agarose gel (Amresco) diluted in saline (3% w/v). After agarose solidification, the thoracic aorta was dissected free from the surrounding connective tissue and fixed in 4% formalin. The isolated thoracic aorta was then dehydrated through a graded sucrose series and subsequently embedded in OCT blocks. For in situ DHE oxidation aortae were dissected and OCT embedded without any prior fixation. Picrosirius Red, Masson’s Trichrome, Hematoxylin and Eosin, Alizarin Red, and von Kossa staining Aortic cross sections (7µm) were stained using the Picrosirius Red Stain kit, the Hematoxylin&Eosin (H&E) Stain kit, the Alizarin Red Stain kit, and the von Kossa Stain kit (all from American MasterTech, USA), as well as the Trichrome Stain Kit (Abcam) according to manufacturer’s instructions. Immunofluorescence Aortic cross sections (7 µm) were fixed for 15 minutes in 4% PFA and PBS. Primary antibodies against Runx2 (Abcam, ab23981), collagen I (Abcam, ab 34710), CD63 (Santa Cruz, sc-13363), alpha-smooth muscle actin (SMA) (Abcam, ab5694), cleaved caspase 3 (Cell Signaling, #9661) were applied overnight. Incubation with secondary antibodies (Alexa Fluor 594 goat anti-rabbit; Molecular Probes) was performed for 1 hour. Counterstaining was performed with Hoechst reagent (bisBenzide H 33258) (Sigma-Aldrich, St. Louis, MO, USA). Negative controls were performed with the omission of the primary antibody. Imaging was performed using a Leica DM4000B (Buffalo Grove, IL, USA). Elastin imaging Elastin autofluorescence was visualized in 30 µm thick aortic cross sections using confocal microscopy and 3D structure was reconstructed from 28 layers using ImageJ (National Institutes of Health, Bethesda, MD, USA).

Elastin fragmentation was quantified in the histologic images using elastin fluorescence morphometric analysis (ImageJ). As previously described5, each continuous set of pixels that formed a connected group was defined as an object. An elastin fragmentation index was defined as the ratio of the number of elastin objects to the area of elastin objects.

3

The number of elastin objects was defined by the count of elastin objects within the media region of interest (ROI). The area of elastin objects was equivalent to the total pixel count across all elastin objects within the media ROI. In situ DHE staining The amount of intracellular ROS production was determined using dihydroethidium (DHE) (Molecular Probes - red fluorescence). Frozen aortic cross sections (7 µm) were mounted on glass slides, rinsed in PBS, and incubated in 10 µM DHE (37°C, 30 minutes). Intensity was measured by fluorescence microscopy (Leica DM4000B; Buffalo Grove, IL, USA) using a Texas red filter (488-nm excitation, 610-nm emission). Autofluorescence from elastic lamellae was subtracted, and fluorescence was quantified using ImageJ (National Institutes of Health, Bethesda, MD, USA) Bisphosphonate-conjugated dye staining (OsteoSense) A bisphosphonate-conjugated fluorescent dye (OsteoSense 680EX, PerkinElmer) that binds to hydroxyapatite was used to assess vascular microcalcifications. Frozen aortic sections were incubated with OsteoSense680 for a minimum of 2 hours before imaging as previously described6. Human carotid plaque tissue served as positive control. Aortic collagen quantification Total aortic collagen was quantified using a hydroxyproline-detection based assay (QuickZyme Total Collagen Assay; Quickzyme) as per manufacturer’s protocol. In brief, dissected thoracic aortae (n=4/group) were dried after removal of all loosely attached perivascular connective tissue and dry weight was recorded. Subsequently, aortic tissue was hydrolyzed in 6 M HCl at 95°C for 20 hours. In the hydrolysate hydroxypoline content was quantified colorimetrically and correlated to a collagen standard curve. Aortic collagen content was expressed as % of dry weight. Western blots Aortae were homogenized in RIPA buffer, protease inhibitors, and 5 mM DTT. Equal amounts of protein were separated by 10% SFS-PAGE, transferred to PVDF membranes and stained with Runx2 (Abcam ab23981; 1:900) and beta-actin (Sigma AC-74; 1:10000), followed by incubation with HRP-conjugated secondary antibodies (Dako P0399, 1:2000 and P0447, 1:2000). Signals were visualized by chemiluminescence (Pierce, Rockford, IL). Cell culture Human aortic smooth muscle cells (AoSMCs) were propagated in growth media (SmGM-2; Lonza) with 5% fetal bovine serum (FBS) per standard protocols (Lonza; passage no. 4–5). Before experimental use, AoSMCs were serum-starved for 48h. For high glucose experiments AoSMCs were incubated in Dulbecco’s modified minimal essential medium (DMEM) containing 10% fetal bovine serum (FBS) and D-glucose (25mM for high glucose conditions; 5mM glucose + 20mM D-mannitol as osmotic control for normal glucose controls) for 48h. TNF-α (10 nM) stimulation was performed for 15 min. Transfection of cultured cells Transfection of AoSMCs was performed using Lipofectamine RNAiMAX (Invitrogen) reagent, and siRNA targeting Runx2 or NF-kB subunits RelA (p65) and Nfkb1 (p50) (all from Ambion). For each transfection, siRNA was diluted in Opti-MEM for a final transfection concentration of 50 nM. Cells were transfected with Lipofectamine/siRNA 24h before high glucose incubation for an additional 48 h, followed by harvest and RNA extraction using TRIzol (Invitrogen). Successful knockdown (>75%) was confirmed by qRT–PCR determining expression levels of RUNX2, RELA (p65) and NFKB1 (p50) (all primers from Life Technologies) (Online Figure XIV). Decreased nuclear NF-κB activity was additionally confirmed via TransAM NF-κB activation ELISA (Active Motif) (Online Figure XV).

4

Immunofluorescence staining AoSMCs were cultured in chamber slides under normal glucose or high glucose conditions (see above). The cells were then fixed in 4% paraformaldehyde, washed with PBS, permeabilized with 0.25% Triton-X and incubated with anti-RelA/p65 antibody (Abcam, ab7970) over night at 4°C. The cells were then washed and incubated with secondary antibodies (Alexa Fluor) and Hoechst nuclear counterstain. Chromatin immunoprecipitation assay (ChIP) ChIP analysis was performed using the ChIP-IT High-Sensitivity Kit (Active Motif) as per manufacturer’s protocol. In brief, following normal or high glucose treatment for 48h AoSMCs were fixed with formaldehyde buffer and sonicated to shear chromatin. Sonicated chromatin was incubated with ChIP-validated antibodies (4 µg per 30 µg chromatin) against NFkB p65 (Active Motif, 39369) and nonspecific IgG (Active Motif). The antibody-bound protein/DNA complexes were immunoprecipitated through the use of protein G agarose beads and washed via gravity filtration. Following immunoprecipitation, the DNA cross-links were reversed and the DNA was purified according to the ChIP protocol. The purified immunoprecipitated and input DNA were analyzed by PCR using SYBR Green PCR reagents and SimpleChIP Human RUNX2 Promoter Primers (Cell Signaling, 12376). Data were expressed as fold enrichment of the ChIP samples relative to the IgG samples (calculated by the method of ΔΔCt). NF-κB activation assay In order to quantify cellular NF-κB activation in aortic tissue and cultured AoSMCs, nuclear extracts were obtained using the Nuclear Extract Kit (Active Motif) as per manufacturer’s protocol. Subsequently NF-κB activation (p65 DNA-binding activity) was measured using the TransAM NF-κB activation Kit ELISA (Active Motif) as previously described7,8. In brief, activated NF-κB (p65) is captured on a 96-well plate via an immobilized oligo containing an NF-κB consensus motif (5’-GGGACTTTCC-3’). By using a horseradish peroxidase (HRP)-conjugated antibody against RelA (p65) (Active Motif, provided in the kit) the amount of bound NF-κB complex can then be quantified by spectrophotometry as per protocol. RelA (p65)/DNA binding assay In order to analyze the NF-κB binding capacity of the predicted RelA (p65) binding motif within the Runx2 promoter we used a DNA-binding ELISA approach (TransAM Flexi NFκB p65 Kit; Active Motif) as previously described9. Custom designed biotinylated 50 bp oligos (Stanford Protein and Nucleic Acid Facility), carrying either the intact predicted binding site or defined mutations thereof (Figure 6C and Online Table I for complete sequences) were bound to 96-well streptavidin-coated ELISA plate. Subsequently the solid-phase bound oligos were incubated with nuclear extract from high glucose stimulated AoSMCs. Using a horseradish peroxidase (HRP)-conjugated antibody against RelA (p65), the amount of bound NF-κB complex was then quantified by spectrophotometry as per protocol. Luciferase assay The functional relevance of direct NF-κB binding for the Runx2 promoter activity was tested by transfecting high glucose stimulated AoSMCs with SwitchGear GoClone luciferase constructs. Cells were transfected in 96-well white-bottomed plates at 40% confluence with plasmids (50 ng per well) containing either the intact human Runx2 promoter, custom mutations of the RelA (p65) binding site (Figure 6G and Online Table II for full sequence), a scrambled sequence, or an empty vector using FuGene (Switchgear) per manufacturer’s protocol. After 24 hours luciferase activity was determined by Lightswitch Assay (Switchgear) as per protocol.

5

References 1. Banerjee C,Javed A,Choi JY,Green J,Rosen V,van Wijnen AJ,Stein JL,Lian JB,Stein GS.Differential regulation of the two principal Runx2/Cbfa1 n-terminal isoforms in response to bone morphogenetic protein-2 during development of the osteoblast phenotype.Endocrinology.2001;142:4026-39. 2. Bronckers AL,Sasaguri K,Cavender AC,D'Souza RN,Engelse MA.Expression of Runx2/Cbfa1/Pebp2alphaA during angiogenesis in postnatal rodent and fetal human orofacial tissues.J Bone Miner Res.2005;20:428-37. 3. Amin M,Le V,Wagenseil J.Mechanical testing of mouse carotid arteries: from newborn to adult.J Vis Exp.2012;60:3733. 4. Wagenseil J,Nerurkar N,Knutsen R,Okamoto R,Li D,Mecham R.Effects of elastin haploinsufficiency on the mechanical behavior of mouse arteries.Am J Physiol Heart Circ Physiol.2005;289:H1209-17. 5. Saatchi S,Wanchoo N,Azuma J,Smith SJ,Tsao PS,Yock PG,Taylor CA.The Use of Immunofluorescent Array Tomography to Study the Three-Dimensional Microstructure of Murine Blood Vessels.Cel Mol Bioeng.2011;4:311-323. 6. New SE,Goettsch C,Aikawa M,Marchini JF,Shibasaki M,Yabusaki K,Libby P,Shanahan CM,Croce K,Aikawa E.Macrophage-derived matrix vesicles: an alternative novel mechanism for microcalcification in atherosclerotic plaques.Circ Res.2013;113:72-7. 7. Renard P,Ernest I,Houbion A,Art M,Le Calvez H,Raes M,Remacle J.Development of a sensitive multi-well colorimetric assay for active NFkappaB.Nucleic Acids Res.2001;29:E21. 8. Kobashi C,Urakaze M,Kishida M,Kibayashi E,Kobayashi H,Kihara S,Funahashi T,Takata M,Temaru R,Sato A,Yamazaki K,Nakamura N,Kobayashi M.Adiponectin inhibits endothelial synthesis of interleukin-8.Circ Res.2005;97:1245-52. 9. Boyle JJ,Johns M,Kampfer T,Nguyen AT,Game L,Schaer DJ,Mason JC,Haskard DO.Activating transcription factor 1 directs Mhem atheroprotective macrophages through coordinated iron handling and foam cell protection.Circ Res.2012;110:20-33.

+/db -

4 wee

ks

+/db -

10 w

eeks

+/db -

20 w

eeks

db/db -

4 wee

ks

db/db -

10 w

eeks

db/db -

20 w

eeks

0

200

400

600

Blo

od g

luco

se [m

g/dl

]

** *

Online Figure I: Blood glucose measurements. Blood glucose levels (fed) of (A) 4, 10 and 20 weeks old db/db mice and heterozygous +/db controls, (B) transgenic Runx2-smTg mice vs. WT (C57Bl/6) controls, and (C) 20 weeks old db/db mice ± 10 weeks of oral TEMPOL treatment. Values are mean ± SEM. * indicates p<0.05, n.s. non-significant

db/db - 20 weeks db/db - 20 weeks0

200

400

600

Blo

od g

luco

se [m

g/dl

]

n.s.

+ TEMPOLC57Bl/6 (WT) Runx2-smTg

0

200

400

600

Blo

od g

luco

se [m

g/dl

]

n.s.

A B C Supplemental Figures

+/db db/db db/db + TEMPOL Online Figure II: Aortic cross sections from 20 week-old mice stained with Hematoxylin and Eosin (HE). Muscle stains deep pink. Arrows (à) indicate medial fibrotic areas (pale pink). Nuclei stain blue. Original magnifications are 400x, scale bars 50 µm.

non-diabetic diabetic0

10

20

30

40

50

1

Fold

cha

nge

vs.

non

-dia

betic

mea

n

RUNX2

*


5

10

15

20

25

1

Fold

cha

nge

vs.

non

-dia

betic

mea

n

COL1A1

*


5

10

15

1

Fold

cha

nge

vs. n

on-d

iabe

tic m

ean

COL1A2

*


2

4

6

8

10

1

Fold

cha

nge

vs. n

on-d

iabe

tic m

ean

FN1

*


10

20

30

40

50

1

Fold

cha

nge

vs. n

on-d

iabe

tic m

ean

SPP1ns

Online Figure III: Scatter blots depicting individual expression levels of RUNX2, COL1A1, COL1A2, FN1 and SPP1 in thoracic aortae of diabetic patients (n=8) compared to non-diabetic patients (n=10). Values are expressed as fold changes relative to the mean expression level in non-diabetic patients (=1; dotted line). * indicates p < 0.05 vs. non-diabetic patients.

Aorta

Carotid

arte

ry

Femora

l arte

ry0.0

0.5

1.5

2.0

1

RU

NX

2 ex

pres

sion

Fold

cha

nge

vs a

orta

nsOnline Figure IV: Comparative analysis of arterial (aortic, carotid, femoral) Runx2 expression in Runx2-smTg mice. Runx2 expression levels in aortae, carotid arteries and femoral arteries harvested from Runx2-smTG mice. Values are expressed as fold changes relative to the mean aortic expression level (=1; dotted line). ns indicates no significant differences among groups.

WT Runx2-‐smTg Online Figure VI: Aortic cross sections from 20 week-old mice stained with Hematoxylin and Eosin (HE). Muscle stains deep pink. Arrows (à) indicate medial fibrotic areas (pale pink). Nuclei stain blue. Original magnifications are 400x, scale bars 50 µm.

WT Runx2-‐smTg Online Figure VII: Representative immunofluorescent images of aortic cross sections stained for alpha smooth muscle actin (SMA)(red/orange). Green depicts the autofluorescence of the elastic lamella. Nuclei are Hoechst stained (blue). Original magnifications are 400x, scale bars 50 µm.

Col3a1

Col5a1

Eln0.0

0.5

1.0

1.5

2.0

2.5

Fold

cha

nge

db/d

b vs

. +/d

b co

ntro

l

ns ns ns

Col3a1

Col5a1

Eln0.0

0.5

1.0

1.5

2.0

Fold

cha

nge

Run

x2-s

mTg

vs.

WT

ns nsnsA B

Online Figure V: Aortic expression of Runx2-independent matrix genes in Runx2-smTg (A) and db/db (B) mice. Col3a1, Col5a1, and Eln expression is expressed as fold change relative to the mean expression level of the WT (A) or +/db (B) controls (=1; dotted line). ns indicates no significant differences vs. controls

WT Runx2-‐smTg Posi;ve control (Colon-‐CA)

Online Figure VIII: Representative immunofluorescent images of aortic cross section stained for activated caspase-3 (red). Green depicts the autofluorescence of the elastic lamella. Nuclei are Hoechst stained (blue). Colon carcinoma tissue served as positive control (right panel). Original magnifications are 100x, scale bars 50 µm.

Online Figure IX: Blood pressure levels of Runx2-smTG mice. (A) Systolic, (B) diastolic, and (C) mean blood pressure levels of Runx2-smTg mice vs. WT (C57Bl/6) controls. n=10/group. Values are mean ± SEM. * indicates p<0.05, n.s. non-significant

WT Runx2-smTg

100

120

140

160

Syst

olic

BP

[mm

Hg]

*

WT Runx2-smTg80

90

100

110

120

130

Dia

stol

ic B

P [m

mH

g]

n.s.

WT Runx2-smTg90

100

110

120

130

Mea

n B

P [m

mH

g]

n.s.A B C

Posi;ve control (human caro;d plaque)

WT

Runx2-‐smTg

O n l i n e F i g u r e X : Representative images of aor t ic c ross sect ions s t a i n e d w i t h b i s p h o s p h o n a t e -conjugated fluorescent dye (OsteoSense) to detect microcalcifications (red). G r e e n d e p i c t s t h e autof luorescence of the elastic lamella. Human carotid plaque tissue served as positive control. Original magnifications are 400x, scale bars 50 µm.

WT Runx2-‐smTg Online Figure XI: Representative immunofluorescent images of aortic cross sections stained for CD63 (red) to detect differences in exosome/matrix vesicle formation. Green depicts the autofluorescence of the elastic lamella. Nuclei are Hoechst stained (blue). Original magnifications are 400x, scale bars 50 µm.

Online Figure XII: Blood pressure levels of TEMPOL treated db/db mice. (A) Systolic, (B) diastolic, and (C) mean blood pressure levels of 20 weeks old db/db mice ± 10 weeks of oral TEMPOL treatment. n=10/group. Values are mean ± SEM. * indicates p<0.05, n.s. non-significant

db/db 20wks db/db 20wks + TEMPOL110

120

130

140

150

160

Syst

olic

BP

[mm

Hg]

*

db/db 20wks db/db 20wks + TEMPOL

80

90

100

110

120

Dia

stol

ic B

P [m

mH

g]

n.s.

db/db 20wks db/db 20wks + TEMPOL

90

100

110

120

130

Mea

n B

P [m

mH

g]

*A B C

Online Figure XIII: Proposed mechanism of diabetes induced upregulation of Runx2 in VSMC leading to increased collagen depostion and aortic stiffening. Diabetes / hyperglycemia induces reactive oxygen species (ROS)-dependent NF-kB activation. NF-kb directly activates the Runx2 promoter resulting in enhanced expression of Runx2 and pro-fibrotic target genes Col1a1 and Col2a1 in vascular smooth muscle cells (VSMCs). Increased VSMC collagen production eventually leads to aberrant medial fibrosis and aortic stiffening.

control siRNA RUNX2 siRNA

0.1

1

10

0.25RU

NX

2 ex

pres

sion

Fold

cha

nge

vs c

ontr

ol s

iRN

A

*

RUNX2

control siRNA Rela siRNA

0.1

1

10

0.25RE

LA e

xpre

ssio

nFo

ld c

hang

e vs

con

trol

siR

NA

*

RELA

control siRNA Nfkb1 siRNA

0.1

1

10

0.25NFK

B1

expr

essi

onFo

ld c

hang

e vs

con

trol

siR

NA

*

NFKB1

Online Figure XIV: Confirmation of siRNA-mediated knockdown of RUNX2, RELA, and NFKB1, respectively in AoSMCS. Expression levels are depicted as fold changes relative to the mean expression level of the respective control siRNA (=1; dotted lines). * indicates p < 0.05 vs control siRNA

control siRNA Rela/Nfkb1 siRNA0.0

0.2

0.4

0.6

0.8

NF-kB

act

ivat

ion

(OD

450n

m)

*Online Figure XV: Confirmation of decreased NF-κB activity in AoSMCs nuclear extracts following siRNA-mediated NF-κB knockdown. * indicates p < 0.05 vs control siRNA

Supplemental Tables Oligo Forward sequence Complementary sequence

(reverse) Runx2 ZAAAAATTAAAAAGCTATAT

CCTTCTGGATGCCAGGAAAGGCCTTACCACAAGCC

GGCTTGTGGTAAGGCCTTTCCTGGCATCCAGAAGGATATAGCTTTTTAATTTTT

Runx2-mut1 ZAAAAATTAAAAAGCTATATCCTTCTGGATGCCAGGAGCCTTACCACAAGCC

GGCTTGTGGTAAGGCTCCTGGCATCCAGAAGGATATAGCTTTTTAATTTTT

Runx2-mut2 ZAAAATTAAAAAGCTATATCCTTCTGGATGCCAGGACGAGACTTACCACAAGC

GCTTGTGGTAAGTCTCGTCCTGGCATCCAGAAGGATATAGCTTTTTAATTTT

Scrambled control

ZTTTTCTGGAAACAAAAGACAGGGAAGAGGATTAGAGAGAGAAACTCAAGTGACCC

GGGTCACTTGAGTTTCTCTCTCTAATCCTCTTCCCTGTCTTTTGTTTCCAGAAAA

Online Table I: List of biotinylated oligos used for the NF-κB binding assay. Z denotes biotin-label. Predicted RelA(p65) binding site / mutations underlined.

Promoter / Mutant

Sequence

Runx2 TTTCAAAGCTTCCATTAGAAACAAAAAAATACATAGCTTCTGTTAACCCACTCTATTCTAAGCTCATAGAATCAAATACTGAACAATCTACATTATAACATAAGCATTTTACTTTATAGAAGATCTGCTATCAGAAACTCTATTAATGTCTAAACTACTTAAAGAACTATATAAACTGAATACACTTCAATGAAAGACAAAAAATATTACAATCATAAAGAAAACTAAGATTCATCCAATAAACTATATTACAATCCCTGTCATTCATTTTTTTAAGATCTTCAAACTAGGCATGAGATAATGGTATACATGAAACATTACATTTAATCTTTATTGTAAAGGCCGCCATCTAATAGATTGATAATAAACTAGACAGACGTGATTTAAAATTTGTAAAAGAATGCCCAGACTAACACTTTCATGACAGCCAATTATAGTCAAGCCTAGCAAGCAGTTTGCAACCAGACCTTAAGGTAAACTTTTTTTTTTTTTACAATGAGTTACAGATTCACAAGTTTAAGAAGACAAGAAAAAGGAAAACAGAAGGAATCCAGCCACCCAGCAAATATGAAGCAGACCCCAGAATGTGATACAGTCCAAAGATGTGAATTATTGTATATCATCACTGTTGTTCAGAATTTCACACAGACTCTTGAGCCAATTTTGTTCATTTTTCCACAGACACAATAATGAACTAAAAAGAGGAGGCAAAAAGGCAGAGGTTGAGCGGGGAGTAGAAAGGAAAGCCCTTAACTGCAGAGCTCTGCTCTACAAATGCTTAACCTTACAGGAGTTTGGGCTCCTTCAGCATTTGTATTCTATCCAAATCCTCATGAGTCACAAAAATTAAAAAGCTATATCCTTCTGGATGCCAGGAAAGGCCTTACCACAAGCCTTTTGTGAGAGAAAGAGAGAGAGAGAAAGAGCAAGGGGGAAAAGCCACAGTGGTAGGCAGTCCCACTTTACTTAAGAGTACTGTGAGGTCACAAACCACATGATTCTGCCTCTCCAGTAATAGTGCTTGCAAAAAAAAGGAGTTTTAAAGCTTTTGCTTTTTTGGATTGTGTGAATGCTTCATTCGCCTCACAAACAAC

Runx2-mut1 TTTCAAAGCTTCCATTAGAAACAAAAAAATACATAGCTTCTGTTAACCCACTCTATTCTAAGCTCATAGAATCAAATACTGAACAATCTACATTATAACATAAGCATTTTACTTTATAGAAGATCTGCTATCAGAAACTCTATTAATGTCTAAACTACTTAAAGAACTATATAAACTGAATACACTTCAATGAAAGACAAAAAATATTACAATCATAAAGAAAACTAAGATTCATCCAATAAACTATATTACAATCCCTGTCATTCATTTTTTTAAGATCTTCAAACTAGGCATGAGATAATGGTATACATGAAACATTACATTTAATCTTTATTGTAAAGGCCGCCATCTAATAGATTGATAATAAACTAGACAGACGTGATTTAAAATTTGTAAAAGAATGCCCAGACTAACACTTTCATGACAGCCAATTATAGTCAAGCCTAGCAAGCAGTTTGCAACCAGACCTTAAGGTAAACTTTTTTTTTTTTTACAATGAGTTACAGATTCACAAGTTTAAGAAGACAAGAAAAAGGAAAACAGAAGGAATCCAGCCACCCAGCAAATATGAAGCAGACCCCAGAATGTGATACAGTCCAAAGATGTGAATTATTGTATATCATCACTGTTGTTCAGAATTTCACACAGACTCTTGAGCCAATTTTGTTCATTTTTCCACAGACACAATAATGAACTAAAAAGAGGAGGCAAAAAGGCAGAGGTTGAGCGGGGAGTAGAAAGGAAAGCCCTTAACTGCAGAGCTCTGCTCTACAAATGCTTAACCTTACAGGAGTTTGGGCTCCTTCAGCATTTGTATTCTATCCAAATCCTCATGAGTCACAAAAATTAAAAAGCTATATCCTTCTGGATGCCAGGAGCCTTACCACAAGCCTTTTGTGAGAGAAAGAGAGAGAGAGAAAGAGCAAGGGGGAAAAGCCAC

AGTGGTAGGCAGTCCCACTTTACTTAAGAGTACTGTGAGGTCACAAACCACATGATTCTGCCTCTCCAGTAATAGTGCTTGCAAAAAAAAGGAGTTTTAAAGCTTTTGCTTTTTTGGATTGTGTGAATGCTTCATTCGCCTCACAAACAAC

Runx2-mut2 TTTCAAAGCTTCCATTAGAAACAAAAAAATACATAGCTTCTGTTAACCCACTCTATTCTAAGCTCATAGAATCAAATACTGAACAATCTACATTATAACATAAGCATTTTACTTTATAGAAGATCTGCTATCAGAAACTCTATTAATGTCTAAACTACTTAAAGAACTATATAAACTGAATACACTTCAATGAAAGACAAAAAATATTACAATCATAAAGAAAACTAAGATTCATCCAATAAACTATATTACAATCCCTGTCATTCATTTTTTTAAGATCTTCAAACTAGGCATGAGATAATGGTATACATGAAACATTACATTTAATCTTTATTGTAAAGGCCGCCATCTAATAGATTGATAATAAACTAGACAGACGTGATTTAAAATTTGTAAAAGAATGCCCAGACTAACACTTTCATGACAGCCAATTATAGTCAAGCCTAGCAAGCAGTTTGCAACCAGACCTTAAGGTAAACTTTTTTTTTTTTTACAATGAGTTACAGATTCACAAGTTTAAGAAGACAAGAAAAAGGAAAACAGAAGGAATCCAGCCACCCAGCAAATATGAAGCAGACCCCAGAATGTGATACAGTCCAAAGATGTGAATTATTGTATATCATCACTGTTGTTCAGAATTTCACACAGACTCTTGAGCCAATTTTGTTCATTTTTCCACAGACACAATAATGAACTAAAAAGAGGAGGCAAAAAGGCAGAGGTTGAGCGGGGAGTAGAAAGGAAAGCCCTTAACTGCAGAGCTCTGCTCTACAAATGCTTAACCTTACAGGAGTTTGGGCTCCTTCAGCATTTGTATTCTATCCAAATCCTCATGAGTCACAAAAATTAAAAAGCTATATCCTTCTGGATGCCAGGACGAGACTTACCACAAGCCTTTTGTGAGAGAAAGAGAGAGAGAGAAAGAGCAAGGGGGAAAAGCCACAGTGGTAGGCAGTCCCACTTTACTTAAGAGTACTGTGAGGTCACAAACCACATGATTCTGCCTCTCCAGTAATAGTGCTTGCAAAAAAAAGGAGTTTTAAAGCTTTTGCTTTTTTGGATTGTGTGAATGCTTCATTCGCCTCACAAACAAC

Scrambled control

CTCTTCCTGCCAAAGGGTTAGTTCCTGGTCCCCCAGGGTGGGGAGGCCCTAGAAAGGCCCTGAGCTTTCACAAGTTTAGGTGCTTTAAGTCTGGGGCTCCCAGGGTGCTGGGGAGCAGACCAGTGGGAGTTTAGTGGGCAGAGTCCTGCCTGGCTCACCCGGCCCCATCCGTCTCCGGTGGGCTCTTCTGCTGCCGGTTGTACAGGAAGAAGACAGTGAGCACAGCAACTAGGATGAGGAACACGGCCACGGTGCCCGCCAGGAGCCTGGCTGCACTTCCCAGACCCCTCTGGGGGCGGGGCTTTTCTGGAAACAAAAGACAGGGAAGAGGATTAGAGAGAGAAACTCAAGTGACCCAAAGAGAGTCAGAGATGTGAGAGAGTCAGACCCTGAGGCAGTACTCTGCCTTTGACATTGCACCCCCAGCTCCCCTCCCCATGGTGCTCCAGTTCTAGGAGGGGCTCCCAGCCGGTGTGGGATGGAGGCTCCTCCTCTAGTTCCCTATGACCCTGTAACCCCACACCCTGCTCTGATCCTGGGATCTGGGGCATGGAGGTAGAACAAGGGTGAGGGTATCTCCTGGACAGGCAGCAGGTGCTGAGATGGGGTCCCCACCCCGTCATTCCATTTCTGGCCCTGCAGGGAAGATTCCTGTTGAGGAGTTTAACTTCTTTCCCCTCCCTGTGCAATTAAACAAGCAAATGAACTAATGGGTGCTTCACCCTCCCAGCTTGGGACAGAGGGTGAGGATCAGGAGGGAAAGGCAGGAGCTGGGAGGGTCGATGAAGAAGGGGCACCTGGGGGTGCCTCCCGGGAAACCAAGCCTCTTCAGTACAGATAGGTGAAAAGCCCAGAGGGCTGTGGTCTAAGGTGAGGGGGCTGAGCCCACCTTCTGGACCCACCTGGTCATGGACCCAGAAGATTGCTGGGCTTGTCGAGGTATTTCACAGTCTGAGCTGGAGACAC

Online Table II: Sequence of luciferase constructs and custom designed mutants. Predicted RelA(p65) binding site / mutations underlined.

Deng, Michael Buerke, Lars Maegdefessel, Gerd Hasenfuß, Joshua M. Spin and Philip S. TsaoH. Zheng, Matti Adam, Ann Jagger, Futoshi Nakagami, Ryuji Toh, Kensuke Toyama, Alicia

WeiKayama, Kiril Penov, Jan K. Hennigs, Florian Salomons, Suzanne Eken, Fabian C. Emrich, Uwe Raaz, Isabel N. Schellinger, Ekaterina Chernogubova, Christina Warnecke, Yosuke

MellitusTranscription Factor Runx2 Promotes Aortic Fibrosis and Stiffness in Type 2 Diabetes

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2015 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

doi: 10.1161/CIRCRESAHA.115.3063412015;117:513-524; originally published online July 24, 2015;Circ Res.

http://circres.ahajournals.org/content/117/6/513World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/suppl/2015/07/24/CIRCRESAHA.115.306341.DC1.htmlData Supplement (unedited) at:

http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer about this process is available in the

located, click Request Permissions in the middle column of the Web page under Services. Further informationEditorial Office. Once the online version of the published article for which permission is being requested is

can be obtained via RightsLink, a service of the Copyright Clearance Center, not theCirculation Researchin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:


http://circres.ahajournals.org/content/117/6/513

http://circres.ahajournals.org/content/suppl/2015/07/24/CIRCRESAHA.115.306341.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circres.ahajournals.org//subscriptions/


Documents

Molecular Medicine - Sid Italia · 513 D iabetes mellitus is a growing health problem throughout the world. The prevalence of diabetes mellitus was estimated to be 171 million people