MOLECULAR CLONING, CHARACTERIZATION AND ENZYMATIC ... · MOLECULAR CLONING, CHARACTERIZATION AND ENZYMATIC PROPERTIES OF A NOVEL ETA-AGARASE FROM A MARINE ISOLATE PSUDOALTEROMONAS

876

Brazilian Journal of Microbiology (2010) 41: 876-889 ISSN 1517-8382

MOLECULAR CLONING, CHARACTERIZATION AND ENZYMATIC PROPERTIES OF A NOVEL �ETA-

AGARASE FROM A MARINE ISOLATE PSUDOALTEROMONAS SP. AG52

Chulhong Oh1,3, Chamilani Nikapitiya1, Youngdeuk Lee1, Ilson Whang2, Do-Hyung Kang3, Soo-Jin Heo3, Young-Ung

Choi3 and Jehee Lee1,4*

1Department of Marine Life Science, Jeju National University 66 Jejudaehakno, Ara-Dong, Jeju, 690-756, Republic of Korea; 2Department of Life Science, Jeju National University 66 Jejudaehakno, Ara-Dong, Jeju, 690-756, Republic of Korea; 3Korea

Ocean Research & Development Institute, Ansan, 426-744, Republic of Korea; 4Marine and Environmental Institute, Jeju National

University, Jeju, 690-814, Republic of Korea.

Submitted: August 04, 2009; Returned to authors for corrections: March 08, 2010; Approved: June 21, 2010.

ABSTRACT

An agar-degrading Pseudoalteromonas sp. AG52 bacterial strain was identified from the red seaweed

Gelidium amansii collected from Jeju Island, Korea. A �-agarase gene which has 96.8% nucleotide identity

to Aeromonas �-agarase was cloned from this strain, and was designated as agaA. The coding region is

870 bp, encoding 290 amino acids and possesses characteristic features of the glycoside hydrolase family

(GHF)-16. The predicted molecular mass of the mature protein was 32 kDa. The recombinant �-agarase

(rAgaA) was overexpressed in Escherichia coli and purified as a fusion protein. The optimal temperature

and pH for activity were 55 oC and 5.5, respectively. The enzyme had a specific activity of 105.1 and 79.5

unit/mg toward agar and agarose, respectively. The pattern of agar hydrolysis demonstrated that the

enzyme is an endo-type �-agarase, producing neoagarohexaose and neoagarotetraose as the final main

products.

Since, Pseudoalteromonas sp. AG52 encodes an agaA gene, which has greater identity to Aeromonas �-

agarase, the enzyme could be considered as novel, with its unique bio chemical characteristics. Altogether,

the purified rAgaA has potential for use in industrial applications such as development of cosmetics and

pharmaceuticals.

Key words: Agar; Aeromonas sp.; �-agarase; Pseudoalteromonas sp.; GHF-16; Neoagaro-

oligosaccharides

INTRODUCTION

The main component of the cell wall of marine red algae

(Rhodophyceaea) is agar, and it is composed of agarose (4) and

agaropectin (12). Agarases are the hydrolytic enzymes mostly

found in marine habitats (5, 39), which are responsible for the

breakdown of agar and agar-derived compounds, and result in

oligosaccharides that have various bioactivities (9, 25). Based

on the pattern of hydrolysis of the substrates, agarases are

grouped into �-agarases and �-agarases (3, 19). To date, most

*Corresponding Author. Mailing address: Department of Marine Life Science, Jeju National University, Jeju, 690-756, Republic of Korea.; Tel: +82-64-754-3472 Fax: +82-64-756-3493.; E-mail: [email protected]

877

Oh, C. et al. Characterization of a novel �-agarase from Psudoalteromonas sp. AG52

of the agarolytic enzymes isolated, purified and characterized

have been from microorganisms, with the majority of the

genera being marine bacteria. Among these known agarases,

most belong to the �-agarase group and few biochemical

studies have been reported for �-agarases (39, 44). Several �-

agarases have been purified and characterized from species

including Pseudoalteromonas (43, 48), Pseudomonas (16, 17,

33), Alteromonas (19, 24, 29, 39, 49), Agarivorans (15, 20),

Vibrio (2, 6, 14, 45), Cytophage (11, 47), Bacillus (46) and

Saccharophagus (13). Cloning and expression of �-agarase

encoding genes has been reported from Pseudoalteromonas

(30), Pseudomonas (17, 27, 41), Agarivorans (28, 34),

Microbulbifer (35-37), Vibrio (45, 50), Zobellia (22) and

Streptomyces (23).

Our laboratory is currently conducting research on the

characterization of a number of �-agarases and the biochemical

properties of recombinant proteins, from various bacterial

species isolated from the marine environment. In this study,

Pseudoalteromonas sp. AG52 was isolated from the Jeju Island

coastal environment, from which a �-agarase gene was

subsequently isolated and designated as agaA. We cloned the

gene, overexpressed the protein in Escherichia coli (E. coli)

and purified the recombinant �-agarase (rAgaA) from

Pseudoalteromonas sp. AG52. In addition, purified rAgaA was

analyzed for biochemical properties such as specific activities

and optimum reaction conditions. Until recently, the

Pseudoalteromonas sp. �-agarase was an unknown entity.

Herein we examine and describe in depth this enzyme, which

upon analysis showed greater identity to Aeromonas �-agarase.

The characterization of this novel enzyme could be beneficial

to a variety of industries.

MATERIALS AND METHODS

Isolation of agarase-producing bacteria strain

Agarolytic bacteria were isolated from the red seaweed,

Gelidium amansii from the south coast of Jeju Island, Republic

of Korea. The crushed seaweeds were spread, on on SWT

(0.3% Tryptone and 1.5% agar in seawater), SWY (0.3% yeast

extract and 1.5% agar in seawater) and marine agar plates

(Difco, Detroit, USA). Positive colonies showing clear zones

or pits were picked out from the selection plates, and re-

streaked The pure colonies were selected by repeat streaking

under the same conditions and inoculated in their respective

broths including 0.2% agar, then incubated at 30 oC. The stock

was prepared from the bacteria culture using 20% glycerol,

then samples were stored at -70 oC. Polymerase Chain Reaction

(PCR) was performed for 16S rDNA sequence amplification

from the extracted genomic DNA of isolated bacteria. The

universal primers (16S-27F as forward and 16S-1492R as

reverse) used for the PCR are shown in Table 1. The sequence

was analyzed using the NCBI Blast N program and the

DNAssist program.

Partial agaA gene amplification

All of the cloning experiments were carried out according

to Sambrook et al. (42) with slight modifications. From

analyzing the sequences of other agarase genes from NCBI

database, three sets of forward and reverse primers were

designed (Table 1) and those mix primers (Mix-AGA-F1 and

R1, Mix-CY-F2 and R2, Mix-Sa-F3 and R3) were used for

initial partial agarase amplification using genomic DNA as

template and Ex Taq DNA polymerase (Takara, Japan).

Long and Accurate Polymerase Chain Reaction (LA PCR)

for detection of full length agaA

The complete agaA was cloned using a LA PCR in vitro

cloning kit (Takara, Korea), according to the manufacturer

instructions. Genomic DNA was digested with separate

restriction enzymes BamH I, EcoR I, Hind III and Xho I, and

subsequently the digested products were ligated with a BamH

I, EcoR I, Hind III and Xho I cassette, then used as a template

for LA PCR. LA52-F1 and LA52-F2 primers and LA52-R1

and LA52-R2 primers were designed to identify the reverse

and forward sequence from the known partial sequence of

agaA, respectively (Table 1). The amplification of upstream or

downstream of the known sequence was performed using

LA52-R1 or LA52-F1 with C1 (from the cassette nucleotide

878


sequence), respectively. Taking the resultant product as the

template, PCR was performed to obtain upstream or

downstream of the known sequence using LA52-R2 or LA52-

F2 with C2 (from the cassette nucleotide sequence),

respectively. Product was sequenced, and the gene was

analyzed by nucleotide BLAST and Protein BLAST of

National Center for Biotechnology Information (NCBI)

database. The signal peptide sequence of AgaA was predicted

through a SignalP program (http://www.cbs.dtu.dk/services/

SignalP/). The LipoP 1.0 Server (http://www.cbs.dtu.dk/

services/LipoP/) was used for a gram-negative bacteria

lipoprotein site search analysis. Identity and percent similarity

of full-length amino acid sequences were calculated using

FASTA program (38).

Table 1. Oligonucleotide primers

Name Object Sequence (5’ to 3’ direction)

16S-27F 16S rDNA sequence amplification AGAGTTTGATCMTGGCTCAG

16S-1492R 16S rDNA sequence amplification TACGGYTACCTTGTTACGACTT

Mix-AGA-F1 agaA partial sequence amplification CWTCKTATATWAATGCTTGGC

Mix-AGA-R1 agaA partial sequence amplification TGGYTGRTAATCTTGAAATGG

Mix-CY-F2 agaA partial sequence amplification YTNGARTAYTAYATHGAYGG

Mix-CY-R2 agaA partial sequence amplification TTRTANACNCKDATCCARTC

Mix-Sa-F3 agaA partial sequence amplification TCNATHCAYYTNTAYGAYTTYCC

Mix-Sa-R3 agaA partial sequence amplification CCAYTCNGCYTTNACNGG

52LA-F1 LA PCR Forward 1 TCGTCGCTACGGTGTTCATTGGAA

52LA-F2 LA PCR Forward 2 TAGTTCGCAGCGTTTCAGGTCCTA

52LA-R1 LA PCR Reverse 1 ACGTGCATACGTTGGTCAAACCAC

52LA-R2 LA PCR Reverse 2 TGCCTCCATCGCATCAATTTCCTG

C1 Cassette primers GTACATATTGTCGTTAGAACGCGTAATACGACTCA

C2 Cassette primers CGTTAGAACGCGTAATACGACTCACTATAGGGAGA

Ag52-F1 Cloning to pET-16b (GA)3 CATATGGCAGATTGGGACGCATATAGTA (Nde I)

Ag52-R2 Cloning to pET-16b (GA)3 GGATCCTTAGTTTGCTTTGTAGACACGTATC (BamH I)

Cloning of AgaA coding sequence into the expression

vectors

Primer set Ag52-F1 and Ag52-R2 were designed with its

corresponding restriction enzyme sites (Table 1) to clone the

coding sequence into the pET16b expression vector (Novagen,

USA), without including its signal sequence. The vector and

PCR products were digested with restriction enzymes, ligated

and transformed into E. coli DH5� cells, and correct

recombinants (confirmed by restriction enzyme digestion and

sequencing) were transformed into E. coli BL21(DE3).

Recombinant cells were overexpressed in the presence of

isopropyl-ß-thiogalactopyranoside (IPTG) at a final

concentration of 1 mM. Briefly, 5 mL of an overnight grown

BL21(DE3) starter culture was inoculated into 100 mL Luria

broth with 100 �L ampicillin (100 mg/mL) and 10 mM glucose

(0.2% final concentration) and incubated at 37 oC.

Recombinant pET-16b- AgaA cells were induced for 24 h at 12 oC, followed by cell harvesting (centrifugation at 4000 x g for

20 min at 4 oC). The cells carrying the pET-16b- AgaA were

resuspended in 5 mL ice-cold 1x binding buffer (8x = 4M

NaCl, 160 mM Tris HCl, 40 mM imidazole, pH 7.9) and frozen

at -20 oC overnight. After thawing on ice, the bacterial cells

879


were sonicated and supernatant was taken as a crude enzyme

after centrifugation. The crude rAgaA fusion protein fused with

His tag was purified using the His Bind purification Kit

(Novagen, USA). Elutes were collected in 500 �L fractions and

respective elutes were run on 12% SDS-PAGE. The

concentrations of purified proteins were determined by the

method of Bradford using bovine serum albumin (BSA) as the

standard.

Agarase enzyme assay

Specific activity of purified rAgaA was determined

according to a modified method of Ohta et al. (35) using

different substrates including 1% food-grade agar, 1% agarose

and 1% carrageenan. Appropriately diluted enzyme solution

was added to different substrates in phosphate buffer (pH 7.0)

at 45 oC, and was incubated at 45 oC for 30 min. Activity was

expressed as the initial rate of agar hydrolysis by measuring the

release of reducing ends using the 3,5-dinitrosalicylic acid

(DNS) procedure (32) with D-galactose as the standard. One

unit of the enzyme activity was defined as the amount of

protein per min produced 1 �mol of reducing sugar as D-

galactose under condition of the assay.

Biochemical characterization of rAgaA

In each experiment, 1% agar solution and purified agarase

were mixed and incubated at various times and temperatures as

described. The relative agarase activity was determined by the

DNS method. The optimum temperature of rAgaA activity was

determined by monitoring the relative enzymatic activity at

temperatures ranging from 40-65 oC with 5 oC intervals at pH

7.0. Optimum pH was tested from pH 4.5-9.0 with pH 0.5

intervals at 45 oC. Acetate buffer and phosphate buffer were

used for pH 4.5-6.0 and pH 6.5-9.0, respectively. The

thermostability of rAgaA was evaluated by measuring the

residual activity of the enzyme after incubation at the

temperatures between 40-55 oC for 30, 60 and 120 min. The

effects of various metal ion salts and chelators on purified

rAgaA activity were tested by determining the activity in the

presence of 2 mM of various ions or chelators (CaCl2, CuSO4,

FeSO4, KCl, MgSO4, MnCl2, NaCl and EDTA) in a final

concentration and incubated at 45 oC for 30 min. The control

was the assay mixture, with no addition of metal ion salts or

chelators.

Identification of rAgaA hydrolyzed agar products

Thin layer chromatography (TLC) was used to identify the

hydrolysis products of agar and neoagarooligosaccharides.

Neoagarohexanitol (NA6) was purchased from Sigma (USA)

and neoagarotetraose (NA4) and neoagarobiose (NA2) (NA4 +

NA2) were prepared by digestion of neoagarohexanitol using

commercial �-agarase (New England Biolab, USA). D-(+)-

galactose was purchased from Sigma (USA), and all above

mentioned oligosaccharides were used as standards. Moreover,

food-grade agar and NA6 were used as substrates for the

reactions. The reaction of purified agarase and agar was carried

out in 200 �L reactions containing 20 �L of purified agarase

and 180 �L of 1% agar at 45 oC for 30, 60, and 120 min. The

NA6 substrate was incubated separately with 20 �L of purified

agarase at 45 oC for 120 min. Subsequently, the reaction

mixtures were applied to a silica gel 60 TLC plate (Merck,

Germany). The TLC plates were developed using a solvent

system consisting of n-butanol: acetic acid: water (2:1:1, v/v).

After hydrolysis of substrates, the resultant oligosaccharide

spots were visualized by spraying 10% H2SO4 on the plate,

then heating it on a hot plate.

Nucleotide sequence accession number

The Pseudoalteromonas sp. AG52 �-agarase nucleotide

sequence was submitted to the NCBI database with accession

number FJ979637.

RESULTS

Identification of the agarase-producing bacteria

Initially, agarase-producing marine bacteria were isolated

from selection plates showing clear zones. The 16S rRNA

sequence analyses results showed that the isolated bacteria

from seaweed was 99% similar to Pseudoalteromonas sp. and

880


is assigned to the genus Pseudoalteromonas and named

Pseudoalteromonas sp. AG52. This strain was deposited in

Korean Culture Collection Center of Microorganisms

(KCCM), Rep. of Korea with accession number KCCM 42924.

Cloning of �-agarase from Pseudoalteromonas sp AG52

The partial agaA sequence (651 bp) followed by full

length sequence was amplified as described in Materials and

Methods. The nucleotide and deduced amino acid sequences of

Pseudoalteromonas sp. AG52 �-agarase is shown in Figure 1.

The agaA gene open reading frame (ORF) consists of a 870 bp

encoding a protein of 290 amino acids. The agaA has a

putative molecular mass of 32 kDa with an isoelectric point of

5.8. The signal peptide (1-21 aa) and lipoprotein signal peptide

(signal peptidase II) were identified in the N-terminal

sequence. Additionally, a characteristic GHF-16 �-agarase

family domain (Cys22-Lys287), catalytically active site residues

(Tyr69, Asp71, Trp72, Trp139, Ser145, Asp150, Glu153, Phe176,

Arg178, Glu257, Glu259), and calcium binding residues (Gln47,

Phe48, Asn49, Gly91, Ala92, Asp282, Trp283) were identified in the

sequence. The agaA nucleotide sequence showed 96.4% and

74.9% nucleotide identity to �-agarase sequence of Aeromonas

sp. (Accession number U61972) and Pseudoalteromonas

atlantica (accession number M73783), respectively. Database

searches using BLASTP yielded results showing homology to

other known GHF-16 family agarases. Pairwise comparison of

AgaA amino acid sequence to known agarases is shown in

Table 2. Interestingly, AgaA amino acid sequence shares

96.9% identity and 99.3% similarity with Aeromonas sp. �-

agarase (accession number AAF03246). The P. atlantica �-

agarase coding sequence (accession number AAA91888)

shares only 84.5% identity, and 92.4% similarity with AgaA.

The multiple alignment shows conserved catalytic and calcium

binding residues of AG52 when compared with other GHF-16

agarases (Figure 2). The phylogenetic analysis of the AgaA

amino acid sequence including known �-agarase amino acid

sequences of different members of the �-agarase family

(GHF16, 52 and 82) was constructed using the neighbor-

joining method as shown in Figure 3. The AgaA coding

sequence was clustered with GHF-16 �-agarases, and formed a

monophyletic clade with �-agarase of Aeromonas sp. and P.

atlantica (AAA91888). However, it was also closely grouped

with Aeromonas �-agarase.

Purification and Biochemical characterization of rAgaA

Successfully purified rAgaA agarase in pET-16b as a

fusion protein was approximately 33 kDa, which was in

agreement with the predicted molecular mass of AgaA (Figure

4), hence enzyme characterization was carried out with the

fusion protein.

The specific activity of purified rAgaA towards agar and

agarose were 105.1 and 79.5 unit/mg, respectively. The

optimum reaction temperature of the purified rAG52 was 55 oC

(Figure 5A), however, more than 50% of the relative activity

was observed between 40 and 60 oC. The effect of pH on

purified enzyme is shown in Figure 5B. The maximal activity

was observed at pH 5.5 and the enzyme was stable (more than

60% relative activity) in the range of buffers from pH 4.5-9

under the conditions of the assay. The temperature dependence

of the rAgaA activity on agar was determined by measuring the

activity at various temperatures for 120 min. The effect of

temperature on the stability of rAG52 is shown in Figure 5C.

The thermostability of rAgaA was retained upto 80% at 40 oC

for 30 min. When temperature was increased to 45, 50 and 55 oC for 30 min, the enzyme relative activity was decreased to

20-30%. Nevertheless, the enzyme was fairly stable (50%

relative activity) at 40 oC for 60 min of incubation. Moreover,

addition of 2 mM CaCl2 to the reaction mixture at 40 oC was

enhanced the thermostability by 20 and 15% at 60 and 120

min, respectively (Figure 5D). The effect of metal ion salts and

chelators on the activity of purified rAgaA enzyme is shown in

Figure 6. rAgaA relative activity was totally inhibited by

divalent metal salts such as CuSO4 and ZnSO4 (each at 2 mM

final concentration). Moreover, 2 mM EDTA inhibited the

enzyme activity by 60%. In contrast, 2 mM FeSO4 and 2 mM

KCl enhanced the activity of rAgaA more than the other metal

ion salts present in seawater.

881


�

Figure 1. The nucleotide and deduced amino acid sequences of the �-agarase of Pseudoalteromonas sp. AG52. The predicted lipoprotein signal

peptide is underlined and signal peptide sequence is in bold face. The start (ATG) and stop (TAA) codons are in bold italics and stop codon is

marked with an asterisk (*). The GHF-16 �-agarase domain is in italics. Active sites and calcium binding residues are in boxes and dotted boxes,

respectively.

882


�

�

Figure 2. Multiple alignment of �-agarase amino acid sequences of Pseudoalteromonas sp. AG52 with known agarases. The inverted triangles

(�) highlight the conserved catalytic residues, and black circles (�) represent the conserved residues involved in calcium ion binding. Identical

residues in all sequences are shaded in gray and indicated by (*) under the column, conserved substitutions are indicated by (:), and semi-

conserved substitutions are indicated by (.). Deletions are indicated by dashes. Sequence sources: Aeromonas sp. �-agarase (AAF03246),

Pseudoalteromonas atlantica �-agarase I (AAA91888), Zobellia galactanivorans �-agarase A (AAF21820), Zobellia galactanivorans �-agarase

B (AAF21821).

883


�

�Table 2. Pairwise analysis and comparisons of the deduced amino acid sequence of Pseudoalteromonas sp. AG52 �-agarase with other

known �-agarases.

Species Accession number Identity (%) Amino acids Aeromonas sp. �-agarase AAF03246 96.9 290 Pseudoalteromonas atlantica �-agarase AAA91888 84.5 290 AguD uncultured bacterium �-agarase AAP49316 45.2 449 Zobellia galactanivorans �-agarase B AAF21821 39.3 353 Pseudomonas sp. ND137 agarase BAB79291 38.7 441

Microbulbifer thermotolerans agarase BAD29947 36.1 433 Microbulbifer elongatus agarase BAC99022 35.6 441 Cellvibrio sp. OA-2007 putative agarase BAH16616 32.3 596 Saccharophagus degradans �-agarase I AAT67062 26.8 593 Zobellia galactanivorans �-agarase A AAF21820 26.0 539 Pseudoalteromonas sp. CY24 agarase AAN39119 24.1 453

�

�

Figure 3. Phylogenetic analysis of AgaA with known agarases based on amino acid sequence. Phylogenetic analysis was done by the Neighbor

Joining method using MEGA3.1, based on sequence alignment using ClustalW (1.81). Numbers indicate the bootstrap confidence values of 1000

replicates. The accession numbers of the selected agarase sequences are as follows: AB178483, agarase (Agarivorans sp. JAMB-A11);

EF051475, QM38 agarase (Agarivorans sp. QM38); EF100136, �-agarase (Agarivorans sp. JA-1); AAA25696, �-agarase precursor

(Pseudoalteromonas atlantica); AAP49346, AguB; AAP70390, AguH; AAP70365, AguK; AAP49316, AguD from uncultured bacterium;

AAA91888, �-agarase I (Pseudoalteromonas atlantica); AAF03246, �-agarase (Aeromonas sp.); AB124837, agarase (Microbulbifer

thermotolerans); BAC99022, agarase (Microbulbifer elongatus); BAB79291, agarase, (Pseudomonas sp. ND137; AAF21821, �-agarase B

precursor (Zobellia galactanivorans); AAF21820, �-agarase A precursor (Zobellia galactanivorans); AAN39119, extracellular agarase

precursor, (Pseudoalteromonas sp. CY24); CAB61795, extracellular agarase precursor (Streptomyces coelicolor A3); AAP70364, AguJ

(uncultured bacterium); BAA04744, �-agarase (Vibrio sp.); BAA03541, �-agarase (Vibrio sp. JT0107); BAH16616, agarase (Cellvibrio sp. OA-

2007); AAT67062, �-agarase I (Saccharophagus degradans); AB160954, �-agarase (Microbulbifer thermotolerans).

884


Figure 4. SDS-PAGE of the rAgaA. Samples of rAgaA were separated on 12% SDS-PAGE and stained with Coomassie brilliant blue. M:

molecular mass marker (BioRad, USA). Lane 1: total cellular extract from E. coli BL21 (DE3) before induction; lane 2: total cellular soluble

extract after induction; lane 3: total cellular insoluble extract after induction; lane 4: purified rAgaA.

Figure 5. Characterization of biochemical properties of purified rAgaA. A. The effect of temperature on the rAgaA. The effect of temperature on

enzyme activity was determined under standard assay conditions as described in Materials and Methods, at temperatures ranging between 40-65 oC. B. The effect of pH on the activity of rAgaA. Optimum pH for rAgaA activity was examined from pH 4.5-9.0 at pH 0.5 intervals at 45 oC

under standard assay conditions (described in Materials and Methods) using acetate (pH 4.5-6.0) and phosphate buffer (pH 6.5-9.0). C. The

effect of thermostability on rAgaA at different temperatures at different time points. Thermostability was determined by measurement of residual

activity under standard assay conditions as described in Materials and Methods at temperatures between 40-55 oC for 30, 60 and 120 min. D. The

effect of 2 mM CaCl2 on thermostability of rAgaA.

885


0

20

40

60

80

100

120

140

160

180

NoneCaC

l2

CuSO4

EDTAFeS

O4KCl

MgS

O4

MnC

l2NaC

l

ZnSO4

Rel

ativ

e ac

tivi

ty (%

) --

*

**

*** *** ***

****

*

****

Figure 6. The effects of metal ions and metal salts on the activity of purified rAgaA. Various ions or chelators (CaCl2, CuSO4,

FeSO4, KCl, MgSO4, MnCl2, NaCl and EDTA) at a final concentration of 2 mM were included in the reaction buffer to test the

activity of rAgaA at 45 oC for 30 min. The data presented are the average of three replicates. Means with the same number of stars

are not significantly different at p<0.05, based on ANOVA. Error bars represent + SD.

Identification of hydrolysis products of the rAgaA by TLC

Hydrolysis patterns of the purified rAgaA against food-

grade agar and neoagarohexanitol (NA6) are shown in Figure

7. When rAgaA was incubated with agar, two distinct spots

namely, NA6 and NA4 were observed on TLC plates at 30, 60

and 120 min after the reaction. Furthermore, the distinct spot of

NA4 was observed when rAgaA was incubated with NA6.

Figure 7. TLC of hydrolysis products of the

purified rAgaA on food-grade agar and neoagaro-

oligosaccharides. The assay of rAgaA and agar

were performed in 200 �l reactions containing 20

�L of purified agarase and 180 �L of 1% agar at 45 oC for 30, 60, and 120 min. The NA6 substrate was

incubated with 20 µl of rAgaA separately at 45 oC

for 120 min. Neoagarohexaitol (NA6), neoagarotetraose (NA4), neoagarobiose (NA2) and

D-(+)-galactose (G) were used as standards (STD).

886


DISCUSSION

In this study, a newly found marine bacterial isolate was

assigned to the genus Pseudoalteromonas based on the 16S

rDNA sequence analysis. We report herein the cloning and

sequencing of the �-agarase gene with �-agarase activity from

Pseudoalteromonas sp. AG52, which has greater identity to the

Aeromonas �-agarase coding sequence than the

Pseudoalteromonas sp. �-agarase coding sequence in the NCBI

Genbank. It was shown in this study that agaA was genetically

closely related to the GHF-16 �-agarases, and hence this gene

should be classified into the GHF-16 family. The primary

structure of the Pseudoalteromonas sp. AG52 �-agarase shows

regions homologous to GHF-16 family members, which

include catalytic domains belonging to GHF-16, which

hydrolyze the internal �-1,4-linkage of agar, producing

neoagarooligosaccharides. BLASTP and pairwise analysis of

agaA full length coding sequence with other agarases which

belong to the GHF-16 family showed overall sequence

identities ranging from 24-97%. Some of the �-agarases encode

for a modular protein consisting of a signal peptide, catalytic

module and C-terminal domain of unknown function or a

carbohydrate binding module (1, 35), and this may be the

reason for having low identity, even within the same family. It

has been reported that homologous regions in most of the

reported GHF-16 agarases were present in catalytic module of

the �-agarases (1). This further confirms the heterogeneity of

the amino acid sequences in length, catalytic properties and

substrate specificities in agarases. Furthermore, the results of

the phylogenetic analysis support the idea that many �-agarases

may have evolved from a common ancestral form, and, that

domain shuffling may contribute significantly to the diversity

of the agarases (7,10). Even though the protein is divergent

from the primary sequences, AgaA features strictly conserved

catalytic residues, which show conservation among the GHF-

16 family members. Glutamic and aspartic acid are the highly

conserved active site residues, which are responsible for

catalytic activity in the GHF (30). According to previous

reports (1, 31), the conserved Glu148 and Glu153 are responsible

for acting as the nucleophile and the acidic/basic residues,

respectively, in AgaA. The third conserved acidic residue at

Asp150, is responsible for maintaining the charges in the

environment of catalytic amino acids. The lipoprotein signal

peptide is one of the secretion systems reported for gram

negative bacteria (40) and such a signal was predicted in the

AgaA sequence at the N-terminal where Cys16 may be linked to

the lipid moiety. However, in this study, the cleavage of N-

terminal hydrophobic segment is by either signal peptidase I or

signal peptidase II is not known clearly and remains to be

elucidated. Using pET16b, intracellular AgaA was expressed

efficiently and purified as a fusion protein. The purified

agarase had a molecular mass of 33 kDa, which is close to

those reported for �-agarases from Pseudoalteromonas sp. N-1

(33 kDa) (48) and Pseudomonas atlantica (32 kDa) (33); but,

smaller than agarases reported for Alteromonas sp. (52 kDa)

(29) and Pseudomonas sp. W7 (59 kDa) (17); and, larger than

agarases reported for Vibrio sp. AP-2 (20kDa) (2). AgaA

hydrolyzes agar to give NA6 and NA4 as the main products,

suggesting that the enzyme is a �-agarase, in accordance with

most of the reported GHF-16 �-agarases (1, 43).

Generally, most of the GHF-16 �-agarases that have been

characterized so far, have optimal function at 40 oC and pH

optimums in the range of neutral to mild alkaline (50). rAgaA

has an optimum temperature (55 oC) that is higher than the

gelling temperature of agar (40 oC) with broad range of pH.

These are properties which are useful for the production of

industrially important oligosaccharides from marine algae or

agar. These findings are in contrast with earlier reported pH

and temperature optima at 7 and 30 oC, respectively, for a

purified �-agarase from Pseudoalteromonas sp. (48). A

temperature optimum at 40 oC and a pH optimum of 6.0 have

been reported for recombinant �-agarase AgaB from

Pseudoalteromonas sp. CY24 (30). In contrast to the

experimentally determined optimum temperature of rAgaA

activity, thermal stability profiles of this protein showed that

the enzyme is stable under 45 oC even after 30 min incubation,

however, it becomes inactivated at higher temperatures. The

enzyme at 40 oC retained 50% activity even after 1 h of

887


incubation, indicating that this enzyme might be used under

mild heating conditions. In addition, the enzyme stability was

considerably enhanced in the presence of CaCl2, and enzyme

retained more than 15% of its initial activity after 1 and 2 h of

incubation with CaCl2. Several published studies support these

results, where a major role is proposed for Ca2+ in stabilization

of enzymes at higher temperatures (18, 21). It was reported that

the reason for this may be due to the strengthening of

interactions inside the protein molecule, and probably by the

binding of Ca2+ to an autolysis site (8, 26). It has been reported

that a catalytic module of �-agarase (�-AgaA_CM) of Z.

galactetanivorans Dsij, had Ca2+ bound on the convex face of

the protein in an octahedral geometry, coordinating with the

backbone carbonyl oxygen atoms of Ser47, Ser91, and Asp279, a

carboxylate oxygen of Asp279, Asn49, and Asp22, and one water

molecule. In the �-agarase (�-AgaB) of Z. galactetanivorans

Dsij, the Ca2+ was positioned in the same locations in a

pentahedral manner to the backbone carbonyl oxygen atom of

Asn83, Gly127, and Asp343, a carboxylate oxygen of Asp343, and

one water molecule (1). Interestingly, in AG52, the Ca2+

binding residues were located at the same positions at Gln47,

Gly91 and Asp282, however, the precise geometrical

arrangement of Ca2+ binding needs to be investigated in future.

In addition, analysis of the amino acid sequence for agaA

confirms the evidence that the Asp, which is responsible for

side-chain interaction with Ca2+, is conserved among the GHF-

16 family members (1). Moreover, among the metal ions,

which are mainly present in seawater (Na+, Mg2+, K+ and Ca2+),

K+ shows considerable effect on rAgaA activity, suggesting

that the red algae is originating from the marine environment.

It is possible that the reason that Zn2+ has an inhibitory effect

on rAgaA might be the structural alteration of the enzyme due

to the affinity of the heavy metals for the SH, CO and NH

moieties of the amino acids in the protein.

In conclusion, a marine bacterium Pseudoalteromonas sp.

was isolated from red algae in the Jeju island (Korea) coastal

environment. AgaA features homologous catalytic domains

belonging to the GHF-16 family, and has characteristic

properties indicating neoagarooligosaccharide production. Due

to the reported functional properties of the

neoagarooligosaccharides (25) when obtained from agar, the

purified r rAgaA enzyme has potential for usage in industries

for the production of pharmaceuticals and cosmetics. To

further advance the research, the crystal structure and three-

dimensional structure analyses need to be carried out in order

to understand the mechanism of the catalysis of rAgaA in

detail, and thereby investigate the structure-function

relationships of the protein. Since no primary structural and

functional characteristics have been reported for Aeromonas �-

agarases to date, the current investigation will be useful for

studying the structure, function and evolution of Aeromonas �-

agarase as well.

ACKNOWLEDGEMENTS

This research was financially supported by the Ministry of

Education, Science Technology (MEST) and Korea Industrial

Technology Foundation (KOTEF) through the Human

Resource Training Project for Regional Innovation, and by a

research grant (PE98472) from Korea Ocean Research &

Development Institute.

REFERENCES

1. Allouch, J.; Jam, M.; Helbert, W.; Barbeyron ,T.; Kloareg, B.; Henrissat,

B.; Czjzek, M. (2003). The three-dimensional structures of two beta

agarases. J. Biol. Chem. 278, 47171-47180.

2. Aoki, T.; Araki, T.; Kitamikado, M. (1990). Purification and

characterization of a novel beta-agarase from Vibrio sp. AP-2. Eur. J.

Biochem. 187, 461-465.

3. Araki, C. (1959). Seaweed polysaccharides. In: Wolfrom ML (ed.),

Carbohydrate chemistry of substances of biological interests. Pergamon

Press, London, pp 15-30.

4. Araki, C. (1966). Some recent studies on the polysaccharide of

agarophytes. In: Young EG, Maclachan JL (ed.), Proceedings

International seaweed symposium. 5, 1965. Pergamon Press, London, pp

3-17.

5. Araki, C.; Arai, K. (1967). Studies on the chemical constitution of Agar-

agar. XXIV. Isolation of a new disaccharide as a reversion product from

acidic hydrolysate. Bull. Chem. Societ. Japan. 40, 1452-1456.

6. Araki, T.; Lu, Z.; Morishita, T. (1998). Optimization of parameters for

isolation of protoplasts from Gracilaria verrucosa (Rhodophyta). J. Mar.

888


Biotechnol. 6, 193-197.

7. Barbeyron, T.; Gerard, A., Potin, P.; Henrissat, B.; Kloareg, B. (1998).

The kappa-carrageenase of the marine bacterium Cytophaga

drobachiensis. Structural and phylogenetic relationships within family 16

glycoside hydrolases. Mol. Biol. Evol. 15, 528-537.

8. Beg, Q.K.; Gupta, R. (2003). Purification and characterization of an

oxidation-stable. Thiol depedent serine alkaline protease from Bacillus

mojavensis. Enzyme Microb. Technol. 32, 294-304.

9. Chen, H.M.; Zheng, L.; Yan, X. J. (2005). The preparation and

bioactivity research of agaro-oligosaccharides. Food Technol. Biotechnol.

43, 29-36.

10. Davies, G.; Henrissat, B. (1995). Structures and mechanisms of glycosyl

hydrolases. Structure. 15; 3(9), 853–859.

11. Duckworth, M.; Turvey, J. R. (1969). The action of a bacterial agarase on

agarose, porphyran and alkali treated porphyran. Biochem. J. 113, 687-

692.

12. Duckworth, M.; Yaphe, W. (1971). Structure of agar. I. Fractionation of

complex mixture of polysaccharides. Carbohydr. Res. 16,189-197.

13. Ekborg, N.A.; Taylor, L.E.; Longmire, A.G.; Henrissat, B.; Weiner, R.

M.; Hutcheson, S.W. (2006). Genomic and proteomic analyses of the

agarolytic system expressed by Saccharophagus degradans 2-40. Appl.

Environ. Microbiol. 72, 3396-3405.

14. Fu, W.; Han, B.; Duan, D., Liu, W., Wang, C. (2008a). Purification and

characterization of agarases from a marine bacterium Vibrio sp. F-6. J.

Indust. Microbiol. Biotechnol. 35, 915-922.

15. Fu, X.T.; Lin, H.; Kim, S.M. (2008b). Purification and characterization of

a novel beta-agarase, AgaA34, from Agarivorans albus YKW-34. Appl.

Microbiol. Biotechnol. 78, 265-273.

16. Groleau, D.; Yaphe, W. (1977). Enzymatic hydrolysis of agar:

purification and characterization of beta-neoagarotetraose hydrolase from

Pseudomonas atlantica. Can. J. Microbiol. 23, 672-679.

17. Ha, J.C.; Kim, J.T.; Kim, S.K.; Oh, T.K.; Yu, J.H; Kong, I.S. (1997).

Beta agarase from Pseudomonas sp. W7: purification of the recombinant

enzyme from Escherichia coli and the effects of salt on its activity.

Biotechnol. Appl. Biochem. 26,1-6.

18. Haddar, A.; Bougatef, A.; Agrebi, R.; Sellami-Kamoun, A.; Nasri, M.

(2009). A novel surfactant-stable alkaline serine protease from a newly

isolated Bacillus mojavensis A21. Purification and characterization.

Process. Biochem. 44, 29-35.

19. Hassairi, I.; Ben, A.R.; Nonus, M.; Gupta, B.B. (2001). Production and

separation of alpha-agarase from Altermonas agarlyticus strain GJ1B.

Biores. Technol. 79, 47-51.

20. Hu, Z.; Lin, B.K.; Xu, Y.; Zhong, M.Q.; Liu, G.M. (2009). Production

and purification of agarase from a marine agarolytic bacterium

Agarivorans sp. HZ105. J. Appl. Microb. 106, 181-190.

21. Jacobs, M.; Elkiasson, M.; Uhlen, M.; Flock, J.I. (1985). Cloning,

sequencing and expression of subtilisin carlsberg from Bacillus

licheniformis. Nucleic Acids Res. 13, 8913-8927.

22. Jam, M.; Flament, D.; Allouch, J.; Potin, P.; Thion, L.; Kloareg, B.;

Czjzek, M.; Helbert, W.; Michel, G.; Barbeyron. T. (2005). The endo-

beta-agarases AgaA and AgaB from the marine bacterium Zobellia

galactanivorans: two paralogue enzymes with different molecular

organizations and catalytic behaviours. Biochem. J. 385, 703-713.

23. Kendall, K.; Cullum, J. (1984). Cloning and expression of an

extracellular-agarase from Streptomyces coelicolor A3(2) in

Streptomyces lividans 66, Gene 29, 315-321.

24. Kirimura, K.; Masuda, N.; Iwasaki, Y.; Nakagawa, H.; Kobayashi, R.;

Usami. S. (1999). Purification and characterization of a novel beta

agarase from an alkalophilic bacterium, Alteromonas sp. E-1. J. Biosci.

Bioeng. 87, 436-441.

25. Kobayashi, R., Takisada, M., Suzuki, T., Kirimura, K.; Usami, S. (1997).

Neoagarobiose as a novel moisturizer with whitening effect. Biosci.

Biotechnol. Biochem. 61, 162-163.

26. Lee, S.; Jang, D. J. (2001). Progressive rearrangement of subtilisin

Carlsberg into orderly and inflexible conformation with Ca2+ binding.

Byophys. J. 81, 2972-2978.

27. Lee, S.; Park, J.; Yoon, S.; Kim, J.; Kong, I. (2000). Sequence analysis of

a beta-agarase gene (pjaA) from Pseudomonas sp. isolated from marine

environment. J. Biosci. Bioeng. 89, 485-488.

28. Lee, D.G.; Park, G.T.; Kim, N.Y.; Lee, E.J.; Jang, M.K.; Shin, Y.G.;

Park, G.S.; Kim, T.M.; Lee, J.W.; Lee, J.H.; Kim, S.J.; Lee, S.H. (2006).

Cloning, expression, and characterization of a glycoside hydrolase family

50 beta-agarase from a marine Agarivorans isolate. Biotechnol. Lett.

28,1925-1932.

29. Leon, O.; Quintana, L.; Peruzzo, G.; Slebe, J.C. (1992). Purification and

properties of an extracellular agarase from Alteromonas sp. strain C-1.

Appl. Environ. Microb. 58, 4060-4063.

30. Ma, C.; Lu, X.; Shi, C.; Shi, C.; Li, J.; Gu, Y.; Ma, Y.; Chu, Y.; Han, F.;

Gong, Q. (2007). Molecular cloning and characterization of a novel beta-

agarase, AgaB, from marine Pseudoalteromonas sp. CY24. J. Biol.

Chem. 282, 3747-3754.

31. Michel, G.; Chantalat, L.; Duee, E.; Barbeyron, T.; Henrissat, B.;

Kloareg, B.; Dideberg, O. (2001). The kappa-carrageenase of

Pseudoalteromonas carrageenovora features a tunnel-shaped active site:

a novel insight in the evolution of clan-B glycoside hydrolases Structure.

9, 513-525.

32. Miller, G.L. (1959). Use of dinitrosalicylic acid reagent for determination

of reducing sugar. Anal. Chem. 31,426-428.

33. Morrice, L. M.; McLean, M.W.; Williamson, F.B.; Long, W.F. (1983).

Beta-agarases I and II from Pseudomonas atlantica. Purifications and

some properties. Eur. J. Biochem. 135, 553-558.

34. Ohta, Y.; Hatada, Y.; Ito, S.; Horikoshi, K. (2005). High-level expression

of a neoagarobiose-producing beta-agarase gene from Agarivorans sp.

JAMB-A11 in Bacillus subtilis and enzymic properties of the

recombinant enzyme. Biotechnol. Appl. Biochem. 41,183-191.

35. Ohta, Y.; Hatada, Y.; Nogi, Y.; Li, Z.; Ito, S.; Horikoshi, K. (2004a).

Cloning, expression, and characterization of a glycoside hydrolase family

86 beta agarase from a deep-sea Microbulbifer-like isolate. Appl. Microb.

889


Biotechnol. 66, 266-275.

36. Ohta, Y.; Hatada, Y.; Nogi, Y.; Miyazaki, M.; Li, Z.; Akita, M.; Hidaka,

Y.; Goda, S.; Ito, S.; Horikoshi, K. (2004b). Enzymatic properties and

nucleotide and amino acid sequences of a thermostable beta-agarase from

a novel species of deep-sea Microbulbifer. Appl. Microb. Biotechnol. 64,

505-514.

37. Ohta, Y.; Hatada, Y.; Nogi, Y.; Miyazaki, M.; Li, Z.; Hatada, Y.; Ito, S.;

Horikoshi, K. (2004c). Enzymatic properties and nucleotide and amino

acid sequences of a thermostable beta agarase from the novel marine

isolate, JAMB-A94. Biosci. Biotechnol. Biochem. 68 (5), 1073-1081.

38. Pearson, W.R. (1990). Rapid and Sensitive Sequence Comparison with

FASTP and FASTA. Methods Enzymol. 183, 63-98.

39. Potin, P.; Richard, C.; Rochas, C.; Kloareg, B. (1993). Purification and

characterization of the alpha-agarase from Alteromonas agarlyticus

(Cataldi) comb. nov., strain GJ1B. Eur. J. Biochem. 214, 599-607.

40. Pugsley, A.P. (1993). The complete general secretory pathway in gram

negative bacteria. Microb. Rev. 57, 50-108.

41. Ryu, S.K.; Cho, S.J.; Park, S.R.; Lim, W.J.; Kim, M.K.; Hong, S.Y.;

Baed, W.; Park, Y.W.; Kim, B.K.; Kim, H.; Yun, H.D. (2001). Cloning

of the cel9A gene and characterization of its gene product from marine

bacterium Pseudomonas sp. SK38. Appl. Microb. Biotechnol. 57, 138-

145.

42. Sambrook, J.; Fritsch, E.F.; Maniatis. T. (1989). Molecular cloning: a

laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring

Harbor, N.Y.

43. Schroeder, D.C.; Jaffer, M.A.; Coyne, V.E. (2003). Investigation of the

role of a beta (1-4) agarase produced by Pseudoalteromonas gracilis B9

in eliciting disease symptoms in the red alga Gracilaria gracilis.

Microbiol. 149, 2919-2929.

44. Sugano, Y.; Kodama, H.; Terada, I.; Yamazaki, Y.; Noma, M. (1994).

Purification and characterization of a novel enzyme, �-

neoagarooligosaccharide hydrolase (�-NAOS hydrolase), from a marine

bacterium, Vibrio sp. strain JT0107. J. Bacteriol. 176, 6812-6818.

45. Sugano, Y.; Terada, I.; Arita, M.; Noma, M.; Matsumoto, T. (1993).

Purification and characterization of a new agarase from a marine

bacterium, Vibrio sp. strain JT0107. Appl. Environ. Microbiol. 59, 1549-

1554.

46. Suzuki, H.; Sawai, Y.; Suzuki, T.; Kawai, K. (2003). Purification and

characterization of an extracellular beta agarase from Bacillus sp. MK03.

J. Biosci. Bioeng. 93, 456-463.

47. Van der Meulen, H.J.; Harder, W. (1975). Production and

characterization of the agarase of Cytoplaga flevensis. Antonie van

Leeuwenhoek. 41, 431-447.

48. Vera, J.; Alvarez, R.; Murano, E.; Slebe, J.C.; Leon, O. (1998).

Identification of a marine agarolytic Pseudoalteromonas isolate and

characterization of its extra cellular agarase. Appl. Environ. Microbiol.

64, 4378-4383.

49. Wang, J.; Mou, H.; Jiang, X.; Guan, H. (2006). Characterization of a

novel beta-agarase from marine Alteromonas sp. SY37-12 and its

degrading products. Appl. Microbiol. Biotechnol. 71, 833-839.

50. Zhang, W.W.; Sun, L. (2007). Cloning, characterization, and molecular

application of a beta-agarase gene from Vibrio sp. strain V134. Appl.

Environ. Microbiol. 73, 2825-2831.

Documents

MOLECULAR CLONING, CHARACTERIZATION AND ENZYMATIC ... · MOLECULAR CLONING, CHARACTERIZATION AND ENZYMATIC PROPERTIES OF A NOVEL ETA-AGARASE FROM A MARINE ISOLATE PSUDOALTEROMONAS