Upload
others
View
4
Download
0
Embed Size (px)
Citation preview
MOLECULAR CHARACTERIZATION OF NEWCASTLE DISEASE VIRUS ISOLATES
A Thesis
Submitted to Bangladesh Agricultural University, Mymensingh
In partial Fulfillment of the Requirements for the Degree of
Master of Science in
Pathology
By
Mohammed Nooruzzaman
Roll No.: 10Vet Path JJ 09 M Registration No.: 31009, Session: 2004-05
Department of Pathology
Bangladesh Agricultural University Mymensingh
May, 2011
MOLECULAR CHARACTERIZATION OF NEWCASTLE DISEASE VIRUS ISOLATES
A Thesis
Submitted to Bangladesh Agricultural University, Mymensingh
In partial Fulfillment of the Requirements for the Degree of
Master of Science in
Pathology
By
Mohammed Nooruzzaman
Approved as to style and contents by
Prof. Dr. Emdadul Haque Chowdhury Prof. Dr. Md. Rafiqul Islam Co-Supervisor Supervisor
Prof. Dr. Md. Rafiqul Islam Chairman, BOS & Head Department of Pathology
May, 2011
DEDICATED TO MY BELOVED PARENTS AND ALL OF MY TEACHERS
iii
ACKNOWLEDGEMENTS
I am very grateful to the Almighty Allah without His grace I would have never been able to pursue my research work and to prepare this manuscript.
It is difficult to overstate my gratitude to my research supervisor, Professor Dr. Md. Rafiqul Islam, Head, Department of Pathology, Bangladesh Agricultural University, Mymensingh because his enthusiasm, his inspiration, and his great efforts to explain things clearly and simply, he helped me to make this research possible. Throughout my thesis-writing period, he provided me encouragement, sound advice, good teaching, good company, and lots of good ideas.
I would like to express my deepest gratitude to my research co-supervisor, Professor Dr. Emdadul Haque Chowdhury, for his excellent guidance, caring, patience, and providing with an excellent atmosphere for doing research.
I am greatly indebted to all my teachers and colleagues Prof. Dr. Md. Iqbal Hossain, Prof. Dr. Md. Abdul Baki, Prof. Priya Mohan Das, Prof. Dr. A.S.M. Bari, Prof. Dr. Md. Mokbul Hossain, Prof. Dr. Md. Habibur Rahman, Prof. Dr. Abu Hadi Noor Ali Khan, Assistant Professor Dr. Roksana Parvin, Lecturer Dr. Jahan Ara Begum, and Dr. Munmun Pervin, Department of Pathology, Bangladesh Agricultural University, Mymensingh, for their contributions and supports throughout my academic career.
I am grateful to Dr. Enamul Haque, Dr. Mushfiqur Rahman, Dr. Abu Sufian, Dr. Ataur Rahman, Dr. Shamim, Dr. Jakir Dr. Reema Dr. Tulu and other PhD students, Department of Pathology, for their guidance and encouragement during my research period.
I would like to acknowledge and extend my heartfelt gratitude to my friends Urmi, Tusar, Rajib, Fauzia, Wakadur, Arun, MS students, Department of Pathology, Bangladesh Agricultural University, Mymensingh for their cooperation during my research period.
Lastly, and most importantly, I wish to thank my beloved parents, brothers and sisters as they raised me, supported me, taught me, and loved me.
The Author
June, 2011
iv
LIST OF CONTENTS PAGE
ACKNOWLEDGEMENT iii
ABBREVIATION viii
ABSTRACT x
CHAPTER I INTRODUCTION 1-2
CHAPTER II REVIEW OF LITERATURE 3-24
2.1 Newcastle disease 3
2.1.1 History 3
2.1.2 Epidemiology 3
2.1.3 Clinical signs and pathology 6
2.2 Newcastle disease virus 9
2.2.1 Taxonomy and physic-chemical properties 9
2.2.2 Biological properties 10
2.2.3 Structure and molecular biology 10
2.3 Virus isolation and characterization 11
2.3.1 Virus isolation and identification 11
2.3.2 Antigenic, pathogenic and molecular characterization
12
2.4 Vaccination 23
CHAPTER III MATERIALS AND METHODS 25-33
3.1 Materials 25
3.1.1 Equipment 25
3.1.2 Plasticware and other consumable 25
3.1.3 Software 25
3.1.4 Virus isolates 25
3.1.5 Primers 26
3.1.6 DNA size marker 26
3.1.7 Kits 27
3.1.8 Solution, buffer and chemicals 27
3.1.8.1 Electrophoresis buffers and reagents 27
3.1.8.2 Cycle sequencing chemicals 27
3.2 Methods 28
3.2.1 Cleaning and sterilization 28
v
LIST OF CONTENTS (Contd.) PAGE
3.2.2 Molecular detection 28
3.2.2.1 Viral RNA extraction 28
3.2.2.2 RT-PCR 29
3.2.2.3 Analysis of PCR products by Agarose gel electrophoresis
30
3.2.3 Molecular characterization 30
3.2.3.1 Purification of PCR products 30
3.2.3.2 Quantification of DNA 31
3.2.3.3 Gene sequencing 31
3.2.3.4 Analysis of nucleotide and deduced amino acid sequences
31
3.2.3.5 Phylogenetic analysis 32
CHAPTER IV RESULTS 34-42
4.1 RT-PCR 34
4.2 Nucleotide sequencing and blast search 34
4.3 Multiple alignment of nucleotide sequences and phylogenetic analysis
36
4.4 Alignment of predicted amino acid sequences 39
4.5 Analysis of the fusion protein cleavage site 41
CHAPTER V DISCUSSION AND CONCLUSION 43-45
REFERENCES 46-69
vi
LIST OF TABLES
TABLES PAGE
1 Primers and probes used in Newcastle disease virus detection and differentiation
14
2 Primers used in this study 26
3 The sequences of NDV isolates used in this study 32
4 Results of nucleotide blast search for BD-C162/10 sequence similarity in the GenBank 35
5 Results of nucleotide blast search for BD-P01/10 sequence similarity in the GenBank 35
6 Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different genotypes of Newcastle disease viruses
37
7 Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different sub-genotypes under the NDV genotype VII
38
8 NDV isolates analyzed in this study showing fusion protein cleavage site 42
vii
LIST OF FIGURES
FIGURES PAGE
1 DNA size marker (100 bp) 26
2 Amplification of F gene fragment (766 bp) by RT-PCR. 34
3 Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to different genotypes
36
4 Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to VII sub-genotypes
38
5 Amino acid residue substitution of F gene for NDV strains of different genotypes
40
6 Amino acid residue substitution of F gene for different NDV strains of subgenotype VII (VIIa-VIIe)
41
viii
LIST OF ABBREVIATIONS AND SYMBOLS
APMV Avian Paramyxovirus
BBS Bangladesh Bureau of Statistics
bp Base pair
CNS Central Nervous System
DNA Deoxyribonucleic acid
et al. And others
F Fusion
Fig. Figure
gm Gram
HA Hemagglutination
HI Hemagglutination Inhibition
HN Hemagglutinin-Neuraminidase
ICDDR, B International Centre for Diarrheal Disease Research, Bangladesh
ICPI Intracerebral Pathogenicity Index
IVPI Intravenous Pathogenicity Index
kbp Kilobase pair
MDT Mean Death Time
min Minute
ml Milliliter
MS Master of Science
ix
ND Newcastle disease
NDV Newcastle disease virus
nm Nanometer
nt Nucleotide
OIE Office des International Epizootic
PCR Polymerase chain reaction
pmol picomole
RBC Red blood corpuscle
RNA Ribonucleic acid
rpm Rotation per minute
RRT-PCR Real-time reverse transcription-polymerase chain reaction
RT-PCR Reverse transcription-polymerase chain reaction
sec Second
SPF Specific pathogen free
TAE Tris Acetate EDTA
UV Ultra-Violate
% Percent
µg Microgram
µl Microliter
µM Micromole
ºC Degree Celsius
x
ABSTRACT Newcastle disease is a highly contagious avian viral disease caused by avian
paramyxovirus type-1. The objective of the study was to adopt a reverse-transcription
polymerase chain reaction (RT-PCR) for rapid detection and identification of Newcastle
disease virus (NDV) and molecular characterization of local NDV isolates. The RT-PCR
successfully amplified a 766 bp fragment covering a part of the matrix (M) protein and
fusion (F) protein genes from all five recent local field samples and a reference vaccine
virus. The nucleotide sequences of the RT-PCR product of a chicken and a pigeon isolate
were determined. The first 354bp of the coding region of the F gene and their deduced
amino acid sequences (residue 1-118) were compared with that of other NDV strains
retrieved from GenBank. Phylogenetic analysis showed that the chicken and pigeon
isolates belong to genotypes VIIb and genotype VI, respectively. Analysis of the deduced
amino acid sequence at F0 cleavage site revealed that both the isolates possess 112RRQKRF117 sequence indicative of velogenic pathotype. Future studies should focus on
in vitro and in vivo pathogenic and antigenic characterization of the Bangladeshi isolates.
1
CHAPTER I
INTRODUCTION
Livestock and poultry is an important sector in the economy of Bangladesh. Commercial
poultry farming has been growing during the last two decades and has now become one of the
most important agri-business in Bangladesh (Islam et al., 2008). The poultry in Bangladesh
includes mainly chickens, ducks and pigeons, which are kept in different production systems.
At present there are about 112.43 million chickens and 42.29 million ducks in our country
(BBS, 2009). There are about 21,712 layer farms and 40,323 broiler farms in Bangladesh
(DLS, 2008) and the investment in this sector is increasing day by day. The development of
poultry sector is seriously hampered by some infectious and non-infectious diseases.
Newcastle disease (ND), popularly known as Ranikhet disease, is one of the important
diseases affecting the commercial as well as backyard poultry worldwide causing significant
economic losses. ND is endemic in Bangladesh claiming significant mortality (Chowdhury et
al., 1982; Saha et al., 1998; Talha et al., 2001; Kafi et al., 2003; Barman et al., 2010).
Newcastle disease virus (NDV), also called Avian Paramyxovirus type 1 (APMV1), is an
enveloped, negative sense single-stranded RNA virus containing a genome of approximately
15 kb (Lamb and Kolakofsky, 1996). It affects almost all species of birds causing a highly
contagious and rapidly spreading disease with high morbidity and mortality and severe drop
in egg production. Signs of the disease usually vary in severity and lethality, but usually
include respiratory distress, diarrhea, circulatory disturbances and central nervous system
impairment (Alexander, 1997). ND has been classified as list-A disease by the World Animal
Health Organization (OIE) (Seal et al., 1995; Pedersen et al., 2004). Although numerous live
and inactivated vaccines have been developed to control the disease, the incidences of ND
outbreaks in commercial poultry have gradually increased since the 1990s (Alexander et al.,
1999).
For confirmation of ND, the OIE prescribes isolation of NDV in embryonated chicken eggs
and their identification using haemagglutination (HA) and hemagglutination inhibition (HI)
test with a NDV-monospecific antiserum (OIE, 2009). Reverse transcription-polymerase
2
chain reaction (RT-PCR) has been established to identify NDV (Jestin and Jestin, 1991;
Stäuber et al., 1995; Oberdörfer and Werner, 1996; Kant et al., 1997; Kou et al., 1999; Kho et
al., 2000, Gohm et al., 2000; Zhang et al., 2010).
The amino acid sequence at fusion protein cleavage site has been postulated as a major
determinant of NDV virulence (Millar et al., 1988). The virulent type of NDV has multiple
basic amino acid residues at F protein cleavage site which can be recognized by ubiquitous
host proteases (Seal et al., 1995; Marin et al., 1996; Gould et al., 2003).
The NDVs currently circulating worldwide exhibit multiple lineages (Alexander, 1988;
Chambers et al., 1986; Toyoda et al., 1987; Glickman et al., 1988; Millar et al., 1988; Yang et
al., 1999). Restriction fragment length polymorphism analysis and partial nucleotide sequence
of fusion gene reveal that NDV strains can be classified into ten genotypes (I to X), with
genotypes VI and VII being further divided into several subgenotypes (Ballagi-Pordany et al.,
1996; Lomniczi et al., 1998; Herczeg et al., 1999; Kwon et al., 2003 and Tsai et al., 2004).
Nothing is known about the genetic properties of NDVs circulating in Bangladesh.
In this context the present study was conducted with the following objectives:
1. Molecular detection of Newcastle disease virus by RT-PCR.
2. Molecular characterization of selected Bangladeshi isolates of Newcastle disease virus
based on analysis of the fusion protein gene sequence.
3
CHAPTER II
REVIEW OF LITERATURE
Newcastle disease (ND) is a viral disease of birds with wide range of clinical signs from
mild to severe. It has a worldwide distribution. Outbreaks of ND have a tremendous
impact on backyard and commercial poultry in developing countries, where this disease is
endemic. The disease is characterized by either gastrointestinal or respiratory or nervous
signs. Available literatures on ND are reviewed in this chapter.
2.1 Newcastle Disease
2.1.1 History
Newcastle disease is one of the most serious infectious diseases affecting birds,
particularly poultry, worldwide and has been the cause of serious economic losses
(Alexander, 1988; Aldous et al., 2003). Newcastle disease was the name given by Doyle to
a highly contagious viral infection of poultry, also known as fowl pest, which was first
reported on a farm near Newcastle upon Tyne, UK, in 1926 (Doyle, 1927). In India, an
outbreak of this disease as a new fowl disease was first recorded by Edwards (Edwards,
1928) in 1927 in the poultry farm at Ranikhet. Cooper worked on the disease (in
Mukteswar Laboratory, Kumaun) and confirmed that the causative agent was a filter
passing virus which was immunologically identical to Newcastle disease virus of England
and other countries (Cooper, 1931). He named the disease as “Ranikhet disease”. In the
USA, Newcastle disease was first identified in California by Beach (Beach, 1942) which
was known as pneumoencephalitis.
The causative agent of the disease in Newcaslte upon Tyne was identified as a virus that
was distinct from fowl plague (avian influenza virus), although the symptoms had some
similarity. Newly emerged ND then rapidly spread throughout the world (Emmerson,
1999; Csatary et al., 2000; Lorence et al., 2001).
2.1.2 Epidemiology
The distribution of ND is dependent on the attempts at eradication and control made in
different countries. Vaccination of poultry throughout the world makes assessment of the
geographical distribution of Newcastle disease difficult. Non pathogenic strains are found
in New Zealand, Papua New Guinea, Fiji and a number of pacific countries but they are
4
free from virulent strains (OIE, 2000). In 2002 outbreaks occurred in Australia and later
on Japan. ND is endemic in Bangladesh (Saha et al., 1998).
Velogenic Newcastle disease virus (NDV) or avian paramyxovirus 1 (APMV-1) is
endemic in Asia, the Middle East, Africa, Central and South America, and parts of
Mexico. Virulent strains are endemic in wild cormorants in the U.S. and Canada, but
commercial poultry are free of velogenic isolates. Lentogenic isolates are found in poultry
throughout the world, including the U.S. Mesogenic strains may also be found, but are less
common (OIE, 2009).
Newcastle disease virus has been isolated from a variety of species of free-living and
domestic birds. It is known to infect more than 250 species of birds in 27 orders; other
avian species may also be susceptible. Chickens are highly susceptible to NDV while
turkeys, pheasants, partridges, quail and guinea fowl are also variably susceptible (OIE
2009). Duck and geese are susceptible but severe disease is rare. Lee et al. (2009) reported
that lentogenic viruses from domestic or wild ducks have a potential to acquire virulence
by duck-to-chicken transmission in nature. Several outbreaks with neurologic signs of
NDV have been reported in pigeon (Tangredi, 1985; Barton et al., 1992). Some wild or
zoo birds like penguins, crows, sparrows, jungle fowls, kites and vultures can suffer and
spread the disease to poultry farms (Chauhan and Roy, 1996). Susceptibility to disease
varies widely in psittacine birds but they tend to carry velogenic species sub-clinically
(Roy et al., 1998). Outbreaks have been reported in ostriches (Jørgensen et al., 1998).
Wild bird species, especially aquatic birds, are considered to be more resistant to the
disease (Erickson et al., 1977 and Kaleta and Baldauf, 1998). However, several outbreaks
of ND with high mortality in Cormorants have been reported in Canada and United States
(Meteyer et al., 1997; Glaser et al., 1999; Kuiken et al., 1999).
NDV is a human pathogen. Reported infections have been non-life threatening and usually
persisting not more than a day or two (Chang, 1981). The most frequently reported and
best substantiated clinical signs in human infections have been eye infections, usually
consisting of unilateral or bilateral reddening, excessive lachrymation, edema of the
eyelids, conjunctivitis and sub-conjunctival hemorrhage. There is evidence that both
vaccinal and virulent (for poultry) strains of NDV may infect and cause clinical signs in
human. There is no evidence of human-to-human spread.
5
Newcastle disease virus is tumor selective and intrinsically oncolytic. Genetically
modified, recombinant NDV strains are cytotoxic to human tumor cell lines of ecto-, endo-
and mesodermal origin. Cytotoxicity against tumor cells is due to multiple caspase-
dependent pathways of apoptosis independent of interferon signaling competence. So, the
recombinant NDV could be developed as a cancer virotherapy agent, either alone or in
combination with therapeutic transgenes (Elankumaran et al., 2006).
The main routes of spread of NDV are respiratory and gastrointestinal tract. Ingestion of
feces is likely to be the main method of bird-to-bird spread for avirulent enteric NDV and
pigeon isolates (Alexander et al., 1984). Clothing, hair and footgear of people and
equipment such as crates, egg flats, feed sacks and vehicles undoubtedly act mechanical
vectors. In this way, vaccinating crews contributed to the spread of velogenic,
viscerotropic ND in California (Utterback and Schwartz, 1973). However virus survival in
the nature is important which is influenced by humidity, temperature, suspending agent
and exposure to light. As a result NDV may survive in contaminated uncleaned poultry
houses for up to 7 days in summer, as long as 14 days in spring and 30 days in winter (OIE
2009).
Live infected chickens are the most likely means of introduction of NDV into village
populations, and the live bird markets are probably the major source of infection
(Alexander 1988b; Martin, 1992; Nguyen, 1992). In many developing countries, farmers
may slaughter or try to sell their chickens when they show signs of disease.
Egg associated transmission of highly virulent isolates in chicken has been reported
(Lancaster and Alexander, 1975; Beard and Hanson, 1984) but this generally results in
death of the embryo before hatching. However, infected embryo may be hatched from
eggs infected with vaccinal or other lentogenic viruses that do not essentially cause the
death of embryo (French et al., 1967).
Introduction of Newcastle disease virus (NDV) into poultry from wild birds has been
documented extensively. Specially, the waterfowl is considered to be a natural reservoir of
potentially infectious agents and a source of pathogenic APMV1 (Alexander et al., 1992;
Collins et al., 1993; Gould et al., 2001). Other common reservoirs include Cormorant,
Shags, Psittacine, Pheasant, Guinea fowl, ostriches and emues (Blaxland, 1951; Seal,
1996; Jorgensen et al., 1998).
6
2.1.3 Clinical signs and pathology
The incubation period of ND after natural exposure has been reported to vary from 2-15
days or longer, with an average of 5-6 days. Clinical signs seen in birds infected with
NDV vary widely and are dependent on factors such as, the virus or pathotype, host
species, age of host, co-infection with other organisms, environmental stress and immune
status (Alexander, 2003; Farkas et al., 2009). Infection with NDV displays a complete
continuum from very rapid fatal disease to inapparent infection.
Initial clinical signs vary but include lethargy, inappetence, ruffled feathers, edema and
infection of conjunctiva. As the disease progresses birds may develop greenish or white
watery diarrhea, dyspnea and inflammation of the head and neck often with cyanotic
discoloration. In later stages of the disease neurologic signs may be manifested as tremors,
twisting, tonic or clonic spasms, wing or leg paresis or paralysis, torticollis and
occasionally aberrant circling (Okoye et al., 2000; Usman and Diarra, 2008; Barman et al.,
2010). Sharp drop in egg production are observed; eggs contain a watery albumin and
appear misshapen with abnormally colored, rough or thin shells. Birds that survive serious
infection may develop neurologic abnormalities and partial or complete cessation of egg
production (Alexander, 2003; OIE, 2009).
The clinical features in pigeons include nervous signs, diarrhea, periocular edema and
bilateral conjuctivitis. Walking on its hock, head tremors, drowsiness, incoordination,
torticollis and green, watery diarrhoea are common signs in pigeon (Kommers et al., 2002;
Abolink et al., 2008). However, clinical signs are less severe in turkey (Box et al., 1970).
In quail, loss of appetite, weakness and decrease in egg production, diarrhea and nervous
symptoms were the main clinical signs (Momayez et al., 2007).
Strains of NDV have been grouped into five pathotypes on the basis of the clinical signs
seen in infected chickens (Beard and Hanson, 1984). These are:
1. Viscerotropic velogenic: a highly pathogenic form in which hemorrhagic intestinal
lesions are frequently seen;
2. Neurotropic velogenic: a form that presents with high mortality, usually following
respiratory and nervous signs;
3. Mesogenic: a form that presents with respiratory signs, occasional nervous signs,
but low mortality;
7
4. Lentogenic or respiratory: a form that presents with mild or subclinical respiratory
infection;
5. Asymptomatic enteric: a form that usually consists of a subclinical enteric
infection.
Pathotype groupings are rarely clear-cut (Alexander and Allan, 1974) and even in
infections of specific pathogen free (SPF) birds, considerable overlapping may be seen. In
addition, exacerbation of the clinical signs induced by the milder strains may occur when
infections by other organisms are superimposed or when adverse environmental conditions
are present.
NDV has an affinity for erythrocytes allowing the virus to be widely distributed
throughout the host body. An increase of the number of various leukocyte subsets was
noticed in the respiratory tract and the Harderian gland, which favors the involvement of
the local cellular immunity in the defense against NDV infection (Kommers et al., 2002).
T-lymphocytes and macrophages may be involved to produce a range of cytokines with
antiviral activity and cytokines that stimulate B-lymphocyte to proliferate and differentiate
into antibody producing plasma cells (Al-Garib et al., 2003). Brown et al. (1999) found
that velogenic viscerotropic pathotypes of NDV caused acute systemic illness with
extensive necrosis of lymphoid areas in the spleen and intestine. Velogenic neurotropic
isolates caused central nervous system disease despite minimal amounts of viral nucleic
acid detected in neural tissue. Mesogenic and lentogenic pathotypes caused no overt
disease; however, viral nucleic acid was present in myocardium and air sac epithelium
following infection with these isolates. Compromise of air sac and myocardium may
predispose mesogenic and lentogenic infected chickens to secondary infection and/or
decreased meat and egg production. However, Lam and Vasconcelos (1994) reported that
NDV in addition to causing necrosis in chicken lymphocytes can induce apoptosis. In
birds with antibody, virus was most frequently isolated from proventriculus, caecal tonsil,
bursa and brain. In immune birds, although clinical signs are mild or absent, widespread
virus replication occur up to 19 day post challenge (Parede and Young, 1990).
The gross lesions and organs infected with NDV are dependent on strain and pathotype of
infecting virus, however significant gross lesions are usually found only in birds infected
with velogenic strains. Affected birds typically have hemorrhage in larynx, trachea, heart
and stomach (Jungherr, 1964; Wan et al., 1984). Although there is no pathognomonic
8
lesions but hemorrhage in proventriculus and caecal tonsil, button ulcers in intestine are
typical (Crawford, 1930; Jungherr, 1964; Mishra et al., 2000; Okoye et al., 2000).
Hemorrhage in the intestine of infected chickens has been used to distinguish velogenic
viscerotropic ND virus from non-velogenic ND virus (Hanson et al., 1973).
Generally, gross lesions are not observed in CNS of birds infected with NDV, regardless
of pathotype (McFerran et al., 1988). Air sacculitis may be present even after infection
with relatively mild strains and thickening of air sacs with catarrhal or caseous discharge
and congestion of lung is often observed (Beard and Hanson, 1984). There are also
lymphoid depletion and degeneration in the bursa of Fabricius, spleen and other lymphoid
organs (Mishra et al., 2000). Chickens and turkeys infected with velogenic virus in lay
show egg yolk in abdomen with flaccid, degenerated follicle as well as hemorrhage and
discoloration of reproductive tract. Similar lesions have been reported in geese, pheasant
and other species infected with virulent strains (OIE, 2009).
In pigeons, haemorrhages and congestion were observed in trachea, lungs, liver,
proventriculus and intestine after infection with NDV (Mushtaq et al., 2006). In quail,
hemorrhagic lesions of the intestinal tracts and proventriculus were found on gross
pathological investigations (Momayez et al., 2007).
The histopathology of NDV infection can be greatly affected by the phenomena as for
clinical signs and gross lesion. Congestion and hemorrhages in lung, trachea and
peritracheal tissues are found. There was rapid and progressive lymphoproliferative
hyperplasia in the gastrointestinal tract (Hamid et al., 1990), congested blood vessels,
hemorrhages and extensive hemosiderin pigment deposition in the lamina propria of
proventiculus and intestine (Kommers et al., 2002; Noor et al., 2005), extensive
degeneration, necrosis, and depletion of acinar cells in the pancreas. In liver hepatocytic
necrosis with thrombi in the sinusoids (Okoye et al., 2000) and generalized congestion was
found (Noor et al., 2005). There may be degenerative lesions in kidneys, myocardium and
liver. Necrosis, infiltration of heterophils and lymphoid cells, hyperblastic changes are
also observed in other organs (Jungherr and Terrell, 1946). Multifocal necrosis with
deposition of fibrin and apoptotic cell in spleen was observed by Kommers et al. (2002).
Intranuclear inclusions can be found in reticular cells of spleen and other organs (Dekock,
1954).
9
Brain showed the most remarkable histological findings. There may be non-purulent
suppurative encephalomyelitis, neuronal necrosis, gliosis, perivascular cuffing and
endothelial hyperplasia in cerebellum, cerebrum and other parts of central nervous systems
(Okoye et al., 2000; Noor et al., 2005; Nakamura et al., 2008; Adi et al., 2010).
2.2 Newcastle disease virus
Newcastle disease is caused by viruses in the serotype avian paramyxovirus type-1
(APMV-1). It was classified as list-A disease by the World Animal Health Organization
(OIE) (Seal et al., 1995; Pedersen et al., 2004).
2.2.1 Taxonomy and physico-chemical properties
Newcastle disease virus (NDV) is the sole member of APMV-1, and is classified in the
Avulavirus genus of the family Paramyxoviridae within the order Mononegavirales (Mayo
et al., 2002).
Virions are enveloped and this is derived from the modified cell membrane as the virus is
budded from the cell surface after capsid assembly in the cytoplasm (Melnick, 1982).
Virions are generally pleomorphic, rounded and 100 to 500 nm in diameter, having helical
capsid symmetry. The virion surface is covered with 8 nm projections (so-called “herring
bone” nucleocapsids) that may be released from disrupted particles (Alexander, 1997).
The infectivity of NDV may be destroyed by physical and chemical treatments such as
heat, radiation (including light and ultraviolet rays), oxidation process, pH effects and
various chemical compounds. The rate at which infectivity is destroyed depends on the
strain of virus, the length of time of exposure, the quantity of virus and the nature of
suspending medium and interaction between treatments. Doyle (1927) reported that the
effect of marked acidity and alkalinity on the NDV infectivity indicate greater resistance
to the H ion than the OH ions. The radiation inactivation of NDV infectivity at low
temperature was due to nucleic acid degeneration and at higher temperature to protein
denaturation (Digioia et al., 1970).
10
2.2.2 Biological properties
Several biologic activities are associated with paramyxovirus, which characterize the
group.
The ability of NDV to agglutinate red blood cells (RBCs) is due to binding of the
hemagglutinin-neuraminidase (HN) protein to receptors on the surface of RBCs. This
property and the specific inhibition of agglutination by antisera (Burnet, 1942; Beach,
1948) have been proven as powerful tools in the diagnosis of the disease. Chicken RBCs
are usually used in hemagglutination tests, but NDV will cause agglutination of all
amphibian, reptilian, and avian cells (Lancaster, 1966). Winslow et al. (1950) showed that
human, mouse and guinea pig RBCs were agglutinated by all NDV strains tested but the
ability to agglutinate cattle, goat, sheep, swine and horse cells varied with the strain of
NDV.
The enzyme neuraminidase (mucopolysaccharide N-acetyl neuraminyl hydrolase) is also a
part of HN molecule. This enzyme is responsible for the gradual elution of agglutinated
RBCs (Ackerman, 1964). NDV isolates can be broadly grouping as rapid or slow eluters
(Spalatin et al., 1970) based on the rate of elution of chicken RBCs. However, rapid
elutions occur in velogenic strain and slow in lentogenic strains (Asahara, 1978; Islam et
al., 1995).
2.2.3 Structure and Molecular biology
The genome of NDV is a single stranded negative-sense RNA consisting of 15,186
nucleotides (Krishnamurthy et al., 1997). The genome of NDV encodes for six structural
proteins. Three of them, the hemagglutinin-neuraminidase (HN), the fusion (F), and the
matrix (M) proteins, are related to the viral envelope. The remaining three proteins,
nucleoprotein (NP), the phosphoprotein (P), and the RNA polymerase (L), are related to
the genomic RNA (Chambers et al., 1986). The nucleocapsid protein (N) is responsible for
the protection of RNA from nuclear damage and the Phosphoprotein binds to the N and L
protein and forms part of the RNA polymerase complex. The matrix protein organizes and
maintains virion structure and the large protein is the catalytic subunit of RNA dependent
RNA polymerase. The HN glycoprotein is involved in attachment and release of virus and
the F glycoprotein mediates fusion of the viral envelope with cellular membranes. NDV
11
produces two additional proteins, V and W, from P gene by alternative mRNAs that are
generated by RNA editing (McGinnes et al., 1988; Samson et al., 1991; Jordan et al.,
2000). In NDV, insertion of one non-template G residue gives rise to a V encoding
mRNA, while insertion of two non template G residues generate a W encoding mRNA.
These V and W protein share their amino (N) terminal domains with P protein and vary in
their carboxy (C) termini. NDV V protein has a cysteine rich C terminal domain which
binds two atoms of Zn2+ (Steward et al., 1995). Of the three NDV P gene products the P
protein together with L protein, is known to form part of the virus RNA polymerase
complex (Lamb and Kolakofsky, 2001).
Coexpression of homologus attachment protein, hemagglutinin-neuraminidase (HN) is
required along with protease cleavage of precursor fusion protein for the activation of
NDV (Garten et al., 1980; Kathryn and Turdy, 2003). The efficiency of cleavage of fusion
protein plays an important role in the pathogenicity of NDV (Panda et al., 2004). Park et
al. (2003) stated that V protein affects the host range of the virus via its species-specific
IFN antagonist activity.
2.3 Virus Isolation and Characterization
2.3.1 Virus Isolation and identification
For confirmation of ND, the OIE standards Commission prescribes NDV isolation in
embryonated chicken eggs, and identification using hemagglutination (HA) and
hemagglutination inhibition (HI) test with a NDV-monospecific antiserum (OIE, 2009).
Other indirect methods like enzyme-linked immunosorbent assays (ELISA), virus culture,
virus (plaque) neutralization (VN), complement fixation (CFT) can be used.
Direct methods include virus isolation, electron microscopy and virus characterization.
Samples from dead birds should consist of oro-nasal swabs, as well as sample collected
from lungs, air sac, intestine (including contents), spleen, brain, liver and heart tissues
collected separately or as a pool and placed in phosphate buffer isotonic saline (7.0-7.4
containing antibiotic) (Alexander, 2000).
Although conventional diagnosis has proven adequate for the control of ND in the past, it
does present some problems. A reliable source of eggs and chickens, which should
preferably be from a specific pathogen free flock, is needed. Confirmed diagnosis may be
12
slow, taking several days to isolate the virus and carry out the pathogenicity test. It
assumes viruses always show their potential pathogenicity for chickens, which does not
always appear to be the case (Collins et al., 1994). Identification of the virus as NDV and
an estimate of its pathogenicity also give no information that would enable assessment of
the source of the virus and its spread. In addition, the use of animals in this way is
becoming increasingly unacceptable with the development of actual or potential
alternatives.
2.3.2 Antigenic, pathogenic and molecular characterization
Virus neutralization (VN) or agar gel diffusion techniques have shown minor antigenic
variation between different strains and isolates of NDV (Gomez-Lillo et al., 1974; Schloer
et al., 1975; Pennington, 1978). Monoclonal antibody technology provided a new
approach to antigenic differentiation of NDV strains and isolates (Russel and Alexander,
1983; Nishikawa et al., 1983; Srinivasappa et al., 1986). Monoclonal antibody may detect
slight variation in antigenicity, such as single amino acid changes at the epitope to which
the antibody is directed. As a result, they are capable of detecting differences not only
between strains but between sub-populations of virus (Hanson, 1988). Panels of mouse
monoclonal antibodies raised against NDV strains have been able to divide NDV isolates
sharing similar biological and epidemiological properties into same antigenic subgroups
(Russel and Alexander, 1983; Alexander et al., 1997).
Currently, one or more of three in vivo tests are used to characterize NDV and assess its
virulence. These include mean death time (MDT) in embryonated fowls’ eggs, the
intracerebral pathogenicity index (ICPI) in 1-day-old chicks and the intravenous
pathogenicity index (IVPI) in 6-week-old chickens (Alexander, 1988). There are three
pathotypes among the pathogenic strains which can be differentiated primarily on the basis
of the above tests. The time required for a minimum lethal dose (MDT) to kill the embryos
is >90 hours for lentogenic strains, 60-90 hours for mesogenic strains and <60 hours for
velogenic strains (Seal et al., 2000; Noor et al., 2005). The difference in
neuropathogenicity of the types is demonstrated by intracerebral inoculation of day old
chick. The pathogenicity of NDV is stronger when the ICPI value is close to 2 and weaker
when the ICPI value is close to 0. Generally speaking, strains with an ICPI value <0.5,
0.5–1.5, and >1.5 are considered as lentogenic, mesogenic, and velogenic, respectively
(Hanson, 1956; Alexander, 1998). The difference in lethality is determined by IVPI. The
13
values in the IVPI test range from 0 to 3.0; the IVPI for velogenic strain approach 3.0,
while lentogenic strains and some mesogenic strains have IVPI values of zero. However,
some viruses that can produce severe disease have IVPI values of zero; the ICPI test is
generally preferred for this reason (OIE, 2009).
Antigenic characterization and in vivo pathogenicity testing proved useful for rapidly
sorting viruses into broad groups but have failed to differentiate viruses that were
antigenically similar or of same pathotype, although not genetically identical. Since ND
viruses have an RNA genome, reverse transcription - polymerase chain reaction (RT-PCR)
Using a reverse transcriptase, the RNA genome is transcribed into a DNA copy, which can
be used as the template in PCR. Amplification of a specific gene region has been achieved
using (i) universal primers (Jestin and Jestin, 1991; Jestin and Cherbonnel, 1992; Gohm et
al., 2000); (ii) pathotype specific primers (Kant et al., 1997); or (iii) nested PCR (Jestin et
al., 1994; Kant et al., 1997; Kou et al., 1999; Kho et al., 2000, Zhang et al., 2010).
Further studies have been carried out using the generated PCR product, including:
• Restriction enzyme analysis (Wehmann et al., 1997; Ballagi Pordany et al., 1996; Kou
et al., 1999; Nanthakumar et al., 2000)
• Probe hybridization (Jarecki Black et al., 1992; Jarecki Black and King, 1993;
Radhavan et al., 1998; Oberdörfer and Werner, 1998; Aldous et al., 2001)
• Nucleotide sequencing for cleavage site analysis and epidemiological studies (Toyoda
et al., 1989; Collins et al., 1993, 1994; Staüber et al., 1995; Seal et al., 1995, 1998;
Marin et al., 1996; Heckert et al., 1996; King and Seal, 1997, Weingartl et al., 2003;
Liu et al., 2003; Lee et al., 2004; Pedersen et al., 2004; Tsai et al., 2004; Singh et al.,
2005; Kattenbelt et al., 2006; Perozo et al., 2006; Wang et al., 2006; Czeglédi et al.,
2006; Lien et al., 2007; Lee et al., 2009; Mase et al., 2009; Adi et al., 2010; Ke et al.,
2010; Krapež et al., 2010; Berhanu et al., 2010; Zhang et al., 2010; Hasan et al., 2010;
Liu et al., 2011; Mohamed et al., 2011)
Thus, RT-PCR has been used for the detection, identification and characterization of
NDV. The primers used in many of the published studies are listed in table 1.
14
Table 1: Primers and probes used in Newcastle disease virus detection and differentiation
Used in Gene Product size (bp)
Sequence (5’ to 3’) References
RT-PCR* F 238 CTTTGCTCACCCCCCTTGG CTTCCCAACTGCCACTGC
Jestin and Jestin, 1991
RT-PCR & sequencing
F 304 TACACCTCATCCCAGACAGG AGTCGGAGGATGTTGGCAGC
Collins et al., 1993
RT-PCR & Sequencing
F ~300 ATGCCCAAAGACAAAGAGCAA TACTGCTGTCGCTACACCTAA
RT-nPCR & Sequencing
F 175 ACACCTCATCCCAGACAG TCTTCCCAACTGCCACTG
Jestin et al., 1994
RT-nPCR & Sequencing
F CTTTGCTCACCCCCCTTGG GCATTTTGTTTGGCTTGTA
Sequencing F AAAGCCCCATTGGAAGCAT Collins et al., 1994
RT-PCR HN ATATCCCGCAGTCGCATAAC TTTTTCTTAATCAAG(TAG)GACT
Sequencing HN GCATTGCAGAAATATCCAATA
RT-PCR F 310 GGAGGATGTTGGCAGCATT GTCAACATATACACCTCATC
Stäuber et al., 1995
RT-PCR & Sequencing
F 254 CCTTGGTGAITCTATCCGIAG CTGCCACTGCTAGTTGIGATAATCC
Seal et al., 1995
M TCGAGICTGTACAATCTTGC GTCCGAGCACATCACTGAGC
RT-PCR F 254 CCTTGGTGAITCTATCCGIAGG CTGCCACTGCTAGTTGIGATATACC
Marin et al., 1996
RT-PCR & Sequencing
F 507 TTAGAAAAAACACGGGTAGAA AGTCGGAGGATGTTGGCAGC
Heckert et al., 1996
RT-PCR & Sequencing
F GCTTTATCTCCTGTTACCACAAT CAGAACACTGACCACTTTACTCAC
RT-PCR F 1349 TGACTCTATCCGTAGGATACAAGAGTCTG GATCTAGGGTATTATTCCCAAGCCA
Ballagi-Pordány et al., 1996
RT-PCR M 1097 TCTAGGACAATTGGGCTGTACTTTGATT AGAGACGCAGCTTATTTCTTAAAAGGATTG
Wehmann et al., 1997
15
Used in Gene Product size (bp)
Sequence (5’ to 3’) References
RT-hnPCR F 362(AB) 362(AB)
TTGATGGCAGGCCTCTTGC GGAGGATGTTGGCAGCATT
Kant et al., 1997
RT-hnPCR F 254 (AC) 254 (AD)
AGCGT(C/T)TCTGTCTCCT G(A/G)CG(A/T)CCCTGT(C/T)TCCC
Probe F Probe TACAACAGGACA(C/T)TGAC(C/T)AC-TTTGCTCACCCCCCTTGGTGA
Probe F Probe TATAACAGAACACTGACTACCTTGC-TCACTCCCCTTGGCGA
RT-PCR F 362 TTGATGGCAGGCCTCTTGC GGAGGATGTTGGCAGCATT
Oberdörfer & Werner, 1998
RT-PCR F 274 CTTTGCTCACCCCCCTTGG CTTCCCAACTGCCACTGC
Probe F Probe TCCACGCCTGGGGGAAGGAGACAGAAA
Probe F Probe TCCACATCAGGAGTAAGGAGGAAGAAG
Probe F Probe ACTACATCTGGAGGGGGGAGACAG-GGG
Sequencing F 778 GGGRAAGARAGTGACWTTTGACA TKGGATAAWCCRYYRGTGACCTC
Lomniczi et al., 1998
Sequencing F 557 CCYRAATCAYYRYGRYRCYRGATAA KCRGCRTTYTGKKTGGCTKGTAT
RT-PCR F 1349 CGATTCCATCCGCAAGATCCAAGGGT-CTG GATCTAGGGTATTATTCCCAAGCCA
Kou et al., 1999
RT-nPCR F GCCTTAACTCAGTTGACTATCCAGGC CAAGCAATAAATGCCCGG
Sequencing F ATATGGGCTCCGAACCTTCTACCAGGG TTTATACAGTCCAATTCTCGCGCCG
Sequencing F TAATACAAGCCAACCAGAATGCCGCC GCTCAAGCAGGAATAAATGCCCGG
Sequencing F GGGCACCTAAATAATATGCGTGCC TCGCTCTTTGGTTGCTTGTACCC
16
Used in Gene Product size (bp)
Sequence (5’ to 3’) References
RT-PCR F 356 GCAGCTGCAGGGATTGTGGT TCTTTGAGCAGGAGGATGTTG
Nanthakumar et al., 2000
RT-PCR F 216 CCCCGTTGGAGGCATAC TGTTGGCAGCATTTTGATTG
RT-nPCR PCR ELISA
F 532 TACACCTCATCCCAGACAGGGTC AGGCAGGGGAAGTGATTTGTGGC
Kho et al., 2000
RT-nPCR PCR ELISA
F 280 Ba-TACTTTGCTCACCCCCCTT Da-CATCTTCCCAACTGCCACT
RT-PCR F 182 CGIAGGATACAAGRGTCTG GCRGCAATGCTCTYTTTAAG
Gohm et al., 2000
RT-PCR F ~700 GACCGCTGACCACGAGGTTA GCAGCATTCTGGTTGGCTTGTATCA GGCAGCATTTTGTTTGGCTTGTATC
Aldous et al., 2001
Probe F AAGCGTTTCTGTCTCCTTCCTCCG
Probe F AGACGTCCCTGTTTCCCTCCTCC
Probe F AAACGTTTCTGTCTCCTTCCTCCGG
Probe F AAACGTCTCTGTCTCCTTCCTCCGG
Probe F AAGCGTTTCTGCCTCCCTCCTCC
Probe F CCTATAAGGCGCCCCTGTCTCCC
RT-PCR & Sequencing
F 750 TGTCGCAGTGACTGCTGACC GTCAGTGACCTCGTGCACAG
Weingartl et al., 2003
RT-PCR & Sequencing
F 970 GCCGAATTCCCGAATCATCACGACGCTTAA GTGAAGCTTGAGTCTGTGAGTCGTAC
Liu et al., 2003
F 839 CACCGGTACCCCTATTCTGATCGTTAAGCTTGTAGTGGCTCTCATCTGATC
RT-PCR & Sequencing
F 695 GCTGATCATGAGGTTACCTC AGTCGGAGGATGTTGGCAGC
Lee et al., 2004
RT-PCR & Sequencing
M &F 1195 TCGAGICTGTACAATCTTGC CTGCCACTGCTAGTTGIGATAATCC
Pedersen et al., 2004
17
Used in Gene Product size (bp)
Sequence (5’ to 3’) References
RT-PCR & Sequencing
F 305 TACACCTCATCCCAGACAGG AGTCGGAGGATGTTGGCAGC
Tsai et al., 2004
RT-PCR F 356 GCAGCTGCAGGGATTGTGGT TCTTTGAGCAGGAGGATGTTG
Singh et al., 2005
RT-nPCR F 216 CCCCGTTGGAGGCATAC TGTTGGCAGCATTTTGATTG
RT-PCR & Sequencing
HN 711 AGATGACAACATGTAGATG GGCTAACTGCGCGGTCCA
Kattenbelt et al., 2006
HN 652 TCACAACATCCGTTCTACCGCATC GAATGTGAGTGATCTCTGCA
HN 597 ATGAGTGCTACCCATTACTG ATAGATAAGATGGCCTGCTG
HN 799 CACAACATTATTCGGGGACTGG AGGGTATTGGATATTTCGGCAATGCT
HN 519 CATACACAACATCAACATG GGTAGCCCAGTTAATTTCCA
RT-PCR F 250 TGGTGAITCTATCCGIAGG CTGCCACTGCTAGTTGIGATAATCC
Perozo et al., 2006
RT-PCR & Sequencing
F 535 ATGGGCYCCAGAYCTTCTAC CTGCCACTGCTAGTTGTGATAATCC
Wang et al., 2006
RT-PCR & Sequencing
NP 1631 TATCTATCCAGGCTCAGRTATGGGTCACAG GACARAAGAGAGTTGCTTGCTCCGGTCTTG
Czeglédi et al., 2006
RT-PCR & Sequencing
F 534 ATGGGC(C/T)CCAGA(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC
Lien et al., 2007
RT-PCR & Sequencing
M &F 695 GCT GAT CAT GAG GTT ACC TC AGT CGG AGG ATG TTG GCA GC
Lee et al., 2009
RT-PCR & Sequencing
F 765 TGGAGCCAAACCGCGCACCTGCGG GGAGGATGTTGGCAGCAT
Mase et al., 2009
RT-PCR & Sequencing
F 356 GCAGCTTGCAGGGATTGTGGT TCTTTGAGCAGGAGGATGTTG
Adi et al., 2010
18
Used in Gene Product size (bp)
Sequence (5’ to 3’) References
RT-PCR & Sequencing
F 535 ATGGGC(C/T)CCAGA(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC
Ke et al., 2010
HN 1922 TTCTATCACATCACCGACAACAAG GTGGGCGGGACTCAGAATAATCAT
RT-PCR & Sequencing
F 454 TGCATCTTCCCAACTGCCACT TTGAYGGCAGRCCTCTTGC
Krapež et al., 2010
RT-PCR & Sequencing
F 535 ATGGGC(C/T)CCAGA(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC
Berhanu et al., 2010
HN 320 ATATCCCGCAGTCGCATAAC TTTTTCTTAATCAAGTGACT
Semi nested RT-PCR for Pathotyping
F 301 TAYACCTCRTCYCAGACW(T GGAGGATGTTGGCAGCATT
Zhang et al., 2010
F 206 TAYACCTCRTCYCAGACW(T AYRGCGCCTATAAASCGTYT
RT-PCR & Sequencing
M&F 1180 CTGTACAATCTTGCGCTCAATGTC CTGCCACTGCTAGTTGTGATAATCC
Hasan et al., 2010
Multiplex RT-PCR
F 433 ATGGATCCCAAGCCTTCTAC TGGCTTGTATGAGGGCAGAA
Liu et al., 2011
F 535 ATGGGCYCCAGAC(C/T)CTTCTAC CTGCCACTGCTAGTTGTGATAATCC
RT-PCR & Sequencing
F 1792 F: ACGGGTAGAAGATTCTG F: GTTGACTAAGTTAGGTG R: CTCTCCGAATTGACAGAC
Mohamed et al., 2011
(Modified and expanded after Adous and Alexander, 2001). *RT-PCR, Reverse transcription polymerase chain reaction; ELISA, Enzyme-linked immunosorbent assay; n, nested; hn, heminested; HN, hemagglutinin-neuraminidase protein; F, fusion protein; M, matrix protein; aB, Biotin label; D, Digoxin label.
Jestin and Jestin (1991) developed first RT-PCR for the identification of NDV. The author
amplified a 238 bp of fusion protein gene using a universal primer which was confirmed
by restriction enzyme digestion. The viruses were propagated in embryonated eggs and the
infective allantoic fluid was used for RNA extraction. The reaction was thought to be
highly specific as there was no reaction with other avian viruses.
19
Later in 2000, NDV was detected directly from infected tissues and feces samples using
RT-PCR rather than egg-grown virus samples and also described a time-course study to
determine the sensitivity of their technique (Gohm et al., 2000). A 182 bp region of the F
gene including the cleavage site was amplified using universal primers. The author also
mentioned the potential of this system for the study of epidemiology in the sampling of
wild bird population.
A molecular test must be simpler, more reliable, rapid test and combined with maximum
operator safety. Kho et al. (2000) mentioned a RT-nested PCR enzyme-linked
immunosorbent assay technique for the rapid and sensitive detection of NDV using a
colorometric detection system rather than electrophoresis thus avoiding the more
hazardous aspect of ethidium bromide during post PCR analysis. They also claimed the
nested PCR to be 100-fold more sensitive than standard PCR.
Recently, Singh et al. (2005) amplified a portion (356bp) of the F gene by RT-PCR from
infected tissues, allantoic fluid as well as vaccine strains. The author also used a nested
RT-PCR for the amplification of a 216 bp of F gene.
A multiplex RT-PCR was developed for the detection and differentiation of class I and
class II strains of NDV (Liu et al., 2011). The author used two specific primer pair for
class I and class II isolates and amplified products of 433bp and 535bp of the F gene
respectively. These results were compared with those obtained by nucleotide sequencing
and phylogenetic analysis and found to be consistent.
FTA filter paper has been used for NDV sampling and inactivation, followed by RT-PCR,
for molecular detection and phylogenetic analysis of NDVs (Perozo et al., 2006).
Although the molecular basis of NDV pathogenicity relies on multiple genes, the amino
acid sequence motif at the cleavage site of the precursor F-glycoprotein is the critical site
for major changes in virulence (Glickman et al., 1988; Peeters et al., 1999; Romer-
Oberdorfer et al., 2003). Indeed, it is widely accepted that its genetic analysis can be used
as a clear predictor of the pathogenicity potential of an NDV isolate (Toyoda et al., 1987;
Gould et al., 2003). Mutational analysis has shown that the fusion peptide and the adjacent
heptad repeat region play a role in the fusion activity of F protein (Sergel-Germano et al.,
1994).The protein is synthesized as precursor molecule (F0), which must be proteolytically
cleaved, producing two disulfide-linked amino-terminal F2 and carboxyl-terminal F1
20
polypeptides (Scheid et. al., 1974 Nagai et al., 1976). The new amino terminus of F1 is
extremely hydrophobic and functions as the insertion peptide, promoting fusion of the
viral and cellular envelopes (Richardson et al., 1980). This cleavage is required for
initiation of infection and is considered to be a major determinant of NDV virulence.
The amino acid sequence at the cleavage site determines viral susceptibility to cleavage.
The velogenic viruses had the motif 112R/K-R-Q-K/R-R116 at the C terminus of the F2
protein and a phenylalanine at residue 117 located at the N terminus of the F1 protein. In
contrast, virus of low virulence had sequences in the same region of 112G/E-K/R-Q-G/E-
R116 at the C terminus of the F2 protein and a leucine at residue 117 (Collins et al., 1993)
and require trypsin-like enzymes for cleavage. These viruses therefore appear to be
restricted to grow in the respiratory and intestinal tracts (Fujii et al., 1999). Some of the
pigeon variant viruses (PPMV–1) examined had the sequence 112G-R-Q-K-R-F117 but
gave high intracerebral pathogenicity index (ICPI) values (Collins et al., 1993, 1994;
Jestin & Cherbonnel, 1992). Thus, there appears to be the requirement of at least a pair of
basic amino acids (arginine, R, or lysine, K) at residues 116 and 115, a phenylalanine at
residue 117 and a basic amino acid (R) at 113 for the virus to show high virulence for
chickens.
The OIE definition for reporting an outbreak of ND is:
‘Newcastle disease is defined as an infection of birds caused by a virus of avian
paramyxovirus serotype 1 (APMV-1) that meets one of the following criteria for
virulence:
a. The virus has an intracerebral pathogenicity index (ICPI) in day-old chicks (Gallus
gallus) of 0.7 or greater.
Or
b. Multiple basic amino acids have been demonstrated in the virus (either directly or
by deduction) at the C-terminus of the F2 protein and phenylalanine at residue 117,
which is the N-terminus of the F1 protein. The term ‘multiple basic amino acids’
refers to at least three arginine or lysine residues between residues 113 and 116.
Failure to demonstrate the characteristic pattern of amino acid residues as
described above would require characterization of the isolated virus by an ICPI
test.’
21
In this definition, amino acid residues are numbered from the N-terminus of the amino
acid sequence deduced from the nucleotide sequence of the F0 gene, 113–116 corresponds
to residues –4 to –1 from the cleavage site.’
Only NDV possessing additional basic amino acids at the cleavage site of the fusion
protein are rendered infectious by nontrypsine like protease. Rott (1985), therefore,
suggested that the ability of NDV isolates to form plaques in cell culture systems in the
absence of trypsin represents a simple in vitro method for the detection of virulent viruses.
Other techniques for pathotyping NDV include PCR amplification of pathotype-specific
sized bands (Kant et al., 1997) or analyzing PCR products using a specific probe, either
radiolabelled (Jarecki-Black and King, 1993) or tagged with digoxygenin (Oberdorfer and
Werner, 1998). Hybridization of PCR fragments with fluorogenic probes specific for
pathotype allowed an estimation of pathogenicity of Newcastle disease virus (NDV)
isolates using a modified TaqMan procedure (Aldous et al., 2001).
Recently, approaches using new methods or chemistry have focused intensively on
reliable pathotyping of APMV-1 (Pham et al., 2005; Wang et al., 2008; Farkas et al., 2009;
Fuller et al., 2009; Tan et al., 2009). The most widely used diagnostic method by far is the
USDA-validated real-time reverse transcription polymerase chain reaction (RRT-PCR)
method described by Wise et al. (2004) using robust TaqMan technology. Steyer et al.
(2010) developed RRT-PCR detection assays using minor groove-binding (MGB) probes
for successful detection and simultaneous prediction of a broad range of APMV-1
pathotypes, including pigeon strains. RRT-PCR methods provide high sensitivity and
opportunity for quantitative measurements. By omitting post-PCR steps, the risk of cross-
contamination and the time and material needed to make a diagnosis can be reduced
(Beläk and Thore, 2004).
Analysis of nucleotide sequences has allowed differentiation of even extremely closely
related viruses resulting in important epidemiological evidence of virus origin (Alexander
et al., 1999). Nucleotide sequencing, after RT-PCR and phylogenetic analysis, has been
used by a number of authors to assess genetic differences and genotypes of ND viruses
(Toyoda et al., 1989; Collins et al., 1993, 1994; Stauber et al., 1995; Seal et al., 1995,
1998; Marin et al., 1996; Heckert et al., 1996; King & Seal, 1997, Weingartl et al., 2003;
Liu et al., 2003; Lee et al., 2004; Pedersen et al., 2004; Tsai et al., 2004; Singh et al.,
22
2005; Kattenbelt et al., 2006; Perozo et al., 2006; Wang et al., 2006; Czeglédi et al., 2006;
Lien et al., 2007; Lee et al., 2009; Mase et al., 2009; Adi et al., 2010; Ke et al., 2010;
Krapež et al., 2010; Berhanu et al., 2010; Zhang et al., 2010; Hasan et al., 2010; Liu et al.,
2011; Mohamed et al., 2011. It has been established that sequences of as little as 250 base
pairs give meaningful phylogenetic analyses, comparable with those obtained with much
longer sequences (Seal et al., 1995; Lomniczi et al., 1998).
To date, phylogenetic analysis based on the genomic sequences have revealed that the
strains of NDV could be divided into 2 distinct clades, class I and class II, and class I
contains 9 genotype (1-9) and class II contains ten genotypes (I-X) with genetic groups VI
and VII being further divided into several sub-genotypes (Ballagi-Pordany et al., 1996;
Lomniczi et al., 1998; Herczeg et al., 1999; Kwon et al., 2003; Liu et al., 2003; Gould et
al., 2003; Tsai et al., 2004; Kim et al., 2007a, b). Class II viruses were responsible for all
four panzootics of ND from the 1920s to the present. In particular, viruses in this class of
genotype VII are the main pathogens that have resulted in most outbreaks of ND in recent
years throughout the world (Liu et al., 2007; Miller et al., 2009, 2010). Most of the class I
isolates have been obtained from waterfowl, shorebirds or poultry in live bird markets
(LBMs) in Asia or America (Kim et al., 2007a,b; Lee et al., 2009; Jindal et al., 2009; Liu
et al., 2009, 2010; Hu et al., 2010). Almost all of the class I NDV isolates collected have
been shown to be lentogenic strains, with the exception of only one isolate, -IECK90187,
which was obtained from domestic poultry and was responsible for sporadic outbreaks of
ND in Ireland during 1990 (Alexander et al., 1992). However, the lentogenic viruses have
the potential to move from low virulence to virulence by mutation in susceptible domestic
poultry (Shengqing et al., 2002).
Four main global streams of infection have been recognized in the history of ND
panzootics in chickens and other bird species (Alexander, 1988; Alexander and Senne,
2008). The first recorded panzootic started in the Southeast Asia in the mid-1920s and it
took about 30 years to spread throughout the world. At least three genotypes (II, III, and
IV) were involved in the first panzootic (Yu et al., 2001). A second panzootic is
recognized to have started in the Middle East in the 1960s and to have spread to most
countries by the early 1970s. This panzootic prompted the development of improved
vaccines and vaccination protocols that combined with implementation of sanitary
measures brought the disease under control in North America and in some European
23
countries. In the larger part of the world, however, especially where rural chicken breeding
is dominant, ND had become endemic. Monoclonal antibody analysis established a close
relationship of NDV strains of the second panzootic with isolates from imported
psittacines (Russell and Alexander, 1983). This was later confirmed by genetic analysis of
the fusion (F) protein gene and the classification of these isolates as genotype V (Ballagi-
Pordany et al., 1996; Lomniczi et al., 1998).
The start and spread of the third panzootic are unclear. Use of improved vaccines had
resulted in improved disease control, but vaccination did not prevent infection and the
transmission of virus from infected vaccinates. Subsequent characterization of those NDV
isolates recovered after the second panzootic revealed further genetic variation. The
presence of genotype VII was identified in Taiwan and Indonesia in the 1980s (Lomniczi
et al., 1998; Yu et al., 2001). The presence of isolates of genotype VIIb in southern Africa
and their involvement in the NDV outbreaks of the 1990s was first described by Herczeg
et al. (1999). The occurrence of other isolates characterized as subtypes of genotype VII
have also been reported: VIIa in the Far East and Europe (Yang et al., 1999; Liang et al.,
2002); VIIb in the Far East, Middle East, Europe (Jogersen et al., 1998; Alexander et al.,
1999 and Wehmann et al., 2003), India, and Southern Africa (Herczeg et al., 2001;
Abolink et al., 2004); VIIc in the Far East and Europe; and VIId in the Far East and South
Africa (Yu et al., 2001; Abolink et al., 2004). The fourth panzootic is attributed to a NDV
variant that infects primarily pigeons and doves (Aldous et al., 2004) and is now
characterized as genotype VI (Ballagi-Pordany et al., 1996; Lomniczi et al., 1998). The
variant virus was first identified in isolates recovered in the Middle East in the late 1970s,
spread to Europe in the 1980s, and was responsible for outbreaks in unvaccinated chickens
infected from feed contaminated by infected pigeons in Great Britain during the mid-
1980s. Although the timeframe overlaps the occurrence of the third panzootic, the variant
virus remains enzootic in pigeons and is a continuing threat to establish infections in
poultry.
2.4 Vaccination
Vaccination against ND should result in immunity against infection and replication of the
virus (Alexander, 1997). Vaccination will protect birds from the more serious
consequences of NDV infection since clinical signs are greatly diminished in relation to
antibody level achieved. However virulent ND strains may still infect, replicate, and be
24
excreted from vaccinated birds. Virulent NDV may also be present in the tissues and
organs of vaccinated and apparently healthy birds. NDV vaccines are either live or
inactivated. Live vaccines are either lentogenic or mesogenic. Three lentogenic strains like
B1, F and LaSota are used in very young chicks without affecting the host. Mesogenic
strains are used in growing and adult birds.
Inactivated vaccines are usually produced from infected allantoic fluid treated with beta-
propiolactone or formalin to kill the virus and then mixed with a carrier adjuvant. Various
seed viruses used in the production of the oil-emulsion vaccines include Ulster 2C, B1,
LaSota, Roakin and also several virulent viruses. One or more other antigens (such as
Infectious Bronchitis Virus, Infectious Bursal Disease Virus) may be incorporated into the
emulsion with NDV (Alexander, 1997).
25
CHAPTER III
MATERIALS AND METHODS
The research work was performed in the Department of Pathology, Bangladesh
Agricultural University, Mymensingh.
3.1 Materials
3.1.1 Equipment
Balance, pH meter, refrigerators, freezers, bench top autoclave, Class II biosafety
cabinet, vortexer, thermomixer, ice box, micropipettes, centrifuge, thermocycler,
gel-electrophoresis apparatus with power supply, gel-documentation system,
spectrophotometer, etc.
3.1.2 Plasticware and other consumables
Pipette tips, Falcon tubes (50 ml and 15 ml), Cryovials (2 ml), Eppendorf tubes (1.5 ml),
PCR tubes (0.2 ml), parafilm, aluminum foil, etc.
3.1.3 Software
The EditSeq, MegAlign modules of “Lasergene” software (DNASTAR Inc., USA) was
used for editing, alignment and analysis of gene sequences. The program “Adobe
Photoshop” software was used for image processing.
3.1.4 Virus isolates
Five isolates of Newcastle disease virus (NDV) isolated earlier from field cases in the
Department of Pathology, BAU (Mazumder, 2010) were used in this study. Four isolates
(BD-C21/10, BD-C50/10, BD-C161/10, BD-C162/10) were obtained from chickens while
one isolate (BD-P01/10) was obtained from a pigeon. All samples had been propagated in
the allantoic sacs of 9-day-old embryonated chicken eggs and identity of the virus
confirmed by hemagglutination (HA) and hemagglutination-inhibition (HI) assays
(Mazumder, 2010). A NDV vaccine virus obtained from the Livestock Rersearch Institute
26
of the Department of Livestock Services (hereafter coded as BD-Vac01) was used as a
positive reference virus.
3.1.5 Primers
The primers used in this study (Table 2) were selected from published literature (Mase et
al., 2009). These primers amplify a 766 bp fragment containing a part (3' end) of the
matrix protein gene and a part (5' end) of the fusion protein gene. The primers were
synthesized commercially.
Table 2: Primers used in this study
Primers Sequences bp Position*
NDV-F2 5’-TGGAGCCAAACCGCGCACCTGCGG-3’ 24 4241-4264
NDV-R2 5’- GGAGGATGTTGGCAGCAT-3’ 18 5006-4989
*Nucleotide numbering is according to the complete genome sequence of LaSota/46
strain (Accession No. AF077761; de Leeuw and Peeters, 1999)
3.1.6 DNA size marker
Promega* DNA Ladder Molecular Weight Markers (Fig. 1) was obtained commercially
(Promega, Madison, WI 53711 USA).
Fig.1: DNA size marker (100 bp)
27
3.1.7 Kits
The following kits are used in this study.
RNeasy mini Kit (RNA extraction kit) (Qiagen, Germany)
Qiagen one step RT–PCR kit (Qiagen, Germany)
EZ-10 Spin column PCR product purification kit (Bio Basic Inc., USA)
3.1.8 Solution, buffer and chemicals
3.1.8.1 Electrophoresis buffers and reagents
TAE buffer (50X)
Tris base 242.0 g
Glacial acetic acid 57.1 ml
0.5 M EDTA, pH 8.0 100.0 ml
Distilled water to make 1 liter
The above mixture was dissolved by stirring and stored at room temperature.
1X working solution was prepared by mixing 1 part stock buffer with 49 parts water.
Electrophoresis grade Agarose:
Obtained from Promega, Madison, WI 53711 USA
Loading dye
Ultra Pure Agarose Gel Loading Dye, Bio Basic Inc., USA
Ethidium bromide (10 mg/ml)
Obtained from Sigma, USA
3.1.8.2 Cycle sequencing chemicals
Terminator Ready Reaction Mix (Big Dye)
Provided by the sequencing lab (ICDDR, B, Dhaka, Bangladesh).
3M sodium acetate pH 4.6, 100ml
Sodium acetate (MW 82.03gm) 24.61gm
Distilled water 80 ml
Dissolved and pH adjusted with 3M Acetic acid solution. Finally the volume was adjusted
with distilled waster to make 100 ml.
28
3M Acetic acid solution, 10 ml
Glacial acetic acid 1.8 ml
Distilled water 8.2 ml
95% and 75% alcohol
Prepared with molecular biology grade absolute alcohol and nuclease free water.
3.2 Methods
3.2.1 Cleaning and sterilization
Glassware, forceps and mortar and pestle were soaked in a household dishwashing
detergent solution ("Trix", Reckitt and Benckeser Bangladesh Ltd.) for at least one hour.
Contaminated items were disinfected overnight in 2% sodium hypochloride solution prior
to immersing in detergent. The items soaked in detergent were cleaned by brushing,
washed thoroughly in running tap water and rinsed four times in distilled water. Finally
glassware, forceps and mortar and pestle were wrapped with brown paper and sterilized by
dry heat in a hot air oven at 160ºC for one hour. Glass bottles having plastic caps or rubber
seals and disposable plasticware (Eppendorf tubes, micropipette tips etc.) were sterilized
by autoclaving for 15 min. at 1210C under 15 lbs pressure per sq. inch. Autoclaved items
were dried in a hot air oven at 50°C. The graduated glass pipettes were taken in a large
cylinder filled with water, washed thoroughly by continuous filling and removal of water
from the cylinder, finally washed 4 times in the same manner using distilled water. The
pipettes were dried in an oven at 500C. The graduated pipettes were cotton plugged at the
neck, placed in a canister and sterilized by dry heat in a hot air oven at 160ºC for one hour.
3.2.2 Molecular detection
3.2.2.1 Viral RNA extraction
Viral RNA was extracted from infected allantoic fluid using RNeasy Kit (Qiagen,
Germany) as recommended by the manufacturer. In brief, 600 µl RLT buffer (10 µl 2-
mercaptoethanol added to 1 ml RLT buffer) and 100 µl virus suspension (allantoic fluid or
reconstituted vaccine) were taken in an Eppendorf tube, vortexed and incubated at room
temperature for 2 minutes. Then 700 µl of 70% ethanol was added to the supernatant and
mixed gently. 700 µl of mixture was transferred to an RNeasy spin column placed in a 2
29
ml collection tube. This was centrifuged at 10,000 rpm for 15 sec. The flow-through at the
collection tubes was discarded and the remaining 700µl of mixture was transferred to the
column and centrifuged again as above. After that 700µl of RW1 buffer was added to the
column, centrifuged as above and the flow-through was discarded. 500µl of RPE (to which
4 volumes ethanol had been added) was added to the spin column and centrifuged for 15
sec at 10,000 rpm and flow-through was removed. Again 500µl of RPE was taken in the
column and centrifuged for 2 min at 10,000 rpm. Then the spin column was placed in a 1.5
ml Eppendorf tube and 50 µl of RNAse free water was added to the column and
centrifuged for 2 min as above. The RNeasy spin column was discarded and the Eppendorf
tube containing RNA was labeled and stored at -20ºC or at -80ºC for short term and long
term storage, respectively.
3.2.2.2 RT-PCR
The RT-PCR was carried out using the Qiagen one step RT–PCR kit (Qiagen, Germany)
as recommended by the supplier with minor modification. The purified NDV genomic
RNA was used as the template.
The reaction was set up as follows:
Components Volume / Reaction Final Concentration
Mastermix
Nuclease-free water 11.5 µl -
5X Qiagen One Step RT-PCR buffer 5.0 µl 1x
dNTP Mix (containing 10 mM
of each dNTP)
1.0 µl 400 µM of each dNTP
Primer NDV F2 (Table 1) 0.5 µl 100 pmol
Primer NDV R2 (Table 1) 0.5 µl 100 pmol
Qiagen OneStep RT-PCR Enzyme Mix 1.0 µl -
RNasin® RNA inhibitor 0.5 µl 10 U /reaction
Total (Mastermix) 20 µl
Template RNA 5.0 µl
Total 25 µl
30
The RT-PCR reaction was performed in a thermocycler (Eppendorf Mastercycler). The
thermal profile was as follows: reverse transcription at 50ºC for 30 min; initial
denaturation and activation of Taq polymerase at 95ºC for 15 min; 30 cycles of the PCR
reactions each consisting of denaturation for 30 sec at 94ºC, annealing for 30 sec at 55ºC
and extension for 1 min at 72ºC; final elongation for10 min at 72ºC.
3.2.2.3 Analysis of PCR products by agarose gel electrophoresis
1.2% agarose gel (w/v) was prepared by dissolving agarose powder in 1x TAE Buffer. The
agarose was dissolved by heating in microwave oven. After that ethidium bromide was
added to the agarose solution @ 0.5µg/ml (5µl of stock/100 ml). The agarose solution
containing ethidium bromide was poured into the gel casting tray to which the comb was
properly positioned. When the gel was completely set, the comb was removed and the gel
was transferred into the electrophoresis tank which was filled with 1x TAE buffer.
An amount of 5 µl PCR product was mixed with DNA loading buffer (5 vol. PCR product
+ 1 vol. DNA loading buffer and loaded onto the slots of the gel. As a size standard, a 100
bp ladder was also loaded to one slot. Electrophoresis was run at 90 V for 30 min. After
the completion of electrophoresis the gel was placed on the UV transilluminator in the
dark chamber of the image viewing and documentation system. The result was viewed on
the monitor as well as saved electronically.
3.2.3 Molecular Characterization
The RT-PCR products were subjected to nucleotide sequencing, which involved the
following steps.
3.2.3.1 Purification of PCR products
PCR products were purified using EZ-10 Spin column PCR product purification kit (Bio
Basic Inc., USA). First the PCR reaction mixture was transferred to a 1.5 ml microfuge
tube and 3 volumes of the Binding Buffer I was added. Then the above mixture solution
was transferred to the EZ-10 column and incubated at room temperature for 2 minutes and
centrifuged at 10,000 rpm for 2 minutes. The flow-through in the tube was removed and
500 µl of Wash Solution was added to the column and centrifuged as above. The washing
step was repeated and spinned at 10,000 rpm for an additional minute to remove any
31
residual Wash Solution. The column was transferred into a clean microfuge tube and 30µl
of Elution Buffer was added into the center of the column and incubated at room
temperature for 2 minutes. The column was then centrifuged at 10,000 rpm for 2 minutes
to elute the DNA. Finally the purified DNA was stored at -20˚C.
3.2.3.2 Quantification of DNA
The purified RT-PCR products (cDNA) were quantified with an UV spectrophotometer
measuring the absorbance at 260nm weave length.
3.2.3.3 Gene sequencing
For sequencing the purified RT-PCR product was subjected to cycle sequencing with Big
Dye Terminator Ready Reaction kit. The concentrations of DNA were adjusted as per
recommendation of the kit. The reaction mixture (total vol. 20 µl) consisted of Terminator
Ready Reaction Mix (Big Dye) 4.0 µl, template (DNA) 1.0 µl, primer (forward or reverse
at conc. of 3.2 pmol/µl) 1.0 µl and deionized water 14.0 µl. The thermal cycling profile
was as follows: initial denaturation at 96°C for 1 minute followed by 25 cycles of
denaturation at 96°C for 10 seconds, annealing at 50°C for 5 seconds and elongation at
60°C for 4 minutes and finally, hold at 4°C.
The cycle sequencing reaction product was purified by ethanol precipitation. Briefly, 20.0
µl products were added to a 1.5 ml micro centrifuge tube containing 2.0 µl of 3M sodium
acetate, pH.4.6, and 50.0 µl 95% alcohol and mixed thoroughly. The tube was left for 1-2
hours at room temperature, and then centrifuged for 20 min at 14000 rpm. The supernatant
was carefully aspirated. The pellets were washed twice with 250 µl of 70% alcohol and
were recovered after spinning for 10 min; finally the pellets were left over night for drying
after covering the tube with parafilm containing a hole. The dried purified product was
sent to a sequencing laboratory at ICDDR, B, Dhaka for generation of sequence data after
capillary electrophoresis on a gene sequencing machine (Genetic Analyzer 3130).
3.2.3.4 Analysis of nucleotide and deduced amino acid sequences
The sequence data were compiled with the EditSeq Module of Lasergene DNASTAR
software (DNASTAR Inc. Madison, WI). Nucleotide and deduced amino acid sequences
of the F gene corresponding to the N terminus of the fusion protein (amino acid residues
32
1-118) of NDV were aligned using the Megalign Module of Lasergene DNASTAR
software (DNAstar Inc. Madison, WI).
3.2.3.5 Phylogenetic analysis
Phylogenetic analysis was performed with ClustalV and tree based on the nucleotide
sequences of 354 bp fragment (corresponding to the first 118 amino acid residues) of the
fusion protein gene were constructed by the neighbor-joining algorithm using MegAlign
Module of Lasergene DNASTAR software. The nucleotide sequence data of the fusion
protein gene used in this study (Table 3) were obtained from GenBank.
Table 3: The sequences of NDV isolates used in this study
NDV Isolates Country Host Geno-type
Patho-type
Accession no.
Reference
Ulster/67 Northern Ireland
CK* I L M24694 Toyoda et al., 1989
D26/76 Japan DK I L M24692 Toyoda et al., 1989
V4/66 Australia CK I L M24693 Toyoda et al., 1989
B1/47 USA CK II L M24695 Toyoda et al., 1989
BD-Vac01 Bangladesh CK II L
LaSota/46 USA CK II L AF077761 De Leeuw and Peeters, 1999
Texas GB/48 USA CK II V M23407 Schaper et al., 1988
Sato/30 Japan CK III V AB070382 Mase et al., 2002
Mukteswar India CK III V AF224505 Wehmann and Lomniczi, 2000
Miyadera/51 Japan CK III V M24701 Toyoda et al., 1987
Texas USA CK IV V M33855 Taylor et al., 1990
Herts/33 Great Britain
CK IV V M24702 Toyoda et al., 1989
CA1085/71 USA CK V V AF001106 Lomniczi et al., 1998
H-10/72 Hungary CK V V AF001107 Lomniczi et al., 1998
33
NDV Isolates Country Host Geno-type
Patho-type
Accession no.
Reference
A-24/96 Australia CK VI V AF001133 Lomniczi et al., 1998
IT-227/82 Hungary PG VI AJ880277 Ujvari, D., 2006
RI-3/88 Indonesia CK VIIa V AF001135 Lomniczi et al., 1998
E-1/93 Hungary CK VIIa V AF001126 Lomniczi et al., 1998
AE232/96 United Arab
Emirates
Partridge
VIIb V AF109884 Alexander et al., 1999
MZ-48/95 Mozam CK VIIb V AF136779 Herczeg et al., 1999
TW/84C Taiwan CK VIIc V AF083965 Yang et al., 1999
JS-2/98 China CK VIIc V AF458013 Liu et al., 2003
Ch/98-3 China CK VIId V AF364835 Yu et al., 2001
Kr/005/00 Korea CK VIId V AY630423 Lee et al., 2004
TW/2000 Taiwan CK VIIe V AF358786 Yu et al., 2001
TW/08-07 Taiwan CK VIIe V AB512616 Ke et al., 2010
SG-4H/65 South Africa
CK VIII V AF136762 Herczeg et al., 1999
AF2240/60 Malaysia CK VIII V AF048763 GenBank
F48E9/44 China CK IX V AY508514 Xu et al., 2003
FJ-1/85 China CK IX V AF458009 Liu et al., 2003
TW-C69-10-36 Taiwan CK X V AY372163 Tsai et al., 2004
DE-R49/99 Germany Duckling
Class I
A DQ097393 Czegledi et al., 2006
Alaska/415/91 Alaska Goose Class I
A AB524405 Tsunekuni et al., 2010
*CK = Chicken, DK = Duck, PG = Pigeon, V = Velogenic, L = Lentogenic, A =
Apathogenic
34
CHAPTER IV
RESULTS
4.1 RT-PCR
A fragment of the F gene of five Bangladeshi NDV isolates was amplified by RT-PCR using NDV-F2 and NDV-R2 primers with the expected band size of 766 bp (Fig. 2).
Fig.2: Amplification of F gene fragment (766 bp) by RT-PCR. M=Marker (100bp), NC= Negative Control, PC= Positive Control (BD-Vac01), 21=BD-C21/10, 50= BD-C50/10,
161=BD-C161/10, 162= BD-C162/10, Pigeon= BD-P01/10.
4.2 Nucleotide sequencing and blast search
The RT-PCR products of one selected chicken isolate (BD-C162/10), the pigeon isolate
(BD-P01/10) and the vaccine virus (BD-Vac01) were subjected to nucleotide sequencing.
The nucleotide sequence of (411-418) base pairs was successfully resolved for all the three
samples. The sequence of BD-C162/10 and BD-P01/10 were subjected to blast search in
the GenBank.
35
The results of the search revealed that the chicken isolate BD-C162/10 had close similarity
with the isolates from the Far East, Europe and South Africa with 91% to 92% and the
pigeon isolate BD-P01/10 had 92% to 95% identity with the isolates from different parts
of the world (Table 4 and 5).
Table 4: Results of nucleotide blast search for BD-C162/10 sequence similarity in the GenBank
Isolates GenBank Accession No.
Country of origin Identity with BD-C162/10
Niigata/89 AB070410 Japan 92% ZW 3422/95 AF109877 Zimbabwe 92% PTTY91146 AY175761 Portugal 92% AESCK90174 AY175652 Spain 92% 1ZAOS95044 AY175640 South Africa 92% IT-112/84 AF218127 Italy 92% ZA-33/94 AF136772 South Africa 92% ZA-26/93 AF136769 South Africa 92% IT-113/85 AF218128 Italy 91% ZA71/B/94 AF532751 South Africa 91%
Table 5: Results of nucleotide blast search for BD-P01/10 sequence similarity in the GenBank
Isolates GenBank Accession No.
Country of origin Identity with BD-P01/10
JAESA90099 AY135748 United Arab Emirates 95% JAEFA96038 AY175738 United Arab Emirates 95% Chiba/69 AB070387 Japan 93% BG-72/74 AF402116 Bulgaria 93% Narashio/68 AB070386 Japan 93% BG-99/82 AF402131 Bulgaria 92% Lebanon 70 AF001110 Lebanon 92% Kuwait 256 AF001109 Kuwait 92% Iraq AG68 AF001108 Iraq 92% ASTR/74 Y19012 Russia 92%
36
4.3 Multiple alignment of nucleotide sequences and phylogenetic analysis
The first 354 nucleotides of the coding region of F gene of BD-C162/10, BD-P01/10 and
BD-Vac01 were aligned with the corresponding region of the F gene of 22 NDV strains
belonging to 10 different genotypes, downloaded from the GenBank. A phylogenetic tree
was constructed (Fig. 3). In the phylogenetic tree, BD-C162/10 isolate clustered with the
strain under genotype VII. The pigeon isolate BD-P01/10 belonged to the genotype VI and
the vaccine strain BD-Vac01 to genotype II.
Fig. 3: Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to different genotypes. The analysis was based on the sequence of 354-bp fragment of the fusion protein gene. Bangladeshi isolates subjected to analysis were
highlighted with double asterisk (**).
37
Table 6 showed the distances in nucleotide sequences of fusion protein gene fragment of
25 strains/isolates belonging to all ten genotypes of NDVs. The nucleotide divergence
between the different genotypes varied from 6.6 – 24%. Within a genotype relatively
higher diversity in nucleotide sequence was notice in genotype VI (8.8-11.1%) and
genotype VII (5.5-11.5%).
The nucleotide sequence divergence between the Bangladeshi chicken isolate BD-C162/10
and pigeon isolate BD-P01/10 was 17.4%. The Bangladeshi vaccine virus (coded as BD-
Vac01) was 20.5% and 22.3% divergent from BD-C162/10 and BD-P01/10, respectively.
Table 6: Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different genotypes of Newcastle disease viruses
The viruses under the genotype VII are further subdivided into 5 sub-genotypes. The
sequence of Bangladeshi chicken isolate BD-C162/10 was aligned with the 10 sequences
representing all five sub-genotypes (VIIa-VIIe). The sequence of D26/76_I strain
(Genotype 1) was used as an outgroup. The results (Fig. 4) showed that BD-C162/10
isolate clustered with the strains belonging to sub-genotype VIIb, although it formed a
separate branch.
38
Fig. 4: Phylogenetic relationship of the Bangladeshi isolates of NDV with the strains belonging to VII sub-genotypes. The analysis was based on the sequence of 354-bp fragment of the fusion protein gene. Bangladeshi isolates subjected to analysis were
highlighted with double asterisk (**). D26/76_I strain was used as an out group.
The sequence distance table (Table 7) revealed that the nucleotide diversity between the
sub-genotypes of genotype VII varied from 2.9 - 15.1%. The Bangladeshi chicken isolate
BD-C162/10 was most closely related to strains belonging to sub-genotype VIIb, but the
nucleotide diversity was quite high (9.5 – 11.5%).
Table 7: Nucleotide sequence distance in the F gene (nt 1-354 of the coding region) among different sub-genotypes under the NDV genotype VII
39
4.4 Alignment of the predicted amino acid sequences
Amino acid residues were predicted from the nucleotide sequences and the resulting
deduced amino acid sequences, spanning from the position 1 to 118 in the fusion protein,
of all the 25 strains/isolates of different genotypes were aligned (Fig. 5). The N terminus
of the fusion protein from residues 1 to 30 appears to be a hypervariable region. The
Bangladeshi chicken isolate BD-C161/10 had unique amino acid substitutions at position
24 (S/G to I) and 43 (V to I). The pigeon isolate BD-P01/10 also possessed two unique
amino acid substitutions at position 8 (R/K/N to W) and 41 (G to E). The genotype II
viruses including Bangladeshi vaccine virus (coded as BD-Vac01) had five signatory
amino acid residues at position 13 (M), 22 (V), 32 (I), 69 (L) and 82 (D). The amino acid
residues at position 72, 78 and 79, suggested to be associated with a neutralizing epitope,
are identical among the two isolates and the vaccine virus from Bangladesh.
Deduced amino acid sequences of 10 strains representing 5 sub-genotypes of VII (VIIa-
VIIe) and the Bangladeshi chicken isolate BD-C162/10 were also aligned (Fig. 6). BD-
C162/10 possessed sub-genotype VIIb specific amino acid substitution (K to R) at position
101. However, BD-C162/10 isolate also had some unique amino acid substitutions at
position 13 (P), 19 (A), 24 (I), 29 (A) and 43 (I) which were different from all other strains
representing different sub-genotypes including VIIb.
40
Fig. 5: Amino acid residue substitution of F gene for NDV strains of different genotypes
41
Fig. 6: Amino acid residue substitution of F gene for different NDV strains of subgenotype
VII (VIIa-VIIe)
4.5 Analysis of the fusion protein cleavage site
The amino acid sequences of the fusion protein cleavage site (amino acid residue 112 to
118) of different strains belonging to different genotypes are shown in Table 8. Both the
Bangladeshi isolates from chicken (BD-C162/10) and pigeon (BD-P01/10) possessed the
same amino acid sequences 112R-R-Q-K-R-F117 at F0 cleavage site, which was identical to
the motif of velogenic type of NDV. On the other hand, the vaccine virus (coded as BD-
Vac01) had amino acid sequences 112G-R-Q-G-R-L117 at the F0 cleavage site representing
the motif of lentogenic type of NDV.
42
Table 8: NDV isolates analyzed in this study showing fusion protein cleavage site
NDV Isolates Country Host Genotype Cleavage sitea Ulster/67 Northern Ireland Chicken I GKQGRL D26/76 Japan Duck I GKQGRL V4/66 Australia Chicken I GKQGRL B1/47 USA Chicken II GRQGRL BD-Vac01 Bangladesh Chicken II GRQGRL LaSota/46 USA Chicken II GRQGRL Texas GB/48 USA Chicken II RRQKRF Sato/30 Japan Chicken III RRQRRF Mukteswar India Chicken III RRQRRF Miyadera/51 Japan Chicken III RRQRRF Texas USA Chicken IV RRQRRF Herts/33 Great Britain Chicken IV RRQRRF CA1085/71 USA Chicken V RRQKRF H-10/72 Hungary Chicken V RRQKRF A-24/96 Australia Chicken VI RRQKRF IT-227/82 Hungary Pigeon VI GRQKRF BD-P01/10 Bangladesh Pigeon VI RRQKRF AE232/96 United Arab Emirates Partridge VIIb KRQRRF BD-C162/10 Bangladesh Chicken VIIb RRQKRF MZ-48/95 Mozam Chicken VIIb RRQKRF RI-3/88 Indonesia Chicken VIIa RRQKRF E-1/93 Hungary Chicken VIIa RRQKRF TW/84C Taiwan Chicken VIIc RRQKRF JS-2/98 China Chicken VIIc RRQKRF Ch/98-3 China Chicken VIId RRQKRF Kr/005/00 Korea Chicken VIId RRQKRF TW/2000 Taiwan Chicken VIIe RRQKRF TW/08-07 Taiwan Chicken VIIe RRQKRF SG-4H/65 South Africa Chicken VIII RRQKRF AF2240/60 Malaysia Chicken VIII RRQKRF F48E9/44 China Chicken IX RRQRRF FJ-1/85 China Chicken IX RRQRRF TW-C69-10-36 Taiwan Chicken X RRQKRF DE-R49/99 Germany Duckling Class I GRQGRL Alaska/415/91 Alaska Goose Class I ERQERL
aAmino acid residues 112-117
43
CHAPTER V
DISCUSSION AND CONCLUSION
An RT-PCR protocol was adopted for molecular detection of NDV. A 766 bp fragment
covering a part of matrix protein and fusion protein genes was successfully amplified from
five local isolates of NDV (four from chickens and one from pigeon) and a reference
vaccine virus. Although virus isolation and serological identification followed by in vivo
pathogenicity testing still remains as the gold standard, RT-PCR offers a reliable tool for
quick detection of NDV. Moreover, RT-PCR products can be used for down steam
pathotypic and genetic analysis (Toyoda et al., 1989; Collins et al., 1993, 1994 and Seal et
al., 1995).
The RT-PCR product of a chicken isolate, the pigeon isolate and the vaccine virus was
subjected to nucleotide sequencing. Blast search, multiple alignment and phylogenetic
analysis of the nucleotide sequence of the first 354 bp from the coding region of F gene
and their deduced amino acid sequence (residues 1-118) revealed that the Bangladeshi
chicken isolate (BD-C162/10) and pigeon isolate (BD-P01/10) belong to genotype VII
(sub-genotype VIIb) and genetype VI, respectively, under the Class II NDV. It has been
established that sequence of as little as 250 base pairs give meaningful phylogenetic
analysis comparable with those obtained with much longer sequence (Seal et al., 1995;
Lomniczi et al., 1998). In this study a 354 base pairs genomic region (nt 1-354 of F gene)
was used for phylogenetic analysis. The topology of the constructed tree was consistent
with previous reports (Collins et al., 1996, Herczeg et al., 1999; Lomniczi et al., 1998 and
Seal et al., 1995). The world has experienced at least four panzootic of NDV infections.
Viruses belonging to genotypes II, III and IV were attributed to the first panzootic (Yu et
al., 2001) while genotype V to the second panzootic (Ballagi-Pordany et al., 1996;
Lomniczi et al., 1998). The viruses of genotype VII are responsible for the third panzootic
and have been causing most of the recent outbreaks (Liu et al., 2007; Miller et al., 2009,
2010). The fourth panzootic which overlapped the third one in terms of time frame is
being caused by genotype VI viruses that primarily infects pigeon and dove (Ballagi-
Pordany et al., 1996; Lomniczi et al., 1998; Aldous et al., 2004 ). The field virus isolates
from a chicken and a pigeon of Bangladesh, characterized in the present study, also belong to
44
genotype VII and genotype VI, respectively. On the other hand, the vaccine strain BD-Vac01
belonged to more classical genotype II viruses.
The amino acid sequence at fusion protein cleavage site has been postulated as a major
determinant of NDV virulence (Millar et al., 1988). Analysis of this cleavage site was used
for determining the pathogenicity of NDV instead of conventional method such as Mean
Death Time (MDT) and Intracerebral Pathogenicity Index (ICPI) tests (Seal et al., 1995;
Marin et al., 1996; Alexander, 1997; Gould et al., 2001). Fewer basic amino acids are
present in fusion protein cleavage site of lentogenic strain than that in the protein of either
mesogenic or velogenic NDV strains (Seal et al., 1995). Study revealed that the two local
isolates BD-C162/10 and BD-P01/10 maintained the common motif of 112RRQKRF117 at
fusion protein cleavage site which was consistent with the characteristics of velogenic
strain, indicating that they may be virulent strains. On the other hand, the Bangladeshi
vaccine isolate BD-Vac01 possessed 112GRQGRL117 motif at fusion protein cleavage site,
suggesting that it was a lantogenic strain. Although Collins et al., 1994 reported that 2 of
15 NDV isolates had the virulent motif of 112RRQKRF117 at F0 cleavage site but
pathogenicity index tests revealed that these isolates were of mesogenic and lentogenic
types. So, in vivo pathogenic characterization is required for the confirmation of the
virulence of the local isolates.
The five major epitopes on F protein of NDV were previously mapped (Toyoda et al.,
1988 and Yusoff et al., 1989). The stretch of amino acids from residues 157-171 and
individual residues 72, 78, 79 and 343 were critical for both the structures and functions of
these epitopes (Chen et al., 2001). Individual residues at positions 72, 78 and 79 were
conserved in the Bangladeshi NDV isolates along with most of the strains included in the
analysis. However, further cross protection test is necessary to check if any antigenic
variations exist between the chicken and pigeon isolates of Bangladesh.
In conclusion, NDV from allantoic fluid and the vaccine virus was successfully detected
by RT-PCR. The chicken and pigeon isolates of NDV from Bangladesh belonged to
genotype VIIb anf genotype VI. Deduced amino acid sequences at the F0 cleavage site
suggest that both the chicken and pigeon isolate of Bangladesh are of velogenic pathotype.
45
Further studies should focus on:
1. Pathogenic characterization of the Bangladeshi isolates based on mean embryo
death time and intracerebral pathogenicity index.
2. In vivo testing of the pigeon isolate for the pathogenicity for chickens.
3. Antigenic characterization of the chicken and pigeon isolates by cross-
neutralization test.
46
REFERENCES
Abolnik, C.; Gerdes, G. H.; Kitching, J.; Swanepoel, S.; Romito, M. and Bisschop, S. P.
R. (2008). Characterization of pigeon paramyxoviruses (Newcastle disease virus)
isolated in South Africa from 2001 to 2006. Onderstepoort Journal of Veterinary
Research, 75:147–152.
Abolnik, C.; Horner, R. F.; Bisschop, S. P. R.; Parker, M. E.; Romito, M. and Viljoen, G.
J. (2004). A phylogenetic study of South African Newcastle disease virus strains
isolated between 1990 and 2002 suggests epidemiological origins in the Far East.
Archive of Virology, 149: 603-619.
Ackerman, W. W. (1964). Cell surface phenomena of Newcastle disease virus. In: R.P.
Hanson (ed.). Newcastle disease virus an evolving pathogen. University of
Wisconsin Press, Medison. WI. pp. 153-166.
Adi, A. A.; Astawa, N. M.; Putra, K. S.; Hayashi, Y. and Matsumoto, Y. (2010). Isolation
and characterization of a pathogenic Newcastle disease virus from a natural case in
Indonesia. Journal of Veterinary Medical Science, 72: 313-319.
Aldous, E. W. and Alexander, D. J. (2001). Detection and differentiation of Newcastle
disease virus (avian paramyxovirus type 1). Avian Pathology, 30: 117-128.
Aldous, E. W.; Collins, M. S.; McGoldrick, A. and Alexander D. J. (2001). Rapid
pathotyping of Newcastle disease virus (NDV) using fluorogenic probes in a PCR
assay. Veterinary Microbiology, 80: 201-212.
Aldous, E. W.; Fuller, C. M.; Mynn, J. K. and Alexander, D. J. (2004). A molecular
epidemiological investigation of isolates of the variant avian paramyxovirus type 1
virus (PPMV-1) responsible for the 1978 to present panzootic in pigeons. Avian
Pathology, 33: 258-269.
Aldous, E. W.; Mynn, J. K.; Banks, J. and Alexander, D. J. (2003). A molecular
epidemiological study of avian paramyxovirus type 1 (Newcastle disease virus)
47
isolates by phylogenetic analysis of a partial nucleotide sequence of the fusion
protein gene. Avian Pathology, 32: 239-256.
Alexander D. J. and Allan W. H. (1974). Newcastle disease virus pathotypes. Avian
Pathology, 3: 269-278.
Alexander D. J.; Campbell, G.; Manvell, R. J; Collins, M. S.; Parsons, G. and McNulty,
M. S. (1992). Characterization of an antigenically unusual virus responsible for
two outbreaks of Newcastle disease in the Republic of Ireland in 1990. Veterinary
Record, 130: 65-68.
Alexander, D. J. (1988). Historical aspects, p. 1–10. In: D. J. Alexander (ed.), Newcastle
disease. Kluwer Academic Publishers, Boston, MA.
Alexander, D. J. (1988b). Newcastle disease diagnosis. In: Alexander, D. J. (Ed.),
Newcastle Disease. Kluwer Academic Publishers, Boston, 147-160.
Alexander, D. J. (1997). Newcastle disease and avian paramyxovirus infections. In:
Calnek, B. W.; Bernes, H. J.; Beard, C. W. and McDougald, L. R. (ed.), Disease of
poultry, 10th edition. Iowa State University Press, Ames. Pp. 541-569.
Alexander, D. J. (1998). Newcastle disease and other avian Paramyxovirus. In: A
laboratory manual for the isolation and identification of avian pathogens, 4th ed.
Swayne, D.; Glisson, J. R.; Jackwood, M. W.; Pearson, J. E. and Reed, W. M. eds.
American Association of Avian Pathologists, Kennett Square, PA. pp. 156-163.
Alexander, D. J. (2000). Newcastle disease and other avian paramyxoviruses. Review of
Science and Technology, 19: 443-462.
Alexander, D. J. (2003). Newcastle disease and other Paramyxoviridae infections. In:
Diseases of poultry, 11th ed. Saif, Y. M.; Barnes, H. J.; Glisson, J. R.; Fadly, A.
M.; McDougald, L. R. and Swayne, D. E. eds. Iowa State University Press, Ames,
IA. pp. 63-87.
48
Alexander, D. J. and Senne, D. A. (2008). In: Diseases of Poultry, ed. by. Saif, Y. M.;
Fadly, A. M.; Glisson, J. R.; McDougald, L. R.; Nolan, L. K.; Swayne, D. E.
Blackwell, Ames, pp. 75-100.
Alexander, D. J., Manvell, R. J., Lowings, P., Frost, K. M., Collins, M. S., Russell, P. and
Smith, J. (1997). Antigenic diversity and similarities detected in avian
paramyxovirus type 1 (Newcastle disease virus) isolates using monoclonal
antibodies. Avian Pathology, 26: 399-418.
Alexander, D. J.; Banks, J.; Collins, M. S.; Manvell, R. J.; Frost, K. M.; Speidel, E. C. and
Aldous, E. W. (1999). Antigenic and genetic characterization of Newcastle disease
viruses isolated from outbreaks in domestic fowl and turkeys in Great Britain
during 1997. Veterinary Record, 145: 417-421.
Alexander, D. J.; Pearson, G. and Marshall, R. (1984). Infection of fowl with Newcastle
disease virus by food contaminated with pigeon feces. Veterinary Record, 115:
601-602.
Al-Garib, S. O.; Gielkens, A. L. J.; Gryus, E. and Koch, G. (2003). Review of Newcastle
disease virus with particular reference to immunity and vaccination. World’s
Poultry Science Journal, 59: 185-200.
Asahara. (1978). Study on the virulence of Newcastle disease virus. Kitasato Archives of
Experimental Medicine, 51:15-29.
Ballagi-Pordany, A.; Wehmann, E.; Herczeg, J.; Belak, S. and Lomniczi, B. (1996).
Identification and grouping of Newcastle disease virus strains by restriction site
analysis of a region from the F gene. Archives of Virology, 141: 243-261.
Bangladesh Bureau of Statistics. (2009). Livestock and Poultry Survey - 2009. Planning
Division, Ministry of Planning. Government of the People’s Republic of
Bangladesh.
Barman, L. R.; Islam, M. N.; Flensburg, M. F.; Permin, A.; Petersen, S. L. and Islam, M.
R. (2010). Newcastle disease vaccination regimen comprising both Lentogenic and
49
Mesogenic strains is more effective than Lentogenic strain only. Bangladesh
Veterinary Journal, 27: 1-7.
Barton, J. T.; Bickford, A. A.; Cooper, G. L.; Charlton, B. R. and Cardona, C. J. (1992).
Avian paramyxovirus type 1 infections in racing pigeons in California. I. Clinical
signs, pathology and serology. Avian Diseases, 36: 463-468.
Beach, J. R. (1942). Avian Pneumoencephalitis. North American Veterinary Journal, 24:
288-292.
Beach, J. R. (1948). The application of hemagglutination inhibition test in the diagnosis of
avian pneumoencephalitis (Newcastle disease). Journal of American Veterinary
Medical Association, 112: 85-91.
Beard, C. W. and Hanson, R. P. (1984). Newcastle disease, In: Hofstad, M. S.; Barnes, H.
J.; Calnek, B. W.; Reid, W. M. and Yoder H. W. (ed.). Disease of poultry, 8th ed.
Iowa State University Press, Ames, IA, pp. 452-470.
Beläk, S. and Thorén, P. (2004). Validation and quality control of polymerase chain
reaction methods used for the diagnosis of infectious diseases, p. 30–36. In OIE
Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, 5th ed. Office
International des Epizooties, Paris, France.
Berhanu, A.; Ideris, A.; Omar, A. R. and Bejo, M. H. (2010). Molecular characterization
of partial fusion gene and C-terminus extension length of haemagglutinin-
neuraminidase gene of recently isolated Newcastle disease virus isolates in
Malaysia. Virology Journal, 7: 183, doi:10.1186/1743-422X-7-183.
Blaxland, J. D. (1951). Newcastle disease in shags and comorants and its significance as a
factor in the spread of this disease among domestic poultry. Veterinary Record, 63:
731-733.
Box, P. G.; Helliwell, B. I. and Halliwell, P. H. (1970). Newcastle disease in turkeys.
Veterinary Record, 86: 524-527.
50
Brown, C.; King, D. J. and Seal, B. S. (1999). Pathogenesis of Newcastle Disease in
Chickens Experimentally Infected with Viruses of Different Virulence. Veterinary
Pathology, 36: 125-132.
Burnet, F. M. (1942). The affinity of Newcastle disease virus to the influenza virus group.
Australian Journal of Experimental Biology and Medical Science, 20: 81-88.
Chambers, P.; Millar, N. S.; Bingham, R. W. and Emmerson, P. T. (1986). Molecular
cloning of complementary DNA to Newcastle disease virus, and nucleotide
sequence analysis of the junction between the genes encoding the haemagglutinin-
neuraminidase and the large protein. Journal of General Virology, 67: 475-486.
Chang, P. W. (1981). Newcastle disease. In: CRC Handbook Series in Zoonoses. Section
B: Viral Zoonoses Volume II, Beran, G. W. (ed.) CRC Press, Boca Raton, Florida,
USA, 261-274.
Chauhan, H. V. S. and Roy, S. (1996). Poultry Disease, Diagnosis and Treatment. 2nd ed.
New Age International (P) Limited Publishers, New Delhi. pp. 58-64.
Chen, L.; Gorman, J. J.; McKimm-Breschkin, J.; Lawrence, L. J.; Tulloch, P. A.; Smith,
B. J.; Colman, P. M. and Lawrence, M. C. (2001). The structure of the fusion
glycoprotein of Newcastle disease virus suggests a novel paradigm for the
molecular mechanism of membrane fusion. Structure, 9: 255-266.
Chowdhury, T. I. M. F. R.; Sarker, A. J.; Amin, M. M. and Hossain, W. I. M. A. (1982).
Studies on Newcastle disease in Bangladesh. A Research Report, Bangladesh
Agricultural University, Mymensingh, Bangladesh.
Collins, M. S.; Bashiruddin, J. B. and Alexander, D. J. (1993). Deduced amino acid
sequences at the fusion protein cleavage site of Newcastle disease virus showing
variation in antigenicity and pathogenicity. Archives of Virology, 128: 363-370.
Collins, M. S.; Strong, I. and Alexander, D. J. (1994). Evaluation of the molecular basis of
pathogenicity of the variant Newcastle disease viruses termed “pigeon PMV-1
viruses. Archives of Virology, 134: 403-411.
51
Collins, M. S.; Strong, I. and Alexander, D. J. (1996). Pathogenicity and phylogenetic
evaluation of the variant Newcastle disease viruses termed ‘pigeon PMV-1 viruses’
based on the nucleotide sequences of the fusion protein gene. Archives of Virology,
141: 635-647.
Cooper, H. (1931). Ranikhet disease: A new disease of fowl in India due to a filter passing
virus. Indian Journal of Veterinary Science and Animal Husbandry, 1: 107-123.
Crawford, M. (1930). Ranikhet disease. Annual Report of Government Veterinary
Surgeon, Colombo, Ceylon.
Csatary, L. K.; Csatary, E. and Moss R. W. (2000). Scientific interest in Newcastle disease
virus is reviving. Journal of National Cancer Institute, 92: 493-494.
Czeglédi, A.; Ujvári, D.; Somogyi, E.; Wehmann, E.; Werner, O. and Lomniczi, B.
(2006). Third genome size category of avian paramyxovirus serotype 1 (Newcastle
disease virus) and evolutionary implications. Virus Research, 120: 36-48.
de Leeuw, O. and Peeters, B. (1999). Complete nucleotide sequence of Newcastle disease
virus: evidence for the existence of a new genus within the subfamily
Paramyxovirinae. Journal of General Virology, 80: 131-136.
Dekock, G. (1954). Studies on the histological and pathogenesis of ND of fowls in South
Africa with special reference to the lymphoid tissue. Onderstepoort Journal of
Veterinary Research, 26: 599-620.
Department of livestock Services (DLS). (2008). Poultry sector review Bangladesh.
ftp://ftp.fao.org/docrep/fao/011/ai319e/ai319e00.pdf.
Digioia, G. A.; Licciardello, J. J.; Nickerson, J. J. R. and Goldblith, S. A. (1970). Thermal
inactivation of Newcastle disease virus. Applied Microbiology, 9: 451-454.
Doyle, T. M. (1927). A hitherto unrecorded disease of fowls due to a filter-passing virus.
Journal of Comparative Pathology and Theriogenology, 48: 1-20.
Edwards, J. T. (1928). A new fowl disease. Annual Report of Institute of Veterinary
Research, Mukteswar, pp. 15-15.
52
Elankumaran, S.; Rockemann, D. and Samal, S. K. (2006). Newcastle Disease Virus
Exerts Oncolysis by both Intrinsic and Extrinsic Caspase-Dependent Pathways of
Cell Death. Journal of Virology, 80: 7522-7534.
Emmerson, P. T. (1999). Newcastle disease virus (Paramyxoviridae); Virology and
Microbiology; Academic press. University of Newcastle upon Tyne, UK.
Erickson, G. A.; Mare´, C. J.; Gustafson, G. A.; Miller, L. D. and Carbrey, E. A. (1977).
Interactions between viscerotropic velogenic Newcastle disease virus and pet birds
of six species. II. Viral evolution through bird passage. Avian Disease, 21: 655-
669.
Farkas, T.; Szekely, E.; Belak, S. and Kiss, I. (2009). Real-time PCR-based pathotyping of
Newcastle disease virus by use of TaqMan minor groove binder probes. Journal of
Clinical Microbiology, 47: 2114-2123.
French, E. L.; St. George, T. D. and Percy, J. J. (1967). Infection of chicks with recently
isolated Newcastle disease virus of low virulence. Australian Veterinary Journal,
43: 403-409.
Fujii, Y.; Sakaguchi, T.; Kiyotani, K. and Yoshida T. (1999). Comparison of substrate
specificities against the fusion glycoprotein of virulent Newcastle disease virus
between a chick embryo fibroblast processing protease and mammalian subtilisin-
like proteases. Microbiology and Immunology, 43:133-40.
Fuller, C. M.; Collins, M. S. and Alexander, D. J. (2009). Development of a real-time
reverse transcription PCR for the detection and simultaneous pathotyping of
Newcastle disease virus isolates using a novel probe. Archive of Virology, 154:
929-937.
Garten, E; Burke, W.; Nagai, Y.; Rott, R. and Klenk, H. D. (1980). Mutational changes of
the protease susceptibility of glycoprotein F of Newcastle disease virus: Effects on
Pathogenicity. Journal of General virology, 50: 135-147.
Glaser, L. C.; Barker, I. K.; Chip Weseloh, D. V.; Ludwig, J.; Windingstad, R. M.; Key,
D. W. and Bollinger, T. K. (1999). The 1992 epizootic of Newcastle disease in
53
double-crested comorants in North America. Journal of Wildlife Disease, 35: 319-
330.
Glickman, R. L.; Syddall, R. J.; Iorio, R. M.; Sheehan, J. P. and Bratt, M. A. (1988).
Quantitative basic residue requirements in the cleavage-activation site of the fusion
glycoprotein as a determinant of virulence for Newcastle disease virus. Journal of
Virology, 62: 354-356.
Gohm, D. S.; Barbara, T. and Hofmann, M. A. (2000). Detection of Newcastle disease
virus in organs and feces of experimentally infected chickens using RT-PCR.
Avian Pathology, 29: 143-152.
Gomez-Lillo, M.; Bankowski, R. A. and Wiggins, A. D. (1974). Antigenic relationship
among viscerotropic velogenic and domestic strains of Newcastle disease virus.
American Journal of Veterinary Research, 35: 471-475.
Gould, A. R.; Hansson, E.; Selleck, K.; Kattenbelt, J. A.; Mackenzie, M. and Della- Porta,
A. J. (2003). Newcastle disease virus fusion and haemagglutinin-neuraminidase
gene motifs as markers for viral lineage. Avian Pathology, 32: 361-373.
Gould, A. R.; Kattenbelt, J. A.; Selleck, P.; Hansson, E.; Della-Porta, A. and Westbury, H.
A. (2001). Virulent Newcastle disease in Australia: Molecular epidemiological
analysis of viruses isolated prior to and during the outbreaks of 1998–2000. Virus
Research, 77: 51-60.
Hamid, H.; Campbell, R. S. F. and Lamichhane, C. (1990). The pathology of infection of
chickens with the lentogenic V4 strain of Newcastle disease virus. Avian
Pathology, 19: 687-696.
Hanson, R. P. (1956). An intracerebral inoculation test for determining the safety of NDD
vaccines. American Journal of Veterinary Research, 17:16-17.
Hanson, R. P. (1988). Heterogeneity within strains of Newcastle disease virus: Key to
survival. In: Alexander (ed.). Newcastle disease. Kluwer Academic Publishers,
Boston, MA, pp. 113-130.
54
Hanson, R. P.; Spalatin, J. and Jacobson, G. S. (1973). The viscerotrophic pathotype of
Newcastle disease virus. Avian Disease, 17: 354-361.
Hassan, W.; Ahmed, S.; Khair, M; Mochotlhoane, B. and Abolnik, C. (2010). Newcastle
disease outbreaks in the Sudan from 2003 to 2006 were caused by viruses of
genotype 5d. Virus Genes, 40: 106-110.
Heckert, R. A.; Collins, M. S.; Manvell, R. J.; Strong, I.; Pearson, J. E. and Alexander, D.
J. (1996). Comparison of Newcastle disease viruses isolated from cormorants in
Canada and the USA in 1975, 1990 and 1992. Canadian Journal of Veterinary
Research, 60: 50-54.
Herczeg, J.; Pascucci, S.; Massi, P.; Luini, M.; Selli, L.; Capua, I. and Lomniczi, B.
(2001). A longitudinal study of velogenic Newcastle disease virus genotypes
isolated in Italy between 1960 and 2000. Avian Pathology, 30: 163-168.
Herczeg, J.; Wehmann, E.; Bragg, R. R.; Travassos, D. P. M.; Hadjiev, G.; Werner, O. and
Lomniczi, B. (1999). Two novel genetic groups (VIIb and VIII) responsible for
recent Newcastle disease outbreaks in southern Africa, one (VIIb) of which
reached southern Europe. Archives of Virology, 144: 2087-2099.
Hu, B.; Huang, Y.; He, Y.; Xu, C.; Lu, X.; Zhang, W.; Meng, B.; Yan, S. and Zhang, X.
(2010). Avian influenza virus and Newcastle disease virus (NDV) surveillance in
commercial breeding farm in China and the characterization of class I NDV
isolates. Veterinary Microbiology, 144: 82-86.
Islam, M. A.; Ito, T. and Kida, H. (1995). Comparison of the hemagglutinin pattern and
pathotype activities of some Japanese isolates of Newcastle disease virus with
reference strains. Bangladesh Veterinary Journal, 29:1-8.
Islam, M. R.; Giasuddin, M.; Samad, M. A.; Taimur, M. J. F. A.; Baqui, M. A.; Mahbub-
E-Elahi, A.T.M. and Amin, M. M. (2008). Phylogenetic analysis of highly
pathogenec avian influenza (H5N1) virus isolates of Bangladesh. A sutdy on
highly pathogenic avian influenza in Bangladesh Livestock Research Institute
Savar, Dhaka.
55
Jarecki Black, J. C.; Bennett, J. D. and Palmieri, S. (1992). A novel oligonucleotide probe
for the detection of Newcastle disease virus. Avian Diseases, 36: 134-138.
Jarecki-Black, J. C. and King, D. J. (1993). An Oligonucleotide probe that distinguishes
isolates of low virulence from the more pathogenic strains of Newcastle disease
virus. Avian Disease, 37: 724-730.
Jestin, V. and Cherbonnel, M. (1992). Use of monoclonal antibodies and gene
amplification (PCR) for characterisation of a-PMV–1 strains. Proceedings CEC
Workshop on Avian Paramyxoviruses, Rauischholhausen, Institut
Geflugelkrankheiten, Giessen, (pp. 157–166).
Jestin, V. and Jestin, A. (1991). Detection of Newcastle disease virus RNA in infected
allantoic fluids by in vitro enzymatic amplification (PCR). Archives of Virology,
118, 151–161.
Jestin, V.; Cherbonnel, M. and Arnauld, C. (1994). Direct identification and
characterization of A-PMV1 from suspicious organs by nested PCR and automated
sequencing. Proceedings of the Joint First Annual Meetings of the National
Newcastle Disease and Avian Influenza Laboratories of the European
Communities, 1993 (pp. 89-97). Brussels, Belgium.
Jindal, N.; Chander, Y.; Chockalingam, A. K.; de Abin, M.; Redig, P. T. and Goyal, S. M.
(2009). Phylogenetic analysis of Newcastle disease viruses isolated from
waterfowl in the upper Midwest region of the United States. Virology Journal, 6:
191; doi: 10.1186/1743-422X-6-191.
Jordan, I. K.; Sutter IV, B. A. and McClure, M. A. (2000). Molecular evolution of the
paramyxoviridae multiple-protein-encoding P gene. Molecular biology and
evolution, 17: 75-86.
Jørgensen P. H.; Herczeg, J.; Lomniczi, B.; Manvell, R. J.; Holm, E. and Alexander D. J.
(1998). Isolation and characterization of avian paramyxovirus type 1 (Newcastle
disease) viruses from a flock of ostriches (Struthio camelus) and emus (Dromaius
novaehollandiae) in Europe with inconsistent serology. Avian Pathology, 27: 352-
8.
56
Jungherr, E. L. (1964). Pathogenicity of NDV for the chicken. In: Hanson, R. P. (ed).
Newcastle disease virus. An evolving Pathogens. University of Wisconsin,
Medison. pp. 257-272.
Jungherr, E. L. and Terrell, N. (1946). Observation on the spread of ND. Proceeding in
Annual Meeting in US Livestock Sanitary Association. 50: 158-171.
Kafi, M. A.; Rahman, M. B.; Amin, M. M.; Islam, M. R.; Rahman, M. M. and Rahman,
M. K. (2003). Comparative serological responses and protection conferred by
vaccination with V4HR and BCRDV in chickens. Bangladesh Journal of
Veterinary Medicine, 1: 25-27.
Kaleta, E. F. and Baldauf, C. (1998). Newcastle disease in free-living and pet birds. In:
Alexander, D. J. (Ed.), Newcastle Disease. Kluwer Academic Publishers, Boston,
pp. 184-196.
Kant, A.; Koch, G.; Van Riizelaar, D. J.; Balk, F. and Ter Huurne, A. (1997).
Differentiation of virulent and non-virulent strains of Newcastle disease virus
within 24 hours by polymerase chain reaction. Avian Pathology, 26: 837-849.
Kathryn, A. G. and Turdy, G. M. (2003). Interacting domains of the HN and F proteins of
Newcastle disease virus. Journal of virology, 77: 11040-11049.
Kattenbelt, J. A.; Meers, J. and Gould, A. R. (2006). Genome sequence of the
thermostable Newcastle disease virus (strain I-2) reveals a possible phenotypic
locus. Veterinary Microbiology, 114: 134-141.
Ke, G. M.; Yu, S. W.; Ho, C. H.; Chu, P. Y.; Ke, L. Y.; Lin, K. H.; Tsai, Y. C.; Liu, H. J.
and Lin, M. Y. (2010). Characterization of newly emerging Newcastle disease
viruses isolated during 2002-2008 in Taiwan. Virus Research, 147: 247-257.
Kho, C. L.; Mohd Azmi, M. L.; Arshad, S. S. and Yusoff, K. (2000). Performance of an
RT-nested PCR ELISA for detection of Newcastle disease virus. Journal of
Virological Methods, 86: 71-83.
57
Kim, L. M.; King, D. J.; Curry, P. E.; Suarez, D. L.; Swayne, D. E.; Stallknecht, D. E.;
Slemons, R. D.; Pedersen, J. C.; Senne, D. A.; Winker, K. and Afonso, C. L.
(2007a). Phylogenetic diversity among low-virulence Newcastle disease viruses
from waterfowl and shorebirds and comparison of genotype distributions to those
of poultry-origin isolates. Journal of Virology, 81: 12641-12653.
Kim, L. M.; King, D. J.; Suarez, D. L.; Wong, C. W. and Afonso, C. L. (2007b).
Characterization of class I Newcastle disease virus isolates from Hong Kong live
bird markets and detection using real-time reverse transcription-PCR. Journal of
Clinical Microbiology, 45: 1310-1314.
King, D. J. and Seal, B. S. (1997). Biological and molecular characterization of Newcastle
disease virus isolates from surveillance of live bird markets in the northeastern
United States. Avian Diseases, 41: 683-689.
Kommers, G. D.; King, D. J.; Seal, B. S.; Carmichael, K. P. and Brown, C. C. (2002).
Pathogenesis of Six Pigeon-Origin Isolates of Newcastle Disease Virus for
Domestic Chickens. Veterinary Pathology, 39: 353-362.
Kou, Y. T.; Chueh, L. L. and Wang, C. H. (1999). Restriction fragment length
polymorphism analysis of the F gene of Newcastle disease viruses isolated from
chickens and an owl in Taiwan. Journal of Veterinary Medical Science, 61: 1191-
1195.
Krapež, U.; Steyer, A. F.; Slavec, B.; Barlič-Maganja, D.; Dovč, A.; Račnik, J. and Rojs,
O. Z. (2010). Molecular characterization of avian paramyxovirus type 1
(Newcastle disease) viruses isolated from pigeons between 2000 and 2008 in
Slovenia. Avian Diseases, 54: 1075-1080.
Krishnamurthy, S. and Samal, S. K. (1997). Nucleotide sequences of the trailer,
nucleocapsid protein genome sequence. Journal of General Virology, 79: 2419-24.
Kuiken, T.; Wobeser, G.; Leighton, F. A.; Haines, D. M.; Chelack, B.; Bogdan, J. B.;
Hassard L.; Heckert, R. A. and Riva, J. (1999). Pathology of Newcastle Disease in
Double-Crested Cormorants from Saskatchewan, with comparison of diagnostic
methods. Journal of Wildlife Diseases, 35: 8-23.
58
Kwon, H. -J.; Cho, S. -H.; Ahn, Y. -J.; Seo, S. -H.; Choi, K. -S.; Kim, S. -J. (2003).
Molecular epidemiology of Newcastle disease in the Republic of Korea. Veterinary
Microbiology, 95: 39-48.
Lam, K. M. and Vasconcelos, A. C. (1994). Newcastle disease virus-induced apoptosis in
chicken peripheral blood lymphocytes. Veterinary Immunology and
Immunopathology, 44: 45-56.
Lamb, R. A. and Kolakofsky, D. (1996). Paramyxoviridae: The viruses and their
replication, p. 557–604. In: Fundamental virology. (Fields B. N.; Knipe D. M. and
Howley P. M. eds.) Lippincott-Raven, Philadelphia, PA.
Lamb, R. A. and Kolakofsky, D. (2001). Paramyxoviridae: the viruses and their
replication. In: Knipe, D.M. and Howley, P.M. (ed), Fields virology, 3rd edi, vol. 1.
Lippincott Wilkins, Philadelphia, Pa. pp. 1305-1340.
Lancaster, J. E. (1966). Newcastle disease - A review 1926-1946. Monograph No.3.
Canadian Department of Agriculture, Ottawa.
Lancaster, J. E. and Alexander, D. J. (1975). Newcastle disease virus and spread.
Monograph No.11, Candian Department of Agriculture, Ottawa.
Lee, E. K.; Jeon, W. J.; Kwon, J. H.; Yang, C. B.; Choi, K. S. (2009). Molecular
epidemiological investigation of Newcastle disease virus from domestic ducks in
Korea. Veterinary Microbiology, 134: 241-248.
Lee, Y. J.; Sung, H. W.; Choi, J. G.; Kim, J. H. and Song, C. S. (2004). Molecular
epidemiology of Newcastle disease viruses isolated in South Korea using
sequencing of the fusion protein cleavage site region and phylogenetic
relationships. Avian Pathology, 33: 482-491.
Liang, R.; Cao, D. J.; Li, J. Q.; Chen, J.; Guo, X.; Zhuang F. F. and Duan, M. X. (2002).
Newcastle disease outbreaks in western China were caused by the genotypes VIIa
and VIII. Veterinary Microbiology, 87: 193-203.
59
Lien, Y. Y.; Lee, J. W.; Su, H. Y.; Tsai, H. J.; Tsai, M. C.; Hsieh, C. Y. and Tsai, S. S.
(2007). Phylogenetic characterization of Newcastle disease viruses isolated in
Taiwan during 2003–2006. Veterinary Microbiology, 123: 194-202.
Liu, H.; Chen, F.; Zhao, Y.; Zheng, D.; Li, J.; Xu, T.; Qi, L. and Wang, Z. (2010).
Genomic characterization of the first class I Newcastle disease virus isolated from
the mainland of China. Virus Genes, 40: 365-371.
Liu, H.; Wang, Z.; Wu, Y.; Zheng, D.; Sun, C.; Bi, D.; Zuo, Y. and Xu, T. (2007).
Molecular epidemiological analysis of Newcastle disease virus isolated in China in
2005. Journal of Virological Methods, 140: 206-211.
Liu, H.; Zhao, Y.; Zheng, D.; Lv, Y.; Zhang, W; Xu, T.; Li, J. and Wang, Z. (2011).
Multiplex RT-PCR for rapid detection and differentiation of class I and class II
Newcastle disease viruses. Journal of Virological Method, 171: 149-155.
Liu, X. F.; Wan, H. Q.; Ni, X. X.; Wu, Y. T. and Liu, W. B. (2003). Pathotypical and
genotypical characterization of strains of Newcastle disease virus isolated from
outbreaks in chicken and goose flocks in some regions of China during 1985-2001.
Archives of Virology, 148: 1387-1403.
Liu, X.; Wang, X.; Wu, S.; Hu, S.; Peng, Y. and Xue, F. (2009). Surveillance for avirulent
Newcastle disease viruses in domestic ducks (Anas platyrhynchos and Cairina
moschata) at live bird markets in Eastern China and characterization of the viruses
isolated. Avian Pathology, 38: 377-391.
Lomniczi, B.; Wehmann, E.; Herczeg, J.; Ballagi-Pordany, A.; Kaleta, E. F.; Werner, O.;
Meulemans, G.; Jorgensen, P. H.; Mante, A. P.; Gielkens, A. L. J.; Capua, I. and
Damoser, J. (1998). Newcastle disease outbreaks in recent years in Western
Europe were caused by an old (VI) and a novel genotype (VII). Archive of
Virology, 143: 49-64.
Lorence, R. M.; Roberts, M. S.; Groene, W. S. and Rabin, H. (2001). Replication-
competent, oncolytic Newcastle disease virus for cancer therapy. In: Driever PH,
Rabkin SD (eds): Replication-competent viruses for cancer therapy. Monographs
in Virology, 22: 160-182.
60
Marin, M. C. (1996). Virus characterization and sequence of the fusion protein gene
cleavage site of recent Newcastle disease virus field isolates from the southeastern
United States and Puerto Rico. Avian Disease, 40: 382-390.
Marin, M. C.; Villegas, P.; Bennett, J. D. and Seal, B. S. (1996). Virus characterization
and sequence of the fusion protein gene cleavage site of recent Newcastle disease
virus field isolates from the southeastern United States and Puerto Rico. Avian
Diseases, 40: 382-390.
Martin, P. A. J. (1992). The epidemiology of Newcastle disease in village chickens. In:
Spardbrow, P. B. (Ed.), Newcastle Disease in Village chickens, Control with
Thermostable Oral Vaccines. In: Proceedings, International Workshop held in
Kaula Lumpur, Malaysia, 6-10 October 1991, Australian Centre for International
Agriculture Research (ACIAR), Canberra, pp. 40-45.
Mase, M.; Imai, K.; Sanada, Y.; Sanada, N.; Yuasa, N.; Imada, T.; Tsukamoto, K. and
Yamaguchi, S. (2002). Phylogenetic analysis of Newcastle disease virus genotypes
isolated in Japan. Journal of Clinical Microbiology, 40: 3826-3830.
Mase, M.; Inoue, T. and Imada, T. (2009). Genotyping of Newcastle Disease Viruses
Isolated from 2001 to 2007 in Japan. Journal of Veterinary Medical Science, 71:
1101-104.
Mayo, M. A. (2002). A summary of taxonomic changes recently approved by ICTV.
Archive of Virology, 147: 1655-1663.
Mazumder A. C. (2010). Pathological and Virological Investigation of Avian Respiratory
Disease. MS Thesis, Department of Pathology, Bangladesh Agricultural
University, Mymensingh.
McFerran, J. B. and McCracken, R. M. (1988). Newcastle disease. In: Alexander, D.J.
(ed.). Newcastle disease. Kluwer Academic Publishers, Boston, MA, pp.161-183.
McGinnes, L.; McQuain, C. and Morrison, T. (1998). The P protein and the nonstructural
38K and 29K proteins of Newcastle disease virus are derived from the same open
reading frame. Virology, 164: 256-264.
61
Melnick, J. L. (1982). Taxonomy and nomenclature of viruses. Progress in Medical
Virology, 28: 208-221.
Meteyer, C. U.; Docherty, D. E.; Glaser, L. C.; Franson, J. C.; Senne, D. A. and Duncan,
R. (1997). Diagnostic findings in the 1992 epornitic of neurotropic velogenic
Newcastle disease in double-crested cormorants from the upper Midwestern United
States. Avian Disease, 41: 171-180.
Millar N. S.; Chambers, P. and Emmerson, P. T. (1988). Nucleotide sequence of the fusion
and hemagglutinin-neuraminidase glycoprotein genes of Newcastle disease virus,
strain Ulster: molecular basis for variations in pathogenicity between strains.
Journal of General Virology, 69: 613-20.
Miller, P. J.; Decanini, E. L. and Afonso, C. L. (2010). Newcastle disease: evolution of
genotypes and the related diagnostic challenges. Infection, Genetics and Evolution,
10: 26-35.
Miller, P. J.; Kim, L. M.; Ip, H. S. and Afonso, C. L. (2009). Evolutionary dynamics of
Newcastle disease virus. Virology, 391: 64-72.
Mishra, S.; Kataria, J. M.; Sah, R. l.; Verma, K. C. and Mishra, J. P. (2000). Pathogenesis
of Newcastle disease virus isolates in pigeon. Indian Journal of Animal Science,
70: 1125-1126.
Mohamed, M. H. A.; Kumar, S.; Paldurai, A. and Samal, S. K. (2011). Sequence analysis
of fusion protein gene of Newcastle disease virus isolated from outbreaks in Egypt
during 2006. Virology Journal, 8: 237; doi: 10.1186/1743-422X-6-191.
Momayez, R.; Gharahkhani, P.; Pourbakhsh, S. A.; Toroghi, R.; Shoushtari, A. H. and
Banani, M. (2007). Isolation and pathogenicity identification of avian
paramyxovirus serotype 1 (Newcastle disease) virus from a Japanese quail flock in
Iran. Archive of Razi Institute, 62: 39-44.
Mushtaq, I.; Rizviand, F. and Ullah, M. S. (2006). Effect of Pigeon origin Newcastle
disease virus on various liver enzymes and associated pathological changes in
experimentally infected Pigeons. Pakistan Veterinary Journal, 26: 171-175.
62
Nagai, Y.; Klenk, H-D and Rott, R. (1976). Proteolytic cleavage of the viral glycoproteins
and its significance for the virulence of Newcastle disease virus. Virology, 72: 484-
508.
Nakamura, K.; Ohtsu, N.; Nakamura, T.; Yamamoto, Y.; Yamada, M.; Mase, M. and Imai,
K. (2008). Pathologic and immunohistochemical studies of Newcastle disease
(ND) in broiler chickens vaccinated with ND: severe nonpurulent encephalitis and
necrotizing pancreatitis. Veterinary Pathology, 45: 928-33.
Nanthakumar, T.; Kataria, R. S.; Tiwari, A. K.; Butchaiah, G. and Kataria, J. M. (2000).
Pathotyping of Newcastle disease viruses by RT-PCR and restriction enzyme
analysis. Veterinary Research Communications, 24: 275-286.
Nguyen, T. D. (1992). Poultry production and Newcastle disease in Vietnam. In:
Spardbrow, P. B. (Ed.). Newcastle Disease in Village chickens, Control with
Thermostable Oral Vaccines. Proceedings, International Workshop held in Kaula
Lumpur, Malaysia, 6-10 October 1991, Australian Centre for International
Agriculture Research, ACIAR, Canberra, 169-170.
Nishikawa, K.; Isomura, S.; Suzuki, S.; Wanatabe, E.; Hamaguchi, M.; Yoshida, T. and
Negai, Y. (1983). Monoclonal antibody to the HN glycoprotein of Newcastle
disease virus. Biological characterization and use for strain comparisons. Virology,
130: 318-330.
Noor, M.; Rajib, D. M. M.; Chowdhury, E. H.; Islam, M. R. and Das, P. M. (2005).
Pathogenic characterization of Newcastle disease virus field isolates. Progressive
Agriculture, 16: 91-98.
Oberdorfer, A. and Werner, O. (1998). Newcastle disease virus: detection and
characterization by PCR of recent German isolates differing in pathogenicity.
Avian Pathology, 27: 237-243.
Office International des Epizootics (OIE). (2000). Newcaslte disease. In: Manual of
Standards for Diagnosis Test and Vaccine. 4th edi. OIE, Paris. Pp.189-207.
63
Office International des Epizooties (OIE): Manual of Diagnostic Tests and Vaccines for
Terrestrial Animals. Paris 2009, Chapter 2.3.14: 576-589.
Okoye, J. O. A.; Agu, A. O.; Chineme, C. N. and Echeonwu, G. O. N. (2000). Pathologic
characterization in chickens of a velogenic Newcastle disease virus isolation from
Guinea fowl. Rev Med Vet Trop, 53: 325-330, Cited by Noor et al., 2005.
Panda, A.; Huang. Z.; Elankumaran, S.; Rockemann, D. D. and Samal, S. K. (2004). Role
of fusion protein cleavage site in the virulence of Newcastle disease virus.
Microbial pathogenesis, 36: 1-10.
Parede, L. and Young, P. L. (1990). The pathogenesis of virulent Newcastle disease virus
of chickens of different ages and different level of immunity. Avian Disease, 34:
803-808.
Park, Man-Seong; Garcia-Sastre, A.; Cors, J. F.; Basler, C. F. and Palese, P. (2003).
Newcastle disease virus V protein is a determinant of host range restriction.
Journal of Virology, 77: 9522-9532.
Pedersen, J. C.; Senne, D. A.; Woolcock, P. R.; Kinde, H.; King, D. J.; Wise, M. G.;
Panigraphy, B and Seal, B. S. (2004). Phylogenetic relationships among virulent
Newcastle disease virus isolates form the 2002-2003outbreaks in California and
other recent outbreaks in North America. Journal of Clinical Microbiology, 42:
2329-2334.
Peeters B. P.; De Leeuw, O. S.; Koch, G. and Gielkens, A. L. (1999). Rescue of Newcastle
disease virus from cloned cDNA: evidence that cleavability of the fusion protein is
a major determinant for virulence. Journal of Virology, 73: 5001-9.
Pennington, T. H. (1978). Antigenic difference between strains of NDV. Archives of
Virology, 56: 345-351.
Perozo, F.; Villegas, P.; Estevez, C.; Alvarado, I. and Purvis, L. B. (2006). Use of FTA
filter paper for the molecular detection of Newcastle disease virus. Avian
Pathology, 35: 93-98.
64
Pham, H. M.; Konnai, S.; Usui, T.; Chang, K. S.; Murata, S.; Mase, M.; Ohashi, K. and
Onuma, M. (2005). Rapid detection and differentiation of Newcastle disease virus
by real-time PCR with melting-curve analysis. Archive of Virology, 150: 2429-
2438.
Radhavan, V. S.; Kumanan, K.; Thirumurugan, G. and Nachimuthu, K. (1998).
Comparison of various diagnostic methods in characterizing Newcastle disease
virus isolates from Desi chickens. Tropical Animal Health and Production, 30:
287-293.
Richardson, C. D.; Scheid, A. and Choppin, P. W. (1980). Specific inhibition of
paramyxovirus and myxovirus replication by oligopeptides with amino acid
sequences similar to those at the N-termini of the F1 or HA2 viral polypeptides.
Virology, 105: 205-222.
Romer-Oberdorfer, A.; Werner, O.; Veits, J.; Mebatsion, T. and Mettenleiter, T. C. (2003).
Contribution of the length of the HN protein and the sequence of the F protein
cleavage site to Newcastle disease virus pathogenicity. Journal of General
Virology, 84: 3121-3129.
Rott, R. (1985). In vitro differenzierung von pathogenen und apathogenen aviaren
influenzaviren. Ber Munch Tieraerztl Wochenschr, 98: 37-39. Cited by Noor et al.,
2005.
Roy, P.; Venugopalan, A. T.; Selvarangam, R. and Ramaswamy, V. (1998). Velogenic
Newcastle disease virus in captive wild birds. Tropical Animal Health and
Production, 30: 299-303.
Russell, P. H. and Alexander, D. J. (1983). Antigenic variation of Newcastle disease virus
strains detected by monoclonal antibodies. Archive of Virology, 75: 243-253.
Saha, S; Islam, M. A.; Rahman, M. M. and Alam, K. H. T. (1998). Efficacy of an
inactivated Newcastle disease virus vaccine prepared from a local isolate.
Bangladesh Veterinary Journal, 32: 57-62.
65
Samson, A. C.; Levesley, I. and Russell, P. H. (1991). The 36K polypeptide synthesized in
Newcastle disease virus-infected cells possesses properties predicted for the
hypothesized V protein. Journal of General Virology, 72: 1709-1713.
Schaper, U. M.; Fuller, F. J.; Ward, M. D.; Mehrotra, Y.; Stone, H. O.; Stripp, B. R. and
De Buysscher, E. V. (1988). Nucleotide sequence of the envelope protein genes of
a highly virulent, neurotropic strain of Newcastle disease virus. Virology, 165:
291-295.
Scheid, A. and Choppin, P. W. (1974). Identification of biological activities of
paramyxovirus glycoproteins. Activation of cell fusion, hemolysis, and infectivity
by proteolytic cleavage of an inactive protein of Sendai virus. Virology, 57: 470-
90.
Schloer, G.; Spalatin, J. and Hanson, R. P. (1975). Newcastle disease virus antigens and
strains variation. American Journal of Veterinary Research, 36: 505-508.
Seal B. S.; King D. J. and Bennett J. B. (1995). Characterization of Newcastle disease
virus isolates by RT-PCR coupled to direct nucleotide sequencing and
development of sequence database for pathotype prediction and molecular
epidemiologic analysis. Journal of Clinical Microbiology, 33: 2624-30.
Seal, B. S. (1996). Analysis of matrix protein gene nucleotide sequence diversity among
Newcastle disease virus isolates demonstrates that recent disease outbreaks are
caused by viruses of psittacine origin. Virus Genes, 11: 217-224.
Seal, B. S.; King, D. J. and Sellers, B. S. (2000). The avian response to Newcastle disease
virus. Developmental Comparative Immunology, 24: 257-268.
Seal, B. S.; King, D. J.; Locke, D. P.; Senne, D. A. and Jackwood, M. W. (1998).
Phylogenetic relationships among highly virulent Newcastle disease virus isolates
obtained from exotic birds and poultry from 1989 to 1996. Journal of Clinical
Microbiology, 36: 1141-1145.
66
Sergel-Germano, T; McQuain, C. and Morrison, T. G. (1994). Mutations in the fusion
peptide and heptad repeat regions of the Newcastle disease virus fusion protein
block fusion. Journal of Virology, 68: 7654-8.
Shengqing, Y.; Kishida, N.; Ito, H.; Kida, H.; Otsuki, K.; Kawaoka, Y. and Ito, T. (2002).
Generation of velogenic Newcastle disease viruses from a nonpathogenic
waterfowl isolate by passaging in chickens. Virology, 301: 206-211.
Singh, K.; Jindal, N.; Gupta, S. L.; Gupta, A. K. and Mittal, D. (2005). Detection of
Newcastle disease virus genome from the field outbreaks in poultry by Reverse
Transcription- Polymerase Chain Reaction. International Journal of Poultry
Science, 4: 472-475.
Spalatin, J.; Hanson, R. P. and Beard, P. D. (1970). The hemagglutination elution pattern
as marker in characterizing Newcastle disease virus. Avian disease, 14: 542-549.
Srinivasappa, G. B.; Snyder, D. B.; Marquardt, W. W. and King, D. J. (1986). Isolation of
a monoclonal antibody with specificity for commonly employed vaccine strains of
Newcastle disease virus. Avian Disease, 30: 562-567.
Stäuber, N.; Brechtbühl, K.; Bruckner, L. & Hofmann, M. A. (1995). Detection of
Newcastle disease virus in poultry vaccines using the polymerase chain reaction
and direct sequencing amplified DNA. Vaccine, 13: 360-364.
Steward, M.; Samson A. C.; Errington, W. and Emmerson, P. T. (1995). The Newcastle
disease virus V protein binds zinc. Archives of Virology, 140: 1321-1328.
Steyer, A. F.; Rojs, O. Z.; Krapež, U.; Slavec, B. and Barlič-Maganja, D. (2010). A
diagnostic method based on MGB probes for rapid detection and simultaneous
differentiation between virulent and vaccine strains of avian paramyxovirus type 1.
Journal of Virological Methods, 166: 28-36.
Talha, A. F. S. M.; Hossain, M. M.; Chowdhury, E. H.; Bari, A. S. M.; Islam, M. R. and
Das, P. M. (2001). Poultry diseases occurring in Mymensingh district of
Bangladesh. The Bangladesh Veterinarian, 18: 20-23.
67
Tan, S. W.; Ideris, A.; Omar, A. R.; Yusoff, K. and Hair-Bejo, M. (2009). Detection and
differentiation of velogenic and lentogenic Newcastle disease viruses using SYBR
Green I real-time PCR with nucleocapsid gene-specific primers. Journal of
Virological Methods, 160: 149-156.
Tangredi B. P. (1985). Avian paramyxovirus type I infection in pigeons: clinical
observations. Avian Diseases, 29: 1252-1255.
Taylor, J.; Edbauer, C.; Rey-Senelonge, A.; Bouquet, J. F.; Norton, E.; Goebel, S.;
Desmettre, P. and Paoletti, E. (1990) . Newcastle disease virus fusion protein
expressed in a fowlpox virus recombinant confer protection in chickens. Journal of
Virology, 64: 1441-1450.
Toyoda, T.; Gotoh, B.; Sakaguchi, T.; Kida, H. and Nagai, Y. (1988). Identification of
amino acids relevant to three antigenic determinants on the fusion protein of
Newcastle disease virus that are involved in fusion inhibition and neutralization.
Journal of Virology, 62: 4427-4430.
Toyoda, T.; Sakaguchi, T.; Hirota, H.; Gotoh, B.; Kuma, K.; Miyata, T. and Nagai, Y.
(1989). Newcastle disease virus evolution. II. Lack of gene recombination in
generating virulent and avirulent strains. Virology, 169: 273-282.
Toyoda, T.; Sakaguchi, T.; Imai, K.; Inocencio, N. M.; Gotoh, B.; Hamaguchi, M. and
Nagai, Y. (1987). Structural comparison of the cleavage-activation site of the
fusion glycoprotein between virulent and avirulent strains of Newcastle disease
virus. Virology, 158: 242-247.
Tsai H. J.; Chang K. H.; Tseng, C. H.; Frost K. M.; Manvell R. J. and Alexander D. J.
(2004). Antigenic and genotypical characterization of Newcastle disease viruses
isolated in Taiwan between 1969 and 1996. Veterinary Microbiology, 104: 19-30.
Tsunekuni, R.; Ito, H.; Otsuki, K.; Kida, H. and Ito, T. (2010). Genetic comparisons
between lentogenic Newcastle disease virus isolated from waterfowl and velogenic
variants. Virus Genes, 40: 252-255.
68
Ujvári, D. (2006). Complete nucleotide sequence of IT-227/82, an avian paramyxovirus
type-1 strain of pigeons (Columba livia). Virus Genes, 32: 49-57.
Usman, B. A. and Diarra, S. S. (2008). Prevalent Diseases and Mortality in Egg Type
Layers: An Overview. International Journal of Poultry Science, 7: 304-310.
Utterback, W. W. and Schwartz, J. H. (1973). Epizootology of velogenic viscerotropic
Newcastle Disease in Southern California 1971-1973. Journal of the American
Veterinary Medical Association, 163: 1080-1088.
Wan, S. X.; Gao, Q. Y. and Shao, Z. H. (1984). Pathomorphological model of
experimental infection with Beijing strain of Newcastle disease virus in chickens.
Chinese Journal of Veterinary Medicine, 10: 6-8.
Wang, L. C.; Pan, C. H.; Severinghaus, L. L.; liu, L. Y.; Chen, C. T.; Pu, C. E.; Huang, D.;
Lir, J. T.; Chin, S. C.; Cheng, M. C.; Lee, S. H. and Wang, C. H. (2008).
Simultaneous detection and differentiation of Newcastle disease and avian
influenza viruses using oligonucleotide microarrays. Veterinary Microbiology,
127: 217-226.
Wang, Z.; Liu, H.; Xu, J.; Bao, J.; Zheng, D.; Sun, C.; Wei, R.; Song, C. and Chen, J.
(2006). Genotyping of Newcastle Disease Viruses Isolated from 2002 to 2004 in
China. Annals of the New York Academy of Sciences, 1081: 228-239.
Wehmann, E.; Czegledi, A.; Werner, O.; Kaleta, E. and Lomniczi, B. (2003). Occurrence
of genotypes IV, V, VI and VIIa in Newcastle disease outbreaks in Germany
between 1939 and 1995. Avian Pathology, 32: 157-163.
Wehmann, E.; Herczeg, J.; Ballagi Pordany, A. and Lomniczi, B. (1997). Rapid
identification of Newcastle disease virus vaccine strains La Sota and B1 by
restriction site analysis of their matrix gene. Vaccine, 15: 1430-1433.
Weingartl, H. M.; Riva, J. and Kumthekar, P. (2003). Molecular characterization of avian
paramyxovirus I isolates collected from cormorants in Canada from 1995 to 2000.
Journal of Clinical Microbiology, 41: 1280-1284.
69
Winslow, N. S.; Hanson, R. P.; Upton, E. and Brandly, C. A. (1950). Agglutination of
mammalian erythrocytes by Newcastle disease virus. Proceeding of Society for
Experimental Biology, 74:174-178.
Wise, M. G.; Suarez, D. L.; Seal, B. S.; Pedersen, J. C.; Senne, D. A.; King, D. J.;
Kapczynski, D. R. and Spackman, E. (2004). Development of a real-time reverse-
transcription PCR for detection of Newcastle disease virus RNA in clinical
samples. Journal of Clinical Microbiology, 42: 329-338.
Xu, F.; Zhong, D. and Yu, W. (2003). Cloning of the Newcastle Disease Virus (NDV) F
Gene and Construction of a Eukaryotic Expression Recombinant Plasmid
Containing NDV F Gene. Anhui Nongxueyuan Xuebao, 30: 280-284.
Yang, C. Y.; Shieh, H. K.; Lin, Y. L. and Chang, P. C. (1999). Newcastle disease virus
isolated from recent outbreaks in Taiwan phylogenetically related to viruses
(genotype VII) from recent outbreaks in Western Europe. Avian Disease, 43: 125-
130.
Yu, L.; Wang, Z.; Jiang,Y.; Chang, L. and Kwang, J. (2001). Characterization of newly
emerging Newcastle disease virus isolates from the People's Republic of China and
Taiwan. Journal of Clinical Microbiology, 39: 3512-3519.
Yusoff, K.; Nesbit, M.; McCartney, H.; Meulemans, G.; Alexander, D. J.; Collins, M. S.;
Emmerson, P. T. and Samson, A. C. (1989). Location of neutralizing epitopes on
the fusion protein of Newcastle disease virus strain Beaudette C. Journal of
General Virology, 70: 3105-3109.
Zhang, L.; Pan, Z.; Geng, S.; Chen, X; Hu, S.; Liu, H.; Wu, Y.; Jiao, X. and Liu, X.
(2010). Sensitive, semi-nested RT-PCR amplification of fusion gene sequences for
the rapid detection and differentiation of Newcastle disease virus. Research in
Veterinary Science, 89: 282-289.