Journal of Medical Virology 86:2134–2141 (2014)

Molecular Characterization of CirculatingPandemic Strains of Influenza A Virus During2012 to 2013 in Lucknow (India)

Tanushree Dangi,1 Bhawana Jain,1 Ajay Kumar Singh,1 J.V. Singh,2 Rashmi Kumar,3

Mukesh Dwivedi,1 Anil Kumar Verma,1 Mandeep S. Chadha,4 and Amita Jain1*1Department of Microbiology, King George’s Medical University, Lucknow, India2Department of Community Medicine, King George’s Medical University, Lucknow, India3Department of Paediatrics, King George’s Medical University, Lucknow, India4National Institute of Virology, Pune, India

The pandemic H1N1 strain of Influenza A virus[A(H1N1)pdm09] is now well adapted in hu-man populations. However, it is still causingsporadic outbreaks worldwide with differentseverity. The present study was planned tounderstand the genetic diversity (based on theHA1 gene) of influenza A(H1N1)pdm09 strainscirculating during the post pandemic period.The HA1 gene was selected because the HA1protein is immunogenic, functions as a recep-tor binding site and indirectly affects transmis-sion and pathogenicity of virus. A total of2,818 cases were enrolled. Nasal/throat swabsfrom all cases were tested by one-step realtime PCR for detection of influenza virus typesand subtypes according to the CDC protocol.Of these, 134 cases were A(H1N1)pdm09 posi-tive, 34 of which were screened for HA1 gene(position 434–905) sequencing (Big-Dye termi-nator using 3130 ABI, Genetic analyzer). Molec-ular and phylogenetic analysis was performedusing PhyML approach (v. 3.0). All A(H1N1)pdm09 positive and negative cases were clini-cally characterized. Phylogentically, all Luck-now strains (n¼ 33) except one fall with theclade seven reference strain. One strainshowed 99.9% similarities with clade one refer-ence strain A/California/07/2009. In mutationalanalysis, 33 strains had the S220T mutation,which is at an antigenic site and characteristicof clade seven along with few minor muta-tions; K180I/T/Q, V190I, S200P, S202T, A203T,A214T, S220T, V251I, and A273T. These resultssuggest that clade seven was the most widelycirculating clade in Lucknow and A(H1N1)pdm09 cases showed mild clinical symptomsas compared to A(H3N2) or influenza B cases.J. Med. Virol. 86:2134–2141, 2014.# 2014 Wiley Periodicals, Inc.

KEY WORDS: influenza A(H1N1)pdm09; he-magglutinin; HA1domain; phy-logenetic; clades; mutation

INTRODUCTION

A novel strain of influenza A(H1N1)pdm09 wasfirst identified in Mexico and very soon attainedpandemic proportions. Disease severity associatedwith 2009 novel strain was low but the virus washighly transmissible. There were 18,449 virologicallyconfirmed deaths in 2009 [WHO Update, 2010] ascompared to 20–50 million deaths in 1918 pandemic[Taubenberger and Morens, 2006]. Genetic analysisconfirmed that it was a triple reassorted virus fromhuman, swine, and avian lineages. The virus carriedthe hemagglutinin (HA), nucleoprotein (NP), andnon-structural (NS) gene segments of classical swinevirus origin, the polymerase basic protein 2 (PB2)and polymerase acidic protein (PA) gene segmentsfrom North American avian viruses, the polymerasebasic protein 1 (PB1) gene from viruses of humanorigin and the neuraminidase (NA) and matrix (M)gene segments from Eurasian swine avian-likeviruses [Brockwell-Staats et al., 2009; Garten

Grant sponsor: Indian council of Medical Research, New Delhi;Grant number: 5/8/7/14/2009-ECD-1(Vol.II).

Conflict of interest: None.�Correspondence to: Prof. Amita Jain, Department of Micro-

biology, King George Medical University, Lucknow 226003,India.E-mail: amita602002@yahoo.com

Accepted 25 March 2014

DOI 10.1002/jmv.23946Published online 29 April 2014 in Wiley Online Library(wileyonlinelibrary.com).

�C 2014 WILEY PERIODICALS, INC.

et al., 2009; Peiris et al., 2009]. Molecular analysis ofA(H1N1)pdm09 strains had classified them into sevendiscrete genetic clades [Nelson et al., 2009] whichwere also confirmed by several subsequent studies[Potdar et al., 2010; Barrero et al., 2011; Chanet al., 2011; Ilyicheva et al., 2011]. Clade sevenrapidly became the most prevalent clade worldwide,but other clades continue to circulate. Multiple intro-ductions of different clades of A(H1N1)pdm09 viruswere observed in many countries worldwide [Parkset al., 2009; Furuse et al., 2010; Shiino et al., 2010;Graham et al., 2011; Pariani et al., 2011].Hemaagglutinin (HA) is a major surface glycopro-

tein of influenza virus. It has shown to be under highselective pressure to evade the host immune responsethat makes it hypervariable [Nelson andHolmes, 2007]. The HA1 globular head domain of HAprotein functions as a receptor binding site as well asantigenic sites which are responsible for virus attach-ment to the host cell surface receptors and generatingimmune response, respectively [Skehel andWiley, 2000; Knossow and Skehel, 2006]. The antigen-ic structure of the HA1 domain contains five distinctantigenic sites on the globular head: Sa, Sb, Ca1, Ca2,and Cb [Gerhard et al., 1981; Nelson et al., 2009;Igarashi et al., 2010]. Any mutational changes in thisregion may affect the transmission and pathogenicityof influenza virus. Change in the HA1 domain mayalso alter the efficacy of the current vaccine. There-fore, continued epidemiological and genetic surveil-lance is important for monitoring changes in virulenceover seasons. This study attempted to characterize theclinical severity and genetic diversity of influenzaA(H1N1)pdm09 strains during a post-pandemic influ-enza season in Lucknow. The present study wascarried out to elucidate the changes in HA1 gene ofcirculating A(H1N1)pdm09 strains in northern India.

MATERIALS AND METHODS

Study Patients

This observational study was carried out using datasampled from Lucknow across two complete years,that is, 2012–2013. Influenza season in 2012 spannedover August-September, while in 2013 year, itspanned over the month of July. Informed consentwas obtained from either the patient or their guard-ian (in case of children) and study was ethicallyapproved by Institutional ethics committee. Patientsof all age groups presenting as influenza like illnesswere included in this study. Nasal and throat swabsof patients were collected in 3.5ml viral transportmedia (Hank’s balanced salt solution supplementedwith 200U Penicillin/ml and 200mg/ml AmphotericinB and 2% BSA), transported to the laboratory withoutdelay (maintaining the cold chain) and processed.Clinical details, age and sex of the cases were

recorded. However, the outcome of the disease wasrecorded telephonically in A(H1N1)pdm09 positivecases only.

Statistical Analysis

All statistical analysis was performed in STATA(version 11) software. P values less than or equal to0.05 were considered as significant. Pearson’s Chi-Squared test was applied to test for differencesbetween clinical parameters of patients infected withA(H1N1)pdm09 versus influenza negatives and influ-enza A(H3N2)/influenza B positives.

RNA Extraction and Sequencing

RNA was extracted using High Pure Viral NucleicAcid Extraction kit (Roche, Germany) according tomanufacturer’s instructions. Samples were screenedfor the presence of influenza A virus by real-timereverse transcription polymerase chain reaction (RT-PCR) targeted to Matrix gene. All samples positivefor influenza A were further sub-typed into A(H1N1)pdm09 and influenza A(H3N2) types by one-step real-time RT-PCR targeted to hemagglutinin (HA) geneaccording to WHO standard protocols. A panel ofoligonucleotide primers and dual labeled hydrolysisprobes (Taqman) were synthesized according to theCentre for Disease and Control (CDC) recommendedprotocol [WHO CDC Protocol, 2009].For partial sequencing of the HA1 gene, samples

positive for A(H1N1)pdm09 virus were selected atrandom (n¼ 34). The HA1 gene was amplified fromA(H1N1)pdm09 positive samples by two-step conven-tional RT-PCR assay, specific for 447bp fragment(nucleotide position 434–905) in the HA1 domain[WHO CDC Protocol, 2009]. Viral complementaryDNA [c-DNA] (20ml) was synthesized on freshlyextracted RNA (10ml) using 0.5ml of 20mM, M-MLV(Moloney Murine Leukemia Virus Reverse Transcrip-tase) reverse transcriptase enzyme (Promega, Madi-son, WI), 2.5ml RT-Buffer (10X) and forward primerpdmH1/434F (50 CGAACAAAGGTGTAACGGCAGCAT30,1.0ml of 10mM concentration), 0.5ml RNase Inhibi-tor (20U/ml, RNaseOUT; Invitrogen, Merelbeke,Belgium) and dNTP (1.0ml of 100mM concentrations),at 37˚C for one hour and 85˚C for 10min [WHO CDCProtocol, 2009]. Amplification was done using 1ml c-DNA in the 25ml final volume of reaction mixturecontaining 2.5ml Taq Buffer (10�), 1ml Taq enzyme(2m/mL, DyNAZymeTM; Fisher Scientific UK Ltd,Bishop Meadow Road, Loughborough, United King-dom), 0.5ml dNTP (100mM), 0.5ml Forward (pdm/434F 50 CGAACAAAGGTGTAACGGCAGCAT 30) andreverse primers (pdm/905R 50 GCACCCTTGGGTGTTTGACAAGTT 30) of 10mM and nuclease freewater. PCR reaction was performed in a thermalcycler (ABI 7,500, Veriti) under the following condi-tions: Initial denaturation at 94˚C for 10min, followedby 40 amplification cycles comprising of denaturationfor 30 sec, primer annealing at 55˚C for 45 sec followedby extension at 72˚C for 1min, to be concluded with afinal extension step at 72˚C for 10min.The amplified PCR products were checked on 2%

Agarose gel-electrophoresis and visualized on a UV

J. Med. Virol. DOI 10.1002/jmv

Molecular Characterization of Pandemic Strains 2135

trans-illuminator after staining with ethidium bro-mide solution. The PCR product seen as a singleband was directly used for further purification pro-cess by Exo-Sap treatment to remove excess primersand un-incorporated dNTPs (by Exonuclease I, 1U/mland Shrimp Alkaline Phosphatase, 20U/ml) (Fas-tApTM, Fermentas) and ethanol precipitation methodwas carried out [Potdar et al., 2010]. Purified prod-ucts were sequenced using BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems, Foster City, CA)and ABI Prism 3130xl DNA-sequencer (AppliedBiosystems).

Phylogenetic Analyis

The generated sequences were edited manually andaligned (nt 414–885) by Clustal W version 1.83[Thompson et al., 1994]. For comparison of nucleotidesequences, representative strains of all clades ofA(H1N1)pdm09 virus (1 to 7) from different geo-graphical regions including India, of the years 2009to 2011, were selected and retrieved from the Influen-za Research Database (www.fludb.org; shown inFig. 1). A phylogenetic tree was constructed using themaximum likelihood (ML) approach in PhyML pro-gram [Guindon and Gascuel, 2003] with 500 boot-strap replicates. The analysis utilized the HKY85þIþG4 nucleotide substitution model and employed theSH-like branch support. The nucleotide sequencesderived from this study were submitted to theGenBank database under accession numbersKC753452, KC792285 to KC792296, KF500955 toKF500976.To rule out the amino acid variations in HA1 gene

encoded amino acid sequences, multiple sequencealignment of 34 amino acid sequences was performedwith reference to vaccine strain (A/California/07/2009, belong to clade one) by ClustalW in MEGA 5.02software [Thompson et al., 1994].

RESULTS

Of a total 2,818 samples, 134 (4.7%) tested positivefor A(H1N1)pdm09 virus, 72 (2.6%) for influenzaA(H3N2) and 245 (8.7%) for influenza B viruses.

Clinical Characterization

Clinical signs and symptoms of patients infectedwith A(H1N1)pdm09 (n¼ 134) were compared tothose infected with influenza A(H3N2) (72), withinfluenza B (245) and influenza negative patients(n¼ 2367). The results are shown in Table I. Feverand nasal discharge were the mandatory inclusioncriteria, hence, were not analyzed. Sore throat (81/134, 60.4%, and P¼ 0.001), chills & rigor (48/134,35.8%, and P¼ 0.001), breathlessness (7/134, 5.2%,P¼ 0.0001), headache (74/134, 55.2% and P¼ 0.001),bodyache (70/134, 52.2% and P¼ 0.0001), fatigue (68/134, 50.7% and P¼ 0.002) and vomiting (7/134, 5.2%and P¼ 0.0001) were significantly associated withA(H1N1)pdm09 positivity. Sore throat and bodyache

were more common in patients infected withA(H1N1)pdm09 virus than those with influenzaA(H3N2) infected patients. Chills and rigor, breath-lessness, vomiting, and diarrhea were significantlyhigher in patients positive for influenza A(H3N2) andinfluenza B viruses than A(H1N1)pdm09 positivepatients. The outcome of all A(H1N1)pdm09 positivepatients was recorded telephonically on the seventhday after enrolment. All A(H1N1)pdm09 positivepatients except two who died, were recovered. Theage group distribution in A(H1N1)pdm09, influenzaA(H3N2) and influenza B positive cases along withinfluenza negative cases is detailed in Table II.Demographic data showed that A(H1N1)pdm09 virusaffect children belonging to >5–15 years of age groupmore significantly (7.6%, P¼ 0.0021) than the otherage groups. Influenza A(H3N2) and influenza Binfection was predominantly higher in children be-longing to 0–5 years of age in comparison withA(H1N1)pdm09 infection.To understand the genetic diversity of influenza

A(H1N1)pdm09 strains circulating in our region, 34strains selected at random (n¼ 14 strains from 2012and n¼ 20 strains from 2013) were sequenced.

Phylogenetic Analysis

Analysis of Lucknow strains with respect to vaccinestrain, that is, A/California/07/2009 revealed 99–99.9% similarities. Total 33/34 Lucknow strains con-tained S220T mutation in HA1 domain, signaturemutation for clade seven A(H1N1)pdm09 referencestrains from India as well as of other countries. Onestrain did not contain S220T mutation in HA1 genespecific for clade seven and showed 99.9% similaritywith clade one A(H1N1)pdm09 reference strain.Phylogenetic tree constructed on the basis of par-

tial HA1 gene sequences of all the 34 strains withrespect to reference strains of A(H1N1)pdm09,showed two groups distinctively, as shown in theFigure 1. Thirty-three strains were grouped separate-ly as a distinct cluster and showed genetic related-ness with clade seven global reference strains(Fig. 1). Interestingly, a single strain represented99.9% genetic relatedness with clade one referencestrain (A/California/07/2009, vaccine strain) and clus-tered distinctively.

Amino Acid Variations

Comparison of HA1 amino acid sequences of Luck-now strains with respect to the influenza A/Califor-nia/07/2009 virus (a prototype vaccine referencestrain) has shown two major mutations, that is,S220T and S202T. The amino acid positions in HA1polypeptide were assigned with respect to full lengthHA coding region including signal peptide of 17amino acids. Other identified changes were K180I/T/Q, V190I, S200P, A203T, A214T, S220T, V251I, andA273T as shown in Table III. The majority (n¼ 33) ofthe strains contained S220T mutations which was

J. Med. Virol. DOI 10.1002/jmv

2136 Dangi et al.

located within the Ca antigenic site and S202Tmutations which was situated within the Sb antigen-ic motif. A203T mutation was present in strains fromyear 2013 and not in strains from year 2012.Interestingly, three types of mutations at 180 aminoacid positions were found in Lucknow strains, of

which five strains from year 2012 showed K180Imutation (non-synonymous mutation), three showedK180T mutation (n¼ 1 strain of 2012 and n¼ 2strains of 2013) and fourteen showed K180Q muta-tion (n¼ 2 strains of year 2012 and n¼ 12 strains ofyear 2013).

Fig. 1. Phylogenetic tree of Influenza A(H1N1)pdm09 studystrains and representative global strains based on HA1 geneusing the maximum likelihood method. Lucknow strainsisolated during year 2012 (blue color font) and year 2013 (redcolor font) are grouped with clade seven reference strains ofinfluenza A(H1N1)pdm09 strains except one strain. The S220Tamino acid mutation characteristic to clade seven is shown at

the root of the branch. One study strain (in red circle) groupedwith clade one reference strains, that is, influenza A/Califor-nia/04/2009 and A/California/04/2009 strains. Amino acid sub-stitutions described in the text are denoted at the nodes ofeach branch. Scale bar indicates the number of nucleotidesubstitutions per site and bootstrap values >75% are shown atbranch nodes.

J. Med. Virol. DOI 10.1002/jmv

Molecular Characterization of Pandemic Strains 2137

Five Lucknow strains from the year 2013 showedsubstitutions of Valine by Iso-leucine at 251 aminoacid position which was also observed in 2009 Indianisolates [Potdar et al., 2010]. But none of Lucknowstrains isolated during 2012, showed this mutation.Mutation at 214 amino acid position was found innine Lucknow strains from year 2012 while strainsfrom year 2013 were similar to prototype strains atthis position. Other changes found at different aminoacid positions were V! I at 190 position (n¼ 2, fromyear 2012 & n¼ 1, from year 2013) and S!P at 200position (n¼ 6, all were from year 2013).

DISCUSSION

Present study was the part of ongoing influenzasurveillance network in this center which revealed

the circulation of influenza A(H1N1)pdm09 viruseswith influenza B and A(H3N2) viruses during 2012/2013 influenza seasons. In 2012 influenza season,influenza B was the predominant subtype over influ-enza A(H1N1)pdm09 viruses. The next influenzaseason (July 2013) was dominated by influenzaA(H3N2) along with a small proportions of A(H1N1)pdm09 viruses and influenza B viruses. Co-circula-tion of influenza strains with different prevalencewas observed globally [ECDC Report, 2012]. Since2009, influenza A(H1N1)pdm09 virus has been con-tinuously circulating in human population with vari-ous magnitude [Morlighem et al., 2011]. Manystudies have been carried out in different parts of theworld to characterize pandemic strains as it evolvesrapidly. Nelson et al. [2009] reported the global

TABLE I. Characteristics of Patients Testing Positive for Influenza A(H1N1)pdm09, Influenza A(H3N2) andInfluenza B Viruses

Symptoms

No. of pH1N1positive

patients (%)N¼134

No. of influenzanegative patients

(%) N¼2367 P-value�

No. ofinfluenza A(H3N2)positive patients

(%) N¼72 P-value��

No. ofinfluenza Bpositive

patients (%)N¼245 P-value���

Median age (IQR) 24 (6 monthsto 80 years)

15 (1 monthsto 84 years)

19 (1 monthsto 85 years)

21 (1 monthsto 80 years)

Cough 121 (90) 2,010 (84.9) 0.087 72 (100) 0.006 212 (86.5) 0.282Sore throat 81 (60.4) 869 (36.7) 0.001 32 (44.4) 0.027 140 (57.1) 0.532Chills & rigor 48 (35.8) 258 (10.9) 0.001 29 (40.2) 0.528 92 (37.5) 0.738Ear discharge 1 (0.71) 4 (0.16) 0.145 2 (2.7) 0.245 4 (1.63) 0.469Expectoration 47 (35.1) 737 (31.1) 0.339 30 (41.6) 0.351 68 (27.7) 0.151Wheezing 2 (1.5) 30 (1.3) 0.060 3 (4.2) 0.234 17 (6.9) 0.020

Breathlessness 7 (5.2) 7 (0.3) 0.0001 18 (25.0) 0.001 28 (11.4) 0.046Seizures 1 (0.71) 32 (1.4) 0.550 1 (1.4) 0.653 2 (0.8) 0.941Crepitation 5 (3.73) 48 (2.0) 0.182 8 (11.1) 0.161 13 (5.3) 0.490

Headache 74 (55.2) 862 (36.4) 0.001 43 (59.7) 0.534 108 (44.0) 0.037Bodyache 70 (52.2) 791 (33.4) 0.0001 31 (43.0) 0.146 102 (41.6) 0.047Fatigue 68 (50.7) 820 (34.6) 0.002 49 (68.0) 0.016 128 (52.2) 0.780Vomiting 7 (5.2) 24 (1.01) 0.0001 17 (23.6) 0.0001 29 (11.8) 0.035Diarrhea 2 (1.5) 21 (0.09) 0.475 14 (19.4) 0.001 18 (7.3) 0.014

Bold numbers represent significant P value (P< 0.05).pH1N1, Influenza A(H1N1)pdm09 virus.�P-value calculated between the clinical features of influenza A(H1N1)pdm09 positive patients and influenza negative patients.��P-value calculated between the clinical features of influenza A(H1N1)pdm09 positive patients and influenza A(H3N2) positive patients.���P-value calculated between the clinical features of influenza A(H1N1)pdm09 positive and influenza B positive patients.

TABLE II. Age Group Distribution Among Patients Testing Positive for Influenza A(H1N1)pdm09, Influenza A(H3N2) andInfluenza B Viruses

Agegroups(yrs)

Totalcases

No. of pH1N1positive

patients (%)N¼134

No. ofinfluenza negative

patients (%)N¼2367 P-value�

No. ofinfluenza

A(H3N2) positivepatients (%)

N¼72 P-value��

No. ofinfluenza Bpositive

patients (%)N¼245 P-value���

0–5 799 15 (1.8) 691 (97.8) 0.0001 28 (3.5) 0.0001 49 (6.1) 0.02>5–15 469 36 (7.6) 381 (91.3) 0.001 16 (3.4) 0.464 88 (18.7) 0.07>15–35 896 43 (4.8) 744 (94.5) 0.873 20 (2.3) 0.521 65 (7.2) 0.25>35–60 465 29 (6.2) 385 (92.9) 0.103 7 (1.5) 0.030 33 (7.1) 0.03>60 189 11 (5.8) 166 (93.7) 0.599 1 (0.5) 0.041 10 (5.29) 0.09

Bold numbers represent significant P value (P< 0.05).pH1N1, influenza A(H1N1)pdm09 virus.�P-value calculated among different age groups patients tested positive for influenza A(H1N1)pdm09 and patients negative for influenzainfection.��P-value calculated among different age groups patients tested positive for influenza A(H1N1)pdm09 and influenza A(H3N2) viruses.���P-value calculated among different age groups patients tested positive for influenza A(H1N1)pdm09 and influenza B viruses.

J. Med. Virol. DOI 10.1002/jmv

2138 Dangi et al.

dissemination of seven phylogentically distinct clades(1 to 7) of A(H1N1)pdm09 strains.The phylogenetic analysis based on partial HA1

gene sequences of Lucknow A(H1N1)pdm09 strainsdemonstrated that all were the genetic variants ofprototype vaccine strain influenza A/California/07/2009 and showed 99–99.9% similarity. All the strainsduring 2012–2013, except one (clade one) showedgenetic relatedness to clade seven of A(H1N1)pdm09virus and contained signature mutation of cladeseven, that is, S220T. Such clear discrimination wasfound in A(H1N1)pdm09 strains of early phase ofpandemic (May 2009) from those of latter phase(October 2009 to January 2010) in several geographicregions of the world [Morlighem et al., 2011]. Data ofthe present study is in concordance with publishedresults from India about the predominant circulationof clade seven in the post pandemic period [Potdaret al., 2010; Mir et al., 2012]. One Lucknow strain(LKO2727/2012) did not show S220T mutation inHA1 domain; therefore clustered separately from restof the strains and fall with A/California.07/2009reference strain which belongs to clade one lineage.

Similar finding was also observed in a study fromGwalior, India, which showed co-circulation of pre-dominant clade seven along with clade one [Sharmaet al., 2011]. Co-circulation of multiple lineages ofpandemic strain was found in Delhi and Pune, India[Mullick et al., 2011; Mir et al., 2012]; reporting thecirculation of clade five and six along with cladeseven. There is no evidence of association betweenclinical severity/fitness among these co-circulatingclades in any geographical region [Nelsonet al., 2009].Analysis of partial amino acid sequences of HA1

gene (from aa 180 to 279) revealed the presence ofminor mutations in antigenic epitope of HA1 domain.These amino acid sequences lie in the region of fourof the five important antigenic sites of HA1 domain,that is, Sa, Ca1, Ca2, and Sb which induce immuneresponse and are also responsible for binding to thehost cell sialic acid receptors. The majority of theisolates (n¼ 33) showed S202T mutation and a few(n¼ 5) showed A203T mutation which lie in Sbantigenic site of the HA1 head domain. Similarmutations are also reported in one study from Delhi

TABLE III. Comparative Amino Acid Sequence Analysis of Study Strains With Respect to Reference Strain

Strain IDAccesssion

no

Residue positions in HA peptide sequences showing variation

Collectiondate

Age(yrs)/sex

180 190 200 202 203 214 220 251 273 279

A/California/07/2009 FJ966974 K V S S A A S V A G

A/India/LKO2131/2012 KC792296 I T T T 22-08-2012 22/MA/India/LKO2151/2012 KC753452 T T T 24-08-2012 13/MA/India/LKO2160/2012 KC792287 T T 25-08-2012 3/FA/India/LKO2238/2012 KC792288 I T T T 01-09-2012 2/MA/India/LKO2288/2012 KC792289 I T T T 04-09-2012 25/MA/India/LKO2300/2012 KC792290 I T T T 05-09-2012 25/MA/India/LKO2335/2012 KC792291 I T T T 06-09-2012 50/MA/India/LKO2383/2012 KC792294 T T T 10-09-2012 11/MA/India/LKO2414/2012 KC792285 T T T 11-09-2012 12/MA/India/LKO2605/2012 KC792295 Q T T — 25-09-2012 22/MA/India/LKO2673/2012 KF500969 T I T T E 01-10-2012 25/FA/India/LKO2711/2012 KC792292 T T 05-10-2012 72/MA/India/LKO2727/2012 KC792293 06-10-2012 32/FA/India/LKO2782/2012 KF500955 T I T T E 10-10-2012 12/MA/India/LKO2832/2012 KF500955 Q T T T 13-10-2012 17/FA/India/LKO3228/2013 KF500973 T T T I 07-01-2013 22/MA/India/LKO3239/2013 KF500974 T T T I 07-01-2013 35/MA/India/LKO3357/2013 KF500957 Q P T T T 19-02-2013 52/MA/India/LKO3379/2013 KF500970 Q P T T T 21-02-2013 68A/India/LKO3386/2013 KF500958 Q T T T 22-02-2013 57/FA/India/LKO3394/2013 KF500972 Q P T T T 23-02-2013 50/FA/India/LKO3396/2013 KF500971 Q T T T 23-02-2013 30/FA/India/LKO3409/2013 KF500959 Q P T T T 25-02-2013 13/MA/India/LKO3416/2013 KF500962 T T T I 26-02-2013 55/FA/India/LKO3426/2013 KF500961 T T T I 27-02-2013 30/FA/India/LKO3487/2013 KF500975 Q T T T 11-03-2013 60/MA/India/LKO3495/2013 KF500963 Q T T T 18-03-2013 35/FA/India/LKO3506/2013 KF500964 T T T 20-03-2013 26/MA/India/LKO3518/2013 KF500968 T I T T E 22-03-2013 75/MA/India/LKO3536/2013 KF500965 Q P T T T 26-03-2013 11/FA/India/LKO3538/2013 KF500966 Q P T T T 27-03-2013 24/FA/India/LKO3691/2013 KF500976 Q T T T 29-04-13 42/MA/India/LKOS415/2013 KF500960 Q T T T 12-05-2013 30/FA/India/LKO3828/2013 KF500967 T T T I 24-06-2013 38/M

J. Med. Virol. DOI 10.1002/jmv

Molecular Characterization of Pandemic Strains 2139

[Mir et al., 2012]. A Eurosurveillance report revealedthe A203T mutation in few A(H1N1)pdm09 strainscirculating during the years 2011 and 2012[ECDC, 2011; ECDC, Dec 2012]. One study fromJapan demonstrated the presence of A203T mutationin 5 out of 207 influenza A(H1N1)pdm09 strainsduring peak phase of 2009 pandemic [Morlighemet al., 2011]. Mutation A214T was identified only innine Lucknow strains circulating in 2012, that wasalso reported in A(H1N1)pdm09 strains circulating inJapan, UK, Russsia, and India [Galiano et al., 2011;Solomina et al., 2011; Inoue et al., 2012; Miret al., 2012]. Mir et al. [2012] observed a substitutionS200P (Sb antigenic site of HA1 domain) in 2010Delhi strains that was also seen in 2012 and 2013Lucknow strains. Two mutations at 180 amino acidposition [K180T and K180I] were seen in Lucknowstrains from 2012 and 2013 influenza season. Fewstudies reported K180T mutation in A(H1N1)pdm09strains isolated in year 2009 [Mak et al., 2011], whileK180T/I mutation was identified in A(H1N1)pdm09strains from the 2010, 2011, and 2012 influenzaseasons [ECDC 2012; Li et al., 2012].Other mutations found in Lucknow A(H1N1)pdm09

sequences include V190I (V173I), V251I (V234I),andA273T (A256T) in the vicinity of the Ca1 antigen-ic site of HA1 domain, may be antigenically signifi-cant and have implication in vaccine efficacy infuture [Potdar et al., 2010; Gunasekaran et al., 2012].Studies from Norway, Australia and Singapore re-ported D222G mutation in the receptor bindingdomain of HA molecule as a pathogenesis relatedmarker [Liu et al., 2010] and showed an associationwith the severity of A(H1N1)pdm09 cases [Kilanderet al., 2010; Rykkvin et al., 2013]. In the presentstudy, change at 222 amino acid position was notobserved in any of the isolates including the isolatesfrom two fatal cases.Demographic data revealed higher incident rate of

A(H1N1)pdm09 virus in >5–15 years of age groupwhich may be due to high exposure rates amongschool going children having higher contact ratesthan others [Greer et al., 2010]. CDC also reportedthat the overall attack rate was the highest amongchildren aged 5–14 years. In 2009, A(H1N1)pdm09strain was characterized by high morbidity in adultswhile mortality was higher in children and eldersaged >60 years [Greer et al., 2010]. Several studiesreported that influenza A(H3N2) and influenza Binfection usually affects >1–15 years of age group[Greer et al., 2010; Das et al., 2011; Brooret al., 2012]. Influenza A(H3N2) and influenza Bviruses infect the people of all age group but childrenand elders are more prone to infection, possibly dueto a weaker immune system in these individuals.Several studies show that A(H1N1)pdm09 virus

was more pathogenic with more of gastrointestinalsymptoms in comparison to influenza A(H3N2) andinfluenza B viruses [Dawood et al., 2009; WHOreport, 2009]. However, present study reveals milder

clinical symptoms and lesser of gastrointestinalsymptoms (vomiting and diarrhea) in patients in-fected with A(H1N1)pdm09 virus. This indicatestowards the possibility that genetic changes inA(H1N1)pdm09 strains are leading to variations inclinical presentations of the patients in post-pandem-ic period. Determining clinical presentations associat-ed with different strains is useful for epidemiologicalcomparison and help clinicians to understand effec-tive control strategies.Any of the newly sequenced viruses may repre-

sent reassortant viruses (with genes from otherlineages in the rest of the genome) but the presenceof reassortant lineages could not be investigatedhere as this study is limited to partial HA genesequencing. Whole genome sequencing of influenzavirus would give complete information about reas-sortment events to confirm the identity of a givenlineage and the potential emergence of drug resis-tant/more virulent strains for future surveillance.However, the present study showed evidence ofpredominant circulation of clade seven havingS220T mutation at the Ca antigenic site. In presentstudy, two major substitutions were also identifiedalong with a few minor substitutions at or in thevicinity of the signature positions of the receptorbinding site, the significance of which needs to beaddressed.

ACKNOWLEDGMENT

We are thankful to staff of influenza and VDLproject for support in collection of samples.

REFERENCES

Barrero PR, Viegas M, Valinotto LE, Mistchenko AS. 2011. Geneticand phylogenetic analyses of influenza A H1N1pdm virus inBuenos Aires, Argentina. J Virol 85:1058–1066.

Brockwell-Staats C, Webster RG, Webby RJ. 2009. Diversity ofinfluenza viruses in swine and the emergence of a novel humanpandemic influenza A(H1N1). Influenza Other Respir Viruses3:207–213.

Broor S, Krishnan A, Roy DS, Dhakad S, Kaushik S, Mir MA,Singh Y, Moen A, Chadha M, Mishra AC, Lal RB. 2012.Dynamic patterns of circulating seasonal and pandemicA(H1N1) pdm09 Influenza viruses from 2007–2010 in andaround Delhi, India. PLoS ONE 7:e29129.

Chan KH, To KK, Hung IF, Zhang AJ, Chan JF, Cheng VC, Tse H,Che XY, Chen H, Yuen KY. 2011. Differences in antibodyresponses of individuals with natural infection and thosevaccinated against pandemic H1N1 2009 influenza. Clin Vaccineimmunol 18:867–873.

Das RR, Sami A, Lodha R, Jain R, Broor S, Kaushik S, Singh BB,Ahmed M, Seth R, Kabra SK. 2011. Clinical profile and outcomeof swine flu in Indian children. Indian Pediatr 48:373–378.

Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, Garten RJ,Gubareva LV, Xu X, Bridges CB, Uyeki TM. 2009. Emergence ofa novel swine-origin influenza A(H1N1) virus in humans. NEngl J Med 360:2605–2615.

Eurosurveillance (ECDC) report. 2011. Influenza virus charac-terisation, summary Europe. May–June 2011. Available on:http://www.ecdc.europa.eu/en/publications/Publications/1108_SUR_Influenza_virus_characterisation_July.pdf

Eurosurveillance (ECDC) report. 2012. Influenza virus characterisa-tion, summary Europe. December 2012. Available on: http://www.ecdc.europa.eu/en/publications/Publications/influenza-virus-characterisation-CNRL-dec-2012.pdf

J. Med. Virol. DOI 10.1002/jmv

2140 Dangi et al.

Furuse Y, Suzuki A, Oshitani H. 2010. Evolutionary analyses onthe HA gene of pandemic H1N1/09: Early findings. Bioinforma-tion 5:7–10.

Galiano M, Agapow PM, Thompson C, Platt S, Underwood A, EllisJ, Myers R, green J, Zambon M. 2011. Evolutionary pathways ofthe pandemic influenza A(H1N1) 2009 in the UK. PLoS ONE 6:e23779.

Garten RJ, Davis CT, Russell CA, Shu B, Lindstrom S, Balish A,Sessions WM, Xu X, Skepner E, Deyde V, Okomo-Adhiambo M,Gubareva L, Barnes J, Smith CB, Emery SL, Hillman MJ,Rivailler P, Smagala J, de Graaf M, Burke DF, Fouchier RA,Pappas C, Alpuche-Aranda CM, Lopez-Gatell H, Olivera H,Lopez I, Myers CA, Faix D, Blair PJ, Yu C, Keene KM, DotsonPD, Boxrud D, Sambol AR, Abid SH, St George K, BannermanT, Moore AL, Stringer DJ, Blevins P, Demmler-Harrison GJ,Ginsberg M, Kriner P, Waterman S, Smole S, Guevara HF,Belongia EA, Clark PA, Beatrice ST, Donis R, Katz J, Finelli L,Bridges CB, Shaw M, Jernigan DB, Uyeki TM, Smith DJ,Klimov AI, Cox NJ. 2009. Antigenic and genetic characteristicsof swine origin 2009 A(H1N1) influenza viruses circulating inhumans. Science 325:197–201.

Gerhard W, Yewdell J, Frankel ME, Webster R. 1981. Antigenicstructure of influenza virus haemagglutinin defined by hybrid-oma antibodies. Nature 290:713–717.

Graham M, Liang B, Domselaar GV, Bastien N, Beaudoin C, TylerS, Kaplen B, Landry E, Li Y. 2011. Nationwide molecularsurveillance of pandemic H1N1 influenza A virus genomes:Canada, 2009. PLoS ONE 6:e16087.

Greer AL, Tuite A, Fisman DN. 2010. Age, influenza pandemicsand disease dynamics. Epidemiol Infect 138:1542–1549.

Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithmto estimate large phylogenies by maximum likelihood. Syst Biol52:696–704.

Gunasekaran KK, Arunagiri K, Sambasivam M, Lakshmipathy M,Arunpon Fathima SG. 2012. Genetic analysis of HA gene ofpandemic H1N1 2009 influenza viruses circulating in india.Indian J Med Microbiol 30:346–349.

Igarashi M, Ito K, Yoshida R, Tomabechi D, Kida H, Takada A.2010. Predicting the antigenic structure of the pandemic (H1N1)2009 influenza virus hemagglutinin. PLoS ONE 5:e8553.

Ilyicheva T, Susloparov I, Durymanov A, Romanovskaya A, Shar-shov K, Kurskaya O, Ignashkina M, Shestopalov A. 2011.Influenza A/H1N1pdm virus in Russian Asia in 2009–2010.Infect Genet Evol 11:2107–2112.

Inoue E, Ieko M, Takahashi N, Osawa Y, Okazaki K. 2012.Phylogenetic analyses of pandemic influenza A(H1N1) virus inuniversity students at Tobetsu, Hokkaido, Japan. MicrobiolImmunol 56:273–279.

Kilander A, Rykkvin R, Dudman SG, Hungnes O. 2010. Observedassociation between the HA1 mutation D222G in the 2009pandemic influenza A(H1N1) virus and severe clinical outcome,Norway 2009–2010. Euro Surveill 15:194–198.

Knossow M, Skehel JJ. 2006. Variation and infectivity neutraliza-tion in influenza. Immunology 119:1–7.

Li J, Shao TJ, Yu XF, Pan JC, Pu XY, Wang HQ, Kou Y. 2012.Molecular evolution of HA gene of the influenza A H1N1 pdm09strain during the consecutive seasons 2009–2011 in Hangzhou,China: Several immune-escape variants without positively se-lected sites. J Clin Virol 55:363–366.

Liu Y, Childs RA, Matrosovich T, Wharton S, Palma AS, Chai W,Daniels R, Gregory V, Uhlendorff J, Kiso M, Klenk HD, Hay A,Feizi T, Matrosovich M. 2010. Altered receptor specificity andcell tropism of D222G hemagglutinin mutants isolated from fatalcases of pandemic A(H1N1) 2009 influenza virus. J Virol84:12069–12074.

Mak GC, Leung CK, Cheng KC, Wong KY, Lim W. 2011. Evolutionof the haemagglutinin gene of the influenza A(H1N1)2009 virusisolated in Hong Kong, 2009–2011. Euro Surveill 16: pii¼19807.Available online: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId¼19807

Mir AM, Lal RB, Sullender W, Singh Y, Garten R, Krishnan A,Broor S. 2012. Genetic diversity of HA1 domain of hemaggluti-nin gene of pandemic influenza H1N1 pdm09 viruses in NewDelhi, India. J Med Virol 84:386–393.

Morlighem JE, Aoki S, Kishima M, Hanami M, Ogawa C, Jalloh A,Takahashi Y, Kawai Y, Saga S, Hayashi E, Ban T, Izumi S,Wada A, Mano M, Fukunaga M, Kijima Y, Shiomi M, Inoue K,Hata T, Koretsune Y, Kudo K, Himeno Y, Hirai A, Takahashi K,Sakai-Tagawa Y, Iwatsuki-Horimoto K, Kawaoka Y, Hayashi-zaki Y, Ishikawa T. 2011. Mutation analysis of 2009 pandemicinfluenza A(H1N1) viruses collected in Japan during the peakphase of the pandemic. PLoS ONE 6:e18956.

Mullick J, Cherian SS, Potdar VA, Chadha MS, Mishra AC. 2011.Evolutionary dynamics of the influenza A pandemic (H1N1) 2009virus with emphasis on Indian isolates: Evidence for adaptiveevolution in the HA gene. Infect Genet Evol 11:997–1005.

Nelson MI, Holmes EC. 2007. The evolution of epidemic influenza.Nat Rev Genet 8:196–205. DOI: 10.1038/nrg2053 Available at:www.nature.com/reviews/genetics

Nelson M, Spiro D, Wentworth D, Beck E, Fan J, Ghedin E, HalpinR, Bera J, Hine E, Proudfoot K, Stockwell T, Lin X, GriesemerS, Kumar S, Bose M, Viboud C, Holmes E, Henrickson K. 2009.The early diversification of influenza A/H1N1pdm. PLoS Curr 1:RRN1126.

Pariani E, Piralla A, Frati E, Anselmi G, Campanini G, Rovida F,Ranghiero A, Percivalle E, Amendola A, Baldanti F, Zanetti AR.2011. Early co-circulation of different clades of influenza A/H1N1v pandemic virus in northern Italy. J Prev Med Hyg52:17–20.

Parks D, Macdonald N, Beiko R. 2009. Tracking the evolution andgeographic spread of Influenza A. PLoS Curr 1:RRN1014.

Peiris JS, Poon LL, Guan Y. 2009. Emergence of a novel swineorigin influenza A virus (S-OIV) H1N1 virus in humans. J ClinVirol 45:169–173.

Potdar VA, Chadha MS, Jadhav SM, Mullick J, Cherian SS, MishraAC. 2010. Genetic characterization of the influenza A pandemic(H1N1) 2009 virus isolates from India. PLoS ONE 5:e9693.

Rykkvin R, Kilander A, Dudman SG, Hungnes O. 2013. Within-patient emergence of the influenza A(H1N1)pdm09 HA1 222Gvariant and clear association with severe disease, Norway. EuroSurveill 18: pii¼20369. Available online: http://www.eurosurveil-lance.org/ViewArticle.aspx?ArticleId¼20369

Sharma S, Parida M, Shukla J, Rao PVL. 2011. Molecularepidemiology of novel swine origin influenza virus (S-OIV) fromGwalior, India, 2009. Virol J 8:280.

Shiino T, Okabe N, Yasui Y, Sunagawa T, Ujike M, Obuchi M,Kishida N, Xu H, Takashita E, Anraku A, Ito R, Doi T, EjimaM, Sugawara H, Horikawa H, Yamazaki S, Kato Y, Oguchi A,Fujita N, Odagiri T, Tashiro M, Watanabe H. 2010. Molecularevolutionary analysis of the influenza A(H1N1)pdm, May–Sep-tember, 2009: Temporal and spatial spreading profile of theviruses in Japan. PLoS ONE 5:e11057.

Skehel JJ, Wiley DC. 2000. Receptor binding and membrane fusionin virus entry: The influenza hemagglutinin. Annu Rev Biochem39:531–569.

Solomina AA, Grudinin MP, Eropkin MI, Karpova LS, PisarevaMM, Komissarov AB, Konovalova NI, Gudkova TM, DanilenkoDM, Smorodintseva EA, Vo�ıtsekhovskaia EM, Kiselev OI. 2011.Analysis of pandemic influenza in Russia as a part of the globalprocess based on data of an influenza monitoring referencecenter. Zh Mikrobiol Epidemiol Immunobio 20–26.

Taubenberger JK, Morens DM. 2006. 1918 influenza: The mother ofall pandemics. Emerg Infect Dis 12:15–22.

Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: Improvingthe sensitivity of progressive multiple sequence alignmentthrough sequence weighting, position specific gap penalties andweight matrix choice. Nucl Acid Res 22:4673–4680.

WHO information for laboratory diagnosis of pandemic (H1N1),2009 virus in humans- revised protocol 23 November 2009.Available on: http://www.chp.gov.hk/files/pdf/CHP_Protocols_-for_the_Detection_of_Human_Swine_Influenza.pdf

WHO Update. 2010. Pandemic (H1N1) 2009 Update 112.August 6th, 2010. Available on: www.who.int/csr/don/2010_08-06/en

World Health Organization. 2009. Human infection with newinfluenza A (H1N1) virus: Clinical observations from Mexico andother affected countries. Wkly Epidemiol Rec 84:185–189.

J. Med. Virol. DOI 10.1002/jmv

Molecular Characterization of Pandemic Strains 2141