Molecular characterization of attenuated Japanese encephalitis live vaccine strain ML-17

Vaccine 24 (2006) 402–411

Molecular characterization of attenuated Japanese encephalitislive vaccine strain ML-17�

Paresh Sumatilal Shaha,b, Mariko Tanakaa, Afjal Hossain Khana, Edward Gitau MatumbiMathengea,d, Isao Fukec, Mitsuo Takagic, Akira Igarashia, Kouichi Moritaa,d,∗

a Department of Virology, Institute of Tropical Medicine, Nagasaki University, 1-12-4 Sakamoto, Nagasaki 852-8523, Japanb Department of Virology, National Institute of Virology, Pune, India

c Kan-onji Institute, The Research Foundation for Microbial Diseases of Osaka University, Kan-onji, Kagawa 768, Japand CREST, Japan Science and Technology Corporation, Saitama 332-0012, Japan

Received 28 March 2005; received in revised form 29 August 2005; accepted 27 October 2005Available online 4 November 2005

Abstract

tify genomica ), NS2A(1),NT 2 previouslye utant2 need toc a possibleb©

K

1

vtillRta

a

and

0casesdia,phali-evel-ne.n

most

on ofells,ssage

per-tedicity

0d

The Japanese encephalitis (JE) zoonotic vaccine strain ML-17 was sequenced and compared to related JE virus strains to identtenuation markers. Relative to its parental strain, JaOH0566, 25 nucleotide alterations and 10 amino acid changes to, prM/M(2S4B(3) and NS5(4) proteins were recorded. Both structural-gene changes were in the prM/M region (127Met→ Ile and 274Asn→ Thr).o study the effects of these prM/M changes, mutants bearing the changes were prepared using an infectious clone of JaOArS98stablished at this lab. Compared with JaOArS982, mutant 127(Met→ Ile) showed marked reduction in murine neuroinvasiveness. M74(Asn→ Thr), showed slight reduction. Neither mutant recorded ML-17-equivalent attenuation, implying that prM/M changesombine with other recorded genomic differences to cause attenuation. Importantly, ML-17 with its unchanged E region, presentsackbone candidate for preparation of “E-replacement” type live attenuated flavivirus chimeric vaccines.2005 Elsevier Ltd. All rights reserved.

eywords: Japanese encephalitis; ML-17 live attenuated zoonotic vaccine strain; Neuroinvasiveness

. Introduction

Japanese encephalitis virus (JEV) is a member of theFla-ivirus genus of the familyFlaviviridae. The virus is transmit-ed byCulex mosquitoes and causes severe viral encephalitisn humans[1]. Classic studies carried out in Japan[2] estab-ished pigs and birds as JEV’s principal viremic hosts. JEV,ike other flaviviruses, has a positive-sense single-strandedNA genome approximately 11 kb in length, which encodes

hree structural proteins, i.e. the capsid (C), membrane (M)nd envelope (E) proteins and seven non-structural (NS)

� The GenBank accession numbers of the sequences reported in this paperre AY508812 and AY508813∗ Corresponding author. Tel.: +81 95 849 7827; fax: +81 95 849 7830.

E-mail address: [email protected] (K. Morita).

proteins, i.e. NS1, NS2A, NS2B, NS3, NS4A, NS4BNS5[3].

The World Health Report 1996[4], estimates that 43,00cases occur every year with 11,000 deaths and 9000of disability in Asian countries, these include China, InNepal, Sri Lanka, Thailand and Vietnam. Japanese encetis is, therefore, currently targeted for the research and dopment of a safe and effective second-generation vacci

Researchers in Japan[5–8] have published reports othe use of a live attenuated JEV vaccine in swine, theimportant JEV amplifier host[2,9]. Yoshida et al.[10] devel-oped an attenuated strain, ML-17, by stepwise adaptatithe virulent JEV strain, JaOH0566 to monkey kidney cthe attenuation process involved in excess of 110 pacycles through a descending series of incubation tematures[10]. Experimentation in swine with the attenuaML-17 strain showed it to possess a higher immunogen

264-410X/$ – see front matter © 2005 Elsevier Ltd. All rights reserved.oi:10.1016/j.vaccine.2005.10.048

P.S. Shah et al. / Vaccine 24 (2006) 402–411 403

than that recorded for a commercially available killed-JEvaccine for veterinary use, and was capable of preventingviremia after challenge with a high dose of a virulent JEVstrain. The attenuated ML-17 strain replicated inCulextritaeniorhynchus at much lower titer levels than its parentalvirus strain and also showed no encephalitogenecity in mon-keys following intracerebral (i.c.) injection. Interestingly,the ability to cause viremia in pigs and the ability to growin C. tritaeniorhynchus were each lost at different stagesduring the course of attenuation of ML-17, thus it is assumedthat at least two mutations may have occurred at differentsites of the viral genome. The ML-17 strain is the onlyofficially approved and commercialized live attenuated-JEvaccine for animals in Japan and its efficacy and safetyhave been verified through its continued use over the last20 years.

Studies carried out on the JE Virus strain SA14 and itsvaccine derivatives assessing genome differences and specu-late on their relative importance[11,12], while nucleotide andamino acid changes at various regions of the genome are pre-sumed to impact on the viral phenotype either individually,severally, or through any number of possible combinations,it would however be quite difficult to ascertain which of thethree was the case without running through every permuta-tion. Studies have hence tended to focus on those changes theyconsidered most relevant, to date a preponderance of theseh enes

rusesh teinsw viralp

s tar-g ns ofd nesee Vax-J ratedb gthc es d viat

omei cter-i inesa of av nua-t

uceda , andi ter-m werec lter-a ns ofg sseds thed rusv

2. Materials and methods

2.1. Virus strains

The JE virus strains used in this study were JaOArS982,JaOH0566[14] and the ML-17 attenuated strain establishedby stepwise adaptation of the virulent JaOH0566 strain, inmonkey kidney cells at incubation temperatures ranging from25◦C to 37◦C [10]. The JaOH0566 strain was isolated fromthe brain of a JE patient using suckling mice in Osaka, Japanin 1966. The JaOArS982 strain was isolated from aCulexmosquito pool using theAedes albopictus clone cell lineC6/36 in Osaka, Japan 1982.

2.2. Cells

A. albopictus clone C6/36 cells[15] were used for viruspropagation and transfection, baby hamster kidney cells,BHK-21, were used for virus titration and porcine stable (PS)kidney cells for plaque assay. All the cell lines were culturedin Eagle’s minimum essential medium (E-MEM) supple-mented with 10% heat-inactivated fetal calf serum (FCS)and 0.2 mM non-essential amino acids at 28◦C for C6/36cells and 37◦C for BHK-21 and PS cells. The maintenancemedium was E-MEM with 2% FCS and 0.2 mM non-essentiala

2

revi-o nc l-t )p ays.

at8 fine( tog-r gcT NAe

2

dv l LS( yn-t er-f reeo 0-R,a i-fip gelaf CR

ave ascribed attenuation to changes in the structural gWork done on Japanese encephalitis and other flavivi

as thus far focused on the changes to the structural prohich would appear to have a definable impact on thehenotype.

Recent research on live attenuated flavivirus vaccineets the production of chimeric recombinants as a meaeveloping novel flavivirus vaccine candidates. The Japancephalitis live attenuated vaccine candidate ChimeriE, currently completing Phase 2 clinical trials, was geney replacing the structural PrM/M and E genes in a full-lenDNA clone of YF 17D virus (yellow fever live vaccintrain), it presents an example of the progress achievehis avenue[13].

Thus, as more chimeric scaffolds are sought it will becncreasingly important to establish the attenuation charastics of other previously approved live attenuated vaccnd determining, at the molecular level, those aspectsiral genome that are necessary and relevant for its atteion.

In the present study, the complete nucleotide and dedmino acid sequences of the attenuated ML-17 strain

ts wild type virulent parental strain, JaOH0566, were deined. Also, the nucleotide and amino acid sequences

ompared with other strains of JEV, and amino acid ations observed at the prM/M protein evaluated by meaenetically engineered mutant viruses. Finally, we assetrain ML-17’s potential to serve as the backbone forevelopment of “E-replacement” type chimeric flaviviaccines.

.mino acids, for all the cell lines.

.3. Virus propagation and purification

Large-scale virus propagation was performed as pusly described[16]. Briefly, 3.0 litres of C6/36 cells iulture (106 cells ml−1) were infected with virus at a muiplicity of infection (MOI) of 10 focus forming units (FFUer cell, and incubated in spinner bottle culture for 3–5 d

The infected culture fluid was centrifuged for 30 min000 rpm. The virus was then subjected to sulfate celluloSC) resin (Seikagaku Kogyo Co., Japan) column chromaaphy as described earlier[17]. Virus titre of the resultinoncentrated virus fluid was approximately 1011 FFU ml−1.he concentrated virus was immediately used for viral Rxtraction.

.4. Viral RNA extraction and RT-PCR

Viral RNA was extracted from 500�l of concentrateirus fluid, prepared as described above, using TrizoGibco BRL) following the manufacturer’s instructions. Shesis of first strand cDNAs from viral RNAs was pormed using ReverTra Ace (Toyobo) and each of thligo-nucleotide primers, i.e. 2670-2626-R, 5554-552nd 10976-10937-R (Table 1) followed by Long-PCR amplcation as previously described[17,18]. The amplified PCRroducts were visualized under UV light, excised from thend purified with the QIAEX-II Gel Extraction Kit (Qiagen®)

ollowing the manufacturer’s instructions. The purified P

404 P.S. Shah et al. / Vaccine 24 (2006) 402–411

Table 1Oligonucleotide primers used for long-PCR amplification of JEV genome

Primer Position Sequencea

a T7 promoter 1-45-S AAATTTAATACGACTCACTATAAGAAGTTTATCTGTGTGAACTTCTTGGCTTAGTATCGTTGb 515-471-R (479G → A) GGTCATCAAAAGCTTCCCCTGGAAATTCGACAACTTTATTGCTCCc 440-485-S (479G → A) CGCAAGCTTGGCAGTTGTCATAGCTTACGCAGGAGCAATAAAGTTGd 2670-2626-R GCTCCAATCTAGTGACAGATCTGACTCCGCACACGCCTTCCTTGTe 2501-2547-S CACAAGAAAAGAGATGAGATGTGGAAGTGGCATCTTTGTGCACAACGf 10976-10937-R AGATCCTGTGTTCTTCCTCACCACCAGCTACATACTTCGGg 944-900-R (919A → C) GGTAAATACCACGCGTTGACCGTTGGTACTGCCAACCATCCAGCCh 882-926-S (919A → C) TTCCTGGCGGCGACACTTGGCTGGATGCTTGGCAGTACCAACGGTi 515-471-R GGTCATCAAAAGCTTCCCCTGGAAATTCGACAACTTCATTGCTCCj 439-485-S CGCAAGCTTGGCAGTTGTCATAGCTTACGCAGGAGCAATGAAGTTGk 5554-5520-R GTCATGAAGATGGCTGCTGCCTCCCCTAATTCCACl 5414-5449-S ACTGATGTCACCGAACAGAGTGCCCAACTACAACCT

The letters S or C suffixed to a primer name indicate sense and complementary. Underlining in primer “a” indicates the T7 promoter sequence. Underlinedsingle letters in primers b, c, g and h indicate mutation sites.

a Primers were designed based on JaOArS982 (Sumiyoshi et al.[19]) for the full-length cDNA construction.

products were then used for direct sequencing and construc-tion of infectious cDNA clones.

2.5. Nucleotide sequencing

Sequencing of the whole ML-17 viral genome was per-formed. Two long-PCR products, amplified with primers T7-JE-1-45-S and 5554-5520-R and 5414-5449-S and 10976-10937-R were used as the sequencing templates (Table 1).BigDye terminator cycle sequencing reaction kit in an ABI310 automated sequencer (Applied Biosystems) accordingto the manufacturers instructions. Sequencing primers (datanot shown), with 20-mers of sense and reverse sequenceswith approximately 500-nucleotide intervals, were designedaccording to the known JEV sequence[19]. The cDNA frag-ments of 5′ and 3′ termini of the RNA were obtained using5′ and 3′ RACE method as previously described[20] andsequenced. The results were analyzed using DNASIS ver-sion 3.6 software (Hitachi software engineering).

2.6. Construction of recombinant full-length JEV cDNA

The construction of recombinant full-length JEV(JaOArS982) cDNA was carried out according to the con-struction strategy shown inFig. 1 using the long-PCR pro-c r1 ),c rasep l-l theg n1 n2 ctedf , byu mers,i9 -t al

sequence primers as shown inFig. 1. Also one revertant full-length JEV cDNA was constructed from ss-cDNAs generatedfrom recombinant virus MS-14, which possesses mutation at479G→ A (Met → Ile at amino acid position 127).

2.7. In vitro transcription and transfection

Infectious recombinant viral RNAs were synthesized froma full-length 11 kb cDNA using the AmpliScribe T7 Tran-scription Kit (Epicentre Technology, USA) and the RNAtranscripts were transferred by electroporation into C6/36cells using Gene Pulse II electroporation system (BIO-RAD)using the protocal previously described[17] The recombi-nant viruses were recovered after 5 days of transfection andpassaged once in C6/36 cells before aliquoting and freezingat−80◦C for subsequent biological characterization.

2.8. Infectivity assay by focus formation

Infectivity of viruses was measured by the focus formationassay, a modification of the procedure described earlier[21].The overlay medium used after infection of BHK-21 cellswith virus was 0.5% methyl cellulose in E-MEM containing1.0% FCS.

2.9. Phenotype assay by plaque formation

ed asd llp jectv rbedf erw p-p ed at3 ith5 ved.T uno-p

edure previously described[17]. A primer, T7 promote-45-S at the 5′ terminus of the non-coding region (UTRarries 22 nucleotides encoding the T7 RNA polymeromoter sequence at its 5′ end. Two recombinant ful

ength JEV cDNAs each with a single mutation inenome, i.e. 479G→ A (Met → Ile at amino acid positio27) and 919A→ C (Asn→ Thr at amino acid positio74), both located in the prM/M gene were constru

rom ss-cDNAs generated from the JaOArS982 strainsing the sense and reverse site-specific mutation pri

.e. 515-471-R (479G→ A) and 440-485-S (479G→ A) and44-900-R (919A→ C) and 822-926-S (919A→ C), respec

ively, in addition to T7 promoter 1-45-S other norm

To evaluate the plaque size, plaque assay was performescribed[22]. Briefly, PS cells were grown in twelve welates to a confluent monolayer. Serial dilutions of subiruses were inoculated onto the monolayer and adsoor 2 h at 37◦C with swirling every 30 min. The monolayas overlaid with 1.25% methyl cellulose in E-MEM sulemented with 1% FCS and the plates were incubat7◦C. Four-day post-infection, the cells were fixed w% formaldehyde for 1 h, and the agarose layer remohe plaques were then visualized by means of immeroxidase staining.


Fig. 1. Construction strategy for full-length genomic cDNA of mutant viruses by long-PCR procedure. The cDNA fragments were generated from extractedssRNA. Long grey boxes indicate DNA fragments synthesized by long-PCR amplification. The black triangle indicates the mutation site. Solid black rectangleat the 5′ end indicate location of T7 promoter sequence. The numbers in parenthesis indicate the number of cycles used for each set of long-PCR amplification.The figure shows only one representative construct, MS-14. MS-15 and MS-14 rev were all generated by similar means using the same strategy.

2.10. Mouse experiments

Three-week-old male C57BL/6N mice (Charles River),were inoculated with different dilutions of recombinantviruses, i.e. MS-14, MS-15, MS-14Rev, JaOArS982,JaOH0566 and attenuated ML-17 strain. The virus dilutionswere prepared in E-MEM containing 2% FCS. However,dosages were adjusted in such a manner as to deliverequivalent numbers of focus forming units of each virus.Typically, five mice were inoculated by intra-peritonealroute (IP) using 0.5 ml of virus solution for each virusdilution and observed for 4 weeks. The values for LD50were calculated according to a previously described method[23]. Inoculations and retro-orbital bleeding were carriedout under diethyl ether anaesthesia and the animals usedwere handled according to the regulations of the NagasakiUniversity animal experimentation facility.

3. Results

3.1. Sequence comparison of virulent JaOH0566 andattenuated ML-17 strain

The complete nucleotide sequences of the attenuatedML-17 strain (AY508812) and its wild type virulent strain,

JaOH0566 (AY508813) were determined bidirectionally. Theviral genomes of both strains were 10,976 nucleotides long.The single long open reading frames (10,296 nucleotides)represented 3432 amino acid residues beginning with the firstAUG codon at nucleotide residues 96–98. The 5′ and 3′ UTRswere found to be 95 and 585 nucleotides long, respectively.

Twenty-five nucleotides were changed in the wholegenome when the sequence of parent JaOH0566 strain wascompared with the sequence of ML-17, its attenuated descen-dant strain. Between them, twenty-three nucleotides differedin the coding regions and two in the 3′ noncoding region(UTR) of the genome. Out of the differences occurring inthe coding region, 2 occurred in prM/M, 2 in E, 1 in NS1,3 in NS2A, 2 in NS3, 5 in NS4B and 8 in NS5 genes.Among these, 10 changes resulted in amino acid substi-tutions. Two were in the prM/M protein (127Met→ Ile,274Asn→ Thr), 1 in NS2A (1209Ala→ Ser), 3 in NS4B(2462Asn→ Lys, 2463Val→ Ile, 2479Thr→ Ser) and 4in NS5 (2652Leu→ Met, 2751Pro→ Ala, 2896Thr→ Ala,3380Ser→ Asn) as recorded inTable 2. There was no aminoacid substitution in the E gene.

Nucleotide and amino acid substitutions between ML-17 and its parental for each region of the genome weredetermined and are shown inTable 3. As a comparativereference the table also shows the nucleotide and aminoacid substitutions that occur between the vaccine strain SA-


Table 2Differences of nucleotide and amino acid sequences between JaOH0566 andML-17

Gene NT AA

Position JaOH0566 ML-17 Position JaOH0566 ML-17

prM 479 G A 127 M IM 919 A C 274 N T

E 1139 T C2456 C T

NS1 3254 G ANS2A 3723 G T 1209 A S

3845 T C4080 T C

NS3 4997 C T5330 A G

NS4B 7319 A T7481 T C7484 T A 2462 N K7485 G A 2463 V I7533 A T 2479 T S

NS5 8052 C A 2652 L M8072 T G8132 A G8273 G A8349 C G 2751 P A8351 G C8784 A G 2896 T A10237 G A 3380 S N

3′NTR 10563 G A10804 G C

NT: nucleotide, AA: amino acid.

14-14-2 and its parental SA-14 (compiled from results ofstudies by Nitayaphan et al.[24] and Ni et al.[12]) as wellas between strains JaOH0566 and JaOArS982. The totalrelative percentage substitution of nucleotides and aminoacids for each comparison pair were calculated to be 0.23%and 0.29% between JaOH0566 and ML-17 strains, and

2.62% and 0.52% between JaOH0566 and JaOArS982 strain(Table 3).

The nucleotide sequences of JaOH0566 and JaOArS982strains showed 288 nucleotide changes in the whole genome.However, out of these 288 nucleotides only 18 changesresulted in amino acid change in C, prM/M, E, NS2A, NS3,NS4A and NS5. The NS1, NS2B and NS4B remained unaf-fected. The sense-mutation rate between JaOH0566 and ML-17 was 40% (10/25), while that between JaOH0566 andJaOArS982 was 6.25% (18/288).

It is also noted that substitution rates between the two wildtype strains were, more or less, similar for all regions of thegenome. In contrast, nucleotide and amino acid substitutionrates (1.45% and 2.61%) in NS4B region between JaOH0566and ML-17 strains were considerably higher than those ofother regions, i.e. (0–0.60% and 0–1.33%).

3.2. Amino acid sequence comparison with other strainsof JEV

Amino acid sequence of ML-17 was compared with sixother JEV strains isolated in Japan and China (JaOArS982,JaGAr01, Nakayama, Beijing, SA14, SA14-14-2). In thisalignment, particular attention was paid to the conservation ofthe ten amino acid differences identified between the ML-17and JaOH0566 strains seen inTable 2.

N,1 con-s otherJ nceso rolei ells.W L-1 dingfi acidc anda

Table 3Nucleotide and amino acid changes between JE virus parental, wild type an

Region Total number, NT/AA JaOHo566/ML-17, NT/AA A

5′ NTR 95/– 0/–C 381/127 0/0PrM 276/92 1/1M 225/75 1/1E 1500/500 2/0NS1 1236/412 1/0NS2a 501/167 3/1NS2b 393/131 0/0NS3 1857/619 2/0NS4a 867/289 0/0NS4b 345/115 5/3NS5 2715/905 8/43′ NTR 585/– 2/–

Total 10976/3432 25/10

Total % change –/– 0.23/0.29a SA14(CDC) and SA-14-14-2 (PDK) Ni et al.[12].

Eight of the amino acids at positions 127M, 274209A, 2462N, 2463V, 2479T, 2652L, and 3380S wereerved between parental JaOH0566 and, six of theEV strains, suggesting that the amino acid differebserved at these positions in ML-17 may have some

n virus attenuation and adaptation to monkey kidney chile the amino acid 2751A and 2896A observed in M

7, were common amongst six other JE viruses incluve wild-type strains, suggesting that these two aminohanges may not be important for virus adaptationttenuation.

d vaccine strains

SA14/SA-14-14-2a, NT/AA JaOHo566/JaOArS982, NT/A

1/– 0/–1/1 8/11/0 7/10/0 5/19/7 31/31/0 28/03/1 17/12/2 12/08/3 50/24/1 29/20/0 12/015/2 77/7

1/– 12/–

46/17 288/18

0.42/0.50 2.62/0.52


SA-14-14-2 is another live attenuated JE virus vaccinestrain developed and widely used in China[25]. Amino acidsequence alignment revealed that none of ML-17’s eight virusattenuation markers were shared with SA-14-14-2 strain,indicating these JE virus attenuation markers are unique toML-17.

3.3. Generation of variants with single mutations toprM/M structural proteins

Rapid generation of genetically engineered JEV wasdemonstrated earlier using the JaOArS982 strain[17]. Inorder to evaluate the impact of the alterations observed inthe structural region of ML-17’s genome, we generated twomutants according to the construction strategy inFig. 1. Des-ignated MS-14 and MS-15 each engineered mutant carriedone of the amino acid substitutions observed on structuralproteins (prM/M), i.e. (479G→ A; Met → Ile at amino acidposition 127) and (919A→ C; Asn→ Thr at amino acid posi-tion 274). Also prepared was a revertant, MS-14-Rev, whichwas generated from the mutant MS-14’s viral RNA usingthe same construction method as above. Two viable variantsand a revertant were successfully recovered within 5 daysof transfecting C6/36 cells with in vitro transcribed viralRNAs. Mutations and reversion were confirmed by molec-u 8 −1

fM

3

inedw waso ffer-e

Table 4Intra-peritoneal LD50 of mutants in C57BL/6N mice

Virus strain Mutation (protein) i.p.LD50 (FFU)

JaOH0566 Wild type 6.3× 101

ML-17 Vaccine strain >1.0× 106

JaOArS982 Wild type 1.6× 101

MS-14 127M→ I (prM) >1.0× 106

MS-15 274N→ T (M) 1.0× 103

MS-14 reva Wild type 3.2× 101

a MS-14 rev is a revertant of MS-14 generated from MS-14 genome usinglong-PCR based site specific mutagenesis.

The average plaque size obtained for the MS-14 variant andMS-15 variant were 1.8 mm and 1.9 mm, respectively. Whileslightly smaller neither was significantly different from theJaOArS982 parent strain’s average plaque size of 2.3 mm.The attenuated ML-17 strain showed a significantly smallerplaque size (0.5 mm) relative to JaOArS982 and the two MSvariants.

3.5. Neurovirulence of mutant viruses in mice

Groups of 5, 3-week-old C57BL/6N mice were inocu-lated intra-peritoneally (i.p.) with serial dilutions of ML-17, mutant viruses (MS-14, MS-15, and MS-14 rev, thegenetically engineered revertant from MS-14), and parentalstrains JaOArS982, and JaOH0566. The LD50 value foreach virus was determined (Table 4). Consistent with pre-vious results ML-17 showed complete loss of virulence evenat a dose of 1× 106 FFU/mouse. The wild type strains,JaOArS982 and JaOH0566 showed LD50 titers of 1.6× 101

and 6.3× 101 FFU, respectively. The mutant viruses, MS-14 and MS-15, showed LD50 titers of >1.0× 106 and1.0× 103 FFU, respectively. Revertant of MS-14 regainedneurovirulence, showing an LD50 of 3.2× 101 FFU.

F ) Phot L-17 straim (JaOH (error barsd

lar sequencing. The titers obtained were 1× 10 FFU mlor parental JaOArS982 strain and 4–7× 107 FFU ml−1 forS-14, M-15 and the revertant.

.4. The biological characterization of mutants

The plaque phenotype of the two mutants thus obtaas then determined in porcine stable kidney cells. Itbserved that MS-14 and MS-15 showed marginal dince when compared to the parent JaOArS982 strain (Fig. 2).

ig. 2. Plaque morphology on PS cells by immuno-staining assay. (autants (MS-14, MS-15), revertant MS-14 rev) and wildtype virusesisplay standard error).

ographic images of plaques produced by inoculation of attenuated Mn,0566, JaOArS982). (b) Bar graph comparison of mean plaque size


4. Discussion

Yoshida et al.[10] reported the attenuation of virulentJapanese encephalitis virus strain, JaOH0566 by stepwiseadaptation in monkey kidney cells and quail embryo fibrob-lasts to produce a live attenuated JE vaccine strain designatedML-17. The biological characterization of ML-17 revealedlow encephalitogenecity (0.6 LD50 per 0.03 ml) followingintracerebral (i.c.) injection into adult mice and no patho-genecity by the subcutaneous (s.c.) route. In suckling micethe ratio of i.c. to s.c. LD50 titers showed that ML-17 wassignificantly less neuroinvasive than its parental JaOH0566virus. In contrast to the parent virus, when ML-17 was inoc-ulated into 1-month-old piglets, no viremia was detectable.A very low infectivity rate (0–1.0%) was observed inC.tritaeniorhynchus. Experimentation in mice with attenuatedML-17 strain showed higher potency than a commercialkilled JE vaccine in preventing viremia after challenge withhigh dose of a virulent JE strain. The virus was also non-encephalitogenic in monkeys when inoculated by i.c. route.Thus, ML-17 a safe live attenuated JE vaccine, came to beused in Japan for swine immunization as the only governmentapproved JE live vaccines for domestic animals.

To characterize the molecular basis associated with JEvirus attenuation, the complete nucleotide sequence of ML-17 strain and its parental wild type JaOH0566 strain wered dingr dingr

ntedh twoo ains)w oteinc rr ino

acid changes in the envelope gene lead to changes in phe-notypic characteristics of flaviviruses, such as JEV, Loupingill virus, and Murray Valley Encephalitis virus[27–30]. Inter-estingly, the ML-17 envelope protein possesses no amino acidalteration when compared with its parental strain JaOH0566.Ten amino acid alterations were recognized, two on prM/Mproteins and eight on the non-structural proteins (Table 2).It is important to indicate that the ten amino acid changesassociated with ML-17 virus attenuation were distinct fromthose found in JE vaccine strain SA-14-14-2, the only otherfully molecularly characterized live attenuated JE vaccinestrain approved for prophylactic use. SA-14-14-2 is currentlyapproved for use for human patients in China and South Korea[12,13].

The relative percentage change in nucleotides and aminoacids between the vaccine strain ML-17 and its parentalstrains, compared with the changes recorded for SA14-14-2vaccine strain and its parental virus, collated from studies byNitayaphan et al.[24] and Ni et al.[12], are shown inFig. 3.The figure clearly shows that attenuating changes occur todifferent degrees and in disparate genomic regions for thetwo vaccine strains. The comparative percentage amino aciddifferences show that for the SA-14/SA-14-14-2 strain pairchange rates are higher in the C, E and NS2b regions whilefor the JaOr0566/ ML-17 strain pair changes occur in PrM, Mregions with a notably high percentage change at NS4b. Witht -14-1 atingA rer -s dis-t sarilyt n off ationm ct of

F genom in n( SA-14- espectivec ng data

etermined. Twenty-three nucleotide changes in the coegion leading to 10 amino acid alterations in the coegion and two changes in the 3′ UTR were detected (Table 2).

The results of the molecular characterization preseere differs from results suggested in earlier work onther JE vaccine strains (i.e. Nakayama and SA-14 strhere the consensus favored strong involvement of E prhanges in the attenuation process[26,12]. Several earlieeports on other flaviviruses have also shown that am

ig. 3. Relative percentage change in nucleotides and amino acids byNT) and amino acids (AA) between the two vaccine strains ML-17 andalculated region by region (*SA-14/SA-14-14-2 graph generated usi

he alignment of the two vaccine strains (ML-17 and SA4-2) against their parentals the locations of their attenuA changes, ML 17 (10AA) and SA-14-14-2 (15AA), a

evealed as distinct from each other[24]. This fact demontrates that flavivirus attenuation can result from totallyinct sets of genomic differences and is hence not neceshe result of a singular process or unique combinatioactors. It is, therefore, logical to propose that the attenu

arkers recorded here are specific to ML-17 and the impa

ic region. Graphical representation of the relative percentage changeucleotides14-2 (PDK) and their viral antecedents JaOH0566 and SA-14 (CDC), rly,collated from studies by Ni et al.[12] and Nitayaphan et al.[24]).


each difference worthy of examination and analysis. Topmostamongst these, in light of our long-term chimerization plans,are those mutations with structural implications. An align-ment comparison of ML-17’s 10 amino acid changes acrossfive wild type strains, JaOArS982, JaGAr0l, Nakayama, Bei-jing, SA14 and the SA-14-14-2 vaccine strain demonstratedthat eight amino acid alterations observed in ML-17 wereentirely unique to this particular strain, and further that ineach of the 8, the ML-17 parental’s (JaOH0566) amino acidwas conserved in all six comparison strains. This fortifiesthe position that these mutations are directly associated withthe biological characteristics recorded for ML-17. Two ofthe amino acid alterations, at ML-17’s NS5 protein, wereconserved amongst the 6 other viruses and are less likelyto be important from an attenuation standpoint. Studies onthe 3′-UTR, by Nickells and Chambers[31] and Proutski etal. [32], report that the region may influence virulence char-acteristics in the Yellow fever virus. In our study, we foundtwo nucleotide changes within the 3′ UTR. However, the firstis located within the NS5 proximal stable hairpin normallyreferred to as structure X, described by Proutski et al.[33,34]as bearing stretches of limited conservation and capable ofaccommodating several compensatory mutations.

The second 3′UTR change falls within a minor loop ofregion 3, just upstream of the cyclization domain but out-side the functionally important long stable hairpin structure( ta-t oft r vir-u

ofm -17( straina icallye labo-r ormo ruc-t rtherc them truc-t iont fulll y. Ad 82)c

eti-c cor-p ental.E allye virus[ roto-c seda d twom twoa M/M( sent

raised hydrophobicity on the hydropathy scale[35]. As shownin Fig. 2andTable 4, both mutants demonstrated slight reduc-tion of plaque size and reduction of neurovirulence in mice oni.p. inoculation. It should be noted that mice in some of thegroups infected with MS-14 mutant contracted encephali-tis in all three series of experiments, however, the mutantsshowed marked reduction of neurovirulence, while ML-17demonstrated no mortality by this inoculation route even at107 FFU virus challenge (data not shown). In the absenceof attenuation to ML-17-levels we conclude that two prM/Mmutations are markers of attenuation of ML-17, but that inter-action with other mutations in the nonstructural proteins arealso essential to effect the virus attenuation level of ML-17. Gritsun[36] demonstrated that the degree of attenuationof tick-borne encephalitis virus depends on the cumulativeeffects of point mutations.

Given that prime objectives of this study included, theestablishing of ML-17’s molecular attenuation profile witha view to using it as a backbone for assembling future fla-vivirus chimeric vaccine candidates, and determining thegene assortment that would best serve the purpose of attenu-ating a chimeric construct. Results from our virulence assess-ment experiments using the JaOArS982 mutagenesis vehicleestablished that each of the preM mutations produced somedegree of attenuation, we hence propose that the mutationsare important and should be retained in any ML-17-basedc

/Mr con-t turep s inti cidicc ry fort try[

/Mp is offl actv ctedp rev ffi-c

ncei thatt teina

om-m ll as3 siso at al ouldp cinep inedc ingb type

LSH). However, without specifically directed experimenion it would be difficult to ascertain the impact, if any,hese nucleotide differences in influencing attenuation olence in the ML-17 virus strain.

The disparity recorded for the relative distributionolecular attenuation markers for SA-14-14-2 and ML

Fig. 3) suggests the presence of unique markers in eachnd presents an avenue by which attenuation of genetngineered JE viruses vaccines may be pursued. Ouratory is addressing a variation of this avenue in the ff flavivirus vaccine candidate development through st

ural gene replacement type chimerization. In order to fularify the mechanism of strain ML-17’s attenuation atolecular level, we aimed to evaluate the capacity of s

ural amino acid differences recorded at the prM/M rego alter biological characteristics when construction of aength JaOH0566 cDNA presented unexpected difficultecision was made to employ a full-length JE V (JaOArS9DNA of established stability instead.

This in view of our long-term aims of establishing a genally engineered structural replacement chimeric virus inorating an attenuated flavivirus as the backbone pararlier we reported on the rapid generation of geneticngineered JEV using JaOArS982 strain as a backbone

17]. We were able to use this previously established pol to rapidly produce the JaOArS982 infectious clone us the assessment vehicle in this study. We generateutants, MS-14 and MS-15 each carrying one of themino acid alterations observed on structural proteins pri.e. 127Met-Ile and 274Asn-Thr) both changes repre

himeric clone assembled as a potential vaccine.At this stage it is not clear how the mutations to prM

educed virus virulence. Studies have shown that prMaining virus particles are more acid resistant than maarticles and present different configuration of epitope

he E protein than do mature particles[37]. The role of prMs to prevent irreversible conformational changes in the aompartments of the secretory pathway that are necessariggering fusion activity in the endosome during virus en38].

It is, therefore, believed that modification of the prMroteins has a role in determining the pathogenesavivirus and mutations in this region and could impirus infection character. The mutations may have afferM/M’s interaction with the E protein in the immatuirion, indirectly hampering maturation or hindering the eiency of replication.

The importance of the E protein in determining virules well established. Therefore, it is possible to speculatehe mutations in the prM through its effect on the E proltered the virulence of the virus.

Further studies with more recombinant viruses accodating mutations on nonstructural proteins as we

′ UTR found in the ML-17 might be useful for analyf flavivirus attenuation in detail and may be pursued

ater date. A better understanding of this phenomenon wrove beneficial in the evaluation of live attenuated vacroduced by genetic engineering. Knowledge thus obtaould help facilitate recombinant vaccine design, allowetter evaluation and reduced risk of reversion to a wild


genotype. Finally, based on our findings we propose thatML-17 represents a good candidate backbone virus for thegeneration of “E-replacement” type flavivirus live vaccineconstructs.

Acknowledgements

The authors are grateful to the staff of the departmentof Virology, Institute of Tropical Medicine, NagasakiUniversity, for their technical assistance and help. The firstauthor is recipient of the RONPAKU fellowship awarded bythe Japanese Society for the Promotion of Science (JSPS)for his work at the Institute of Tropical Medicine, NagasakiUniversity.

This study was supported in part by Grant-in-Aid forscientific research (No. 16017284) from the Ministry of Edu-cation, Science Sport and Culture of Japan, the Grant forResearch on Emerging and Re-emerging Infectious Diseases(H15-Shinko-19) from the Ministry of Health and Welfareand Labor of Japan and the 21st century Centers of Excellence[COE] program on “Global strategies for Control of tropicaland emerging infectious diseases” Nagasaki University.

References

ekgy

neseodynol

di-s;

ase:

ted:194–

onese

er-e for

dahalitis

Res

ofemiol

[ t al.halitis

[ tidehalitislogy

[12] Ni H, Chang GJ, Xie H, Trent DW, Barrett AD. Molecular basisof attenuation of neurovirulence of wild-type Japanese encephalitisvirus strain SA14. J Gen Virol 1995;76:409–13.

[13] Monath TP, Guirakhoo F, Nichols R, et al. Chimeric live, attenu-ated vaccine against Japanese encephalitis (ChimeriVax-JE): Phase 2clinical trials for safety and immunogenicity, effect of vaccine doseand schedule, and memory response to challenge with inactivatedJapanese encephalitis antigen. J Infect Dis 2003;188:1213–30.

[14] Hori H, Morita K, Igarashi A. Oligonucleotide fingerprint analysison Japanese encephalitis virus strains isolated in Japan and Thailand.Acta Virol 1986;30:353–9.

[15] Igarashi A. Isolation of Singh’sAedes albopictus cell clone sensitiveto dengue and chikungunya viruses. J Gen Virol 1978;40:531–44.

[16] Morita K, Igarashi A. Suspension culture ofAedes albopictuscells for flavivirus mass production. J Tissue Culture Methods1989;12:35–7.

[17] Morita K, Tadano M, Nakaji S, Kosai K, Mathenge EG, PandeyBD, et al. Locus of a virus neutralization epitope on theJapanese encephalitis virus envelope protein determined by useof long PCR-based region-specific random mutagenesis. Virology2001;287:417–26.

[18] Mathenge EGM, Parquet MC, Funakoshi Y, Houhara S, WongPF, Ichinose A, et al. Fusion PCR generated Japanese encephali-tis virus/dengue 4 virus chimera exhibits lack of neuroinvasiveness,attenuated neurovimlence, and a dual-flavi immune response in mice.J Gen Virol 2004;85:2503–13.

[19] Sumiyoshi H, Mori C, Fuke I, Morita K, Kuhara S, Kondou J, etal. Complete nucleotide sequence of the Japanese encephalitis virusgenome RNA. Virology 1987;161:497–510.

[20] Khan AH, Morita K, Parquet MC, Hasebe F, Mathenge EGM,Igarashi A. Complete nucleotide sequence of chikungunya virus

Virol

[ kagihalitis

[ ightt dis-

[ ent

[ tidehalitislogy

[ hehar-biol

[ etults in–64.

[ neu-sistant

[ perngereasesafety

[ inostant–5.

[ eyand

Virol

[1] Westaway EG, Brinton MA, Gaidamovich S S.Y.A., HorzinMS, Igarashi A, Kaariainen L, et al. Flaviviridae. Intervirolo1985;24:183–92.

[2] Scherer WF, Moyer JT, Izumi T. Immunologic studies of Japaencephalitis virus in Japan. V. Maternal antibodies, antibresponses and viremia following infection of swine. J Immu1959;83:620–6.

[3] Burke DS, Monath TP. Flaviviruses. In: Knipe DM, Howley PM, etors. Fields virology, vol. 1, fourth ed. USA: Williams and Wilkin2001. p. 1043–125.

[4] WHO (Geneva), The world Health report 1996. Fighting disefostering development; 1996. p. 49, 111.

[5] Kodama K, Sasaki N, Inoue YK. Studies of live attenuaJapanese encephalitis vaccine in swine. J Immunol 1968;100200.

[6] Fujisaki Y, Sugimori T, Morimoto T, Miura Y, Kawakami Y, NakanK. Immunization of pigs with the attenuated S-strain of Japaencephalitis virus. Natl Inst Anim Health Q 1975;15:55–60.

[7] Ueba N, Kimura T, Nakajima S, Kurimura T, Kitaura T. Field expiments on live attenuated Japanese encephalitis virus vaccinswine. Biken J 1978;21:95–103.

[8] Sasaki O, Karoji Y, Kuroda A, Karaki T, Takenokuma K, MaeO. Protection of pigs against mosquito-borne Japanese encepvirus by immunization with a live attenuated vaccine. Antiviral1982;2:355–60.

[9] Konno J, Endo K, Agatsuma H, Ishida N. Cyclic outbreaksJapanese encephalitis among pigs and humans. Am J Epid1966;84(2):292–300.

10] Yoshida I, Takagi M, Inokuma E, Goda H, Ono K, Takaku K, eEstablishment of an attenuated ML-17 strain of Japanese encepvirus. Biken J 1981;24:47–67.

11] Nitayaphan S, Grant JA, Chang GJ, Trent DW. Nucleosequence of the virulent SA-14 strain of Japanese encepvirus and its attenuated vaccine derivative, SA-14-14-2. Viro1990;177:541–52.

and evidence for an internal polyadenylation site. J Gen2002;83:3075–84.

21] Okuno Y, Fukunaga T, Tadano M, Okamoto Y, Ohnishi T, TaM. Rapid focus reduction neutralization test of Japanese encepvirus in microtiter system. Arch Virol 1985;86:129–35.

22] Mangada MNM, Igarashi A. Molecular and in vitro analysis of edengue type 2 viruses isolated from patients exhibiting differenease severities. Virology 1998;244:458–66.

23] Reed LJ, Muench H. A simple method of estimating fifty percendpoints. Am J Hyg 1938;27:493–7.

24] Nitayaphan S, Grant JA, Chang GJ, Trent DW. Nucleosequence of the virulent SA-14 strain of Japanese encepvirus and its attenuated vaccine derivative, SA-14-14-2. Viro1990;177:541–52.

25] Yu YX, Ao J, Chu YG, Font T, Huang NJ, Liu LH. Study on tvariation of Japanese B encephalitis virus V. The biological cacteristics of an attenuated live-vaccine virus strain. Acta MicroSin 1973;13:16–24.

26] Cao JX, Ni H, Wills MR, Campbell GA, Sil BK, Ryman KD,al. Passage of Japanese encephalitis virus in HeLa cells resattenuation of virulence in mice. J Gen Virol 1995;76(11):2757

27] Cecilia D, Gould EA. Nucleotide changes responsible for loss ofroinvasiveness in Japanese encephalitis virus neutralization-remutants. Virology 1991;181:70–7.

28] Monath TP, Arroyo J, Levenbook I, Zhang ZX, Catalan J, DraK, et al. Single mutation in the flavivirus envelope protein hiregion increases neurovirulence for mice and monkeys but decviscerotropism for monkeys: relevance to development and stesting of live, attenuated vaccines. J Virol 2002;76:1932–43.

29] Jiang WR, Lowe A, Higgs S, Reid H, Gould EA. Single amacid codon changes detected in louping ill virus antibody-resimutants with reduced neurovirulence. J Gen Virol 1993;74:931

30] Hurrelbrink RJ, McMinn PC. Attenuation of Murray vallencephalitis virus by site- directed mutagenesis of the hingeputative receptor-binding regions of the envelope protein. J2001;75:7692–702.


[31] Nickells M, Chambers TJ. Neuroadapted yellow fever virus 17D:determinants in the envelope protein govern neuroinvasiveness forSCID mice. J Virol 2003;77:12232–42.

[32] Proutski V, Gritsun TS, Gould EA, Holmes EC. Biological conse-quences of deletions within the 3′-untranslated region of flavivirusesmay be due to rearrangements of RNA secondary structure. VirusRes 1999;64:107–23.

[33] Proutski V, Gaunt MW, Gould A, Holmes EC. Secondary struc-ture of the 3′-untranslated region of yellow fever virus: implicationsfor virulence, attenuation and vaccine development. J Gen Virol1997;78:1543–9.

[34] Proutski V, Gould EA, Holmes EC. Secondary structure of the3′ untranslated region of flaviviruses: similarities and differences.Nucleic Acids Res 1997;15(25):1194–202.

[35] Kyte J, Doolittle RF. A simple method for displaying the hydropathiccharacter of a protein. J Mol Biol 1982;157:105–32.

[36] Gritsun TS, Desai A, Gould EA. The degree of attenuation of tick-borne encephalitis virus depends on the cumulative effects of pointmutations. J Gen Virol 2001;82:1667–75.

[37] Guirakhoo F, Bolin RA, Roehrig JT. The Murray Valley encephalitisvirus prM protein confers acid resistance to virus particles and altersthe expression of epitopes within the R2 domain of E glycoprotein.Virology 1992;191:921–31.

[38] Heinz FX, Stiasny K, P̈uschner-Auer G, Holzmann H, AllisonSL, Mandl CW, et al. Structural changes and functional con-trol of the Tick-borne encephalitis virus glycoprotein E by theheterodimeric association with protein prM. Virology 1994;198:109–17.

Documents

Molecular characterization of attenuated Japanese encephalitis live vaccine strain ML-17