Upload
lamdieu
View
218
Download
0
Embed Size (px)
Citation preview
MOLECULAR CHARACTERISATION OF
THE INTERGENIC REGIONS OF
BANANA BUNCHY TOP VIRUS
By
VIRGINIA AURORA HERRERA-VALENCIA
Plant Biotechnology Program
Science Research Centre
A thesis submitted for the degree of Doctor of Philosophy at
the Queensland University of Technology
2005
i
Abstract
Banana bunchy top virus (BBTV) is a circular, single-stranded (css)
DNA virus that belongs to the genus Babuvirus in the family Nanoviridae.
BBTV is responsible for the most devastating virus disease of banana known
as “bunchy top”, for which conventional control measures are generally
ineffective. Genetically engineered resistance appears to be the most
promising strategy to generate BBTV-resistant bananas but the success of
this strategy is largely dependent upon the molecular characterisation of the
target virus and knowledge of the virus life cycle, particularly the replication
strategy. This PhD study was aimed at the molecular characterisation of the
intergenic regions of BBTV, in order to complement the molecular information
currently available and to potentially contribute to the development of
transgenic resistance strategies against BBTV in banana.
Three putative iterative sequences (iterons; GGGAC) previously
identified in the BBTV intergenic regions were initially characterised. In order
to determine their role in the binding of the master BBTV replication initiation
protein (M-Rep), the putative iterons (F1 and F2 in the virion sense, and R in
the complementary sense) were independently mutated in a BBTV DNA-6
greater-than-genome-length clone (1.1 mer). The DNA-6 1.1 mers (native and
mutants) and the M-Rep-encoding component (DNA-1) were co-bombarded
into banana (Musa spp. cv.”Lady finger”) embryogenic suspension cells and
transient replication was evaluated by Southern hybridisation. Analysis of the
DNA-6 replicative forms showed a significant decrease of approximately 41%
for the F1 iteron mutant and 61% for the R iteron mutant in comparison with
ii
native levels. However, the mutation in the F2 iteron caused the most
dramatic effect, decreasing replication to levels barely detectable by Southern
hybridisation. These results suggest that the three iterons all play a role in
BBTV replication, most likely as recognition and binding sites for the M-Rep,
but that the F2 iteron appears to be the most important in replication.
Following the observation that all BBTV isolates sequenced to date
have identical iteron sequences, the extent to which the M-Rep would
recognise, bind and initiate replication of heterologous components from
geographically diverse BBTV isolates (the South Pacific and the Asian
groups) was evaluated. Cross replication assays revealed that heterologous
M-Reps from Fiji, Hawaii (South Pacific group) and Vietnam (Asian group)
were able to initiate replication of the coat protein-encoding component (DNA-
3) from the Australian BBTV isolate (South Pacific group). However,
replication of DNA-3 from the Vietnamese isolate was not initiated by
heterologous M-Reps from the two South Pacific isolates tested (Australia and
Hawaii). These results suggest that a broad-range transgenic resistance
strategy based on replication using Australian BBTV intergenic regions may
be successful as this region will be recognised by the M-Reps from both Asian
and South Pacific BBTV isolates. However, a Rep protein-mediated
resistance strategy will more likely be specific to geographical isolates and,
therefore, less suitable as a broad-range control strategy.
To further characterise the BBTV intergenic regions and to gain a
better understanding of the BBTV transcription process, the 5’ untranslated
regions (UTRs) of the major open reading frames (ORFs) associated with
each of the six BBTV DNA components were mapped. In all cases, the
iii
transcription start sites were located 3’ of a putative TATA box and the 5’
UTRs varied in length from 23 nucleotides (DNA-6) to 5 nucleotides (DNA-3).
Two potential transcription start sites (nt 84 and 87) were mapped for DNA-1,
but whether these represent the transcription start sites of the two genes
associated with DNA-1 remains to be determined. Two start sites were also
associated with DNA-2 which is thought to be monocistronic. Whether one of
these start sites is an artefact or whether they are due to natural sequence
variability of BBTV is unknown. These results now enable us to define the
transcribed regions of each BBTV DNA component and accurately predict
their promoter regions in an attempt to gain a fundamental understanding of
BBTV gene expression patterns.
iv
Table of Contents
Title Page
Abstract i
Table of Contents iv
List of Figures viii
List of Tables x
List of Abbreviations xi
Declaration xiii
Acknowledgements xiv
Dedication xv
Chapter 1: Literature Review 1
1.1 Family Geminiviridae 1
1.1.1 General information 1
1.1.2 Replication of geminiviruses 6
1.1.3 Geminivirus/host interactions 9
1.1.4 The role of iterons in geminivirus replication 12
1.2 A new family of circular ssDNA viruses: the Nanoviridae 18
1.2.1 General information 18
1.2.2 Genus Nanovirus 21
1.2.3 Iterons in nanoviruses 25
1.2.4 Genus Babuvirus: Banana bunchy top virus (BBTV) 27
1.3 Pathogen-derived resistance 34
1.4 Aims of this study 37
v
Chapter 2: General Materials and Methods 39
2.1 Protocols for gene cloning 39
2.1.1 Extraction of DNA from agarose 39
2.1.2 Ligations 39
2.1.3 Transformation of E. coli JM109 40
2.1.4 Preparation and transformation of heat-shock competent
XL1-Blue E. coli 40
2.1.5 Small-scale plasmid purification 41
2.1.6 Large-scale plasmid purification 42
2.2 Sequencing and analysis 42
2.3 Microprojectile bombardment 43
2.4 DNA extraction from banana cells 44
2.5 Southern hybridisation 45
2.5.1 Digoxigenin (DIG)-labelling of probes 45
2.5.2 Southern hybridisation 46
Chapter 3: Identification and Characterisation of the BBTV Iteron
Sequences 49
3.1 Introduction 49
3.2 Materials and Methods 51
3.2.1 Mutagenesis of F1 and R iterons 53
3.2.2 Mutagenesis of F2 and F1/F2 iterons 53
3.2.3 Replication assays 57
3.2.4 Statistical analysis 58
3.3 Results 58
3.4 Discussion 63
vi
Chapter 4: Evaluation of Cross Replication Between Asian and South
Pacific Groups of BBTV Isolates 69
4.1 Introduction 69
4.2 Materials and Methods 72
4.2.1 Amplification of BBTV genomic DNA 73
4.2.2 Construction of BBTV 1.1 mer DNA components 73
4.2.3 BBTV DNA-3 specific probe 78
4.2.4 Transient analysis of BBTV cross-replication 78
4.3 Results 79
4.3.1 Sequence analysis of South Pacific and Asian BBTV
isolates 79
4.3.2 Cross-replication of South Pacific and Asian BBTV
DNA components 84
4.4 Discussion 87
Chapter 5: Mapping the 5’ Ends of mRNAs Encoded by BBTV 96
5.1 Introduction 96
5.2 Materials and Methods 97
5.2.1 Plant material 97
5.2.2 RNA extraction 97
5.2.3 DNase treatment 98
5.2.4 RT-PCR controls 98
5.2.5 RLM-RACE to detect and characterise 5’ ends 99
5.2.6 Reverse transcription 103
5.2.7 PCR amplification of cDNA 5’ ends 103
vii
5.2.8 Analysis of 5’ RLM-RACE products from BBTV-
infected banana tissue 105
5.3 Results 106
5.3.1 RNA extraction and control RT-PCRs 106
5.3.2 Analysis of the 5’ UTRs of BBTV DNA-1 to –6
transcripts 108
5.4 Discussion 111
Chapter 6: General Discussion 115
Chapter 7: References 123
viii
List of Figures
Figure 1.1 Electron micrographs of virus particles 2
Figure 1.2 Genetic organisation of the four genera of the family
Geminiviridae 4
Figure 1.3 Modular organisation of a geminivirus origin of replication 15
Figure 1.4 Characteristic symptoms of banana bunchy top disease 28
Figure 1.5 Diagrammatic representation of the proposed genome
organisation of BBTV, and the general organisation of each one of the DNA
components, including the proposed function of the gene products 30
Figure 1.6 Putative Rep DNA-binding domains (iterons) of BBTV 35
Figure 1.7 Putative iterons of BBTV compared to the nanoviruses 36
Figure 3.1 Part of the sequence of the BBTV DNA-6 intergenic region with
boxes showing the location of the three putative iterons F1, F2 and R
(GGGAC) 51
Figure 3.2 Strategy for the construction of a mutated BBTV DNA-6 1.1 mer
component 54
Figure 3.3 Overview of the QuikChangeR site-directed mutagenesis method
(Stratagene) 56
Figure 3.4 (A-C) Replication of BBTV DNA-6 in bombarded ‘Ladyfinger’
banana embryogenic cell suspensions 59
Figure 3.5 (A,B) Replication of BBTV DNA-6 in bombarded ‘Ladyfinger’
banana embryogenic cell suspensions 64
ix
Figure 4.1 Overview of the InPAct strategy to control ssDNA viruses 71
Figure 4.2 General strategy for the construction of BBTV 1.1 mer
components 75
Figure 4.3 Sequence alignment of the four BBTV M-Rep proteins 80
Figure 4.4 Sequence alignment of the three BBTV DNA-3 components from
Australia, Fiji and Vietnam 81
Figure 4.5 Replication of Australian BBTV DNA-3 by its cognate (Australia)
and heterologous (Fiji, Vietnam) M-Reps (DNA-1) 85
Figure 4.6 Replication of BBTV DNA-3 derived from Fijian, Vietnamese and
Australian BBTV isolates by the M-Rep from Australia 86
Figure 4.7 Replication of BBTV DNA-3 derived from Fiji, Vietnam and
Australia by the master Rep from Hawaii 88
Figure 5.1 Overview of the RLM-RACE protocol 101
Figure 5.2 Agarose gel electrophoresis of RNA and RT-PCR samples 107
Figure 5.3 Sequence of cloned 5’ RACE products for each BBTV DNA
component 109
x
List of Tables
Table 1.1 Proposed roles for the nanoviruses components and their encoded
gene products 20
Table 3.1 Sequence of the primers utilised for the mutagenesis strategies and
to amplify the DNA-6 probe used in this work 52
Table 3.2 Densitometry readings based on the supercoiled, replicative form of
BBTV DNA-6 62
Table 4.1 Sequence of the primers used for the construction of BBTV DNA-1
and DNA-3 1.1 mers and to amplify the DNA-3 probe 74
Table 4.2 Qualitative evaluation of BBTV cross-replication between South
Pacific and Asian isolates 89
Table 5.1 PCR primers used as internal RT-PCR controls 100
Table 5.2 Sequence of the PCR GeneRacerTM primers and reverse gene
specific primers (GSP) used to amplify BBTV 5’ ends 104
xi
List of Abbreviations
BBTD = banana bunchy top disease
BBTV = Banana bunchy top virus
bp = base pair(s)
CLINK = cell cycle link protein
CP = capsid protein
CR-M = common region - major
CR-SL = common region - stem loop
dH2O = distilled water
DIG = digoxygenin
DNA = deoxyribonucleic acid
ds = double stranded
EDTA = ethylenediamine tetraacetic acid
g = gravitational force
hr = hour(s)
IAA = iso-amyl alcohol
kb = kilobase(s)
LB = Luria-Bertani
LIR = large intergenic region
min = minute(s)
mg = milligram(s)
ml = millilitre(s)
MP = movement protein
NSP = nuclear shuttle protein
xii
nt = nucleotide(s)
oc = open circular
ORF = open reading frame
PCNA = proliferating cell nuclear antigen
PCR = polymerase chain reaction
PDR = pathogen derived resistance
Rb = retinoblastoma
RCR = rolling circle replication
REn = replication enhancer protein
Rep = replication initiation protein
RLM-RACE = RNA ligase mediated rapid amplification
RNA = ribonucleic acid
Sat = satellite
sc = supercoiled
sec = second(s)
SIR = small intergenic region
ss = single stranded
TAE = Tris-Acetate-EDTA
TE = Tris EDTA
TrAP = transcriptional activator protein
Tris = Tris (hydroxymethyl)aminomethane
xiii
Declaration
The work contained in this thesis has not been previously submitted for a
degree or diploma at any other higher education institute. To the best of my
knowledge and belief, this thesis contains no material previously published or
written by another person except where due reference is made.
Signed: ………………………………………..
Date: ……………………………………………
xiv
Acknowledgements
I would like to thank my supervisor Professor James Dale for his advice and
support. Thanks for giving me the opportunity to learn from you and to grow
as a scientific researcher. I would also like to thank my associate supervisor
Associate Professor Rob Harding for his guidance and assistance. Special
thanks to Dr. Benjamin Dugdale for always being there and providing valuable
help and advice.
Thanks to the members of the Plant Biotechnology Program. For all the
things, big or small, that I learned from them and for the people that gave me
their friendship.
Thanks to the Queensland University of Technology, a great place to do
scientific research. I would also like to thank all the lab support and
administration staff, and special thanks to Diana O’Rourke and Jenny Mayes.
I would like to thank the “Consejo Nacional de Ciencia y Tecnología”
(CONACyT, México). This PhD would have never been possible for me
without the scholarship granted by CONACyT.
Thanks to Santy, I cannot thank you enough. Finally, I would like to thank my
parents, my brother and friends in Mexico (special thanks to Lety) for their
love, support and encouragement that took me through the good and bad
times with a clear light of hope for the future.
xv
Dedication
To the people of Mexico:
You great people, people that keep working, hoping, smiling, loving and
enjoying against all odds and against all times.
Your time of light will come, and we will all live and cherish the light.
I will continue working for you, and for better times, for times of light.
1
Chapter 1
Literature Review
1.1 Family Geminiviridae
1.1.1 General information
Currently, only two families of plant viruses are known to have ssDNA
genomes, the Geminiviridae and the Nanoviridae (Figure. 1.1). The
Geminiviridae is a large, diverse family of plant viruses that infect a broad
range of plants, including both monocots and dicots, and cause significant
losses to economically important crops worldwide. Geminiviruses have
geminate virions (ca. 18-30 nm), and circular single-stranded DNA (ssDNA)
genomes that replicate through double-stranded DNA (dsDNA) intermediates
in the nucleus of infected cells (Hanley-Bowdoin et al., 1999; Gutierrez,
2000). Geminiviruses contribute only a few factors for their replication and
transcription, and are dependent on the nuclear DNA and RNA polymerases
of their plant hosts. These properties are unusual among plant viruses, most
of which are RNA viruses or replicate through RNA intermediates using
virus-encoded replicases (Hanley-Bowdoin et al., 1999).
The Geminiviridae consists of four genera that differ with respect to
insect vector, host range and genome organisation. The genus Mastrevirus
contains the economically important Maize streak virus (MSV), which is also
the type species for this genus. All members have narrow host ranges and,
with the exception of Tobacco yellow dwarf virus (TYDV) and Bean yellow
dwarf virus (BeYDV) which infect dicotyledonous species, their host ranges
2
3
are limited to species in the Poaceae. Mastreviruses are transmitted by
leafhoppers in a circulative, non- propagative manner, and have genomes
comprising a single component of ssDNA.
The genus Begomovirus is the largest geminivirus genus, however, its
members have a narrow host range limited to dicot species. Begomoviruses are
transmitted by whiteflies and most members of this genus have their genomes
divided between two DNA molecules (bipartite) although a small number are
monopartite. The type species of this genus is Bean golden mosaic virus
(BGMV). The genus Curtovirus contains Beet curly top virus (BCTV) as the type
member, which causes an important disease affecting sugarbeet. Curtoviruses
are transmitted by leafhoppers in a circulative, non-propagative manner, and
they have a monopartite ssDNA genome like mastreviruses but infect dicot
plants like begomoviruses. The genus Topocuvirus is a recently designated
genus. Topocuviruses have a similar genome organisation to the curtoviruses
but are transmitted by the treehopper, Micrutalis malleifera. The type species of
this genus is Tomato pseudo-curly top virus (TPCTV) (Stenger, 1998; Hanley-
Bowdoin et al., 1999; Hull, 2002).
The genetic organisation of the four genera of the family Geminiviridae
has been reviewed by Gutierrez (2002) (Figure 1.2). Mastrevirus genomes
contain a large (LIR) and a small (SIR) intergenic region, which are located at
opposite sides of the circular viral genomic molecule, and intrinsic to the rolling
circle strategy by which these viruses
4
Fig. 1.2 Genetic organisation of the four genera of the family Geminiviridae.
Maps of the type members are shown: MSV (genus Mastrevirus), BCTV
(Curtovirus), TPCTV (Topocuvirus), and BGMV (Begomovirus). The gene
products are: RepA, replication initiation protein interacting with retinoblastoma
protein; Rep, replication initiation protein; REn, replication enhancer protein;
TrAP, transcriptional activator protein; MP, movement protein; CP, capsid
protein; NSP, nuclear shuttle protein; MPB, movement protein. The non-coding
regions (or part of them) are the LIR and SIR in mastreviruses, the intergenic
region (IR) in curtoviruses and topocuviruses, and the common region (CR) in
begomoviruses. The invariant TAATATTAC loop sequence is also indicated.
The downward arrow indicates the initiation site for rolling-circle DNA
replication. From Gutierrez (2002).
5
replicate. In addition, mastreviruses are characterized by (i) an ~80 nt-long
bound nucleic acid that is complementary to part of the SIR and present within
the virus particle, and (ii) the occurrence of splicing events in both the
complementary-sense (C-sense) and the viral-sense (V-sense) transcripts. The
mastrevirus genome encodes four proteins: RepA, exclusive to this genus, and
Rep, (both encoded on the C-sense strand) and the movement protein (MP) and
the capsid protein (CP), on the V-sense strand.
In curtoviruses, the V-sense strand encodes the V2 protein, in addition to
MP and CP, and the C-sense strand contains four open reading frames (ORFs)
that encode Rep (C1), C2, REn (a replication enhancer protein; C3) and protein
C4. The sole topocuvirus member, TPCTV, represents the least-well
characterised genus of geminiviruses and has a monopartite genome that is
organised similarly to that of curtoviruses.
Finally, the begomoviruses have bipartite genomes composed of circular
single-stranded molecules designated DNA A and DNA B. DNA A encodes the
CP on the V-sense strand while the C-sense strand encodes four proteins: Rep
(C1), TrAP (a transcriptional activator; C2), REn (C3) and C4. DNA B encodes
proteins directly involved in movement of viral DNA: NSP (nuclear shuttle
protein, formerly called BR1 or BV1) and MPB (movement protein encoded in
the B component, formerly known as BL1 or BC1). However, some
begomoviruses, such as Tomato yellow leaf curl virus, have been identified that
lack DNA B. For these viruses, all the viral products required for replication,
gene expression, whitefly transmission and systemic infection are encoded on a
single DNA component (Briddon et al. 2003).
6
An important aspect of geminivirology, which has expanded recently, is
the association of a variety of circular single-stranded DNA molecules with some
monopartite begomoviruses (Briddon 2003; Briddon et al., 2003; Mansoor et al.
2003; Idris et al., 2005). These small satellite-like DNA (satDNA) molecules can
be one of three types. The first begomovirus-associated satellite-like DNA is
associated with only one virus, Tomato leaf curl virus (ToLCV) from Australia
(Dry et al., 1993). This molecule, comprising 682 nt, had no apparent effects on
viral replication or symptoms but required ToLCV for replication, spread within
plants and insect transmission (Dry et al., 1997). This molecule is now thought
to represent a half unit-size, defective satDNA. The second type of satDNA is
known as DNA β. These molecules are typically ~1350 nt (approximately half
that of their “helper” begomoviruses) and encode a single ORF, the product of
which is involved in symptom induction. Like the ToLCV-sat, DNA β require their
helper viruses for replication, movement within plants and insect transmission.
In addition to DNA β, some monopartite viruses are also associated with
another cssDNA molecule of ~1350 nt which is known as DNA-1. DNA-1
contains a single ORF which encodes a replication-associated protein similar to
that of nanoviruses. As such, DNA-1 is capable of self replication but still relies
on its helper begomovirus for movement in plants and insect transmission.
1.1.2 Replication of geminiviruses
In 1991, Stenger et al. established that geminiviruses employed a rolling-
circle replication (RCR) strategy to replicate their genomes, and that
7
initiation of plus-strand synthesis occurred at some point within a 20 bp
sequence that is part of the conserved hairpin and includes the invariant
TAATATTAC loop sequence common to all geminiviruses.
DNA replication in geminiviruses can be divided into three stages
(Gutierrez, 2000). During the first stage (early infection), the genomic ssDNA is
converted into a dsDNA product that associates with cellular histones to form
viral minichromosomes, with the exclusive participation of proteins from the
infected cell since the dsDNA is the transcriptionally active template. In the
second stage, new dsDNA intermediates and ssDNA products are generated,
which in turn can be converted into dsDNA through a rolling-circle replication
(RCR) mechanism, in which the replication initiator protein (Rep) is the only
virus-encoded protein absolutely required. Rep protein initiates the reaction by
introducing an endonucleolytic nick within the nonanucleotide invariant loop
sequence located within the geminivirus intergenic region (LIR in
mastreviruses). After the initiation step, the factors required to complete the
rolling-circle phase are of cellular origin, and most of these replication factors
are absent, scarce or functionally inactive in differentiated cells, where viral
replication appears to take place. Hence, it has been suggested that viral
encoded proteins interact with different cellular processes controlling cell cycle,
to create a cellular environment permissive to replication. The third stage
involves the production of ssDNA product, which once sufficient proteins
involved in movement and capsid protein have accumulated, are actively
transported to neighbouring cells or encapsidated.
A recent analysis of the replicative DNA forms present during Abutilon
mosaic virus (AbMV) infection, indicated that the majority of DNA
8
intermediates were compatible with a recombinant-dependent replication (RDR)
model, providing some evidence that rolling circle replication does not fully
account for geminivirus DNA replication (Jeske et al., 2001). Preiss and Jeske
(2003) analysed geminiviruses from different genera and geographic origins
using cellulose chromatography in combination with an improved high resolution
two-dimensional gel electrophoresis, and concluded that multitasking in
replication is widespread, at least for African cassava mosaic virus (ACMV),
BCTV, Tomato golden mosaic virus (TGMV) and Tomato yellow leaf curl virus
(TYLCV). They further showed that multitasking was not a peculiarity of AbMV
as a consequence of adaptation to the vegetatively propagated host but a
widespread phenomenon among geminiviruses that infect dicots. However, it
still remains to be shown whether a geminiviral RDR mechanism completely
relies on host factors or is promoted by a viral protein.
There are three motifs conserved between geminivirus Rep proteins and
initiator proteins of prokaryotic rolling circle replicons (Hanley-Bowdoin et al.,
1999). It has been shown that the N-termini of the Rep proteins from WDV,
TYLCV and TGMV are sufficient to support DNA cleavage and ligation in vitro,
and the smallest peptide with cleavage/ligation activity includes a region from
amino acid 1 to 120 in the TGMV Rep. This region contains the conserved
Motifs I, II and III that are associated with the initiator proteins of other rolling
circle replication systems. Motif III (YXXK107) corresponds to the active site for
DNA cleavage, and mutation in this motif blocked DNA cleavage and replication
by TYLCV and TGMV Rep proteins. Deletion and site-directed mutagenesis of
Motifs I (FLTY18) and II (HLH60) of TGMV Rep also blocked DNA cleavage and
9
replication, but the precise roles of these motifs are not known (Hanley-Bowdoin
et al., 1999).
More recently, the 3D structure of the catalytic Rep domain of Tomato
yellow leaf curl virus (TYLCV) was determined by heteronuclear
multidimensional NMR spectroscopy (Campos-Olivas et al. 2002). The three
amino acid motifs that characterize the Rep catalytic domain are described as
follows: I (FLTYP), II (HxH) and III (YxxxY) or (YxxK). Motif III contained the
active site tyrosine(s), motif II was postulated as a metal ion binding site, and no
function was ascribed to motif I. The Rep structure revealed similarity to other
nucleic acid binding proteins. The comparison of the location of crucial amino
acids involved in binding of similar proteins, with those of motif I and motif II is
intriguing in that they appear to structurally coincide (Campos-Olivas et al.
2002).
1.1.3 Geminivirus/host interactions
During development, plant cells leave the cell division cycle and lack
detectable levels of DNA replication enzymes after differentiation. DNA
replication and cell division is confined to apical meristems, developing leaves
and the cambium of mature plants. Hence, viral replication may be restricted to
meristematic cells or geminiviruses may modify differentiated cells to induce the
synthesis of replication enzymes. Some geminiviruses are restricted to the
phloem and may replicate in procambial cells using pre-existing plant
machinery. However, other geminiviruses are not confined to vascular tissue
and, instead, are found in a variety of tissues (Hanley-Bowdoin et al. 2000).
10
Geminiviruses can be found in cells that have exited the cell division
cycle and thus, may not contain the replication enzymes needed for virus
replication (Hanley-Bowdoin et al. 2004). In the case of TGMV, both DNA and
viral replication proteins, Rep and REn, are found in differentiated mesophyll,
epidermal and vascular cells of leaves (Nagar et al., 1995). In fact, in vivo
labelling with a thymidine analogue, 5-bromo-2-deoxyuridine (BrdU), showed
that TGMV replicates in these cells, suggesting that host DNA replication was
activated in infected tissues. In addition, BrdU incorporation was shown to be
associated with both host and viral DNA in infected cells (Nagar et al., 2002),
indicating that the cells had acquired the ability to support efficient DNA
replication characteristic of S phase. Nevertheless, there is no evidence of
metaphase or other stages of cell division during TGMV infection, and tumors
are not associated with TGMV infection in Nicotiana benthamiana, possibly
because cell cycle progression is blocked in infected cells (Bass et al., 2000). In
contrast, Beet curly top virus (BCTV, curtovirus) and Bean yellow dwarf virus
(BeYDV, mastrevirus) both cause ectopic cell division and contain a functional
C4 protein that is apparently involved in this phenomena (Latham et al., 1997;
Liu et al., 1997, 1999b). TGMV contains no functional C4 homologue and thus
may not be able to drive plant cells through mitosis. Therefore, some
geminiviruses induce cell division in their hosts while others are found in cells
arrested in early mitosis (Bass et al. 2000). Either way, geminiviruses reprogram
gene expression in differentiated plant cells to induce accumulation of host DNA
replication machinery (Hanley-Bowdoin et al. 2004).
11
Geminiviruses are similar to mammalian DNA tumour viruses in that they
rely on host replication machinery and they can replicate in differentiated cells.
Like animal DNA viruses, geminiviruses encode proteins that can interact with
retinoblastoma-related proteins in plants (pRBR), which could be related to the
entry of the cell into S phase (Hanley-Bowdoin et al. 2004). This interaction has
been shown for mastreviruses (e.g. BeYDV, Liu et al., 1999b) and
begomoviruses (e.g. TGMV, Settlage et al., 2001), and even for nanoviruses,
the only other of plant ssDNA viruses (Aronson et al., 2000). In mastreviruses
and nanoviruses, the Rep and CLINK proteins, respectively, interact with pRBR
through an LxCxE motif (Liu et al., 1999b; Aronson et al., 2000). In contrast,
none of the begomovirus replication proteins contains an intact LxCxE motif,
suggesting they bind to pRBR via different mechanisms.
One of the host factors implicated in geminivirus replication is
proliferating cell nuclear antigen (PCNA), an essential, ubiquitous, and highly
conserved protein in eukaryotes that functions as a DNA sliding clamp (Castillo
et al., 2003). Analysis of the levels of host plant PCNA has suggested that host
transcription is activated by geminiviruses in mature leaves by relieving
pRBR/E2F repression. pRB family members negatively regulate cell cycle
progression, in part, through interactions with E2F transcription factors (Hanley-
Bowdoin et al. 2004). Nagar et al. (1995) first showed that geminivirus infection
induced the accumulation of PCNA, and that the viral Rep protein was sufficient
for induction. It was later determined that PCNA accumulation reflected
transcriptional activation of the host gene (Egelkrout et al., 2001). Expression of
the PCNA gene is high in young leaves of healthy N. benthamiana but is not
12
detectable in mature leaves of plants. However, both young and mature leaves
of TGMV-infected plants contain detectable levels of PCNA mRNA, indicating
that geminivirus infection affects the expression profile. Mutation of an E2F
consensus element in the PCNA promoter increased transcription in healthy
mature leaves. Thus, it was suggested that the geminivirus infection induced the
accumulation of a host replication factor by activating its gene in mature tissues,
most likely by overcoming E2F-mediated repression (Egelkrout et al., 2001).
More recently, it was demonstrated that the Rep and REn of Tomato
yellow leaf curl virus-Sardinia (TYLCV-Sar) interact with PCNA (Castillo et al.,
2003). These authors proposed that the interaction between PCNA and the viral
proteins involved in replication induces the assembly of the plant replication
complex (replisome) close to the virus origin of replication.
1.1.4 The role of iterons in geminivirus replication
Sequence-specific recognition of the origin of replication
Several authors have demonstrated that the geminivirus origin of
replication has to be recognized in a sequence specific manner by the viral Rep
protein for replication to occur (Fontes et al., 1992; Lazarowitz et al., 1992;
Fontes et al., 1994a, 1994b; Jupin et al., 1995; Choi and Stenger, 1995, 1996;
Behjatnia et al., 1998; Orozco et al., 1998; Chatterji et al., 1999; Liu et al.,
1999a; Lin et al., 2003). These authors identified the origin of replication 5’ of
the common region, and it has been demonstrated that the Rep protein binds to
repeated motifs, known as iterons, and that this binding is necessary for
replication (Fontes et al., 1994a; Jupin et al., 1995; Behjatnia et al., 1998).
13
However, in the case of TLCV, mutagenesis of the Rep binding motifs did not
abolish in vivo accumulation of the viral DNA, despite preventing high-affinity
Rep-binding in vitro (Lin et al., 2003). Although the reason for this observation is
yet to be determined, the authors suggest the possibility that TLCV and its
satellite are more permissive with respect to the requirement for high-affinity
Rep binding.
Both the spacing and sequence of the binding sites may contribute to
specificity in the origin recognition (Orozco et al., 1998; Chatterji et al., 1999).
Further, a differential contribution of the 5’ –proximal and 3’ –proximal elements
of the directly repeated motif has been observed both in the begomovirus TGMV
and the curtovirus BCTV (Fontes et al., 1994a; Choi and Stenger, 1996). In both
cases, the 3’ –proximal direct repeat contributed more to replication specificity,
probably acting as an essential cis-acting element for replication while the 5’
repeat possibly enhances replication. On the other hand, the 5’ iteron appears
to contribute more to replication in Tomato leaf curl virus-New Delhi (ToLCV-
Nde), where there was evidence that the amino acid 10 of the Rep protein
specifically recognizes the third base pair of the 5’ iteron (Chatterji et al., 1999).
Organisation of the geminivirus origin of replication
Fontes et al., (1994b) suggested that begomovirus replication origins
consist of at least three functional modules, which are: (i) a high affinity binding
site for the Rep protein that is located on the left side of the origin, which
contains the repeated motif (iteron) 5’ –TGGAGACTGGAG, (ii) the putative
stem-loop structure that delimits the right side of the origin and (iii) an
14
intervening sequence that contains at least one element that must interact
specifically with viral trans-acting factors for replication to occur in vivo (Fig.
1.3). The existence of this additional element was inferred from the inability of
TGMV DNA-A to replicate a BGMV mutant that carried both the high-affinity Rep
binding site and the stem-loop sequence of TGMV. From studies with TGMV,
Orozco et al. (1998) have also suggested replication probably requires an
interaction between two or more cis elements, most likely through the proteins
that recognize and bind them. In fact, Chatterji et al. (2000) have mentioned
that, though the recognition of cognate iterons may represent an important step
in the replication process, there might be other interactions between the iteron
sequences and, possibly, other yet-to-be identified proteins that recognize or
bind them, which might have some role to play in the replication process.
Organisation of iterons throughout the geminiviruses
Argüello-Astorga et al. (1994) carried out a phylogenetic and structural
analysis of the intergenic regions from 22 dicot-infecting and 8 monocot-
infecting geminiviruses. They identified iterons which were specific for each
geminivirus, but showed similar arrangement within phylogenetically defined
groups, and suggested these iterons may correspond to the geminiviral
replication-associated Rep protein-specific binding sites. According to their
phylogenetic analysis, there are two major evolutionary branches of dicot-
geminiviruses, one including geminiviruses from the Western Hemisphere
15
Fig. 1.3 Modular organisation of a geminivirus origin of replication. The relative
locations of the AL1 (AC1) binding site (hatched box) and the stem loop motif
in the origin are indicated. The invariant sequence and the AT-rich spacer
motif in the loop are marked. The limits of the DNA sequence that contains
the probable nick site for initiation of rolling circle replication are shown ( ).
Other sites in the origin that may be involved in additional interactions with
viral replication proteins are illustrated by the open boxes. Sites that may
function in a sequence-specific manner are marked by the large open
rectangle, whereas specific interactions that may be mediated by differential
spacing are indicated by the small open boxes (Fontes et al., 1994b).
16
(WH, America) and the second including viruses from the Eastern Hemisphere
(EH, Europe, Africa and Asia); a third phylogenetic line included SLCV and the
pepper jalapeño virus. Their analysis further revealed that in dicot-infecting
geminiviruses, the sequences of the iterons are, as a rule, specific for each
geminivirus, since they differ even between closely related members of each
subgroup (e.g. Israel, Sardinia, and Thailand isolates of TYLCV). Nevertheless,
with the exception of the SLCV branch, all of these elements are similar in
sequence to the octamer AATTGGAG, from which they may have evolved by
substitutions, insertions, or deletions. Their analysis of the dicot-infecting
geminiviruses also revealed (i) the spacing between the inverted repeat
elements found in WH geminiviruses is absolutely conserved, while in EH
geminiviruses the distance between the more 5’ distal iteron and the first iteron
from the pair clustered to the TATA box is less conserved, (ii) some
geminiviruses have iterons identical in sequence to those present in distantly
related viruses and (iii) in several cases, the TATA-proximal iteron is a shorter,
imperfect repeat maintaining a core of at least five bases with consensus
YGGDG.
Analysis of the monocot-infecting geminiviruses included a search for
motifs conserved between the putative structurally conserved element (SCE)
sequences and the A subregion. The search showed that in all monocot-
geminiviruses there was a 7- to 9-nucleotide element, which was identical
(except for Panicum streak virus, PanSV) to one present in the corresponding
SCE. This element is located 20-35 nucleotides downstream of the TATA box
for the replication associated protein gene. The orientation of the iterons is
17
conserved in all of these viruses. Additional features found for the monocot-
geminivirus iterons were (i) they are GC-rich and specific for each individual
virus and (ii) although there are some examples of completely duplicated iterons
within the SCE, in most cases, there is only a single complete iteron in the left
half of the SCE and a partial duplication on the right side. Finally, these authors
developed two hypotheses for the probable function of the identified iterons;
hypothesis 1 proposed that the iterons constitute the specific binding sites for
the Rep protein, while hypothesis 2 proposed that specific binding sites for the
monocot-geminivirus Reps reside in the SCE.
A Rep domain for the predicted iterons
Computer-assisted comparisons of Rep protein sequences have
identified a domain (the iteron-related domain, IRD) comprising 8-10 amino
acids, the primary structure of which varied between viruses with different
iterons, but was conserved among viruses with identical iterons (Argüello-
Astorga and Ruiz-Medrano, 2001). For all geminiviruses, the IRD is adjacent to
RCR Motif I and the conserved phenylalanine of the IRD is always separated
from the phenylalanine of Motif I by seven amino acids. The analysis revealed a
correlation between specific residues of Rep and nucleotides of its predicted
cognate iteron, thereby suggesting that the IRD may be a major component of
the specific DNA recognition domain of Rep. There was a strong correlation
between the IRD and iteron sequences of MSV isolates, with only two of the 30
IRD sequences diverging despite these correlating with strains harbouring
different iterons (Argüello-Astorga and Ruiz-Medrano, 2001).
18
1.2 A new family of circular ssDNA viruses: the Nanoviridae
1.2.1 General information
The Nanoviridae constitutes a recently recognised family of plant viruses
with genomes comprising multiple circular ssDNA genome components
encapsidated in small icosahedral particles. The family was recently divided into
two genera, Nanovirus and Babuvirus (Vetten et al. 2004). The nanoviruses
include Faba bean necrotic yellows virus (FBNYV), Milk vetch dwarf virus (MDV)
and Subterranean clover stunt virus (SCSV, the type species of this genus),
while the Babuvirus genus contains the sole member, Banana bunchy top virus
(BBTV).
Nanoviruses differ from geminiviruses in that their genomes consist of
multiple (at least six) circular ssDNA molecules each approximately 1 kb in size
and their virions are 17-20 nm icosahedral particles. The name Nanovirus,
derived from the Greek nanos, meaning small, refers to the fact that these plant
viruses have the smallest virions and genome segment sizes amongst all
characterised viruses. Individual species have narrow host ranges - FBNYV,
MDV, and SCSV naturally infect leguminous species, whereas BBTV has been
reported to infect only species within the genus Musa. Nanoviruses are often
associated with symptoms including stunting, leafroll and chlorosis, which can
significantly affect fruit production (in the case of BBTV and banana) and cause
premature death (Vetten et al., 2004).
None of these viruses can be transmitted mechanically either in sap or
after purification, and only SCSV has been shown to replicate in transformed
protoplasts. Under natural conditions, all the nanoviruses are transmitted by
19
aphids in a circulative (non-propagative) persistent manner (Vetten et al., 2004).
The minimum acquisition feed for FBNYV is 15-30 minutes and for BBTV is
within 4 hours. The inoculation access period for both viruses is 5-15 minutes,
and vectors can transmit the virus at any stage throughout its lifespan. The
persistent transmission of nanoviruses can be erratic, which may be attributed
to their multicomponent nature (Hu et al., 1996; Hull, 2002).
BBTV is widely distributed throughout banana-growing countries in the
Asia-Pacific region and Africa. SCSV occurs in Australia, FBNYV occurs in West
Asia and North and East Africa, and MDV occurs in Japan. The tentative
member, CFDV, is transmitted by a cixiid planthopper and occurs in Vanuatu
(Randles et al., 2000).
Antibody studies suggest the dicot-infecting nanoviruses, FBNYV, MDV
and SCSV, are all serologically related (Katul et al., 1997), while BBTV seems
to be serologically unrelated to any of the other assigned members (Vetten et
al., 2004).
All nanovirus genomes have a region capable of forming a stem-loop,
they also share some identity in the amino acid sequence of the capsid proteins
and each encodes a protein with a consensus retinoblastoma (Rb)–binding
motif (LXCXE) (Boevink et al., 1995; Burns et al., 1995; Katul et al., 1997; Sano
et al., 1998). Multiple Rep components seem to be a common feature of
nanovirus infection. However, a master Rep concept was established for
FBNYV and also applies to the other nanoviruses, MDV, SCSV and BBTV
(Timchenko et al. 2000; Horser et al. 2001a). Table 1.1 shows the different
20
components of each nanovirus and the proposed roles of their encoded gene
products (Boevink et al., 1995; Hafner et al., 1997b;
Table 1.1 Proposed roles for the nanoviruses components and their encoded
gene products.
Name
Function
FBNYV
MDV
SCSV
BBTV
Master
Rep
C2 C11 C8 DNA-1
Replication
initiation
C1, C7,
C9, C11
C1, C2,
C3, C10
C2, C6
W1, W2, S1,
S2, S3, Y1
Coat
protein
C5 C9 C5 DNA-3
pRB
binding
C10 C4 C3 DNA-5
Movement
protein
C4 C8 C1 DNA-4
Unknown C3, C6, C8 C5, C6, C7 C4, C7 DNA-2
Nuclear
shuttling
- - - DNA-6
21
Katul et al., 1997; Wanitchakorn et al., 1997; Sano et al., 1998; Timchenko et
al., 2000; Wanitchakorn et al., 2000a).
1.2.2 Genus Nanovirus
As mentioned previously, SCSV is the type member of the Nanovirus
genus. Subterranean clover stunt is an aphid-transmitted viral disease of
Trifolium subterraneum L. (subterranean clover) and several other pasture and
grain legumes in Australia, and can cause yield losses of up to 65%. Seven
components of one isolate of SCSV have been sequenced (Boevink et al.,
1995); these authors also reported a sequence in the non-coding region, which
can form a hairpin structure with a GC-rich stem and an AT-rich loop (potential
stem-loop sequence).
The sequence of one ssDNA component of CFDV has been reported
(Rohde et al., 1990) and it also contained a potential stem-loop. The putative
Rep for CFDV, encoded by ORF1, shares some similarities to the Reps of
geminiviruses and other nanoviruses (Merits et al., 2000).
FBNYV is associated with an economically important disease affecting
several legume crops in the Middle East and North Africa. FBNYV causes
stunting, leaf rolling and yellowing ultimately leading to necrosis and early death
of the plants, and it is persistently transmitted by the aphid species
Acyrthosiphon pisum and Aphis craccivora in which it does not replicate (Katul
et al., 1993). The first ssDNA component reported for this virus, from a Syrian
isolate (FBNYV-Sy), was designated FBNYV-C1 and encoded a putative Rep
22
(Katul et al., 1995). Five further ssDNA components of the FBNYV genome
were later sequenced and included a second putative Rep-encoding component
as well as the coat protein (CP)-encoding component (Katul et al., 1997).
Similar to FBNYV-C1, the non-coding region of each of the five ssDNA
components contained a highly conserved GC-rich region of 9 to 11 nt arranged
as inverted direct repeats separated by an AT-rich region of 11 nt which formed
a possible stem-loop structure. This region was found to be the only common
region among all six FBNYV components (Katul et al., 1997). Katul et al. (1998)
later reported the cloning, sequencing and analysis of a further four ssDNA
genome components from FBNYV-Sy and ten genome components from an
Egyptian isolate of FBNYV (FBNYV-Eg). Analysis of FBNYV-Eg suggested that
at least four Rep and six non-Rep encoding components were associated with
the genome. The gene product of FBNYV-C10 contained the amino acid motif,
LXCXE, which is present in the RepA proteins of mastreviruses and has been
shown to be required for efficient viral DNA replication (Katul et al., 1998).
Sano et al. (1998) reported the analysis of MDV genomic DNA. They
reported the sequences of ten ssDNA components associated with MDV, and
compared them with those available from related viruses. Components C1, C2,
C3 and C10 all encoded putative Rep-associated proteins, however, there was
no evidence that all four Rep proteins were essential for virus replication. The
observation that there are very similar counterparts of the putative Rep
components from MDV, FBNYV and SCSV indicates that the three viruses may
have evolved from a common origin. Based on overall sequence similarities,
23
MDV and FBNYV are more closely related to each other than to SCSV, but are
regarded as separate species.
Sano et al. (1998) also reported that proteins encoded by MDV-C4,
FBNYV-C10, SCSV-C3 and BBTV-C5 all contain the consensus retinoblastoma
(Rb)-binding motif (LXCXE) at equivalent positions, suggesting that they may be
involved in controlling the host cell cycle. The Rb tumour suppressor is the key
regulatory factor of cell cycle progression at the G1/S boundary in mammalian
systems. Tumour virus oncoproteins are known to interact with Rb by forming a
stable complex through the LXCXE motif, thereby driving the host cell cycle into
S phase, where the cellular environment is suitable for viral DNA replication
(reviewed by Lam et al., 1994). In fact, the FBNYV C10 gene product is able to
bind to members of the retinoblastoma tumour suppressor protein (pRB) family
and this interaction correlates with a stimulation of viral DNA replication. Based
on its ability to link viral DNA replication with key regulatory pathways of the cell
cycle, the FBNYV C10 gene product was named CLINK, an acronym for “cell
cycle link” (Aronson et al., 2000).
Timchenko et al. (1999) demonstrated the existence of a master
replication protein in FBNYV, ie. the only Rep protein with the ability to initiate,
in trans, the replication of all other genome components of FBNYV. The authors
further proposed that the concept of a modular arrangement of specificity
elements and a common initiation signal, recognised and acted on by Rep
proteins in a two-step process, is easily transferable from the bipartite genome
of some geminiviruses to the multipartite genome of the nanoviruses (Fontes et
al., 1994b). Timchenko et al. (1999) reported that only the protein encoded by
24
FBNYV C2 (Rep2) initiated the replication of all non-rep components in addition
to its cognate DNA. None of the other Rep proteins was able to trigger
replication of any DNA other than its cognate. Component C2 was detected in
all 55 samples from eight countries, thus providing independent evidence for
this DNA encoding a master Rep protein. The erratic distribution of the rep
components, C1, C7, C9, and C11 components in a geographically diverse
FBNYV samples tends to suggest that they may not be integral parts of the
FBNYV genome but rather autonomously replicating satellite components. As
yet, it is unknown whether these satellite-like components influence disease
symptoms, hence it is unclear as to whether they act as defective interfering
molecules (Timchenko et al., 1999).
Later, Timchenko et al. (2000) also showed that the master Rep concept,
established for FBNYV and based on a similar type of origin recognition, also
applies to other nanoviruses. They identified previously undescribed Rep
components from MDV and SCSV and demonstrated that they encode the
previously unidentified master Rep (M-Rep) proteins of these nanoviruses. In
addition to initiating replication of the respective virus’ CP-encoding DNA
component, the M-Rep proteins of FBNYV, MDV and SCSV were also shown to
support the replication of heterologous non-rep DNAs in various combinations
tested. Taking into account the presence of almost identical iteron sequences in
the origin regions of the three legume nanoviruses, such a cross-species
replication is readily explained by mutual origin recognition. Pseudorecombinant
viruses may represent starting points for selective adaptation through mutation
and intermolecular recombination, a major driving force in the evolution of
25
viruses (Timchenko et al., 2000). An interesting example of interfamiliar
coinfection and recombination between plant ssDNA viruses has been shown
for geminivirus infections of cotton (Gossypium hirsutum) in Pakistan (Mansoor
et al., 1999) and Ageratum conyzoides in Singapore (Saunders and Stanley,
1999). In both cases, nanovirus-like rep DNAs that supposedly contribute to
disease were encapsidated along with the geminivirus DNA. Moreover, a
chimeric defective geminivirus-nanovirus recombinant that included part of the
geminivirus DNA-A component and a nanovirus-like rep DNA was also found in
infected A. conyzoides (Saunders and Stanley, 1999). The association of an
autonomously replicating nanovirus-like rep DNA with two geminiviruses
resembles in some way the association of such additional rep DNAs with the
nanoviruses themselves (Timchenko et al., 2000). The intriguing question about
the significance of these rep DNAs will only be answered by the experimental
reproduction of the full biological infection cycle of a nanovirus using infectious
cloned copies of the complete genomic DNA. The challenge to fulfil Koch’s
postulate for any nanovirus remains unfulfilled and the role of these satellite-
type replicons in the evolution of these viruses remains unclear.
1.2.3 Iterons in nanoviruses
As previously stated, the master Rep (M-Rep) of FBNYV is capable of
initiating the replication of all non-rep components in addition to its cognate
DNA. The observation that DNA sequence motifs flanking the conserved
inverted repeat element are shared by M-Rep-encoding component (C2) and
the other six genome components, further suggests that such common
26
sequences may contain specificity elements for M-Rep recognition (Timchenko
et al., 1999). A sequence comparison of the non-coding regions of all FBNYV
DNAs revealed short conserved sequences in a region of about 70 nucleotides
shared by C2 and all non-rep DNAs. This region contained iteron-like
sequences in an arrangement reminiscent of geminivirus replication origins. The
existence of common sequence motifs in the replication origin regions of the M-
rep and non-rep DNAs of FBNYV, MDV and SCSV and the similarity among the
three M-Rep proteins suggested they might be capable of substituting for each
other in DNA replication initiation. In an experiment set up to evaluate this
hypothesis, it was shown that the M-Rep proteins of FBNYV, MDV and SCSV
supported the replication of a cognate non-rep DNA (ie. coat protein DNA)
(Timchenko et al., 2000). Furthermore, all three nanovirus M-Rep proteins also
supported replication of heterologous non-rep DNAs, such as the FBNYV cp
and C10 DNAs. However, in some combinations, quantitative differences in the
efficiency of this cross-species replication were observed. The M-Rep proteins
of FBNYV and MDV efficiently supported replication initiation of their respective
heterologous cp DNA. By contrast, replication initiation of MDV cp DNA by
SCSV M-Rep protein and, reciprocally, replication of SCSV cp DNA by the M-
Rep proteins of FBNYV and MDV were less efficient than that catalysed by the
cognate M-Rep protein of the respective virus. According to the authors this
observation may reflect slight differences in iteron sequences between the three
viruses.
27
1.2.4 Genus Babuvirus: Banana bunchy top virus (BBTV)
Bananas are one of the world’s most important crops, grown in all types
of tropical agricultural systems from small, mixed, subsistence gardens to very
large company-owned monocultures, and the export trade in bananas is
considerable (Dale, 1987). Banana bunchy top disease (BBTD) is the most
important virus disease affecting bananas causing characteristic crop damage
and often complete loss of fruit yield. Banana bunchy top virus (BBTV), the
causal agent of BBTD, is transmitted by the aphid vector Pentalonia
nigronervosa or through infected planting material (Dale, 1987). Undoubtedly
the most common means of transmission of BBTV in the field is by the aphid
vector. BBTV does not replicate within P. nigronervosa, so the virus-vector
relationship of BBTV has been suggested to be a persistent, circulative (non-
propagative) type (Hafner et al., 1995).
All cultivars of banana grown in Australia are susceptible to BBTV (Smith,
1972). In fact, Dale (1987) noted that all species, cultivars or types within the
genus Musa that have been challenged are susceptible to BBTV. The first
symptom-bearing leaf develops dark green streaks of variable length in the leaf
veins, midribs and petioles. Subsequent leaves become progressively dwarfed
and develop marginal chlorosis or yellowing. As the disease develops, the
leaves become more upright and crowded or bunched at the apex of the plant,
hence the name of the disease. The plant may produce no fruit or the bunch
may not emerge from the pseudostem depending on when the plant becomes
infected (Fig. 1.4). The control of BBTV in Australia has followed two main
directions, first the protection of uninfected areas by exclusion and second the
rehabilitation of infected areas
28
Fig. 1.4 Characteristic symptoms of banana bunchy top disease. A) Banana
plant showing leaves that have became dwarfed, present marginal yellowing
and are upright and bunched at the apex of the plant. B) A banana leaf showing
dark green streaks of variable length in the leaf veins and midribs, and marginal
chlorosis or yellowing.
A B
29
by eradication (reviewed by Dale, 1987). The “second-generation” control will, in
all probability, utilise recombinant DNA technology such as gene transfer and
pathogen-derived resistance. The success of this approach will depend in part
on the manipulation of virus genes and, therefore, will require an intimate
knowledge of the viral genome (Dale, 1987).
BBTV is an isometric virus with a genome comprising at least six
components of circular, single-stranded (css) DNA, BBTV DNA-1 to –6 (Harding
et al., 1993; Burns et al., 1995). All components are approximately 1 kb in size
and share a common genome organisation, a 69 nucleotide (nt) stem loop
common region (CR-SL) which comprises the potential stem-loop and has at
least 62% homology between components, a 62-92 nt major common region
(CR-M) located 5’ of the CR-SL with at least 76% homology between
components, a potential TATA box 3’ of the stem-loop, at least one major gene
in the virion sense and a polyadenylation signal associated with each gene
(Burns et al., 1995; Beetham et al., 1997; Beetham et al., 1999) (Fig. 1.5). The
major gene of DNA-1 encodes a replication initiation protein (Rep), which has
site-specific nicking and joining activities (Hafner et al., 1997b). Interestingly,
Beetham et al. (1997) also identified a smaller internal gene in a +2 reading
frame in DNA-1, which is actively transcribed during BBTV infection, however,
the function of this gene product remains unkown.DNA-3 encodes the viral coat
protein (CP) (Wanitchakorn et al., 1997) and the gene product of DNA-5 has
been shown to contain an LXCXE motif and to have retinoblastoma protein
(Rb)-binding activity (Wanitchakorn et al., 2000a). BBTV DNA-4 and –6 appear
to encode movement and nuclear
30
Fig. 1.5 Diagrammatic representation of the proposed genome organisation of
BBTV, and the general organisation of each of the DNA components, including
the proposed gene functions.
BBTV DNA-1
BBTV DNA-6
BBTV DNA-5
BBTV DNA-4
BBTV DNA-3
BBTV DNA-2
Master Rep
Unknown
Coat protein
Movement protein
pRB binding
Nuclear shuttling
ORF, Open reading frame Stem-loop
CR-SL, Stem-loop common region
CR-M, Major common region
Polyadenylation signal
TATA Box
Internal ORF
Intergenic region
COMPONENT FUNCTION
31
shuttle proteins (Wanitchakorn et al., 2000a) respectively, while the function of
the DNA-2 gene product remains unknown (Fig. 1.5).
BBTV genomic cssDNA is capable of in vitro self-primed complementary
strand DNA synthesis, which is initiated from within the CR-M, located in the
intergenic region. It has been suggested that one of the potential roles of the
CR-M may be to direct the synthesis of this primer (Hafner et al., 1997a). The
intergenic regions of BBTV DNA-1 to –6 function as promoters in monocot and
dicot systems, where they are active to varying degrees but primarily vascular-
associated (Dugdale et al., 1998; Dugdale et al., 2000).
Karan et al. (1994) demonstrated that DNA-1 was present in all isolates
of BBTV tested from 10 different countries. When the authors compared the full
sequences of BBTV DNA-1 from these isolates as well as compared selected
regions within the component they found two distinct groups were formed, the
South Pacific group, which included isolates from Fiji, Western Samoa, Tonga,
Australia, India, Burundi and Egypt, and the Asian group which included isolates
from Taiwan the Philippines and Vietnam. However, some of the regions were
highly conserved irrespective of group; including the stem-loop structure, the
potential TATA box, the intervening sequence between the stem-loop structure
and the potential TATA box, and the dNTP-binding motif and the
polyadenylation signal within the major ORF, suggesting these sequences
probably had highly specific functions. The major Rep-encoding ORF was
present in all isolates and although less variable than the complete sequence,
32
when compared at the nucleotide and amino acid level, still conformed to the
two-group theory. In contrast, the CR-M was highly conserved within each group
but highly variable between the two groups. Despite having no obvious
explanation for this, the authors did note that CR-M may be a reliable marker to
rapidly identify the origins and affinities of the new isolates. Later, Wanitchakorn
et al. (2000b) confirmed the presence of the BBTV groupings by analysis of the
BBTV DNA-3 sequences from six geographical isolates of BBTV. The Asian
group comprised isolates from the Philippines, Taiwan and Vietnam while
isolates from Australia, Burundi and Fiji formed the South Pacific group.
Sequences of BBTV DNA-3 from the South Pacific isolates showed
considerably less divergence than those of their Asian counterparts. The
authors recognised that the measure of variability not only had implications with
respect to the evolution of the virus and disease but may also impact upon virus
diagnosis and the development of transgenic resistance. In this study, the BBTV
CP remained highly conserved at the amino acid level, with a maximum of less
than 3% sequence variation between all isolates. Further, the authors noted that
given the high level of conservation of this gene, it was likely that any BBTV CP
transgene sequence would provide effective CP-mediated resistance against
both groups of BBTV isolates, and also suggested that a single, high-titre
antiserum should be effective for the detection of all isolates of BBTV.
Two new BBTV-associated sequences, BBTV S1 and S2, associated
with Taiwanese isolates but absent in South Pacific isolates have been
characterised (Horser et al., 2001b). Both components appear to encode Rep
proteins but, unlike BBTV DNA-1, do not contain the small internal gene
33
(Beetham et al., 1997). Further, it was shown that BBTV DNA-1, but not BBTV
S1, can direct replication of a DNA component which has no obvious role in
BBTV replication, namely the coat protein-encoding component, BBTV DNA-3.
These results indicate that BBTV DNA-1 encodes the M-Rep (Horser et al.,
2001a). Other components have been characterised from Taiwanese BBTV
isolates, BBTV W1, W2 and Y1 (Yeh et al., 1994; Wu et al., 1994). Comparison
of the amino acid sequences of the nanovirus Reps showed that BBTV-S1, S2
and Y1 are more closely related to the Reps encoded by CFDV, MDV and
FBNYV (except FBNYV DNA-2) than they are to the M-Rep encoded by BBTV
DNA-1 (Horser et al., 2001b). Based on their limited geographical distribution
and different genome organisation, they proposed that BBTV-S1 and S2 (and
Y1, W1 and W2) were non-essential Rep-encoding components of the BBTV
genome. The authors also noted that similar components have been isolated
from three other nanoviruses (FBNYV, MDV and SCSV), and suggested that
these additional Rep-encoding components are a characteristic of nanovirus
genomes. More recently, Bell et al. (2002) reported the full sequence of a further
Rep-encoding component associated with some BBTV isolates from Vietnam,
BBTV-S3, which shared 47%, 69%, 56% and 65% nucleotide sequence identity
with the previously reported Rep-encoding components BBTV DNA-1, S1, S2
and Y1, respectively. Sequence variability analysis of BBTV DNA-1 from 17
isolates collected throughout Vietnam, showed that isolates separated into two
distinct geographical groups, northern and southern Vietnam, and the variation
found within Vietnam was approximately double that previously reported for
Asian BBTV isolates. Based on these observations, the authors suggested that
34
the high degree of sequence variability within Vietnam might have future
implications on the development of virus-derived resistance strategies to control
BBTV in Vietnam.
Horser (2000) identified a direct repeat (GGGACGGGAC) within the
intergenic regions of BBTV DNA-1 to 6. The position of this potential Rep
binding site was completely conserved between five components with a single
nucleotide difference in BBTV DNA-2. An inverted sequence (GTCCC) was also
identified in all BBTV intergenic regions, however, unlike the direct repeat, the
position of this sequence varied from 10 nt (BBTV DNA-6), 19 nt (BBTV DNA-1,
3, 4 and 5) and 90 nt (BBTV DNA-2) upstream (5’) of the stem-loop base (Fig.
1.6). BBTV would appear to differ from the dicot- infecting nanoviruses in that
BBTV sequences have fewer putative iterative elements, three, compared to six
for FBNYV and MDV and seven for SCSV (Fig. 1.7). Although the BBTV
replicative process is not fully understood, the presence of potential Rep binding
sites (both direct and inverted) in close proximity to the potential stem-loop, a
putative G-Box and TATA box suggests BBTV may have a similar control and
replicative mechanism to the geminiviruses (Horser, 2000).
1.3 Pathogen-derived resistance
The concept of expressing virus-derived genes or genome fragments to
generate virus resistance in transgenic plants is known as pathogen-derived
resistance (PDR) (Baulcombe, 1996). In contrast to the RNA plant viruses, there
are few reports of transgenic resistance to ssDNA viruses, with no commercial
35
release of resistant crops. There have been only two instances of antisense
RNA-mediated resistance (Day et al., 1991;
Fig. 1.6 Putative Rep DNA-binding domains (iterons) of BBTV. Intergenic
segments of BBTV DNA-1 to 6 with putative iterons (F) (GGGAC), reverse
iteron (R) (GTCCC). Arrows indicate direction. Potential G-box sequence and
the conserved stem-loop sequences are indicated (Horser, 2000).
BBTV DNA-1 AACGGCGAGATCAGATGTCCCGAGTTAGTGCGCC
48 nucleotides upstream, BBTV DNA-2 has a sequence GTCCC.
36
Fig. 1.7 Putative iterons for BBTV compared to other nanoviruses. (A) BBTV
DNA -1 to-6, (B) FBNYV C2, C3, C4, C5, C6, C8, C10, (C) MDV C4, C5, C6,
C7, C8, C9, (D) SCSV C1, C3, C4, C5, C7. F and R indicate directions of
iterons as do arrows. For SCSV F1 is equivalent to F, with F2 representing a
different iterative element. Putative G-boxes are indicated by the striped box
(Horser, 2000).
37
Bendahmane and Gronenborn, 1997), two reports of movement protein
mediated resistance (von Arnim and Stanley, 1992; Hou et al, 2000) and one
report using a post-transcriptional gene silencing (PTGS) strategy (Asad et al.,
2003), commonly adopted with the ssRNA viruses. One novel approach to
generate transgenic resistance was dependent on Rep-mediated transactivation
of the African cassava mosaic virus (ACMV) coat protein promoter driving the
lethal dianthin gene (Hong et al., 1996, 1997). However, since these
publications in 1996-7, there has been no report on the robustness and long-
term effectiveness of this resistance strategy. In fact,
the ACMV studies are in conflict with the recent findings of Seemanpillai et al.
(2003) who reported, following systemic Tomato leaf curl virus (TLCV) infection
of plants stably expressing TLCV promoter:GUS fusions, transgene expression
driven by all six TLCV promoters was silenced. They further showed this
silencing was associated with cytosine hypermethylation of the TLCV-derived
promoter sequences. Most emphasis on geminivirus resistance today is directed
towards interfering with replication either through a trans-dominant negative
strategy of expressing mutated or truncated Reps (Gronenborn, 1997; Hanley-
Bowdoin et al, 2002; Polston et al, 2000; Brunetti et al, 2001; Stout et al, 2001)
or expression of a phage ssDNA binding protein in plants (Padidam et al, 1999).
38
However, none of these strategies have been demonstrated to generate
immune plants.
1.4 Aims of this study
BBTV is a circular, single-stranded (css) DNA virus that belongs to the
genus Babuvirus in the family Nanoviridae, and is responsible for the
devastating disease affecting banana known as “bunchy top”. In Australia, the
disease has been kept in check primarily by roguing of infected plants and
quarantine of infected plots. This strategy, however, is unsuitable in other
countries where bananas are grown and BBTD continues to cause significant
losses. As bananas are essentially sterile, and conventional breeding for
resistance is deemed impractical, recombinant DNA technology may be the only
approach to controlling this pathogen.
Two strategies to generate resistance to BBTV in banana are being
evaluated by the Plant Biotechnology group at QUT. The first, like the
geminiviruses, involves the over-expression of mutant BBTV Reps while the
second utilises a novel technology called InPAct (In Plant Activation), in which
expression of a lethal gene is activated by the BBTV-encoded Rep protein (Dale
et al., 2001). For the broad range success of either strategy, an intimate
knowledge of the BBTV replication processes, the degree of worldwide
sequence variability within the Rep encoding gene and its subsequent ability to
cross-replicate heterologous BBTV components, and understanding the
mechanism of Rep binding through iteron sequences are essential. As such,
the aims of this study were to;
39
(i) experimentally confirm the F1, F2 and R sequences as iteron-like
sequences and characterise their role in specific binding of the BBTV M-
Rep protein,
(ii) evaluate cross-replication between BBTV isolates belonging to the Asian
and the South Pacific groups and
(iii) isolate BBTV-associated mRNA and map the transcription initiation sites
of DNA-1 to -6 using RLM-5’ RACE.
Chapter 2
General Materials and Methods
2.1 Protocols for gene cloning
Unless otherwise stated, the composition and preparation of all media and
solutions used were as described by Sambrook et al. (1989).
2.1.1 Extraction of DNA from agarose
The QIAquick gel extraction kit (QIAGEN) was used to extract and purify
PCR products from agarose gels. In brief, the DNA fragment was excised from
the agarose gel with a clean, sharp scalpel and purified as per the
manufacturer’s instructions. The DNA was eluted in 30 μl of 10 mM Tris-HCl (pH
7.5).
2.1.2 Ligations
40
In general, ligations were performed at 16oC overnight, using 400 U or
200 U of T4 DNA ligase (New England (NE) BioLabs, Ipswich, MA, USA), 10X
Ligation Buffer (NE BioLabs), 10 μl of insert DNA (approximately 50-100 ng), 50
ng of vector DNA (pGEM-T-Easy, Promega) in a 15 μl ligation reaction.
2.1.3 Transformation of E.coli JM109
For transformation of JM109 competent cells (Promega), 10 μl of the
ligation reaction was added to 50 μl of JM109 cells in a 1.5 ml sterile Eppendorf
tube, and gently mixed. The cells were incubated on ice for 20 min, heat
shocked by incubation at 42oC for 45 sec, then placed on ice for 2 min. One
millilitre of SOC medium was added and incubated at 37oC for 1.5 hr with
shaking (225 rpm). After incubation, the sample was centrifuged at 10,000 g in a
microcentrifuge for 10 sec, the supernatant discarded and the pellet
resuspended in 100 μl of SOC medium. The transformation mix was then plated
on LB agar plates containing 100 μg/ml of ampicillin, 0.5 mM IPTG and 80 μg/ml
of X-Gal and incubated overnight (16 hr) at 37oC.
2.1.4 Preparation and transformation of heat-shock competent XL1-Blue E.
coli
A protocol based on the method of Inoue et al. (1990) was used to
prepare XL1 blue E. coli ultra-competent cells for transformation. The cells were
transferred to Eppendorf tubes, frozen in liquid nitrogen and immediately stored
41
at –80oC. Transformation of XL1-Blue E. coli by heat shock was essentially as
described in Section 2.1.3 except 100 μl of XL1-Blue competent cells were used
for each transformation and cells were resuscitated in 600 μl of SOC media.
2.1.5 Small-scale plasmid purification
For small-scale plasmid purification, a modified protocol from Sambrook
et al, (1989) was used. A single bacterial colony was inoculated into liquid LB
medium containing 100 μg/ml ampicillin and incubated overnight (approximately
16 hr) with shaking at 225 rpm. After incubation, 1.4 ml of cell culture was
transferred to a fresh Eppendorf tube, centrifuged at 10,000 x g in a
microcentrifuge and the supernatant discarded. The bacterial pellet was
resuspended in 500 μl of ice cold STE, centrifuged for 30 sec and the
supernatant discarded. The pellet was resuspended in 100 μl of ice cold
Solution I and incubated for 5 min on ice. The bacterial mix was lysed by
addition of 200 μl Solution II (room temperature) followed by incubation on ice
for 5 min. The lysed cell mix was neutralized by adding 150 μl of ice cold
Solution III and 150 μl CHCL3:IAA (24:1) followed by gentle mixing. The sample
was centrifuged at 10,000 x g for 5 min and the supernatant transferred to a
fresh tube containing 900 μl of 100% ethanol. Plasmid DNA was precipitated by
incubation at room temperature for 3 min and centrifugation at 10,000 x g for 5
min. The supernatant was discarded and the pellet washed with 700 μl of 70%
42
ethanol and centrifuged at 10,000 x g for 5 min. The resulting pellet was air
dried, resuspended in ddH2O (usually 30 μl) containing 1.0 μg RNaseA and
incubated at 37oC for 30 min.
2.1.6 Large-scale plasmid purification
A single bacterial colony was transferred from selective LB plates and
inoculated into 3 ml of LB medium containing 100 μg/ml ampicillin and incubated
at 37oC overnight (approximately 16 hr) with vigorous shaking (225 rpm). One
millilitre of the starter culture was used to inoculate 30 ml of LB medium
containing 100 μg/ml ampicillin and incubated at 37oC overnight with vigorous
shaking (225 rpm). Following overnight incubation (average cell density OD600 =
2-6), bacteria were pelleted by centrifugation at 5,000 x g for 10 min at 4oC.
Plasmid DNA was then purified using a Midiprep Plasmid kit (Roche) according
to the manufacturer’s instructions. The final DNA pellet was air-dried and
resuspended in an appropriate amount of TE buffer (pH 8). The integrity and
concentration of plasmid DNA was assessed by agarose gel electrophoresis
and spectrophotometry. Plasmid DNA was diluted to 1 μg/μl and stored at –
20oC for later use.
2.2 Sequencing and analysis
43
For sequencing, 2 μl of miniprep plasmid DNA was used as a template.
Forward universal (FU) (5’-CACGACGTTGTAAAACGAC-3’) and reverse
universal (RU) (5’-GAAACAGCTATGACCATG-3) primers (3.2 pmol) were used
to confirm cloned PCR products in pGEM-T.Easy. The reaction also contained 1
μl of ABI Big Dye Terminator (BDT) Version 3.1, 3.5 μl of BDT Version 3.1
buffer, and sterile ddH2O to a final volume of 20 μl. The thermalcycler program
consisted of one cycle of 95oC for 3 min, then 35 cycles of 95oC for 30 sec,
50oC for 30 sec and 60oC for 4 min.
Following cycling, samples were transferred to fresh 1.5 ml Eppendorf
tubes and precipitated by adding 10 μl of ddH2O, 2 μl of 3 M NaOAC (pH 5.2)
and 50 μl of 96% ethanol. Samples were mixed, incubated at room temperature
for 15 min, and centrifuged at 10,000 x g for 20 min. The supernatant was
carefully removed and discarded and the pellet washed in 200 μl of 70% ethanol
followed by centrifugation at 10,000 x g for 15 min. The supernatant was
discarded and the pellet air dried for approximately 10 min at room temperature.
Samples were sequenced by capillary separation at the Australian Genome
Resource Facility Ltd in Brisbane, Australia (http://www.agrf.org.au/). Sequence
alignments were performed using the Clustal W algorithm (Thompson et al.,
1997) in AlignX (a component of Vector NTI Suite 6.0).
2.3 Microprojectile bombardment
Microprojectile bombardment was essentially as described by Becker et
al. (2000) with some minor modifications. Banana embryogenic cell suspensions
(either cv. ‘Lady finger’ or ‘Grand Nain’) were bombarded using a particle inflow
44
gun (Finer et al., 1992). To prepare gold particles (Bio-Rad; 1.0 μm diameter) for
bombardment, 120 mg of gold particles were washed three times in 100%
ethanol and three times in sterile distilled water before resuspending them in 1
ml of sterile 50% (v/v) glycerol. Microprojectiles were coated with plasmid DNA
by sonicating 25 μl of gold particles for 30 sec, then adding 25 μl of 2.5 M CaCl2,
5 μl of 0.1 M spermidine-free base and 1-2 μg of Midiprep plasmid DNA. The
gold:DNA mix was kept in suspension for 5 min by occasional vortexing, and
then allowed to settle for 10 min on ice. Following incubation, 22 μl of
supernatant was discarded and the remaining gold:DNA mix resuspended by
vortexing. For each shot, 6 μl of the gold:DNA mix was bombarded into target
cells placed 8 cm from the point of particle discharge and covered by a 210 μm
stainless steel mesh baffle. Helium pressure was 550 Kpa and chamber vacuum
was –90 Kpa.
2.4 DNA extraction from banana cells
Total DNA was extracted from banana cells using a modified method of
Stewart and Via (1993). Cells were transferred from plates to 1.5 ml Eppendorf
tubes using a sterile spatula. Approximately 650 μl of pre-warmed (65oC) CTAB
extraction buffer (1.0% Sarcosine, 0.8 M NaCl, 0.022 M EDTA (pH 8.0), 0.22 M
Tris-HCl (pH 7.8) and 0.8% CTAB, 0.14 M mannitol: 14 μl of β-mercaptoethanol
was added per ml of isolation buffer before use) was used per 100 μl of cells.
Cells were homogenised using an Eppendorf micro-pestle and incubated at
65oC for 25 min with occasional mixing. Following incubation, 700 μl of
45
CHCl3:IAA (24:1) was added per sample, mixed thoroughly by vortexing and
centrifuged at 10,000 x g for 5 min. The supernatant was transferred to a fresh
2.0 ml Eppendorf tube, an equal volume of 100% isopropanol added and mixed
by inverting the tube. Total DNA was precipitated by centrifugation at 10,000 x g
for 5 min. The pellet was washed in 800 μl of 70% ethanol followed by
centrifugation at 10,000 x g for 5 min. The pellet was air dried and resuspended
in 40 μl of TE buffer (pH 8.0) and incubated for 10 min at 65oC. RNA was
removed by addition of RNase A to a final concentration of 10 μg/ml and
incubation at 37oC for 30 min. DNA concentration was estimated by
spectrophotometry while integrity and purity of the DNA was assessed by
agarose gel electrophoresis.
2.5 Southern hybridisation
Southern hybridisation was essentially as described in the DIG-Easy Hyb
manual (Roche) using reagents recommended by the manufacturer. Unless
otherwise stated, all solutions were prepared and used as per the
manufacturer’s instructions or as outlined in Sambrook et al., (1989).
2.5.1 Digoxigenin (DIG)-labelling of probes
Digoxigenin (DIG)-labelled probes were generated using PCR and DIG-
11-dUTP (digoxigenin-11-2’-deoxy-uridine-5’-triphosphate, alkali-labile; Roche)
as per the manufacturer’s protocol. The 10X DIG mix (1:3) (2 mM) contained 0.7
mM DIG-11-dUTP, 1.3 mM dTTP, and 2 mM of each dATP, dCTP and dGTP
(Roche). Primers were designed to amplify a portion of the open reading frame
46
of the desired BBTV component. PCR mixes comprised 100 ρg of plasmid
template, 10 ρmol of each primer, 10X DIG mix, 1.4 U DNA polymerase
(Expand Long Template, Roche), and the manufacturer’s buffer system 1 in a
50 μl reaction. The PCR mix was denatured at 95oC for 3 min followed by 30
cycles of 95oC for 30 sec, 50oC for 30 sec and 68oC for 1 min followed by one
cycle of 68oC for 10 min. PCR products were electrophoresed through a 1.5 %
agarose gel, and extracted from the agarose using the procedure described in
Section 2.1.1. Purified DIG-labelled probes were eluted in a 50 μl volume.
2.5.2 Southern hybridisation
A. Electrophoresis
For Southern hybridisation, samples were electrophoresed through a 1.1
% TAE agarose gel at 55 V for approximately 210 minutes.
B. Preparation of the gel and Southern transfer
The following treatments were performed at room temperature.
Depurination - the gel was completely immersed in depurination solution and
gently agitated for 10 min. During this time the bromophenol blue loading dye
changed to a yellow colour. Denaturation - the gel was completely immersed in
denaturation solution and gently agitated for 30 min. During this time the
bromophenol blue dye returned to its original colour. Neutralization - the gel was
completely immersed in neutralization solution and gently agitated for 30 min.
Equilibration - the gel was equilibrated in 20 X SSC (transfer buffer) for 5 min.
47
After each step the gel was rinsed in distilled water. The Southern transfer was
set up as described by Sambrook et al., (1989).
C. Post-transfer treatment of nylon membrane
The membrane was washed briefly in 2 X SSC (2 washes, 2 min each),
blotted dry between two sheets of Whatman 3MM paper and baked at 80oC for
2 hr. After baking the membrane was used immediately for prehybridisation, or
stored for later use between two sheets of Whatman 3 MM paper in a sealed
plastic bag at 4oC.
D. Prehybridisation and hybridisation
The membrane was placed into a clean hybridisation bottle. For every
100 cm2 of membrane, 10 ml of DIG Easy Hyb was used for prehybridisation
and 7 ml of DIG Easy Hyb for hybridisation. The bottle was rotated in an
incubator for at least 1 hr at 42oC.
In general, 25 μl of DIG-labelled probe was added to 25 μl of sterile
ddH2O, denatured by incubation at 100oC for 5 min, and quenched on ice for 5
min. The denatured probe was then immediately added to a tube containing 7
ml of pre-warmed (42oC) DIG Easy Hyb and mixed by inversion to form the
hybridisation solution. The prehybridisation buffer was poured off and the 7 ml of
hybridisation solution immediately added. The hybridisation bottle was rotated
overnight at 42oC (an appropriate temperature when the probe was 80 - 100%
homologous to the target).
48
E. Washing
A number of different stringency washes were used (prepared according
to Sambrook et al., 1989). In a low stringency wash, the membrane was washed
twice in 200 ml of low stringency buffer by shaking for 5 min at room
temperature. In a high stringency wash, the membrane was washed twice in
200 ml of preheated (68oC) high stringency buffer by shaking for 15 min at 68oC.
For the final wash, the membrane was washed once in 150 ml of wash buffer by
shaking for 5 min at room temperature.
F. Chemiluminescent Assay
The membrane was blocked in 100 ml of blocking solution (Roche) by
shaking for 30 min at room temperature. The blocking solution was discarded
and the membrane incubated in 40 ml of antibody solution for 30 min with
shaking. The membrane was washed twice in 200 ml of washing buffer by
shaking at room temperature for 15 min and finally equilibrated in 150 ml of
detection buffer for 15 min at room temperature.
The membrane was placed between two plastic sleeves. For every 10
cm2 of membrane, 1 ml of CDP-star working solution was applied over the
surface of the blot until the entire surface was evenly soaked and the plastic
sleeve sealed. The membrane was incubated at room temperature for 5 min,
and excess liquid removed. The sleeve was placed in an X-ray cassette and the
49
membrane exposed to X-OMAT AR Scientific Imaging Film (Kodak) for 1 to 10
min. An automatic developer was used to develop the film.
50
Chapter 3
Identification and Characterisation of the BBTV Iteron Sequences
3.1 Introduction
The exact mechanism by which BBTV replicates is unknown. However,
based on the similarities between nanovirus DNAs and those of the
geminiviruses, it is thought that replication occurs by a rolling circle type of
mechanism (Stenger et al., 1991). In geminiviruses, iterated DNA sequences
(iterons) play an important role in the rolling circle replication mechanism, in that
they act as recognition sites for binding of their cognate Reps. Mutation of these
sites can negatively affect Rep-binding in vitro and replication in vivo (Chatterji
et al., 2000; Choi and Stenger, 1996; Fontes et al., 1994a,b; Orozco et al.,
1998). For example, in the begomovirus Tomato golden mosaic virus (TGMV)
and the curtovirus Beet curly top virus (BCTV), the Rep proteins bind to two
direct repeats within the genome, of which the 3’ iteron appears essential to
replication (Fontes et al., 1994a; Choi and Stenger, 1996). Putative iteron
sequences have also been identified in the non-coding regions of the
nanoviruses, Faba bean necrotic yellow virus (FBNYV), Milk vetch dwarf virus
(MDV) and Subterranean clover stunt virus (SCSV) (Timchenko et al., 2000).
However, the exact role of these sequences in nanovirus replication has yet to
be experimentally determined.
51
Analysis of the intergenic regions of BBTV DNA-1 to -6 (Horser 2000)
identified a putative iteron sequence (GGGAC) occurring as a tandem repeat
(designated iterons F1 and F2, respectively) on the virion-sense strand 3’ of the
stem-loop and as a single iteron (designated iteron R) on the complementary
strand 5’ of the stem-loop. The direct repeat iterons, F1 and F2, were located
two nucleotides 3’ of the stem-loop in DNA-1 and DNA-3 to -6 whereas in DNA-
2, they commenced one nucleotide 3’ of the stem-loop. However, the location of
iteron R varied from 10 nt (DNA-6), 19 nt (DNA-1, 3, 4 and 5) and 90 nt (DNA-2)
upstream of the 5’ base of the stem-loop.
This chapter describes a study to define the role of the putative iterons in
BBTV replication by assessing the ability of BBTV DNA-1 to replicate native and
iteron mutants of DNA-6 in banana embryogenic cells. DNA-6 was selected as
a representative genome component because it encodes a putative nuclear
shuttle protein which is not intrinsic to the replication process. The system used
to assess replication involved the use of greater-than-unit-length BBTV clones,
which incorporate two stem-loops. In the presence of the BBTV Rep (encoded
by DNA-1), the virus sequence is excised at the conserved nonanucleotide loop
sequence and is subsequently recircularisd by the ligating activity of Rep into a
transcriptionally active molecule. In addition to DNA-1, a 1.1mer of the cell
cycle-link encoding component (BBTV DNA-5) is also co-delivered since this
protein has been shown to enhance replication by forcing the plant cell into the
S-phase of the cell cycle (Horser et al., 2001a).
52
3.2 Materials and Methods
Greater-than-genome-length clones (1.1mers) of BBTV DNA-1, 5 and 6
were already available from previous studies (Horser et al., 2001a; Horser,
2000). A 1.1mer of BBTV DNA-6 was used as the backbone for all iteron
mutation analyses. In all cases, the native iteron sequence was mutated to that
of the unique restriction site Xba I (TCTAGA), as illustrated in Figure 3.1. All
primers used in this study are shown in Table 3.1.
Fig. 3.1 Part of the sequence of the BBTV DNA-6 intergenic region with boxes
showing the location of the three putative iterons F1, F2 and R (GGGAC).
Arrows indicate sequence direction. The Xba I restriction sites used for
mutagenesis are also shown.
CTCTTA CAGGGC TACTGCATTCGTGCCCCCTGATAATAATGGGGGGCACGA GCCCTGCCCTGT ACTG
Duplicated Xba I restriction sites
AGATCTAGATCT
GAGAAT GTCCCG ATGACGTAAGCACGGGGGACTATTATTACCCCCCGTGCT CGGGACGGGACA TGAC
R
F1 F2 G-box stem stemloop
5’ 3’
TCTAGATCTAGA TCTAGA AGATCT
5’3’
5’ 3’ 5’
5’3’
3’5’
Xba I restriction site
3’
53
Table 3.1 Sequence of the primers utilized for the mutagenesis strategies, and
to amplify the DNA-6 probe, used in this work.
Name
Sequence
C1
5’- TCTAGAGGGACATGACGTCAGCAAGG –3’
C2 5’- TCTAGAAGCACGGGGGGTAATAATAG 3’
C3 5’- ATAAAAGTTGTGCTGTAATGT –3’
D1 5’- TCTAGAATGACGTAAGCACGGGGGAC –3’
D2 5’- TCTAGAATTCTCCCCACCTTTTAGTTG -3’
D3 5’- CGCTTCTGCCTTCCGCTTTCG -3’
Y1 5’- CCCGTGCTCGGGACTCTAGATGACGTCAGCAAGG -3’
Y2 5’- CCTTGCTGACGTCATCTAGAGTCCCGAGCACGGG -3’
Z1 5’- TTACCCCCCGTGCTTCTAGATCTAGATGACGTCAG -3’
Z2 5’- CTGACGTCATCTAGATCTAGAAGCACGGGGGGTAA -3’
Q1 5’- ATGGATTGGGCGGAATCACAATTC -3’
Q2 5’- TTATTCCTTGATTCTTAACGAACAAAC -3’
3.2.1 Mutagenesis of F1 and R iterons
54
DNA-6 1.1mers containing mutations in either the F1 or R iterons were
generated using a PCR-based approach (Figure 3.2). Two fragments, A and B,
were amplified by PCR from the native DNA-6 1.1mer. Following purification
using a QIAquick gel extraction kit (QIAGEN), the amplicons were cloned into
pGEM-T-Easy (Promega). Fragment A was subsequently excised from the
plasmid using Xba I digestion and ligated into the Xba I-digested clone
containing fragment B to create the DNA-6 1.1 mer iteron mutants, pMutF1 and
pMutR. For the construction of the mutated F1 iteron (designated pMutF1),
fragment A was amplified using primer pairs C1/C2 while fragment B was
amplified with primer pairs C2/C3. Similarly, primer pairs D1/D2 (fragment A)
and D1/D3 (fragment B) were used for the construction of the mutated R iteron
(pMutR). PCR mixes comprised 50 ρmol of each primer, 10 mM dNTP’s, 2.5 U
DNA polymerase mix (Expand Long Template, Roche) and 100 ng of plasmid
DNA-6 in Buffer System 3 (Expand Long Template, Roche). PCR mixes were
denatured at 95oC for 10 min followed by 30 cycles of 95oC for 30 sec, 55oC for
30 sec and 72oC for 1 min followed by 1 cycle of 72oC for 10 min. Clones were
sequenced using automated sequencing and Big Dye Termination Cycle
Sequencing Ready Reaction (Applied Biosystems) (section 2.2).
3.2.2 Mutagenesis of F2 and F1F2 iterons
A QuikChangeR site-directed mutagenesis kit (Stratagene) was used to
generate the DNA-6 1.1mer F2 iteron mutant (pMutF2) and the combined F1F2
55
Fig. 3.2 Strategy for the construction of a mutated BBTV DNA-6 1.1 mer
component. In this example, the sequence of iteron R is altered to a Xba I
restriction site. Black represents the original sequence while red indicates the
Xba I site.
iteron mutant DNA-6 1.1 mer (pMutF1F2), according to the manufacturers’
instructions. The general strategy of the QuikChangeR site-directed
Cloning into pGEM-T-Easy
Cloning intopGEM-T-Easy
A
A B
PCR to amplify “A” and “B” fragments
Xba I digestion
Xba I digestion
A + B
A + B Ligation
and Cloning
A
Forward primer
Reverse primer
Forward primer
primer
B
B
56
mutagenesis method is described in Figure 3.3. In brief, the reaction contained
1 X reaction buffer, 50 ng plasmid DNA-6 1.1 mer, 125 ng of oligonucleotide
primer #1, 150 ng of oligonucleotide primer #2, 1 μl of dNTP mix from the kit,
sterile ddH2O in a final volume of 50 μl, and finally 2.5 U of Pfu Turbo DNA
polymerase. The mix was subjected to 1 cycle of 95oC for 30 sec, 18 cycles of
95oC for 30 sec, 55oC for 1 min and 68oC for 9 min. The mix was incubated with
10 U of Dpn I restriction enzyme at 37oC for 1 hr to digest the parental (i.e. the
non-mutated) supercoiled dsDNA. Dpn I-treated DNA (1 μl) was transformed
into XL1-Blue Supercompetent cells (provided in the kit) according to
manufacturers’ specifications. Transformation mixes were plated on LB agar
plates containing 100 μg/ml of ampicillin, 80 μg/ml X-gal and 20 mM IPTG, and
incubated at 37oC for at least 16 hr. Plasmid DNA was isolated by alkaline lysis
and sequenced as described in Chapter 2.
Primers, Y1 and Y2, were used in the construction of pMutF2. This
plasmid was subsequently used as template for the construction of pMutF1F2
with primer pair Z1 and Z2. The integrity of all sequences was confirmed by
sequencing as previously described.
57
Fig. 3.3 Overview of the QuikChangeR site-directed mutagenesis method
(Stratagene).
3.2.3 Replication assays
Step 1 Plasmid
Target site ( ) for mutation
Step 2 Temperature
Anneal primers ( ) containing the desired
mutation Pfu Turbo DNA polymerase extends and
incorporates the mutated primers
Step 3 Digestion
Digest the methylated, nonmutated parental
DNA template with Dpn
Nicks in the mutated plasmid are repaired following
transformation
Step 4 Transformation
58
Microprojectile bombardment of banana (Musa spp. cv. ‘Lady finger’)
embryogenic cell suspensions was as previously described (section 2.3).
Plasmid DNA was purified using a Midiprep Plasmid kit (Roche) (section 2.1.6).
Plasmids pMutR, pMutF1, pMutF2 and pMutF1F2 were independently
co-bombarded (in equimolar amounts) in combination with 1.1mers of both
DNA-1 (M-Rep) and DNA-5 (Rb-binding). The native DNA-6 1.1 mer (pWt6) was
similarly co-bombarded as a positive control for replication. In total, ten replicate
bombardments were performed per plasmid combination in order to account for
variation between independent transformation events and individual treatments.
Total nucleic acid was extracted (section 2.4) four days post-
bombardment and 60 µg of total nucleic acid were electrophoresed through
agarose gels and transferred to a nylon membrane as described (section 2.5). A
digoxigenin (DIG)-labelled probe specific for the DNA-6 ORF was PCR amplified
with DIG-11-dUTP (1:3) (Roche) from a pWt-6 template using primers Q1 and
Q2. Following hybridisation (section 2.5.2), signal was detected on Kodak film
and densitometry performed on autoradiographs using TotalLab v1.11 software
from Phoretix (Nonlinear Dynamics, Newcastle Upon Tyne, UK). To assess
replication, densitometry readings were based on the supercoiled, replicative
episomal forms of DNA-6. On each blot, densitometry readings were made
relative to the lane containing a DNA extract from an infected plant (lane “I”).
The same DNA extract was used for each blot.
3.2.4 Statistical analysis
59
Differences in mean densitometry readings between treatments were
analysed using one-way analysis of variance (ANOVA, SPSS 13.0 for Windows)
and significant differences between means identified with a least significant
difference (LSD) post hoc test using a 0.05 significance level.
3.3 Results
To evaluate the role of the three putative BBTV iterons in replication,
1.1mers of BBTV DNA-6 were mutated either in the F1 (pMutF1), F2 (pMutF2),
R (pMutR) or the combined F1F2 iterons (pMutF1F2). Plasmid combinations
used for replication assays included one of the DNA-6 iteron mutants 1.1 mer in
addition to 1.1mers of DNA-1 (M-Rep) and DNA-5 (Rb-binding). As a control,
the native DNA-6 1.1 mer (pWt6) was used. The probe used in this work was
specific for the DNA-6 ORF and did not cross-hybridize with the BBTV DNA-1 or
–5 components used in this study (results not shown).
The effect of mutating putative iterons F1 and R on the replication and
subsequent accumulation of replicative intermediates of BBTV DNA-6 is shown
in Figure 3.4 (A-C). The densitometry readings for each of the ten replicate
experiments, based on the supercoiled replicative form of DNA-6, are presented
in Table 3.2. In comparison to the DNA-6 native control, mutation of the F1 and
R iterons reduced replication levels by 41.69% and 61.83%, respectively. When
the densitometry data were analysed using analysis of variance (ANOVA) and
LSD post hoc tests, means from all the treatments were found to be significantly
different from each other at the 0.05 level.
60
Fig. 3.4 (A-C) The effect of mutating putative iterons F1 and R on the replication
of BBTV DNA-6 in bombarded ‘Lady finger’ banana embryogenic cell
suspensions. Cloned 1.1 mers of DNA-6 with mutated iterons pMutF1 or pMutR
were co-bombarded with BBTV DNA-1 and DNA-5. Wild type DNA-6 (pWt6)
was co-bombarded with DNA-1 and DNA-5 as a positive control for replication.
Replication was evaluated four days post-bombardment by Southern blot
analysis using a DNA-6 specific probe. “P6” lane indicates a component-specific
control for BBTV DNA-6. The BBTV replicative intermediates [open circular (oc),
supercoiled (sc) and single stranded (ss)] are indicated. “I” represents nucleic
acids extracted from infected tissue and “U” represents nucleic acids extracted
from not bombarded (untransformed) banana cell suspensions. The lower panel
is a loading control and shows the ethidium bromide-stained DNA extracts prior
to blotting.
61
62
63
Table 3.2 Densitometry readings based on the supercoiled, replicative form of
BBTV DNA-6. Ten replicate readings were done for each mutation; pMutF1 = F1
iteron mutant, pMutR = R iteron mutant, pWt6 = native DNA-6. Bottom row is
the mean for each treatment ± the standard error. Means annotated with
different letters are significantly different at the 0.05 level.
pMutF1 pMutR pWt6
858,346.00 637,318.67 1,051,800.30
962,362.00 777,352.33 1,343,207.00
916,367.67 362,641.67 1,302,901.30
426,508.67 621,006.00 1,266,024.70
311,324.00 323,645.00 1,345,675.00
629,869.00 284,011.33 1,193,306.00
566,851.00 217,009.33 1,222,128.30
632,448.67 408,186.67 1,359,300.70
609,454.00 345,797.00 618,983.00
701,482.33 353,193.67 640,860.33
661,501.33 ± 65,589.49a 433,016.17 ± 57,350.62b 1,134,418.7 ± 88,929.47c
64
Mutation of the F2 iteron caused a drastic reduction in the replication of
DNA-6 to levels barely detectable by Southern hybridisation (faint bands were
only visible following over-exposure of the blots). This effect was reflected in
replication assays using the combined F1F2 iteron mutant, in which replication
intermediates were only visible after prolonged exposure (Figure 3.5A,B). This
prolonged exposure resulted in over-exposure of the WT DNA-6 (pWt6) and
infected (I) lanes precluding any meaningful densitometry readings and
therefore statistical analysis.
3.4 Discussion
In this study, site-directed mutagenesis was used to determine whether
the three putative iterons, F1, F2 and R, common to the intergenic regions of
each BBTV component, are involved in the replication of this virus. DNA-6 was
selected as a representative genome component since its gene product
functions as a putative nuclear shuttle protein and is, therefore, not intrinsic to
the replication process. In addition to a M-Rep encoding component (DNA-1), a
1.1mer of the cell cycle-link encoding component (DNA-5) was also co-delivered
to enhance replication. The results suggest that sequence-specific recognition
of the iteron motifs by the BBTV M-Rep is required for optimal replication and
accumulation of DNA-6, since mutagenesis of these elements, individually and
in tandem, significantly reduced the accumulation of replicative intermediates in
transient biolistic assays. However, the degree to which replication is affected
65
Fig. 3.5 (A&B) The effect of mutating putative iterons F2 and F1/F2 on the
replication of BBTV DNA-6 in bombarded ‘Lady finger’ banana embryogenic cell
suspensions. Cloned 1.1 mers of DNA-6 with mutated iterons pMutF2 or
pMutF1F2 were co-bombarded with BBTV DNA-1 and DNA-5. Wild type DNA-6
(pWt6) was co-bombarded with DNA-1 and DNA-5 as a positive control for
replication. Replication was evaluated four days post-bombardment by Southern
blot analysis using a DNA-6 specific probe. “P6” lane indicates a component-
specific control for DNA-6. The BBTV replicative intermediates [open circular
(oc), supercoiled (sc) and single stranded (ss)] are indicated. “I” represents
nucleic acids extracted from infected tissue and “U” represents nucleic acids
extracted from not bombarded (untransformed) banana cell suspensions. The
lower panel is a loading control and shows the ethidium bromide-stained DNA
extracts prior to blotting.
66
67
appears dependent upon the individual iteron, with the F2 iteron appearing to be
most important for replication.
Although F1 and F2 iterons are identical, a mutation in F1 decreased
replication by approximately 42%, whereas mutation of F2 practically abolished
replication. Differential contributions of the 5’- and 3’-proximal iterons in tandem
repeats have been reported in geminiviruses. In the case of the begomovirus
TGMV, and the curtovirus BCTV, the 3’ repeat contributes more to replication
specificity (Fontes et al., 1994a; Choi and Stenger, 1996) and probably
functions as an essential cis-acting element for replication, while the 5’ repeat
possibly enhances replication (Fontes et al., 1994a). In contrast, studies with
ToLCV-Nde have shown that the 5’ iteron contributes to replication more than
the 3’ iteron (Chatterji et al., 1999). In relation to the geminiviruses, BBTV
appears more similar to TGMV and BCTV in that the 3’ proximal direct repeat,
here the F2 iteron, is essential for replication. However, the arrangement of the
tandem iterons in both of these geminiviruses differs greatly to that of BBTV in
that they are located 5’ of the origin of replication (Choi and Stenger, 1996;
Fontes et al., 1994a).
Like the F1 iteron, mutation in the R iteron caused a significant reduction
in the accumulation of DNA-6 replicative forms. These results suggest that both
the F1 and R sequences, while not essential to the replication process, play an
important role in Rep recognition and may function as enhancers to the BBTV
replication process.
BBTV is no more similar to other members of the Nanoviridae family than
it is to the Geminiviridae. For example, members of the Nanovirus genus
68
(FBNYV, MDV and SCSV) infect dicot plants, specifically leguminous species,
while BBTV (Babuvirus genus) infects monocots, specifically species within the
genus Musa (Randles et al., 2000). Moreover, antibody studies suggest that all
members of the Nanoviridae, with the exception of BBTV and CFDV, are
serologically related (Katul et al., 1997, Randles et al., 2000). This phenomenon
is also reflected at the iteron level; BBTV has fewer iterons than the
nanoviruses, three compared to six for FBNYV and MDV, and seven for SCSV,
and their sequence and arrangement also differ (Timchenko et al., 2000). In
contrast, all three nanoviruses have iteron-like sequences that are very similar
in sequence and arrangement, and their Master-Rep (M-Rep) proteins are able
to support inter-species cross-replication of heterologous non-rep DNAs,
although efficiency of cross-replication appears to correlate with the relatedness
of the two species being tested (Timchenko et al., 2000). To date, the exact role
of iterons in nanovirus replication has yet to be investigated.
Interestingly, iterons in the non-essential BBTV satellite components S1,
S2, S3 and Y1, and the satellite components associated with FBNYV, MDV and
SCSV, share a similar structural arrangement to the mastreviruses, suggesting
they may have a common origin (Horser, 2000).
In summary, we have shown that the three BBTV iterons are not only
involved in virus replication, but they play an important part in this process,
since an alteration in their sequence negatively affects replication. Moreover, we
found that they have different contributions to this process, with the F2 iteron
appearing most important. Further research will allow us to obtain a more detail
description on how these iterons interact with the M-Rep, how the M-Rep binds
69
to them, and therefore to have a better understanding of the mechanism in
which the virus multiplies.
70
Chapter 4
Evaluation of Cross Replication Between the Asian and South Pacific
Groups of BBTV Isolates
4.1 Introduction
Since the first report of coat protein-mediated resistance to a plant virus
(Powell et al., 1986), the concept of expressing virus-derived genes or genome
fragments to generate virus resistance in plants (ie. pathogen derived resistance
or PDR) has expanded considerably. Today, strategies such as the use of
satellite RNA, antisense RNA, dsRNA-induced gene silencing, ribozymes,
suicide genes, and antibody expression have been investigated in numerous
plant species with varying success (reviewed by Dasgupta et al., 2003).
Defective Rep-mediated resistance (DRR), a PDR strategy specifically
aimed at the circular ssDNA viruses, is achieved by over-expression of a non-
functional Rep protein usually in the form of a trans-dominant mutant or
truncated protein. In transgenic plants, the non-functional Rep (i.e. able to bind
but not replicate circular ssDNA viral sequences) is thought to out-compete the
virus-encoded Rep at the binding sites of the infecting virus genome and
prevent/delay virus replication and/or infection. To date, DRR has been
demonstrated with at least one begomovirus, Tomato yellow leaf curl (Noris et
al., 1996).
71
Recently, a novel approach to generating virus resistance, termed InPAct
(In Plant Activation) has been developed by researchers at QUT (Dale et al.,
2001)(Fig.4.1). Like DRR, InPAct is specifically targeted to the circular ssDNA
plant viruses and exploits the rolling circle replication strategy of these viruses.
InPAct vectors are designed to contain duplicated origins of replication flanking
a suicide gene expression cassette arranged in such a way that transcription
and translation is activated only in the presence of the cognate virus-encoded
Rep protein. Hence, upon virus infection, expression of the suicide gene in
transgenic plants will occur only in those cells containing virus-derived Rep
protein resulting in localized cell death, containment of the virus and ultimately
virus resistance.
Apart from the Americas, BBTV is geographically widespread and has
been detected in the Mid East, some parts of Africa, Asia, and the South Pacific.
Based on worldwide BBTV DNA-1 sequence diversity, Karan et al. (1994)
suggested that there are two groups of BBTV, the South Pacific and the Asian
groups. Between these two groups, the DNA-1-encoded Rep protein differed at
the amino acid level by approximately 5%, however, the DNA-1 origin of
replication remained highly conserved and, importantly, the putative iterative
sequences or iterons, which act as recognition and binding sites for Rep, were
virtually identical.
72
Fig.4.1 Overview of the InPAct strategy to control ssDNA plant viruses. For
virus resistance, the green fluorescent protein (GFP) gene is replaced by the
barnase (ribonuclease) gene.
A transgenic approach to virus resistance appears the most likely
solution to generating bananas resistant to BBTV. Of the methods available,
DRR and InPAct-derived resistance would seem the most effective strategies.
However, for the broad range application of either method it is essential to
73
determine the ability of Rep to not only bind and replicate local BBTV isolates
but also geographically diverse isolates, and vice versa.
The aim of this study, therefore, was to assess the efficiency of cross-
replication between isolates from the South Pacific and Asian groups of BBTV.
In doing so, we hoped to show the limit to which the master Rep protein is
capable of binding and initiating the replication of related sequences. This
information may assist in the design of a worldwide Rep-based resistance
strategy to BBTV and further our understanding of the Rep mediated-replication
process.
4.2 Materials and Methods
BBTV-infected banana material, previously collected from Fiji and Hawaii
(representing the South Pacific group) and Vietnam (representing the Asian
group) and stored at -80°C, was used in this study. Total nucleic acids were
isolated using a modified CTAB extraction method according to Stewart and Via
(1993). Greater-than-genome-length clones (1.1mers) of BBTV DNA-1 and
DNA-3 (Australian isolate) were already available from a previous study (Horser
et al., 2000).
4.2.1 Amplification of BBTV genomic DNA
To amplify the complete sequence of DNA-1 from a Fijian BBTV isolate,
adjacent, outwardly extending primers 1f/1r (Table 4.1) were used in a PCR
containing 100 pmol of each primer, 200 µM dNTP’s, 1mM MgSO4, 2.5 U DNA
74
polymerase (Platinum Pfx, Invitrogen), the manufacturer’s Pfx amplification
buffer and enhancer buffer, and 100 ng of total nucleic acid. The PCR mix was
denatured at 95oC for 3 min followed by 30 cycles of 95oC for 30 sec, 50oC for
30 sec and 68oC for 1 min, followed by one cycle of 68oC for 10 min. In order to
add 3’ A overhangs for future cloning, 5 U of Taq polymerase (Roche) and 2
mM dATP (Roche) were added, mixed and incubated at 72oC for 30 min. PCR
products were electrophoresed through a 1.5% agarose gel, purified using a
QIAquick gel extraction kit (QIAGEN), and cloned into pGEM-T-Easy (Promega)
according to manufacturers’ instructions. Clones were sequenced as previously
described (PE Applied Biosystems) (section 2.2).
The complete DNA-3 sequence of both the Fijian and Vietnamese BBTV
isolate was PCR amplified from total nucleic acid extracts using primers 3f/3r
(Table 4.1) essentially as described above for BBTV DNA-1 (Fiji).
4.2.2 Construction of BBTV 1.1 mer DNA components
The general strategy for the construction of BBTV 1.1mer clones is
presented in Figure 4.2. All primers used are listed in Table 4.1.
Table 4.1 Sequence of the primers used for the construction of the BBTV DNA-
1 and DNA-3 1.1 mers and to amplify the DNA-3 probe.
Name
Sequence
1Yf
5’-AGGAAGGAATCTTTTCTGAAG-3’
75
1Yr 5’-TCGGAAGGAAGTTAGCCATTAC-3’
1Af 5’-AGCGCACGCTCCGACAAAAGCACACTATG-3’
1Ar 5’-GTAATGGAGAGGGGGGAGGTCTATTTATAG-3’
1Bf 5’-TCTAATGAAGACGAGAAATGCGTTTTATTC-3’
1Br 5’-TAAAACGCATTTCTCGTCTTCATTAGATG-3’
1Cf 5’-TCTAATGAAGACGGGAAATGCGTTTTATTC-3’
1Cr 5’-TAAAACGCATTTCCCGTCTTCATTAGATG-3’
1Dr 5’-GAAATGGAGAGGGGGGAGGTCTATTTATAG-3’
1Ef 5’-CAATCGTACGCTATGACAAAAGGGGAAAAG-3’
1Er 5’-GTAGTGGAGGGGGGGGAGTTCTATTTATAG-3’
1Ff 5’-CAAGAATCGAAGGTCCCTTCGAGTTTGGTG-3’
1Fr 5’-CACCAAACTCGAAGGGACCTTCGATTCTTG-3’
3Zf 5’-TATTTCGGATTGAGCCTACTG-3’
3Zr 5’-CTTGACGGTGTTTTCAGGAAC-3’
3Gf 5’-AAGCATCACACCCACCACTTTAGTG-3’
3Gr 5’-GGGCCCTATATCCACAATCCATTAG-3’
3Hf 5’-GGGTTGGGCGCCGGAAGTATGGCAG-3’
3Hr 5’-CTGCCATACTTCCGGCGCCCAACCC-3’
3If 5’-AAGCATCAGAACCACCACTTTAGTG-3’
3Ir 5’-GGGCCCTTATTCCATTATCCATTAG-3’
3Jf 5’-CGGGGGTTGATTGGTCTATCGTATC-3’
3Jr 5’-CTGCGGCCCTTAAGCGATACGATAG-3’
3Pf 5’-AGGTATCCGAAGAAATCCATC-3’
3Pr 5’-ATCATAGCCCAATGAAGTATTC-3’
76
Fig. 4.2 General strategy for the construction of BBTV 1.1 mer components.
The blue line indicates the restriction site for BBTV. The yellow line indicates the
restriction site for the pGEM-T-Easy vector.
DNA-1 (Fiji)
A unique Bbs I restriction site was identified within the DNA-1 sequence
and two primer pairs were designed to amplify separate DNA-1 fragments (both
containing the Bbs I restriction site). Primer pairs 1Af/1Br and 1Bf/1Ar were
used to amplify fragment “F” (approximately 800 bp), and fragment “R”
F primer
r primer
R primer
f primer
F fragment R fragment
Cloning into pGEM-T-easy
vector
PCR to amplify “F” and “R” fragments
Double enzymatic digestion
Double enzymatic digestion
F and R ligation
77
(approximately 510 bp) from total nucleic acids extracted from BBTV-infected
leaves (Fiji), and amplicons were cloned and sequenced.
Clones containing the “F” and “R” fragments were double-digested with
Bbs I and Dra III (New England BioLabs), electrophoresed through a 1.5 %
agarose gel, and the appropriate bands gel purified and ligated to generate the
plasmid DNA-1 1.1mer (Fiji). The plasmid was sequenced, as described
previously, to confirm the integrity of the construct.
DNA-1 (Hawaii)
The sequence of BBTV DNA-1 from Hawaii was already available (GenBank
accession number BBU18077). Primer pairs 1Af/1Cr and 1Cf/1Dr were used to
amplify fragment “F” (approximately 840 bp), and fragment “R” (approximately
500 bp), respectively, from total nucleic acid extracted from the Hawaiian BBTV
isolate. PCR products were cloned and sequenced, and the 1.1mer generated
using the Bbs I and Dra III restriction-ligation approach described above.
DNA-1 (Vietnam)
The sequence of BBTV DNA-1 from Vietnam was already available
(GenBank accession number AF416472). Primer pairs 1Ef/1Fr and 1Ff/1Er
were used to amplify fragment “F” (approximately 515 bp) and fragment “R”
(approximately 829 bp). Construction of the DNA-1 1.1mer (Vietnam) clone was
essentially as described using a unique Ppu MI restriction site.
78
DNA-3 (Fiji)
Based on the sequence of DNA-3, primer pairs 3Gf/3Hr and 3Hf/3Gr
were deigned to amplify fragment “F” (approximately 355 bp) and fragment “R”
(approximately 870 bp), respectively. Construction of the DNA-1 1.1mer
(Vietnam) clone was essentially as described above using a unique Kas I
restriction site.
DNA-3 (Vietnam)
From the sequences obtained, primer pairs 3lf/3Jr and 3Jf/3lr were
designed to amplify fragment “F” (approximately 940 bp) and fragment “R”
(approximately 280 bp). Construction of the DNA-1 1.1mer (Vietnam) clone was
essentially as described above using a unique Bst98 I restriction site.
4.2.3 BBTV DNA-3 specific probe
Primers 3Pf and 3Pr (Table 4.1) were designed to amplify a 236 bp
region spanning the ORF of DNA-3 (Australia). This region shares 95.34%
homology with the DNA-3 ORF sequences of Fiji and Vietnam. A DIG-labelled
PCR product was amplified and prepared for hybridisation as previously
described (2.5.1).
4.2.4 Transient analysis of BBTV cross-replication
Combinations of DNA-1 and DNA-3 1.1mers from different geographical
isolates were co-transformed into banana (cv. ‘Ladyfinger’) embryogenic cells
79
by microprojectile bombardment as previously described (section 2.3). To
enhance replication, the plasmid p35S-ORF5 (kindly supplied by Dr Ben
Dugdale, QUT), from which the BBTV DNA-5 gene product is expressed under
the control of the CaMV 35S promoter, was co-delivered.
As a positive control, total DNA extracted from BBTV-infected plant
material was included. Negative controls included total DNA extracted from
untransformed banana embryogenic cells, and total DNA extracted from banana
cells bombarded with a BBTV satellite (S1) 1.1mer, p35S-ORF5 and DNA-3
1.1mer (Australia). The S1 satellite component encodes a Rep protein incapable
of replicating other BBTV DNA components and was included as negative
control to confirm that any replication observed from the other treatments was a
direct result of the Rep-encoding component.
In total, ten replicate bombardments were performed per plasmid
combination. Total DNA extractions, agarose gel electrophoresis, Southern
hybridisation and signal detection were essentially as described in Chapter 2,
except total DNA was extracted four days post-bombardment and the DNA-3
specific probe was hybridised at 43 0C. Importantly, at this hybridisation
temperature the probe was specific to DNA-3 but cross reacted with all
geographical isolates of DNA-3. The intensity of the replicative monomer signal
served as the reference for relative qualitative comparisons between different
BBTV 1.1mer combinations.
4.3 Results
4.3.1 Sequence analysis of South Pacific and Asian BBTV isolates
80
The complete sequences of DNA-1 and DNA-3 from a Fijian BBTV
isolate and DNA-3 from a Vietnamese BBTV isolate were amplified, cloned and
sequenced. To determine their relatedness to the other BBTV sequences used
in this study, comparisons were made between the putative amino acid
sequences of the M-Rep from the Australian, Fijian, Hawaiian and Vietnamese
isolates, and between the published nucleotide sequences of BBTV DNA-3 from
the Australian, Fijian and Vietnamese isolates (Figures 4.3 and 4.4,
respectively).
Alignment of the amino acid sequences of DNA-1 revealed that the Rep
encoded by the Fijian isolate (obtained in this study), was most similar (98.6%)
to the other South Pacific (Australia and Hawaii) BBTV Rep proteins (differing
by only two amino acids in both cases) and was least similar (95.1%) to the
Vietnamese Rep protein (differing by 14 amino acids).
81
Fig. 4.3 Sequence alignment of the four BBTV master Rep proteins. Au 1=
Australia, Fj 1= Fiji, Hw 1= Hawaii, Vt 1= Vietnam. Sequence identity (%) of
each M-Rep protein with the Australian M-Rep is given at the end of each
sequence. Differing amino acids are indicated in red.
82
Fig. 4.4 Sequence alignment of the BBTV DNA-3 components from Australia
(Au 3), Fiji (Fj 3) and Vietnam (Vt 3). Square brackets delimit the sequences for
the R, F1 and F2 iterons, the putative G-box and the CR-M (major common
region). The stem-loop area, and the start and the stop codons of the open
reading frame are also indicated. Differing nucleotides are indicated in red.
83
84
85
Comparison of the entire BBTV DNA-3 nucleotide sequences from
Australia, with those obtained from Fiji and Vietnam in this study, revealed that
the South Pacific (Australia and Fiji) DNA-3 components showed 98.9% identity,
but between groups (Australia vs. Vietnam) there was only 87.7% identity.
Importantly, the origin of replication (including the stem-loop structure) and the
iterons proposed as Rep binding sites, were completely conserved between
geographical groups. However, significant nucleotide differences were apparent
in the CR-M (the origin of second strand synthesis) and a single nucleotide
polymorphism was evident in the putative G-box 5’ of the stem-loop structure.
4.3.2 Cross-replication of South Pacific and Asian BBTV DNA components
Analysis of cross-replication between geographically diverse BBTV
components was examined in three independent experiments. As expected, the
Rep encoded by DNA-1 (Australia) was shown to efficiently replicate its cognate
DNA-3 component (Figure 4.5). Further, based on the relative intensity of
replicative monomers observed in Figure 4.5, the heterologous Reps encoded
by both DNA-1 (Fiji) and DNA-1 (Vietnam) were also shown to be capable of
replicating DNA-3 (Australia) just as efficiently as the Australian BBTV Rep.
However, when the Rep encoded by DNA-1 (Australia) was tested for its ability
to cross-replicate DNA-3 from either Fiji or Vietnam, it was found to efficiently
replicate BBTV DNA-3 derived from a South Pacific isolate (Fiji), but was unable
to efficiently replicate BBTV DNA-3 from an Asian isolate (Vietnam)(Figure 4.6).
86
Fig. 4.5 Replication of Australian BBTV DNA-3 by its cognate (Australia) and
heterologous (Fiji, Vietnam) M-Reps (DNA-1). Cloned 1.1 mers of BBTV DNA-3
(Aust) were co-bombarded with either BBTV DNA-1 from Fiji, Vietnam or
Australia, plus BBTV DNA-5 under the control of the CaMV 35S promoter.
Replication was evaluated four days post-bombardment by Southern blot
analysis using a BBTV DNA-3 specific probe. Four replicates are shown. “I”
represents nucleic acids extracted from infected tissue. The BBTV replicative
intermediates [open circular (oc), supercoiled (sc) and single stranded (ss)] are
indicated. “U” represents nucleic acids extracted from non-bombarded
(untransformed) banana cell suspensions. S1 indicates the combination of the
BBTV S1 satellite plus the Australian DNA-1 and DNA-5 under the CaMV 35S
promoter. The lower panel is a loading control and shows the ethidium bromide-
stained DNA extracts prior to blotting.
Fiji Vietnam Australia
I U S1
viral DNA
oc
sc ss
87
Fig. 4.6 Replication of BBTV DNA-3 derived from Fijian, Vietnamese and
Australian BBTV isolates by the master Rep from Australia. Cloned 1.1 mers of
DNA-3 from the different isolates were co-bombarded with DNA-1 from Australia
plus DNA-5 under the control of the CaMV 35S promoter. Replication was
evaluated four days post-bombardment by Southern blot analysis using a DNA-
3 specific probe. Four replicates are shown. “I” represents nucleic acids
extracted from infected tissue. The BBTV replicative intermediates [open
circular (oc), supercoiled (sc) and single stranded (ss)] are indicated. “U”
represents nucleic acids extracted from non bombarded (untransformed)
banana cell suspensions. S1 indicates the combination of the BBTV S1 satellite
plus the Australian DNA-1 and DNA-5 under the control of the 35S promoter.
The lower panel is a loading control and shows the ethidium bromide-stained
DNA extracts prior to blotting.
I U S1
Fiji DNA-3
Australia DNA-3
Vietnam DNA-3
viral DNA oc
sc ss
88
To determine whether another member of the South Pacific group of
BBTV isolates was capable of replicating an Asian-derived BBTV component,
the Rep encoded by DNA-1 (Hawaii) was tested (Figure 4.7). Despite some
internal variation between treatments, a similar result was obtained, with the
Hawaiian BBTV Rep capable of replicating DNA-3 from two South Pacific BBTV
isolates (Australia and Fiji) but incapable of efficiently replicating the Asian DNA-
3 (Vietnam) component. Importantly, no replication of any DNA-3 component
tested was observed in the BBTV satellite (S1) negative control. A qualitative
evaluation of the summarised data is illustrated in Table 4.2.
4.4 Discussion
Although several Rep-encoding satellite DNAs have been isolated from
several Asian BBTV isolates, it is only the Master Rep protein encoded by DNA-
1 that is an integral component of the BBTV genome and capable of initiating
replication of all other viral genomic components (Horser, 2000; Horser et al.,
2001 a, b). Based on a sequence variability study of BBTV DNA-1 from different
geographical isolates, Karan et al. (1994) reported the existence of two
geographical groupings of BBTV isolates, the South Pacific and Asian groups.
The greatest sequence diversity in the DNA-1 encoded Rep protein between
these two groups was approximately 5% at the amino acid level while within
groups DNA-1 variability never exceeded 3% at the nucleotide level. Later, a
more detailed sequence variability analysis of BBTV DNA-1 sequences
89
Fig. 4.7 Replication of BBTV DNA-3 derived from Fiji, Vietnam and Australia by
the master Rep from Hawaii. Cloned 1.1 mers of DNA-3 from the different
isolates were co-bombarded with DNA-1 from Hawaii plus DNA-5 under the
control of the CaMV 35S promoter. Replication was evaluated four days post-
bombardment by Southern blot analysis using a DNA-3 specific probe. Four
replicates are shown. “I” represents nucleic acids extracted from infected tissue.
The BBTV replicative intermediates [open circular (oc), supercoiled (sc) and
single stranded (ss)] are indicated. “U” represents nucleic acids extracted from
non bombarded (untransformed) banana cell suspensions. S1 indicates the
combination of the BBTV S1 satellite plus the Australian DNA-1 and DNA-5
under the control of the 35S promoter. The lower panel is a loading control and
shows the ethidium bromide-stained DNA extracts prior to blotting.
I U S1
Fiji DNA-3
Australia DNA-3
Vietnam DNA-3
viral DNA oc
sc ss
90
Table 4.2 Qualitative evaluation of BBTV cross replication between South
Pacific and Asian isolates.
DNA-1
DNA-3
Australia
Hawaii
Fiji
Vietnam
Australia
+++++
+++++
+++++
+++++
Fiji
+++++
++++
ND
ND
Vietnam
+
+
ND
ND
Countries running horizontally represent DNA-1 (Rep) donor isolates and
countries running vertically represent DNA-3 (Coat protein) donor isolates.
Intensity of the replicative monomer signal (i.e. efficiency of replication) is
represented with +. Efficiency of replication ranges from low/undetectable (+) to
high (+++++). ND = not determined.
91
throughout Vietnam (Asian group) suggested that the Vietnamese BBTV
isolates could be further divided into two geographical subgroups that generally
correlated to the northern or southern regions of Vietnam (Bell et al., 2002).
Moreover, the sequence variability within Vietnam was greater than (at least
double) than that previously reported from within the Asian group (Karan et al.,
1994). In the present study, the Rep encoded by DNA-1 (Vietnam) showed
94.8% amino acid identity to that of the Rep encoded by DNA-1 (Australia) and,
although the replicative elements (including the origin of replication and iterons)
were highly conserved, the sequence of the DNA-3 components from both
isolates differed by 12.3% at the nucleotide level. Despite these differences, the
Rep encoded by DNA-1 (Vietnam) was capable of initiating replication of the
coat protein gene encoded by DNA-3 (Australia). This finding would suggest
that this Rep is able to recognize and bind iterative sequences adjacent to the
origin of replication of DNA-3 (Australia) and that the replication initiator
domains and the helicase domains are able to co-ordinately function to
accomplish rolling circle replication.
In contrast, the Reps encoded by the DNA-1 components representing
the South Pacific group (Australia and Hawaii) were able to initiate replication of
their cognate components but not the Asian-derived DNA-3 (Vietnam)
component. This specificity for replication is most likely due to subtle sequence
differences in the intergenic region and Rep proteins of opposing isolates thus
preventing or inhibiting Rep recognition and/or binding and therefore
accumulation of replicative intermediates.
92
As the origin of replication and the proposed iteron sequences are
identical in all BBTV components used in this work, we assume additional cis-
acting sequences may be involved in Rep recognition/binding. In fact, in a
cross-replication study using two begomoviruses, Fontes et al. (1994b)
proposed that geminivirus replication origins are composed of at least three
functional modules: (1) a putative stem-loop structure that is required for
replication but does not contribute to virus-specific recognition of the origin, (2)
specific, high-affinity binding sites for the AL1 (Rep) protein, the iterons, and (3)
at least one additional element that contributes to specific origin recognition by
viral trans-acting factors. The precise location in the BBTV genome and the
exact role of this additional element in the BBTV replication process has yet to
be determined, however, it seems plausible that nucleotide differences in this
additional element may contribute to the inability of the DNA-3 component from
Vietnam to be replicated by Rep proteins from South Pacific BBTV isolates.
When the DNA-3 sequences from all four BBTV isolates used in this
study were compared, greatest variability was observed within the 3’ region of
the Common Region-Major (CR-M). This finding is consistent with the results of
Wanitchakorn et al. (2000) who showed that the 90 bp CR-M was highly
conserved (maximum 4.05% nucleotide variation) in isolates of the same group,
but varied greatly (maximum 42.22% nucleotide variation) between groups. The
CR-M is the initiation site for self-primed complementary strand synthesis of the
ssDNA genome during rolling circle replication (Hafner et al., 1997a), a process
essential to the formation of the transcriptionally active dsDNA. To date,
93
however, there is no evidence to suggest that the virus-encoded Rep binds to
this element or is integral to this process.
The G-box, CACGTG, is a hexameric cis-element located in the
upstream regulatory region of many diverse plant genes, and has been show to
be an essential functional component of many stimulus-responsive promoters
(Menkens et al., 1995). Some geminiviruses contain a G-box within their
intergenic region which acts primarily as a positive regulator of viral
transcription, and although not essential to viral replication, has been suggested
to contribute to efficient origin utilisation (Eagle and Hanley-Bowdoin, 1997).
Mutations in the G-box of Tomato golden mosaic virus (TGMV) caused a
decrease in genome replication efficiency, an effect possibly reflecting a
reduced affinity for a putative G-box factor; a factor which normally might
facilitate Rep recruitment and binding to the origin, modulate chromatin
assembly and origin accessibility, or stabilise an origin conformation required for
efficient replication (Eagle and Hanley-Bowdoin, 1997; Hanley-Bowdoin et al.,
2000). Interestingly, all BBTV DNA-3 components from the South Pacific group
of isolates contain a putative G-box sequence, CACGTA, immediately upstream
of the stem-loop structure and origin of replication. In DNA-3 (Vietnam),
however, the similarly located motif differs by one nucleotide, CACGTG, and
conforms to the consensus G-box sequence. This subtle difference in a motif
associated with modulating replication efficiency may be linked with the
differences in replication observed in this study. However, until mutational
analysis of DNA-3 (Vietnam) can be assessed (for example mutating the G-box
94
motif to mirror that of the South Pacific group DNA-3) the exact role of this motif
remains unclear.
Interestingly, two strains of Tomato leaf curl virus (ToLCV-Nde) from New
Delhi (sharing 94% sequence identity) cause either mild or severe symptoms on
tomato and tobacco. Both strains are capable of replicating their cognate DNAs
but inefficiently cross-replicate between strains. The specificity determinant was
mapped to a single amino acid change (D10N) in the amino terminus of the Rep
which was shown to interact with the third base pair of the putative binding site
sequence, GGTGTCGGAGTC, in the severe strain (Chatterji et al., 1999).
Similarly, the virus-specific origin-recognition domains of both the TYLCV and
TGMV Reps have been mapped to the first 116 and 211 amino acids,
respectively (Gladfelter et al., 1997; Jupin et al., 1995). Importantly, two of the
more significant amino acid differences, A16T and F25I, between the BBTV
DNA-1 (Vietnam) Rep and its South Pacific counterparts occur within the first 25
amino acids of the N terminus. Both changes are within proximity to an
upstream sequence, CWMFTIN, which conforms to a dNTP binding motif
consensus sequence described by Gorbalenya et al. (1990). Obviously these
differences do not appear to affect the ability of DNA-1 (Vietnam) to replicate
South Pacific BBTV isolates but may be associated with the low replication
efficiencies observed between the South Pacific-derived Reps and DNA-3
(Vietnam). In order to determine the significance of these amino acid changes,
we intend mutating these amino acids within the DNA-1 (Australia) Rep to that
of the DNA-1 (Vietnam) Rep and repeating cross-replication assays with the
DNA-3 (Vietnam) component.
95
Faba bean necrotic yellows virus (FBNYV), Milk vetch dwarf virus (MDV)
and Subterranean clover stunt virus (SCSV) are all members of the Nanovirus
genus. Unlike BBTV, these viruses all infect legumes and are serologically
related. In addition, Timchenko et al. (2000) showed the Rep proteins of these
nanoviruses were capable of supporting the replication of heterologous DNAs
across species. This finding is in stark contrast to the results of this study ie.
Reps derived from South Pacific isolates of BBTV are incapable of supporting
efficient intra-species replication. Together these findings raise questions as to
the taxonomic status of the legume-infecting nanoviruses and the biological and
biophysical constraints placed on the evolution of both nanovirus and babuvirus
genera.
This study has provided some useful guidelines for the design of a
globally-effective InPAct vector to generate BBTV resistant bananas. InPAct
vectors rely on efficient Rep-mediated release of a suicide gene expression
cassette and, therefore, the intergenic regions flanking this cassette should be
recognised and processed by Rep proteins encoded by geographically diverse
BBTV isolates. Based on our findings, the intergenic region of BBTV DNA-3
from Vietnam would be best suited for such a vector, as this component was the
only one effectively replicated by the Rep-encoding components of both Asian
and South Pacific BBTV isolates. In relation to DRR, however, a more detailed
functional analysis of the inability of South Pacific derived BBTV Reps to
replicate Asian derived BBTV isolates is required. For example, is this
phenomenon in fact due to inhibition of Rep binding to the intergenic region
during the initial stages of RCR or is this effect due to an impedance of later
96
downstream Rep-associated functions. Only until these questions are answered
will we be able to address the requirements of a global DRR strategy to BBTV in
banana.
97
Chapter 5
Mapping the 5’ Ends Encoded by BBTV
5.1 Introduction
As part of the molecular characterization of the BBTV, northern
hybridisation and 3’ RACE analysis have been previously used to map the RNA
transcripts associated with the major genes of BBTV DNA-1 to –6 (Beetham et
al., 1997; 1999). From their analysis, Beetham et al. (1997) determined that two
mRNAs were transcribed from DNA-1, one from the major Rep ORF, and
another from the small ORF completely internal to the major Rep ORF in a +2
reading frame. DNA-2 to –6, however, were monocistronic, as only one mRNA
was transcribed from each component (Beetham et al., 1999).
Although the 3’ ends of the transcripts associated with BBTV DNA-1 to -6
have been analysed, no studies have been undertaken to characterise the
5’ends. This chapter reports the amplification, cloning, sequencing and mapping
of the 5’ ends of the transcripts associated with the major ORFs of BBTV DNA-1
to -6. Such information is necessary to complete the characterisation of the
BBTV intergenic regions and to gain a better understanding of the BBTV
transcription process.
98
5.2 Materials and Methods
5.2.1 Plant material
BBTV-infected leaf and midrib samples were obtained from both growth
cabinet-maintained banana plants (Musa spp. cv. “Cavendish”) (3 month old
infection) and field isolates from Nambour, Qld, Australia. All samples were
collected, immediately frozen in liquid nitrogen and stored at –800 C prior to
RNA extraction.
5.2.2 RNA extraction
Total RNA was isolated from plant material according to Schuler and
Zielinski (1989) with some modifications. Banana tissue (1.5 g) was ground to a
fine powder in liquid nitrogen and incubated at 65oC for 15 min in 15 ml of pre-
warmed TEN buffer (100 mM Tris pH 8, 50 mM EDTA pH 8.0, 500 mM NaCl)
containing 0.01 vol. of β-mercaptoethanol. After incubation, an equal volume of
CHCl3:IAA (24:1) was added, vortexed and centrifuged at 3,700 rpm for 10 min.
The supernatant was transferred to a fresh tube and the CHCl3:IAA extraction
repeated. An equal volume of isopropanol was added to the supernatant and
RNA precipitated by centrifugation at 3,700 rpm for 10 min. The pellet was air
dried for ~10 min, resuspended in 900 μl of SSTE (0.1 M NaCl, 0.5% SDS, 10
mM Tris-HCl pH 8, 5 mM EDTA pH 8.0) and extracted in an equal volume of
CHCl3:IAA. A 0.25 volume of 10 M LiCl and 0.25 volume of 8 M urea were
added to the supernatant, mixed by inverting and incubated at 4oC overnight.
Samples were centrifuged at 14,000 rpm for 15 min and the pellet resuspended
in 600 μl of SSTE. An equal volume of isopropanol and 0.1 volume of 3 M
99
NaOAc (pH 7.0) were added, samples mixed by inversion and centrifuged at
14,000 rpm for 5 min. The pellet was washed in 800 μl of 70% ethanol and
centrifuged at 14,000 rpm for 5 min. The resulting pellet was air dried and
resuspended in 40 μl of sterile ddH2O.
5.2.3 DNase treatment
For DNase treatment, 10 μl of RNA sample, 6 U of DNase, 1 X buffer
(Promega), and 10 U of RNase inhibitor (Invitrogen) were combined in a final 20
μl volume and incubated at 37oC for 30 min. RNA was extracted by addition of
750 μl SSTE and 750 μl CHCl3:IAA (24:1), vortexed and centrifuged for 5 min.
RNA was precipitated by addition of an equal volume of isopropanol and 0.1
volume of 3 M NaOAC (pH 7.0), incubation on ice for 10 min, and centrifugation
for 10 min. The pellet was washed once with 70% ethanol, the pellet air dried for
approximately 10 min and finally resuspended in an appropriate volume of
sterile ddH2O (usually 10 μl).
5.2.4 RT-PCR controls
Prior to reverse transcription (RT), 10 μl of the RNA sample was
incubated with 50 μM of GeneRacerTM RNA Oligo dT Primer (5’-
GCTGTCAACGATACGCTACGTAACGGCATGACAGTG(T)18-3’) (Invitrogen) at
75oC for 5 min and immediately chilled on ice for 3 min. The RT reaction
contained 15 U of Thermoscript enzyme and its 5X first strand buffer, 1 μl of 0.1
M DTT and 10 U RNase inhibitor (Invitrogen) plus 2 μl of 10 mM dNTP’s mix
100
and was incubated at 50oC for 90 min. The reaction was stopped by incubation
at 85oC for 5 min and RNA degraded by addition of RNase H (2 U) and
incubation at 37oC for 20 min.
To ensure successful cDNA synthesis and the presence of all BBTV-
associated transcripts, control RT-PCRs were performed using gene-specific
primers designed to amplify a fragment within the ORF of each of the BBTV
components (Table 5.1). PCR mixes comprised 100 pmol of each primer, 10
mM dNTP’s, 2.5 U DNA polymerase mix (Expand Long Template, Roche) with
the manufacturer’s buffer system 1 and 1 μl of RT reaction, and were denatured
at 95oC for 5 min followed by 35 cycles of 95oC for 1 min, 55oC for 1 min and
68oC for 1 min followed by 1 cycle of 68oC for 10 min. PCR products were
electrophoresed through a 1.5% agarose gel.
5.2.5 RLM-RACE to detect and characterise 5’ ends
RNA ligase-mediated rapid amplification of 5’ cDNA ends (RLM-RACE)
was carried out using the GeneRacerTM Kit (Invitrogen Life Technologies),
following the directions of the manufacturer. An outline of the protocol is shown
in Fig. 5.1.
Dephosphorylation reaction
Up to 15 μg of total RNA was incubated with 1 X CIP buffer, 40 U
RNaseOutTM, 10 U CIP and DEPC water in a final volume of 10 μl at 50oC for 1
hr. After incubation, the tube was centrifuged briefly and placed on ice.
101
Table 5.1. PCR primers used as internal RT-PCR controls.
Name
Sequence
BT1fw
5’-ATGGCGCGATTGTGGTATGCTGGATGTTC-3’
BT1rv 5’-CTCTGCTTGTACTCTGTATAATG-3’
BT2fw 5’-ATGACCGAAGGTCAAGGTAACCGG-3’
BT2rv 5’-CCTCTCTAGATGCAGGTCGTTCC-3’
BT3fw 5’-ATGTTCAGACAAGAAATGGCTAGG-3’
BT3rv 5’-AATAAACCTGGGGCTTCCAGAC-3’
BT4fw 5’-AGGAGCTCGTGAGGTGTTTGG-3’
BT4rv 5’-CTTGATCATCCCTTCTATTTGG-3’
BT5fw 5’-GAAATGGAGTTCTGGGAATCGTCTGCC-3’
BT5rv 5’-CTTGATATACTGAGTAATCACC-3’
BT6fw 5’-GGAAGGCAGAAGCGATGGATTGGGCGG-3’
BT6rv 5’-CATTATGATATCCATATCCTCC-3’
102
Fig. 5.1 Overview of the RLM-RACE protocol
Precipitation of RNA
103
To precipitate the RNA, 750 μl SSTE and 750 μl CHCl3:IAA (24:1) were
added, the samples vortexed and then centrifuged for 5 min. An equal volume of
isopropanol and 0.1 volume of 3 M NaOAC (pH 7.0) were added to the
supernatant, incubated on ice for 10 min and centrifuged for 10 min. The pellet
was washed once with 70% ethanol, air dried and resuspended in 7 μl of DEPC-
treated water.
Decapping reaction
Decapping of the RNA was achieved using 7 μl dephosphorylated RNA,
1 X TAP buffer, 40 U RnaseOutTM and 0.5 U TAP in a final volume of 10 μl. The
reaction carried out at 37oC for 1 hr. RNA was subsequently precipitated as
previously described and resuspended in 7 μl DEPC-treated water.
Ligation reaction
The 7 μl of dephosphorylated, decapped RNA was added to a tube
containing 0.25 μg of lyophilised GeneRacerTM RNA Oligo (5’-
CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3’),
incubated 65oC for 5 min and then placed on ice for 2 min. The following
reagents were added in a final volume of 10 μl: 1 X Ligase buffer, 1 mM ATP, 40
U RNaseOutTM and 5 U T4 RNA Ligase and incubated at 37oC for 1 hr. RNA
was precipitated as previously described and resuspended in 10 μl DEPC-
treated water.
104
5.2.6 Reverse transcription
Prior to reverse transcription, 50 μM of the GeneRacerTM Oligo dT Primer
and 1 μL of dNTP Mix (10 mM each) were added to the ligated RNA, incubated
at 65oC for 5 min and placed on ice for 2 min. The following reagents were
added to the 12 μL ligated RNA/primer mixture in a final volume of 20 μL: 1 X
First strand buffer, 10 mM DTT, 40 U RNaseOutTM and 15 U ThermoscriptTM RT.
The reaction was incubated at 50oC for 50 min and placed on ice for 2 min. RNA
was degraded by addition of 2 U of RNase H and incubation at 37oC for 20 min.
5.2.7 PCR amplification of cDNA 5’ ends
PCR mixes to amplify the 5’ ends of each BBTV-associated cDNA
contained 30 pmol of GeneRacer TM 5’ Primer (Table 5.2) and 10 pmol of DNA-1
to –6 specific primer (Table 5.2) with 200 μM dNTPs, 2.5 U DNA polymerase
mix (Expand Long Template, Roche) with the manufacturer’s buffer system 1
and up to 2 μl of the RT reaction from RLM-RACE. PCR mixes were denatured
at 95oC for 5 min followed by 35 cycles of 95oC for 30 sec, 55oC for 30 sec
(except for DNA-5 for which a 60oC annealing temperature was used) and 68oC
for 1 min, followed by one cycle of 68oC for 10 min.
A second nested PCR to amplify 5’ ends contained 10 pmol of
GeneRacer TM 5’ Nested Primer (Table 5.2) and 10 pmol of DNA-1 to –6 nested
primer (Table 5.2) with 200 μM dNTPs, 2.5 U DNA polymerase mix (Expand
Long Template, Roche) with the manufacturer’s buffer system 1 and 1 μl of the
105
Table 5.2 Sequence of the PCR GeneRacerTM primers and reverse gene
specific primers (GSP) used to amplify BBTV 5’ ends.
Primer
Sequence
GeneRacer TM 5’ primer
5’-CGACTGGAGCACGAGGACACTGA-3’
GeneRacer TM 5’ nested primer 5’-GGACACTGACATGGACTGAAGGAGTA-3’
DNA-1 primer 5’-TGATATTCTCCACCTCTGATGTCCAAG-3’
DNA-1 nested primer 5’-AGTTCTCCAGCTATTCATCGCCTTC-3’
DNA-2 primer 5’-ATCTTCCGCCTCAGCACAACCACC-3’
DNA-2 nested primer 5’-AGAGAGCAATTATCCTTGACAG-3’
DNA-3 primer 5’-AATAAACCTGGGGCTTCCAGAC-3’
DNA-3 nested primer 5’-GGTTGTCGGCTGGTTGATTTCC-3’
DNA-4 primer 5’-CTTGATCATCCCTTCTATTTGG-3’
DNA-4 nested primer 5’-GAAGGGATTACCTGAGATACATGTG-3’
DNA-5 Primer 5’-TTACTCCTACATCTTCTTCCTCTGTC-3’
DNA-5 nested primer 5’-GAAGAAGAGAGTACCTCATCACAATAG-3’
DNA-6 primer 5’-CATTATGATATCCATATCCTCC-3’
DNA-6 nested primer 5’-GAATGGTACTATGAGTACTGGAC-3’
initial PCR. Cycling parameters for the nested PCR were as described for the
initial PCR.
106
5.2.8 Analysis of 5’ RLM-RACE products from BBTV-infected banana
tissue
Nested PCRs were electrophoresed through a 1.5% agarose gel and
products excised and purified using a QIAquick gel purification kit (QIAGEN)
according to the manufacturers instructions. Purified PCR products were ligated
into pGEM-T- Easy vector using 80 U of T4 DNA Ligase (NE BioLabs) in a
reaction containing 5X buffer, 50 ng of vector and approximately 200 ng of PCR
product. Ligation reactions were incubated at 16oC overnight and transformed
into XL1 blue competent E. coli as described previously (Chapter 2).
Recombinant colonies were inoculated into liquid LB medium and plasmid DNA
purified using a Miniprep kit (Roche) according to the manufacturers’
instructions.
Plasmid DNA was digested with Eco RI restriction enzyme and
electrophoresed through a 1.5% agarose gel. Clones containing inserts were
sequenced using automated sequencing and Big Dye Termination Cycle
Sequencing Ready Reaction (BDT 3.1, PE Applied Biosystems).
5.3 Results
5.3.1 RNA extraction and control RT-PCRs
The quantity and quality of total RNA extracted from both young leaves
and midribs of BBTV infected plants was evaluated by electrophoresis through
107
agarose (Fig. 5.2A). In both instances, two major bands of largely undegraded
RNA were observed. As BBTV gene expression is thought to vary considerably
throughout infection (Beetham et al., 1999), control RT-PCRs were conducted in
order to demonstrate the presence of transcripts associated with all six BBTV
DNA components within the RNA extracts. Using RT-PCR with component-
specific primer pairs designed to amplify a region internal to each of the six
major ORFs, products of the expected size were amplified for each BBTV
genomic component (Fig. 5.2B) suggesting the RNA extract would be suitable
for further 5’ RACE studies. Further, control RT-PCRs designed to amplify a
banana house-keeping gene, the actin gene, suggested the RNA extract was
not contaminated with extraneous genomic DNA, as no product was obtained in
the no RT control and the expected size reduction between amplicons derived
from cDNA and gDNA was observed correlating to the processing of a small
(~100 bp) intron within the actin transcript.
108
Fig. 5.2 Agarose gel electrophoresis of RNA and RT-PCR samples. (A) Total
RNA extracted from BBTV infected banana plant material (Lane 1). M= marker
X (Roche). (B) RT-PCR to identify the presence of transcripts associated with
BBTV DNA-1 to -6. Lanes 1-6 correspond to RT-PCR products associated
BBTV DNA-1 to -6, respectively. M2=Marker 2 Log (NE Biolabs), PA=Actin
positive RT-PCR control, NA=Actin negative RT-PCR control, A=Actin gDNA
positive PCR control.
5.3.2 Analysis of the 5’ untranslated regions of BBTV DNA-1 to –6
transcripts
Having confirmed the presence of transcripts associated with each of the
six BBTV DNA components, RLM-5’ RACE was used to map their initiation
sites. Using approximately 7 to 8 μg of total RNA from BBTV infected banana
leaves, 5’ RACE products were only obtained for the DNA-3 and –6 ORFs,
109
suggesting these genes may have been more abundant at the stage of infection
when the samples were taken. This was supported by the fact that 5’ RACE
products for DNA-1, -2, -4 and –5 ORFs were only obtained when double the
total RNA (~15 μg) isolated from BBTV-infected banana tissue was used as a
template for RT-PCR. RLM-5’ RACE products were ligated into pGEM-T and
between 5 and 18 independent clones for each BBTV DNA component were
sequenced and analysed (Figure 5.3).
Eighteen BBTV DNA-1 RLM-5’ RACE clones were sequenced and
aligned with BBTV DNA-1 (GenBank accession number NC_003479). Nine
clones included 18 bp of untranslated sequence and 462 bp of translated
sequence. The other nine clones included 15 nucleotides of untranslated
sequence and 462 nucleotides of translated sequence. Two transcription
initiation sites were identified for DNA-1, one mapping to nt 84 and the other
mapping to nt 87.
Nine BBTV DNA-2 RLM-5’ RACE clones were sequenced and aligned
with BBTV DNA-2 (GenBank accession number NC_003475). Five of the clones
included 20 bp of untranslated sequence and 152 bp of translated sequence,
110
Fig. 5.3 Sequence of cloned 5’ RACE products for each BBTV DNA component.
Sequences are aligned with the published BBTV DNA component sequence for
convenience. Intergenic region is in italics, putative TATA boxes are underlined,
and ATG translation start codon is in bold.
and the transcription initiation site mapped to nt 122. The other four clones
included 23 nt of untranslated sequence and 152 nt of translated sequence, and
the transcription initiation site mapped to nt 119. However, in comparison to the
GenBank sequence, the isolated 5’ UTR contained a two nucleotide change
(GA to TC) at the immediate 5’ end.
DNA-1 CTATAAATAGACCTCCCCCCTCTCCATTACAAGATCATCATCGACGACAGAATGGCGCGATATGTG nt 51
CAATAATTAAGAGAACTGTTCAAACTCGTGGTATGACCGAAGGTCAA DNA-2 nt 110
CTATAAATACCAGTGTCTAGATAGATGTTCAGACAAGAAATGGCTAGGTATCCG DNA-3 nt 189
AACAAATGGCTAGGTATCCG RLM-5’RACE
GAACTGTTCAAACTCGTGGTATGACCGAAGGTCAA
ACTGAACTGTTCAAACTCGTGGTATGACCGAAGGTCAA RLM-5’RACE
ATCATCATCGACGACAGAATGGCGCGATATGTG
ATCATCGACGACAGAATGGCGCGATATGTG RLM-5’RACE
CTATAAATAGGACGCAGCTAAATGGCATTAACAACA
AGGACGCAGCTAAATGGCATTAACAACA
nt 258
RLM-5’RACE
DNA-4
CTATTTAAACCTGATGGTTTTGTGATTTCCGAAATCACTCGTCGGAAGAGAAATGGAGTTCTGGGAA
ACTCGTCGGAAGAGAAATGGAGTTCTGGGAA
nt 188
RLM-5’RACE
DNA-5
CTATTAATATGTGAGTCTCTGCCGAAAAAAATCAGAGCGAAAGCGGAAGGCAGAAGCGATGGATTGGGCGGAA
AGAGCGAAAGCGAAGCAGAAGCGATGGATTGGGCGGAA
nt 223
RLM-5’RACE
DNA-6
111
Twelve BBTV DNA-3 RLM-5’ RACE clones were sequenced and aligned
with BBTV DNA-3 (GenBank accession number NC_003473). All 12 clones
included 5 nucleotides of untranslated sequence and 276 nucleotides of
translated sequence, and the transcription initiation site mapped to nt 223.
However, in comparison to the GenBank sequence, the isolated 5’ UTR
contained one nucleotide change, a C to G transition at nt 225.
Five BBTV DNA-4 RLM-5’ RACE clones were sequenced and aligned
with BBTV DNA-4 (GenBank accession number NC_003474). All five included
13 nt of untranslated sequence and 296 nt of translated sequence, and the
transcription initiation site mapped to nt 266.
Fourteen BBTV DNA-5 RLM-5’ RACE clones were sequenced and
aligned with BBTV DNA-5 (GenBank accession number NC_003477). All 14
clones included 16 nt of untranslated sequence and 359 nt of translated
sequence and the transcription initiation site mapped to nt 224.
Twelve BBTV DNA-6 RLM-5’ RACE clones were sequenced and aligned
with BBTV DNA-6 (GenBank accession number NC_003476). All 12 clones
included 23 nt of untranslated sequence and 267 nt of translated sequence and
the transcription initiation site mapped to nt 256. However, compared with the
GenBank sequence, two nucleotide deletions (nt 268 and 272) were evident in
the isolated 5’ UTR.
5.4 Discussion
In this study, the GeneRacerTM kit for full-length RNA ligase-mediated
rapid amplification of 5’ cDNA ends (RLM-5’ RACE) was used to map the
112
transcription start sites of the major ORFs associated with the six DNA
components of BBTV. In all cases, the transcription start sites were located 3’ of
a putative TATA box and the 5’ UTRs varied in length from 23 nucleotides
(DNA-6) to 5 nucleotides (DNA-3). These results support the predicted
consensus TATA boxes for DNA-1, -3 -4, -5 and –6 (Burns et al., 1995), and
also confirm the findings of Beetham et al. (1999) suggesting that DNA-2 most
likely utilises a non-consensus TATA box sequence (CAATAATTA) from
nucleotide 110 – 118.
Like the geminiviruses, BBTV gene expression is most likely a complex
process in which transcription from independent components may be trans-
activated or down-regulated in the presence of virus-encoded gene products or
perhaps host-encoded gene products (Sunter et al., 1993; Sunter and Bisaro,
1997). In fact, the BBTV M-Rep has been shown to decrease activity associated
with each of the six BBTV promoters in transient reporter gene studies
(Dugdale, 1998). For this reason, the relative abundance of BBTV transcripts is
likely to vary considerably during the infection process (Beetham et al., 1999).
Considering the age of the infected plant material, it was anticipated that
transcripts associated with some of the BBTV genes (in particular the early
genes encoded by DNA-1 and -5) might only be detected when abundant total
RNA isolated from banana midribs was used as a template for RLM-5’ RACE.
BBTV DNA-1 contains two ORFs which are transcribed during infection
(Beetham et al., 1997). Two potential transcription start sites were mapped for
the Master-Rep encoding gene from this component (nt 84 and 87). The fact
that an equal proportion of clones were isolated for either site suggests these
113
two sequences were not an artefact due to truncated mRNAs, but rather true
initiation sites representing either a RNA polymerase slippage effect or one of
these sequences represents the transcription initiation start site of the smaller
internal ORF. The latter could only be determined using oligo-dT-primed cDNA
in a PCR with a primer specific for the 5’ end sequence (obtained in this study)
in conjunction with an oligo-dT primer. If one of these transcription initiation sites
is utilized by the internal ORF, this approach would yield two RT-PCR products
of differing sizes (the Master-Rep of approx 1 kb and the internal ORF of
approx. 500 bp).
Like DNA-1, two distinct 5’ RACE sequences were obtained for DNA-2.
The longer of these (mapping to nt 119), however, had two nucleotide changes
(GA to TC) in comparison to the GenBank Accession. Again, due to the equal
proportion of clones representing either product it seems unlikely either start site
is an artefact. Rather, this abnormality may be due to natural sequence
variability of BBTV in the field over the ten years since the original BBTV
sequence was published. Based on location and proximity in relation to the
transcription start site determined in this study, these results support the
hypothesis of Beetham et al. (1999) that, unlike the other components, DNA-2
utilizes a non-consensus TATA box (CAATAATTA).
Single transcription initiation sites were mapped for the major genes
associated with DNA-3, -4, -5, and –6. DNA-3 contained the shortest 5’ UTR,
being just 5 nucleotides from the transcription initiation site to the ATG start
codon. Short UTRs have also been observed for the bicistronic RNA transcript
encoding the movement and coat proteins of the Mastreviruses, MSV and DSV
114
(Palmer and Rybicki, 1998). In these cases, however, the short UTR is thought
to bias over-expression from the downstream coat protein coding region. An
explanation for this being, that ribosomes frequently miss the first ATG
(movement protein) in the transcript when located within close proximity
(between 1 and 4 nucleotides) to the 5’ end of the mRNA. In this instance the
next ATG (the coat protein ATG) would be favoured if the “ribosome scanning”
model for initiation of translation holds. The short 5’ UTR of DNA-3 may reflect
size constraints associated with the BBTV genome, and does not appear to
have an effect on the expression levels of the BBTV coat protein, as this gene
product is generally in abundance at most times throughout the infection. The 5’
UTR of DNA-3 isolated in this study did differ from the published sequence (G to
C at nt 225), which may again reflect natural genomic variation. However, the
transcription start site further confirms the findings of Wanitchakorn et al. (1997)
who, based on N-terminal sequencing, proposed the ATG start codon is located
at nt 228, fifteen nucleotides downstream from that proposed originally by Burns
et al. (1995).
Interestingly, the DNA-4 transcription start point was mapped to the last
nucleotide of the consensus TATA box. Of the six components, this 5’ UTR was
the most difficult to isolate, probably due to a low abundance of transcript,
suggesting DNA-4 transcription may be spatially regulated due to a constrained
architecture or down regulated by BBTV-encoded gene products. The latter
suggestion is more likely as the DNA-4 promoter was one of the strongest of the
six BBTV promoters, directing relatively high levels of gfp reporter gene
expression in transient banana cell assays (Dugdale et al., 1998). DNA-5 and –
115
6 transcription start sites mapped to nt 224 and 256, respectively, both
conforming to the predicted TATA box and start codons suggested by Burns et
al. (1995).
In summary, we have mapped the transcription initiation sites of six major
BBTV-encoded genes and confirmed the predicted ORFs, TATA boxes and
likely ATG start codons suggested originally by Burns et al. (1995) with later
revisions by both Wanitchakorn et al. (1997) and Beetham et al. (1999). In
conjunction with the findings of Beetham et al. (1997, 1999) we can now fully
define the transcribed regions of each BBTV DNA component and accurately
predict their promoter regions in an attempt to gain a fundamental
understanding of BBTV gene expression patterns, cell specificity and
development.
Chapter 6
General Discussion
The Geminiviridae and the Nanoviridae are the only plant virus families
with members containing cssDNA genomes. Viruses belonging to both these
families represent a considerable threat to agricultural systems worldwide but
thus far, most strategies used to control these viruses have been ineffective.
Genetically engineered resistance would appear to be the most promising
strategy to generate resistance to these viruses – the success of this approach,
however, is determined to a large degree upon the molecular characterisation of
116
the target virus and knowledge of the virus life cycle, particularly the replication
strategy. In contrast to the geminiviruses, considerably less information is
known about the nanoviruses. As such, this study was undertaken to complete
the molecular characterisation of the nanovirus, BBTV, and to investigate its
replication strategy.
Iterative-sequence motifs (iterons) were initially identified in
geminiviruses, and although they were specific for each geminivirus, their
similar arrangement within phylogenetically defined groups suggested they were
Rep protein-specific binding sites (Argüello-Astorga et al., 1994). Further, it was
demonstrated in some geminiviruses, that mutation of these iterons negatively
affected Rep-binding in vitro and replication in vivo (Chatterji et al., 2000; Choi
and Stenger, 1996; Fontes et al., 1994a,b; Orozco et al., 1998). Iteron-like
sequences were subsequently identified in the nanoviruses, FBNYV, MDV, and
SCSV (Timchenko et al., 2000) and the sole babuvirus, BBTV (Horser, 2000).
Prior to this study, however, the involvement of these sequences in replication
of any of members of the Nanoviridae was unproven.
In order to determine if the putative BBTV iteron sequences were
involved in the recognition and binding of the master BBTV replication initiator
protein (M-Rep) for the initiation of replication, the putative iterons F1, F2 and R
were mutated and transient replication assays were performed in banana cells.
The results from this study indicated that the three repeated motifs were acting
as recognition and possibly binding sites for the M-Rep, since mutation of these
iterons caused a significant reduction in viral replication. The F2 iteron appeared
to be essential to the replication process, since replication levels were barely
117
detectable by Southern hybridisation when this iteron was mutated. It is possible
that the BBTV M-Rep protein has a stronger affinity for the F2 iteron and lower
affinities for the R and F1 iterons. A more detailed investigation of the interaction
of the M-Rep with each of the iterons, perhaps using electrophoretic mobility
shift assays (EMSA), is necessary to confirm this hypothesis. Further research
is also needed to (i) define which nucleotides within the iteron sequences are
essential for recognition and binding of the M-Rep, and how they interact, and
(ii) investigate the amino acids in the M-Rep that interact with the iterons.
Although iterons are known to be important elements in the replication of
geminiviruses, they are not the only factor involved in the initiation of replication.
The putative stem-loop structure containing the invariant sequence, 5’-
TAATATTAC-3’, has also been shown to be important in replication (Fontes et
al., 1994b). Further, the presence of iterons and the stem-loop are still not
sufficient for replication to occur in a recombinant component, since a TGMV
Rep was unable to replicate a BGMV mutant carrying the binding site and the
stem-loop sequence of TGMV (Fontes et al., 1994b). Determining all the factors
involved in the initiation of replication will obviously be an important prerequisite
for the generation of transgenic BBTV-resistant banana plants.
For the successful development of any resistance strategy involving the
viral Rep and Rep-binding (including both mutated Rep and InPact strategies),
whether for geminiviruses or nanoviruses, the level of trans-replication will be a
major factor impacting on the breadth and stability of the resistance. As such, a
study of was undertaken to assess the efficiency of cross-replication between
BBTV isolates from the South Pacific and Asian groups. Analysis of the genome
118
sequences of all available BBTV isolates has revealed that all components
share identical iteron sequences as well as conserved putative stem-loops.
Despite this finding, the M-Reps from the South Pacific group of BBTV isolates
(Australia, Hawaii and Fiji) were only found to initiate replication of South Pacific
virus isolates (Australia and Fiji) and were unable to replicate the Asian isolate
from Vietnam. In contrast, the M-Rep from the Asian BBTV isolate (Vietnam)
was able to initiate efficient replication of the two South Pacific isolates tested
(Australia and Fiji). The results of the cross replication study clearly show that
iteron sequences are not the only elements affecting initiation of replication
(since these were identical) and, as such, have important implications in the
development of resistance strategies. The InPAct technology developed within
the Plant Biotechnology Program at QUT is based upon the activation of an
integrated suicide gene (the ribonuclease, barnase), flanked by viral intergenic
sequences (containing iterons and the stem-loop), in the presence of the viral
Rep protein (Dale et al., 2001). Upon infection, the BBTV M-Rep from the
incoming virus will recognize the viral intergenic region of the InPAct vector and
initiate its replication, thus allowing transcription and translation of RNase which
will lead to cell death and the confinement of the virus. For this strategy to be of
practical use against a broad range of BBTV isolates, it is essential that the
intergenic region used in the InPAct construct is able to be recognised by as
many different BBTV Reps as possible. The results from this cross replication
study suggest that an InPAct vector based on the Australian BBTV intergenic
region would be activated upon infection by both South Pacific BBTV isolates
(Australia, Fiji and Hawaii), as well as an Asian isolate (Vietnam). Further
119
studies would need to be undertaken to determine whether this breadth of
activation extends to other BBTV isolates belonging to the two groups.
Regardless of the in vitro results, it will not be until transgenic bananas are
challenged with BBTV in the field that the success of the InPAct technology can
be assessed. To this end, the initial field trials will be conducted in Hawaii,
where BBTV is a major constraint to production and where a framework for
conducting field trials with transgenic plants is already well established.
The results of the cross replication assays support the notion that
elements other than iterons are involved in the BBTV replication process. For
example, although the M-Rep from Vietnam initiated replication of a DNA
component from Australia, the M-Rep from Australia was unable to initiate
replication of a DNA component from Vietnam. To further our understanding of
the BBTV replication process, EMSA’s could be used to examine the interaction
of the M-Rep protein with the iterons in a cross replication study, in order to
investigate the interaction of the BBTV M-Rep with heterologous BBTV DNA
components from different isolates, and particularly to determine whether the M-
Reps from Australia and Hawaii are perhaps binding to the iterons in the
Vietnamese DNA component but not efficiently initiating replication. It has been
previously shown in the geminivirus, TLCV, that the disruption of the Rep-
binding motifs does not abolish in vivo accumulation of DNA, even when it
prevents high-affinity Rep-binding in vitro (Lin et al, 2003). In contrast, in the
case of BBTV replication, the M-Rep could be binding efficiently to its iterons,
but some other factor(s) could be involved that ultimately determines whether
replication proceeds. In both TLCV and BBTV replication, the replication
120
process appears to include some other different interactions between the Rep
protein and the viral DNA, which might involve additional elements or factor to
those already identified.
Further research is needed to identify any additional factor(s) and to
determine whether they have a role in recognition and binding of the BBTV M-
Rep to its cognate iteron, or whether they have another role in replication.
Interestingly, a comparison of the nucleotide sequence of the three DNA-3
components (Australia, Fiji and Vietnam) used in this study, revealed high
sequence variability in a region that included part of the CR-M (major common
region). Although the CR-M is known to be the site of first-strand synthesis
(Hafner et al., 1997a), there is no evidence to suggest it plays any role in Rep-
binding. Another interesting observation was a nucleotide difference in the G-
box of the Vietnam DNA-3 component. To investigate the possible involvement
of the CR-M and the G-box in replication, site-directed mutagenesis could be
used to mutate the G-box of DNA-3 from Vietnam to make it identical to that of
the Australian isolate. The effect of this change on the ability of the Australian
M-Rep to initiate its replication could then be assessed. If replication is initiated,
the G-box sequences of the DNA-3 components from Australia and Fiji could be
mutated to that of the Vietnamese isolate, and any negative effects on
replication assessed. Mutagenesis could also be used to assess the function of
other sequences in replication, such as regions within, and adjacent to, the CR-
M in the BBTV intergenic region.
The final component of the research in this thesis focussed on the
molecular characterization of the BBTV intergenic regions including the mapping
121
of the 5’ transcription initiation sites for the six BBTV DNA components. The
determination of transcriptional start sites is an essential step in the analysis of
the promoter function. Although the rapid amplification of cDNA ends (RACE)
technique (Frohman et al., 1988) has been used for efficient PCR cloning of
reverse transcribed mRNA ends, we used the GeneRacerTM method, a
technique based on RNA ligase-mediated (RLM-RACE) and oligo-capping rapid
amplification of cDNA ends (RACE) methods, which results in the selective
ligation of an RNA oligonucleotide to the 5’ end of decapped mRNA using T4
RNA ligase (Maruyama and Sugano, 1994; Schaefer, 1995; Volloch et al.,
1994). Using this approach, the 5’ untranslated sequences of the six BBTV DNA
components were obtained, the analysis of which confirmed the putative TATA
boxes previously suggested by Beetham et al. (1999). BBTV DNA-1 contains
two ORFs which are transcribed during infection, one corresponding to the
major M-Rep ORF and another to the small ORF within the major gene ORF
(Beetham et al., 1997). Although two transcription start sites were identified from
DNA-1, it was not possible to determine whether different start sites belonged to
different genes. The function of the protein expressed from the small internal
ORF of DNA-1 is yet to be determined, and it will be interesting to determine
what role, if any, it plays in the replication of the virus. In contrast to DNA-1,
BBTV DNA-2 to –6 are monocistronic (Beetham et al., 1999). Although a single
transcription start site was identified in BBTV DNA-3 to -6, two start sites were
identified in DNA-2. The fact that sequences corresponding to both sites were
present in equal proportions suggested that these were not artefacts but may
have been due to natural variation of the virus in the field. The results from this
122
study have contributed to the analysis of the BBTV promoter regions and further
our understanding of the BBTV transcription process which may ultimately
assist in the development of control strategies.
In summary, the results presented in this thesis have contributed to the
molecular characterisation of BBTV, which is of particular importance in the
development of transgenic resistance to this virus. The major research
outcomes have been (i) characterisation of the BBTV iteron sequences and
demonstration of their involvement in viral replication, most likely as recognition
and binding sites for the M-Rep, (ii) determining the extent to which the M-Rep
is able to recognize, bind and initiate replication of heterologous DNA
components from geographically different BBTV isolates, which has implications
in the development of resistance against this virus using Rep-based strategies
and (iii) mapping the 5’ UTRs of the BBTV DNA components, which extends our
understanding of the BBTV promoters and the viral transcription process. The
results from this study have extended the knowledge that is accumulating on
BBTV and will hopefully lay the foundation for the development of transgenic
bananas that are resistant to this devastating virus, as well as the development
and exploitation of BBTV as a recombinant vector.
123
Chapter 7
References
Agrios, G. (1997). Plant Pathology. 4th ed. Academic Press. USA. pp 479 –
505.
Argüello-Astorga, G. R., Guevara-Gonzalez, R. G., Herrera-Estrella, L. R. &
Rivero-Bustamante, R. F. (1994). Geminivirus replication origins have a group-
specific organization of iterative elements: a model for replication. Virology 203:
90-100.
Argüello-Astorga, G. R. & Ruiz-Medrano, R. (2001). An iteron-related domain is
associated to Motif 1 in the replication proteins of geminiviruses: identification of
potential interacting amino acid-base pairs by a comparative approach. Archives
of Virology 146: 1465-1485.
Aronson, M., Meyer, A., Györgyey, J., Katul, L., Vetten, H., Gronenborn, B. &
Timchenko, T. (2000). Clink, a nanovirus-encoded protein, binds both pRB and
SKP1. Journal of Virology 74: 2967-2972.
124
Asad, S., Haris, W. A., Bashir, A., Zafar, Y., Malik, K. A., Malik N.N. &
Lichtenstein, C.P. (2003). Transgenic tobacco expressing geminiviral RNAs
are resistant to the serious viral pathogen causing cotton leaf curl disease.
Archives of Virology 148: 2341-2352.
Bass, H.W., Nagar, S., Hanley-Bowdoin, L. & Robertson, D. (2000).
Chromosome condensation induced by geminivirus infection of mature plant
cells. Journal of Cell Science 113: 1149-1160.
Baulcombe, D. C. (1996). Mechanisms of pathogen-derived resistance to
viruses in transgenic plants. The Plant Cell 8: 1833-1844.
Becker, D. K., Dugdale, B., Smith, M. K., Harding, R. M. & Dale, J. L. (2000).
Genetic transformation of Cavendish banana (Musa spp. AAA group) cv ‘Grand
Nain’ via microparticle bombardment. Plant Cell Reports 19: 229-234.
Beetham, P., Hafner, G., Harding, R. M. & Dale, J. L. (1997). Two mRNAs are
transcribed from banana bunchy top virus DNA-1. Journal of General Virology
78: 229-236.
Beetham, P., Harding, R. M. & Dale, J. L. (1999). Banana bunchy top virus
DNA-2 to 6 are monocistronic. Archives of Virology 144: 89-105.
125
Behjatnia, S. A. A., Dry, I. B. & Rezaian, M. A. (1998). Identification of the
replication-associated protein binding domain within the intergenic region of
tomato leaf curl geminivirus. Nucleic Acids Research 26: 925-931.
Bell, K., Dale, J. L., Ha, C., Vu, M. & Revill, P. (2002). Characterisation of Rep-
encoding components associated with banana bunchy top virus in Vietnam.
Archives of Virology 147: 695- 707.
Bendahmane, M. & Gronenborn, B. (1997). Engineering resistance against
tomato yellow leaf curl virus (TYLCV) using antisense RNA. Plant Molecular
Biology 33: 351-7.
Boevink, P., Chu, P. & Keese, P. (1995). Sequence of subterranean clover stunt
virus DNA: affinities with the geminiviruses. Virology 207: 354-361.
Briddon, R., Bull, S., Amin, I., Idris, A., Mansoor, D., Bedford, I., Dhawan, P.,
Rishi, N., Siwatch, S., Abdel-Salam, A., Brown, J., Zafar, Y. and Markham, P.G.
(2003). Diversity of DNA ß: a satellite molecule associated with some
monopartite begomoviruses. Virology 312: 106–121.
Briddon, R. (2003). Cotton leaf curl disease, a multicomponent begomovirus
complex. Molecular Plant Pathology 4: 427-434.
126
Brunetti, A., Tavazza, R., Noris, E., Lucioli, A., Accotto, G. P. & Tavazza, M.
(2001). Transgenically expressed T-Rep of Tomato yellow leaf curl Sardinia
virus acts as a trans-dominant-negative mutant, inhibiting viral transcription and
replication. Journal of Virology 75: 10573-10581.
Burns, T., Harding, R. M. & Dale, J. L. (1995). The genome organization of
banana bunchy top virus: analysis of six ssDNA components. Journal of
General Virology 76: 1471-1482.
Campos-Olivos, R., Louis, J.M., Clerot. D., Gronenborn, B. & Gronenborn, A.M.
(2002). The structure of a replication initiator unites diverse aspects of nucleic
acid metabolism. Proceedings of the National Academy of Sciences, USA 88:
6721-6725.
Castillo, A. G., Collinet, D., Deret, S., Kashoggi, A. & Bejarano, E. (2003). Dual
interaction of plant PCNA with geminivirus replication accessory protein (Ren)
and viral replication protein (Rep). Virology 312: 381-394.
Chatterji, A., Padidam, M. Beachy, R. & Fauquet, C. (1999). Identification of
replication specificity determinants in two strains of tomato leaf curly virus from
New Delhi. Journal of Virology 73: 5481-5489.
127
Chatterji, A., Chatterji, U., Beachy, R. & Fauquet, C. (2000). Sequence
parameters that determine specificity of binding of the replication-associated
protein to its cognate site in two strains of tomato leaf curl virus-New Delhi.
Virology 273: 341-350.
Choi, I.-R. & Stenger, D. (1995). Strain-specific determinants of beet curly top
geminivirus DNA replication. Virology 206: 904-912.
Choi, I.-R. & Stenger, D. (1996). The strain-specific cis-acting element of beet
curly top geminivirus DNA replication maps to the directly repeated motif of the
ori. Virology 226: 122-126.
Dale, J. L. (1987). Banana bunchy top: an economically important tropical plant
virus disease. Advances in Virus Research 33: 301-325.
Dale, J., Dugdale, B., Hafner, G., Harding, R., Becker, D., Hermann, S. and
Chowpongpang, S. (2001). A construct capable of release in closed circular
form from a larger nucleotide sequence permitting site specific expression
and/or developmentally regulated expression of selected genetic sequences.
Patent WO01/72996.
Dasgupta, I., Malathi, V.G. & Mukherjee, S.K. (2003). Genetic engineering for
virus resistance. Current Science 84: 341-354.
128
Day, A.G., Bejarano, E.R., Buck, K.W., Burrell, M. & Lichtenstein, C.P. (1991).
Expression of an antisense viral gene in transgenic tobacco confers resistance
to the DNA virus tomato golden mosaic virus. Proceedings of the National
Academy of Sciences, USA 88: 6721-6725.
Dry, I., Rigden, J., Krake, J., Mullineaux, P. & Rezaian, A. (1993). Nucleotide
sequence and genome organization of Tomato leaf curl geminivirus. Journal of
General Virology 74: 147–151.
Dry, I., Krake, J., Rigden, J. & Rezaian, A. (1997). A novel subviral agent
associated with a geminivirus: the first report of a DNA satellite. Proceedings of
the National Academy of Sciences, USA 94: 7088–7093.
Dugdale, B., Beetham, P., Becker, D., Harding, R. & Dale, J. (1998). Promoter
activity associated with the intergenic regions of banana bunchy top virus DNA-
1 to –6 in transgenic tobacco and banana cells. Journal of General Virology 79:
2301-2311.
Dugdale, B. (1998) Promoter activity associated with the intergenic regions of
banana bunchy top virus. PhD Thesis. Queensland University of Technology,
Brisbane, Australia. 177pp.
129
Dugdale, B., Becker, D., Beetham, P., Harding, R. M. & Dale, J. L. (2000).
Promoters derived from banana bunchy top virus DNA-1 to –5 direct vascular-
associated expression in transgenic banana (Musa spp.). Plant Cell Reports 19:
810-814.
Eagle, P. A. & Hanley-Bowdoin, L. (1997). Cis-elements that contribute to
geminivirus transcriptional regulation and efficient DNA replication. Journal of
Virology 71: 6947-6955.
Egelkrout, E., Robertson, D. & Hanley-Bowdoin, L. (2001). Proliferating cell
nuclear antigen transcription is repressed through an E2F consensus element
and activated by geminivirus infection in mature leaves. Plant Cell 13: 1437-
1452.
Finer, J. J., Vain, P., Jones, M. W. & McMullen, M. D. (1992). Development of a
particle inflow gun for DNA delivery into plant cells. Plant Cell Reports 11: 323-
328.
Fontes, E., Eagle, P., Sipe, P., Luckow, V. & Hanley-Bowdoin, L. (1994a).
Interaction between a geminivirus replication protein and origin DNA is essential
for viral replication. The Journal of Biological Chemistry 269: 8450-8465.
130
Fontes, E., Gladfelter, H., Schaffer, R., Petty, I. & Hanley-Bowdoin, L. (1994b).
Geminivirus replication origins have a modular organization. The Plant Cell 6:
405-416.
Fontes, E., Luckow, V. & Hanley-Bowdoin, L. (1992). A geminivirus replication
protein is a sequence-specific DNA binding protein. The Plant Cell 4: 597-608.
Frohman, M. A., Dush, M. K. & Martin, G. R. (1988). Rapid production of full-
length cDNAs from rare transcripts: amplification using a single gene-specific
oligonucleotide primer. Proceedings of the National Academy of Sciences, USA
85: 8998-9002.
Gladfelter, H. J., Eagle, P. A., Fontes, E. P. B., Batts, L. & Hanley-Bowdoin, L.
(1997). Two domains of the AL1 protein mediate geminivirus origin recognition.
Virology 239: 186-197.
Gorbalenya, A. E., Koonin, E. V. & Wolf, Y. I. (1990). A new superfamily of
putative NTP-binding domains encoded by genomes of small DNA and RNA
viruses. FEBS Letters 262: 145-148.
Gronenborn, B. (2000). US Patent Number 6,133,505.
131
Gutierrez, C. (2000). Geminiviruses and the plant cycle. Plant Molecular Biology
43: 763-772.
Gutierrez, C. (2002). Strategies for geminivirus DNA replication and cell cycle
interference. Physiological and Molecular Plant Pathology 60: 219-230.
Hafner, G., Harding, R. M. & Dale, J. L. (1995). Movement and transmission of
banana bunchy top virus DNA component one in bananas. Journal of General
Virology 76: 2279-2285.
Hafner, G., Harding, R. M. & Dale, J. L. (1997a). A DNA primer associated with
banana bunchy top virus. Journal of General Virology 78: 479-486.
Hafner, G., Stafford, M., Wolter, L., Harding, R. M. & Dale, J. L. (1997b). Nicking
and joining activity of banana bunchy top virus replication protein in vitro.
Journal of General Virology 78: 1795-1799.
Hanley-Bowdoin, L., Settlage, S., Orozco, B., Nagar, S. & Robertson, D. (1999).
Geminiviruses: models for plant DNA replication, transcription, and cell cycle
regulation. Critical Reviews in Plant Science 18: 71-106.
Hanley-Bowdoin, L., Settlage, S., Orozco, B., Nagar, S. & Robertson, D. (2000).
Geminiviruses: models for plant DNA replication, transcription, and cell cycle
regulation. Critical Reviews in Biochemistry and Molecular Biology 35: 105-140.
132
Hanley-Bowdoin, L., Settlage, S. & Robertson, D. (2004). Reprogramming plant
gene expression: a prerequisite to geminivirus DNA replication. Molecular Plant
Pathology 5: 149-156.
Harding, R. M., Burns, T. M. & Dale, J. L. (1991). Virus-like particles associated
with banana bunchy top disease contain small single-stranded DNA. Journal of
General Virology 72: 225-230.
Harding, R. M., Burns, T., Hafner, G., Dietzgen, R. & Dale, J. L. (1993).
Nucleotide sequence of one component of the banana bunchy top virus genome
contains a putative replicase gene. Journal of General Virology 74: 323-328.
Hong, Y., Saunders, K., Hartley, M. R. & Stanley, J. (1996). Resistance to
geminivirus infection by virus-induced expression of dianthin in transgenic
plants. Virology 220: 119-127.
Hong, Y., Saunders, K. and Stanley, J. (1997). Transactivation of dianthin
transgene expression by African cassava mosaic virus AC2. Virology 228: 383-
387.
133
Horser, C. L. (2000) Characterisation of the putative satellite DNAs associated
with banana bunchy top virus. PhD Thesis. Queensland University of
Technology, Brisbane, Australia. 168pp.
Horser, C. L., Harding, R. M. & Dale, J. L. (2001a). Banana bunchy top
nanovirus DNA-1 encodes the ‘master’ replication initiation protein. Journal of
General Virology 82: 459-464.
Horser, C. L., Karan, M., Harding, R. M. & Dale, J. L. (2001b). Additional Rep-
encoding DNAs associated with banana bunchy top virus. Archives of Virology
146: 71-86.
Hou, Y.M., Sanders, R., Ursin, V.M. & Gilbertson, R.L. (2000). Transgenic
plants expressing geminivirus movement proteins: abnormal phenotypes and
delayed infection by Tomato mottle virus in transgenic tomatoes expressing the
Bean dwarf mosaic virus BV1 or BC1 proteins. Molecular Plant Microbe
Interactions 13: 297-308.
Hu, J. S., Wang, M., Sether, D., Xie, W & Leonhardt, K. W. (1996). Use of
polymerase chain reaction (PCR) to study transmission of banana bunchy top
virus by the banana aphid (Pentalonia nigronervosa). Annals of Applied Biology
128: 55-64.
134
Hull, R. (2002). Matthews’ Plant Virology. 4th ed. Academic Press, San
Diego/London.
Idris, A., Briddon, R., Bull, S. & Brown, J. (2005). Cotton leaf curl Gezira virus-
satellite DNAs represent a divergent, geographically isolated Nile Basin lineage:
predictive identification of a satDNA REP-binding motif. Virus Research 109: 19-
32.
Inoue, H., Nojima, H. & Okayama, H. (1990). High efficiency transformation of
Escherichia coli with plasmids. Gene 96: 23-28.
Jeske, H. M., Lütgemeier, M. & Preiss, W. (2001). Distinct DNA forms indicate
rolling circle and recombination-dependent replication of Abutilon mosaic
geminivirus. EMBO Journal 20: 6158-6167.
Jupin, I., Hericourt, F., Benz, B. & Gronenborn, B. (1995). DNA replication
specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino
acids of the Rep protein. FEBS Letters 362: 116-120.
Karan, M., Harding, R. M. & Dale, J. L. (1994). Evidence for two groups of
banana bunchy top virus isolates. Journal of General Virology 74: 3541-3546.
135
Katul, L., Maiss, E., & Vetten, H. (1995). Sequence analysis of a faba bean
necrotic yellows virus DNA component containing a putative replicase gene.
Journal of General Virology 76: 475-479.
Katul, L., Maiss, E., Morozov, S. & Vetten, H. (1997). Analysis of six
components of the faba bean necrotic yellows virus genome and their structural
affinity to related plant virus genomes. Virology 233: 247-259.
Katul, L., Timchenko, T., Gronenborn, B & Vetten, H. (1998). Ten distinct
circular ssDNA components, four of which encode putative replication-
associated proteins, are associated with the faba bean necrotic yellows virus
genome. Journal of General Virology 79: 3101-3109.
Lam, E.W-F. & La Thangue, N.B. (1994). DP and E2F proteins; coordinating
transcription with cell cycle progression. Current Opinion in Cell Biology 6: 859-
866.
Latham, J.R., Saunders, K., Pinner, M.S. & Stanley, J. (1997). Induction of plant
cell division by beet curly top virus gene C4. Plant Journal 11: 1273-1283.
Lazarowitz, S., Wu, L., Rogers, S. & Elmer, S. (1992). Sequence-specific
interaction with the viral AL1 protein identifies a geminivirus DNA replication
origin. The Plant Cell 4: 799-809.
136
Lin, B., Behjatnia, S. A. A., Dry, I. B., Randles, J. W. & Rezaian, M. A. (2003).
High-affinity Rep-binding is not required for the replication of a geminivirus DNA
and its satellite. Virology 305: 353-363.
Liu, L., Saunders, K., Thomas, C.L, Davies, J., & Stanley, J. (1999a). Bean
yellow dwarf virus RepA, but not Rep, binds to maize retinoblastoma protein,
and the virus tolerates mutations in the consensus binding motif. Virology 256:
270-279.
Liu, L., Pinner, M., Davies, J., & Stanley, J. (1999b). Adaptation of the
geminivirus bean yellow dwarf virus to dicotyledonous hosts involves both
virion-sense and complementary-sense genes. Journal of General Virology, 80:
501-506.
Mansoor, S., Khan, S., Bashir, A., Muhammed, S., Zafar, Y., Malik, K., Briddon,
R. W., Stanley, J. & Marham, P. (1999). Identification of a novel circular single-
stranded DNA associated with cotton leaf curl disease in Pakistan. Virology 259:
190-199.
Mansoor, S., Briddon, R. W., Zafar, Y. & Stanley, J. (2003). Geminivirus disease
complexes: an emerging threat. Trends in Plant Science 8: 128-134.
137
Maruyama, K. & Sugano, S. (1994). Oligo-capping: a simple method to replace
the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene138: 171-
174.
Menkens, A. E., Schindler, U. & Cashmore, A. R. (1995). The G-box: a
ubiquitous regulatory DNA element in plants bound by the GBF family of bZIP
proteins. Trends in Biochemical Sciences 20: 506-510.
Merits, A., Fedorkin, O. Guo, D., Kalinina, N. & Morozov, S. (2000). Activities
associated with the putative replication initiation protein of coconut foliar decay
virus, a tentative member of the genus Nanovirus. Journal of General Virology
81: 3099-3106.
Nagar, S., Hanley-Bowdoin.L. & Robertson, D. (2002). Host DNA replication is
induced by geminivirus replication of differentiated plant cells. Plant Cell 14:
2995-3007.
Nagar, S., Pedersen, T.J. Carrick, K., Hanley-Bowdoin.L. & Robertson, D.
(1995). A geminivirus induces expression of a host DNA synthesis protein in
terminally differentiated plant cells. Plant Cell 7: 705-719.
138
Noris, E., Accotto, G.P., Tavazza, R., Brunetti, A., Crespi, S., Tavazza, M.
(1996). Resistance to tomato yellow leaf curl geminivirus in Nicotiana
benthamiana plants transformed with a truncated viral C1 gene. Virology 224:
130-138.
Orozco, B., Gladfelter, H., Settlage, S., Eagle, P., Gentry, R. & Hanley-Bowdoin,
L. (1998). Multiple cis elements contribute to geminivirus origin function.
Virology 242: 346-356.
Padidam, M., Beachy, R.N. & Fauquet, C.M. (1999). A phage single-stranded
DNA (ssDNA) binding protein complements ssDNA accumulation of a
geminivirus and interferes with viral movement. Journal of Virology 73: 1609-
1616.
Polston, J., Heibert, E., Abouzid, A. & Hunter, W. (2000). WIPO Patent
Application Number W00043220A2.
Palmer, K. E. & Rybicki, E. P. (1998). The molecular biology of mastreviruses.
Advances in Virus Research 50: 183-234.
Powell, P.A., Nelson, R.S., De, B., Hoffmann, N., Rogers, S.G., Fraley, R.T. &
Beachy, R.N. (1986). Delay of disease development in transgenic plants that
express the tobacco mosaic virus coat protein gene. Science 232: 738-743.
139
Preiss, W. & Jeske, H. (2003). Multitasking in replication is common among
geminiviruses. Journal of Virology 77: 2972-2980.
Randles, J.W., Chu, P.W.G., Dale, J.L., Harding, R., Hu, J., Katul, L., Kojima,
M., Makkouk, K.M., Sano, Y., Thomas, J.E., and Vetten, H.J. (2000). Genus
Nanovirus. In “Virus Taxonomy, Seventh Report of the International Committee
on Taxonomy of Viruses” (M.H.V. Van Regenmortel, C.M. Fauquet, and D.H.L.
Bishop, Eds.), Academic Press, San Diego/London. pp.303-309.
Rohde, W., Randles, J., Langridge, P. & Hanold, D. (1990). Nucleotide
sequence of a circular single-stranded DNA associated with coconut foliar
decay virus. Virology 176: 648-651.
Sambrook, J., Fritsch, E. & Maniatis, T. (1989). Molecular cloning, a laboratory
manual. 2nd ed. Cold Spring Harbour Laboratory Press, U.S.A.
Sano, Y., Wada, M., Hashimoto, Y., Matsumoto, T. & Kojima, M. (1998).
Sequences of ten circular ssDNA components associated with the milk vetch
dwarf virus genome. Journal of General Virology 79: 3111-3118.
Saunders, K. & Stanley, J. (1999). A nanovirus-like DNA component associated
with yellow vein disease of Ageratum conyzoides: evidence for interfamilial
recombination between plant DNA viruses. Virology 264: 142-152.
140
Schaefer, B. C. (1995). Revolutions in rapid amplification of cDNA ends: new
strategies for polymerase chain reaction cloning of full-length cDNA ends.
Analytical Biochemistry 227: 255-273.
Schuler, M. A. & Zielinski, R. E. (1989). RNA isolation from light- and dark-
grown seedlings. In: Methods in plant molecular biology. Academic Press, Inc.
U.S.A. pp.89-96.
Seemanpillai, M., Dry, I., Randles, J. & Rezaian, A. (2003). Transcriptional
silencing of geminiviral promoter-driven transgenes following homologous virus
infection. Molecular Plant Microbe Interactions 16: 429-438.
Settlage, S., Miller, A., Gruissem, W. & Hanley-Bowdoin, L. (2001). Dual
interaction of a geminivirus replication accessory factor with a viral replication
protein and a plant cell cycle regulator. Virology 279: 570-576.
Smith, K. (1972). A textbook of Plant Virus Diseases. 3rd ed. Academic Press.
New York. pp 49-51.
Stenger, D. C., Revington, G. N., Stevenson, M. C. & Bisaro, D. M. (1991).
Replicational release of geminivirus genomes from tandemly repeated copies:
Evidence for rolling-circle replication of a plant viral DNA. Proceedings of the
National Academy of Sciences, USA 88: 8029-8033.
141
Stenger, D. C. (1998). Replication specificity elements of the Worland strain of
beet curly top virus are compatible with those of the CFH strain but not those of
the Cal/Logan strain. Phytopathology 88: 1174-1178.
Stewart, C. & Via, L. (1993). A rapid CTAB DNA isolation technique for RAPD
fingerprint and PCR application. Biotechniques 14: 748-750.
Stout, J., Luu, H., Hanson, S., Maxwell, D., Ahlquist, P., & Gilbertson, R. (2001).
US Patent Number 6,291,743.
Sunter G., Hartitz M.D. & Bisaro D.M. (1993). Tomato golden mosaic virus
leftward gene expression: autoregulation of geminivirus replication protein.
Virology 195: 275-280.
Sunter G. & Bisaro D.M. (1997). Regulation of geminivirus coat protein promoter
by AL2 protein (TrAP): evidence for activation and derepression mechanisms.
Virology 232: 269-80.
Thompson, J., Gibson, T., Plewniak, F., Jeanmougin, F. & Higgins, G. (1997).
The ClustalX windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Research 28: 4876-
4882.
142
Timchenko, T., De Kouchovsky, F., Katul, L., David, C., Vetten, H. &
Gronenborn, B. (1999). A single Rep protein initiates replication of multiple
genome components of Faba bean necrotic yellow virus, a single-stranded DNA
virus of plants. Journal of Virology 73: 10173-10182.
Timchenko, T., Katul, L., Sano, Y., De Kouchovsky, F., Vetten, H. &
Gronenborn, B. (2000). The master Rep concept in nanovirus replication:
identification of missing genome components and potential for natural genetic
reassortment. Virology 274: 189-195.
Vetten, H.J., Chu, P.W.G., Dale, J.L., Harding, R., Hu, J., Katul, L., Kojima, M.,
Randles, J.W., Sano, Y. and Thomas, J.E. (2004). Nanoviridae. In: Virus
Taxonomy, VIIIth Report of the ICTV (C.M. Fauquet, M.A. Mayo, J. Maniloff, U.
Desselberger, and L.A. Ball, eds.), 343-352. Elsevier/Academic Press, London
Volloch, V., Schweitzer, B. & Rits, S. (1994). Ligation-mediated amplification of
RNA from murine erythroid cells reveals a novel class of beta-globin mRNA with
an extended 5’-untranslated region. Nucleic Acids Research 22: 2507-2511.
Von Arnim, A. & Stanley, J. (1992). Inhibition of African cassava mosaic virus
systemic infection by a movement protein from the related geminivirus tomato
golden mosaic virus. Virology 187: 555-564.
143
Wanitchakorn, R., Harding, R. M. & Dale, J. L. (1997). Banana bunchy top virus
DNA-3 encodes the viral coat protein. Archives of Virology 142: 1673-1680.
Wanitchakorn, R., Hafner, G., Harding, R. M. & Dale, J. L. (2000a). Functional
analysis of proteins encoded by banana bunchy top virus DNA-4 to –6. Journal
of General Virology 81: 299-306.
Wanitchakorn, R., Harding, R. M. & Dale, J. L. (2000b). Sequence variability in
the coat protein gene of two groups of banana bunchy top isolates. Archives of
Virology 145: 593-602.
Wu, R., You, L. & Soong, T. (1994). Nucleotide sequences of two circular
single-stranded DNAs associated with banana bunchy top virus. Phytopathology
84: 952-958.
Yeh, H., Su, H. & Chao, Y. (1994). Genome characterization and identification
of viral-associated dsDNA component of banana bunchy top virus. Virology 198:
645-652.