Molecular Biology and Taxonomy - NTUAold-2017.metal.ntua.gr/uploads/4434/5_taxonomy.pdf · Molecular Biology and Taxonomy 1252 Likewise the location of these proteins with respect

CHAPTER 5

Molecular Biology and Taxonomy

15th International Biohydrometallurgy Symposium (IBS 2003) September 14-19, Athens, Hellas

"Biohydrometallurgy: a sustainable technology in evolution"

1249

A promiscuous, broad-host range, IncQ-like plasmid isolated from an industrial strain of Acidithiobacillus caldus, its

accessory DNA and potential to participate in the horizontal gene pool of biomining and other bacteria

Gunther K. Goldschmidt, Murray N. Gardner, Leonardo J. van Zyl, Shelly M. Deane and Douglas E. Rawlings

Department of Microbiology, University of Stellenbosch, Private Bag X1, Matieland 7602, South Africa

Abstract A consortium of bacteria consisting primarily of the iron-oxidizing, Leptospirillum

ferriphilum and the sulfur-oxidizing, Acidithiobacillus caldus were found to dominate the population of organisms in industrial continuous-flow tank reactors used to oxidize arsenopyrite concentrate. A 14.15 kb plasmid was isolated from At. caldus strain f which was present in the consortium of cells. The plasmid, pTC-F14, was found to belong to the IncQ-like group of highly promiscuous, mobilizable, broad host-range plasmids. Plasmid pTC-F14 has a replicon and mobilization region closely related to pTF-FC2, a 12.2 kb plasmid isolated from Acidithiobacillus ferrooxidans about 15 years previously. Surprisingly, the replication and mobilization proteins of another broad host-range IncQ-like plasmid, pRAS3.2 (isolated from the fish pathogen, Aeromonas salmonocida in Norway), are even more closely related to pTF-FC2 than plasmids pTC-F14 and pTF-FC2 are to each other. This suggests that these highly promiscuous IncQ-like plasmids are potential vehicles for the horizontal transfer of DNA between bacteria from very different environments.

The sequence of plasmid pTC-F14 has been completed and the region that contains the accessory genes has been analysed. Present within this region is an insertion sequence ISAtc1, that is most closely related (92% nucleotide identity) to the mobile element, ISAfe1, previously identified in many isolates of At. ferrooxidans and At. thiooxidans. ISAtc1 is present in three At. caldus strains isolated from South Africa but not present in three At. caldus strains from Europe or Australia. The presence of insertion sequences on both a plasmid and the chromosome allows plasmids to integrate into the chromosome and provides an enhanced level of genome plasticity. Plasmids pTC-F14 and pTF-FC2 and the accessory genes that they contain are analysed and compared.

Keywords: Acidithiobacillus caldus, plasmids, accessory genes, horizontal gene pool


1250

1. INTRODUCTION Plasmids are pieces of extrachromosomal DNA that are replicated independently of

the host chromosome and may contain genes that, while not essential for host survival under some conditions, may enhance survival of a host cell under other circumstances (e.g. antibiotic or metal ion resistance genes). Some plasmids can be transferred between bacterial hosts by a mating process called conjugation [1]. Self-transmissible plasmids contain all of the genes required for conjugation, while mobilizable plasmids encode for a subset of genes required for DNA processing only and require the presence a self-transmissible plasmid for conjugation. Self-transmissible plasmids are generally larger in size (>30 kb) than mobilizable plasmids (typically 6 to 20 kb). Plasmids are widespread amongst bacteria and have been reported to contribute from 1 to >10% of the total genome of many bacterial species [2]. As conjugation is not restricted to members of the same species, but also takes place between species, self-transmissible and mobilizable plasmids play an important role in the horizontal gene pool that is shared between many organisms.

Although most plasmids are narrow host-range and can replicate only in closely related species, other plasmids are capable of replication in many types of bacteria. IncQ or IncQ-like plasmids are relatively small in size (5 to 15 kb) and capable of replication in wide variety of Gram-negative and Gram-positive bacteria [3]. Furthermore, these plasmids are mobilized by a family of broad host-range plasmids known as IncP plasmids (as well as the Ti-plasmids of Agrobacteria). As a result, IncQ and IncQ-like plasmids are highly promiscuous.

We investigated plasmids from biomining bacteria to discover what types of genes are present within the mobile gene pool of bacteria growing in low pH inorganic mineral environments and whether the replication and mobilization genes of plasmids from these bacteria are related to those of other bacteria. This research should help address the question of whether plasmids from acidiphilic, chemolithotrophic bacteria are part of an isolated gene pool or whether they are active participants in the horizontal gene pool shared by other bacteria. We report on the analysis of an IncQ-like plasmid from a strain of the sulfur-oxidizing, moderately thermophilic bacterium (optimum 45-50°C), Acidithiobacillus caldus [4].

2. MATERIALS AND METHODS Media and growth. At. caldus strains were grown at 37°C (rather than the 45-50°C

optimum as aeration facilities were better) in tetrathionate medium (3 mM), sterilised and adjusted to pH 2.5 as reported previously [5]. At. caldus cultures were purified using solid FeSo overlay medium that incorporates the acidophilic heterotroph Acidiphilium SJH into the lower layer [6]. Bacteria and plasmids are shown in Table 1.

Southern hybridization. Labelling of probes, hybridization and detection was performed by using a digoxigenin-dUTP non-radioactive DNA labelling and detection kit (Roche). Hybridization was at 40°C in Easy Hyb (Roche) followed by two non-stringent washes at 25°C (in 2 X SSC, 0.1% SDS) and two stringent washes at 65°C (0.1 X SSC, 0.1% SDS).

DNA sequencing and bioinformatics. The isolation and cloning of plasmid pTC-F14 was described previously [7]. DNA sequencing was by the dideoxy chain termination method, using an ABI PRISMTM 377 automated DNA sequencer and the sequence was analysed using a variety of software programmes but mainly the PC based DNAMAN (version 4.1) package from Lynnon BioSoft. Comparison searches were performed using


1251

the gapped-BLAST program at the National Center for Biotechnology Information. The phylogenetic trees were constructed using the ClustalW-based multiple sequence alignment tool in DNAMAN.

Table 1. Details of bacterial strains and plasmids used in this study

Bacterial strain Geographical origin Source or reference At. caldus "f" Nickel pilot plant, Billiton, Randburg, South Africa Own laboratory #6 Fairview mine, Barberton, South Africa Own laboratory MNG Arsenopyrite pilot plant, UCT Murray Gardner C-SH12 Continuous bioreactor, Brisbane, Australia Kevin Hallberg BC13 Birch Coppice, Warwickshire, UK [4] KU DSM8584 Kingsbury coal spoil, UK [4] Plasmids pTF-FC2 From At. ferrooxidans from a mixed culture used to

biooxidize an arsenopyrite concentrate from the Fairview mine, Barberton, South Africa

[8]

pTC-F14 From At. caldus strain ‘f’ above [7]

3. RESULTS

3.1 Comparison of plasmid ‘backbone’ genes At. caldus strain f, contains at least two plasmids, one of approximately 45 kb, which

has not yet been cloned and a smaller plasmid called pTC-F14 [7], the DNA sequence of which has recently been determined (14,149 bp, unpublished). Plasmid pTC-F14 is closely related to pTC-FC2 (Figure 1, Table 2) previously isolated from At. ferrooxidans [8]. Both belong to the family of IncQ-like plasmids, and are therefore broad host-range, mobilizable, highly promiscuous plasmids. The plasmid ‘backbone’ consists of those genes and sites associated with aspects of plasmid biology and includes functions such as replication, conjugation (mobilization) and stability [3].

Figure 1. Comparison of genes, open reading frames and sites of plasmids pTF-FC2 and pTC-F14

A comparison of the proteins of pTF-FC2 and pTC-F14 involved in plasmid replication, mobilization and the toxin-antitoxin stability systems is shown in Table 2. All three replication proteins (RepA, RepB and RepC), two of the plasmid addiction system proteins (PasA and PasB), as well as two of the five mobilization proteins (MobA and MobB) are highly conserved with amino acid sequence identities of between 72 and 81%.

pTF-FC2 0 12180 orf18.9 mobD oriT mobA/repB repA oriV 38bp grx orf43.4 res 38bp mobE mobC mobB mobA repB pasABC repC merR-like tnpR/tnpA* Tn5467 pTC-F14 0 14149 mobD oriT mobA/repB repA oriV orf13 26bp tnp 26bp mobE mobC mobB mobA repB pasAB repC orf20.8 orf17.4 orf33.2 ISAtc1 orf9.5


1252

Likewise the location of these proteins with respect to each other on the two plasmids is highly similar (Figure 1). This suggests that the two plasmids had a common plasmid ancestor.

Table 2. Comparison of the replication, addiction and mobilization proteins of plasmids pTCF14 and pTF-FC2

Recently, another IncQ-like plasmid has been isolated from the fish pathogen, Aeromonas salmonicida in Norway (L'Abée-Lund, NCBI accession number, AY043298). This plasmid, called pRAS3, carries a tetracycline resistance gene and regulator. Surprisingly, two of the three replication proteins and all five of the mobilization proteins are substantially more closely related to pTF-FC2, than pTF-FC2 is to pTC-F14 (Figure 2A and B). The most likely interpretation of this observation is that pRAS3 and pTF-FC2 diverged from a common ancestor more recently than pTF-FC2 and pTC-F14, even though the latter two plasmids were isolated from At. ferrooxidans and At. caldus, bacteria that share the same ecological niche. The observation that pTF-FC2 and pRAS3 are closer relatives than pTF-FC2 and pTF-F14 is supporting evidence of how promiscuous the IncQ-like plasmids may be. These IncQ-like plasmids are therefore potentially important vehicles in the horizontal distribution of the genes they carry between amongst a broad bacterial community.

3.2 Accessory genes Accessory DNA contains ‘passenger’ genes and functions that are not directly

involved with plasmid biology but which may be either parasitic or increase the fitness of the host in which the plasmid resides. Those accessory genes that improve host fitness are expected to be preferentially selected, as these should help to counter the additional metabolic burden that replication and maintenance of the plasmid places on the host. It is therefore of great interest to examine the accessory DNA in the hope of identifying what types of genes the plasmid has acquired. A list of the accessory genes found on plasmids pTF-FC2 and pTC-F14 is shown in Table 3.

pTC-F14 pTF-FC2 Protein

Function Amino

acids Mol mass

(Da) pI Amino

acids Mol mass

(Da) pI

% amino acid

identity RepA replication specific helicase 291 31289 5.92 290 31227 6.21 81.0 RepB plasmid specific DNA primase 352 40623 9.73 352 40111 9.77 78.4 RepC iteron-specific binding protein 303 33712 9.28 299 33740 8.99 74.2 PasA antitoxin of plasmid addiction system 74 8523 4.46 74 8453 4.71 81.1 PasB toxin of plasmid addiction system 90 10483 10.36 90 10307 10.4 72.2 PasC toxin-antitoxin accessory protein - - - 71 7676 3.76 - MobA-RepB oriT-specific relaxase 833 95792 9.50 831 94854 9.59 75.0 MobB oriT-processing accessory protein 103 11198 9.72 106 11605 9.79 77.4 MobC DNA-binding accessory protein 131 13969 10.03 118 12941 10.01 22.7 MobD mobilization protein of unknown function 226 24698 6.60 227 25274 5.25 39.4 MobE mobilization protein of unknown function 220 23811 5.53 213 23093 8.19 19.8


1253

RepA

pTC-F14

pTF-FC2

pIE1107/pDN1/pIE1115pIE1130

RSF1010

93%

90%

74%

62%

RepC

pTC-F14

pTF-FC2

RSF1010

pIE1130

pIE1107

pDN1

pIE1115

99%

99%

94%

92%

81%

44%

RepB

pTC-F14

pTF-FC2

pIE1107/ pDN1

pIE1115

pIE1130

RF1010

98%

91%

78%

74%

15%

pRAS3 94% pRAS3 97%

pRAS3

35%

MobB/TraJ

58%

77%

37%

27%

67%

22%

25%

72%

MobA/TraI 400 aa

MobC/TraK

MobE/TraM

53%

32%

23%

23%

MobD/TraL

85% 17%

10%39%

10%

18%69%

91%92%

96%

98%

92%

24%

RP4

R751

pTC-F14

pTF-FC2

pRAS3

pRA2

RP4

R751

pTC-F14

pTF-FC2

pRAS3

pRA2

RP4

R751

pTF-FC2

pRAS3

pTC-F14

pRA2

RP4

R751

pTC-F14

pTF-FC2

pRAS3

pRA2

RP4

R751

pRAS3

pTF-FC2

pTC-F14

pRA2

Figure 2, A and B. Phylogenetic relationships between the replication (A) and mobilization proteins (B) of the IncQ plasmid family. Percentages are amino acid sequence identities

A

B


1254

3.2.1 Accessory DNA from pTF-FC2 isolated from At. ferrooxidans Most of the accessory DNA of plasmid pTF-FC2 consists of a defective Tn21-like

transposon, Tn5467, which has been reported previously [9]. Although Tn5467 was not able to transpose or resolve on its own, its 38 bp terminal repeats and res sites were functional, as Tn5467 was able to transpose and resolve if the genes for Tn21 transposase and resolvase were provided in trans. Tn5467 contains three open reading frames (ORFs) which are potentially functional. One of these, encoded by a gene now called grx, encodes a glutaredoxin-like protein that was shown to functionally complement thioredoxin deficient mutants of the bacterium, Escherichia coli for the ability to grow on minimal medium lacking glutathione. Thioredoxin is also essential for the arsenate resistance activity of a family of arsenate reductases (product of arsC gene) [10]. These enzymes use thioredoxin to reduce arsenate to arsenite prior to its removal from a cell by an arsenite efflux pump (product of arsB gene). We have recently shown (B. Butcher, unpublished), that product of the glx gene present on Tn5467 is able to substitute for thioredoxin and allows the cloned At. ferrooxidans arsC gene product to reduce arsenate to arsenite, thereby conferring additional arsenate resistance to an E. coli thioredoxin (trxA) mutant.

Table 3. Accessory proteins of plasmids pTF-FC2 and pTC-F14

aPart of protein, is the number of amino acids over which the similarity/identity to the highest match in the NCBI data base was determined. NA, not applicable

New closest matches to proteins in the database have been obtained using the BLAST program. Interestingly, the closest match to what was previously called the MerR-like family regulator is to a transcriptional regulator of a copper efflux mechanism that reduces the toxicity of copper at low pH in Sinorhizobium meliloti [11]. While the closest match to Tn5467 ORF43 is to a twelve, transmembrane-spanning protein that is related to the family of multidrug exporters. It is likely that the MerR-like family transcriptional regulator regulates expression of ORF43, however, attempts to detect increased resistance

Putative protein or

ORF

Size amino acids and

(Da)

Putatative RBS

Most related protein and proposed function and predicted size

% identity/ similarity -

(part of protein)a

BLAST E value

Reference NCBI

accession no. Plasmid pTF-FC2

ORF18.9 170 (18925)

GAGGG No meaningful BLAST hits NA NA NA

ORF8 grx

85 (9042)

GGAGAA thioredoxin from 186 kB plasmid, named beta and present in Nostoc sp. PCC7120, 83 aa

42/67 (63) 3 e -9 AP003602

MerR-like regulator

137 (15097)

GGAGGA copper efflux transcriptional regulator, hmrR, preventing low pH copper toxicity in

Sinorhizobium meliloti, 147 aa

41/57 (128) 4 e -19 Q9X5X4

ORF43 406 (43416)

GGAGAA 12 transmembrane segment, multidrug resistance-like protein in genome of Synechocystis sp. PCC 6803, 418 aa

36/48 (323) 2 e -54 NP_442543

Plasmid pTC-F14 ORF13 124

(13008) AGGAGA no meaningful BLAST hits NA NA NA

ORF20.8 189 (20795)

AGGCGA invertase/recombinase protein, Xanthomonas axonopodis pv. citri str. 306, 209 aa

61/71 (186)

5e-54 NP_644692

ORF17.4 153 (17405)

AGGAG conserved hypothetical protein, Geobacter metallireducens, 110 aa Pseudomonas fluorescens, 146 aa Ralstonia metallidurans, 145 aa

65/88 (110) 53/70 (141) 51/74 (145)

1e-35

2e-35

3e-35

ZP_00080185 ZP_00082921 ZP_00025386

ORF33 286 (33169)

AGGAG aminotransferase, Bacillus halodurans, 397 aa 27/48 (133)

6.8e-2 NP_244179

transposase 404 (46188)

AGGAG transposase from ISAfe1, Acidithiobacillus ferrooxidans, 404 aa

92/95 (404) 0.0 AAB07489

ORF9.5 86 (9485)

AGGAG no meaningful BLAST hits NA NA NA


1255

to metal ions or antibiotics in E. coli due to the presence of these two ORFs have so far been unsuccessful (unpublished).

The amino acid sequence of ORF18.9, which falls outside of the Tn5467 inverted repeat sequences did not give any meaningful similarity hits using the BLAST program.

3.2.2 Accessory DNA of pTC-F14 isolated from At. caldus Six open reading frames that gave putative translation products of 9 kDa or larger and

that were preceded by putative ribosome binding sites were detected in the accessory DNA of pTC-F14 (Table 3). Two of these, ORFs 13 and 9.5 gave no meaningful similarity hits using the BLAST program. ORF33, gave relatively weak similarity and identity to approximately one third of the amino acid sequence of an aminotransferase. However, this level of similarity was considered to be insufficient to assign this as a likely function of the putative protein.

The remaining three ORFs had strong amino acid sequence relationships to ORFs already present in the NCBI database. ORF20.8 had the highest sequence match to an invertase or recombinase, previously found in Xanthomonas axonopodis pv citri. The function of these enzymes is the rearrangement of DNA within a sequence or the exchange of DNA between sequences, but this property is not specifically associated with the environment of At caldus. Similarly, ORF17.4 is related to a hypothetical protein that is highly conserved in a wide variety of bacteria of which only the three highest matches are shown in Table 3. In spite of its wide distribution, the function of this hypothetical protein is unknown. The remaining ORF of 404 amino acids had very high sequence identity to the transposase of an insertion sequence, ISAfe1 [12], previously identified in At. ferrooxidans a relative of At. caldus.

3.3 ISAtc1 and its comparison with ISAfe1 ISAfe1 (previously called IST1), is one of two types of insertion sequences found in

the genome of a several, but not all, strains of At. ferrooxidans and At. thiooxidans [12, 13]. The putative transposase found on At. caldus plasmid pTC-F14, is clearly a close relative of ISAfe1 and we have named it ISAtc1. The two transposases are both 404 amino acids in length and sequence alignment indicated that the proteins are 92% identical. Both IS elements are 1303 bp in size. Like ISAfe1, ISAtc1 is flanked by two sets of imperfectly conserved 26 bp inverted repeat sequences which are strongly conserved, with the two left and two right termini having 1 and 3 bp sequence variations between the two IS elements respectively (underlined Table 4).

Table 4. Alignment of the 5` and the 3` terminal inverted repeats of ISAfe1 with ISAtc1 Insertion sequence Left and right terminal IR sequences

ISAfe1 5`-GGCTCTTCGTCGGATTGAGTGGGTAG 3`-GGCTCTTCGTCATTTCAAGTGGGTAG

ISAtc1 5`-GGCTCTTCGTCAGATTGAGTGGGTAG 3`-GGCTCTTCGACGTTTCATGTGGGTAG

The complementary strand of the right hand IR is shown to facilitate comparison. We wished to determine whether ISAtc1 elements are as widespread amongst At.

caldus strains as ISAfe1 is amongst At. ferrooxidans strains [12, 13]. Genomic DNA was prepared from six At. caldus strains, two of which originated from Europe, one from Australia and three from South Africa. A Southern hybridization experiment was carried


1256

out in which the genomic DNA was hybridised to a labelled probe prepared from ISAtc1 and the result is shown in Figure 3. Positive hybridization signals were obtained for all three of the At. caldus isolates from South Africa but not from any of the others. Approximately 11-14 bands were obtained for each of the South African isolates, which indicated that multiple copies of ISAtc1 were present. Some of the bands appeared to be of a similar in size, but there were also clear differences in banding pattern between isolates.

Figure 3. DNA hybridization experiment showing that three strains have this insertion sequence on their chromosomal DNA. Lane 1, MNG; lane 2, “f”; lane 3, #6; lane 4, CSH12; lane5, BC13; lane 6, KU and lane 7, a subclone of pTC-F14 containing only accessory DNA and used as positive control. The probe was made using an internal fragment of the tnp gene of ISAtc1

4. DISCUSSION Free-living bacteria typically have in excess of one thousand genes, the majority of

which encode for essential cell functions that are required for cell viability. These are the so-called, ‘house-keeping genes’. Bacteria also have access to a pool of genes that can be acquired from other bacteria or even non-bacteria, known as the "horizontal" gene pool [2]. Although some house-keeping genes may become caught up in this horizontal gene pool, the horizontal gene pool is thought to consist mostly of genes that are not essential to host survival under some circumstances. However, genes that may increase host cell fitness under certain circumstances can be recruited from the horizontal gene pool and then lost again when no longer advantageous [14]. Several types of genetic elements can play a role in moving DNA between bacteria, and sometimes integrating them into the chromosome, including plasmids, bacterial phages, transposons and insertion sequences.

From this and previous studies, the environmental niche in which the IncQ-like plasmids are found clearly includes the highly acidic, mineral rich, inorganic environments in which the acidithiobacilli grow. These plasmids can therefore presumably move between bacteria that grow within this ecological niche. Although pTF-FC2 and


1257

pTC-F14 are closely related, they have relicons that are compatible with each other and can be coresident in the same cell for extended periods in the absence of external selection [7]. They therefore appear to have adapted to living in the same environment as each other. The discovery of a close relative of pTF-FC2 in a Norwegian salmon pathogen further supports the view that these plasmids are capable of moving between bacteria from very different ecological niches. IncQ-like plasmids are therefore potential role players in the movement of genes between many different types of bacteria. Most of the IncQ-like plasmids already discovered carry genes for antibiotic resistance [3]. This is not unexpected as antibiotic resistance is a particularly easy property to screen for. Only one IncQ-like plasmid discovered to date, carries no recognizable accessory DNA (plasmid pDN1, isolated from an Australian strain of the sheep foot-rot causing bacterium, Dichelobacter nodosus [15]).

Analysis of the accessory DNA present on pTC-F14 was disappointing as no genes that confer a property that is known to provide a selective advantage to the host were detected. The products of open reading frames, ORF13, ORF33.2 and ORF17.4 may be advantageous to a host cell, but the functions of these putative proteins are unknown. Of these three ORFs, ORF17.4 is particularly interesting as highly related ORFs are present among a wide range of bacteria, which improves the likelihood that its function will be discovered. The insertion sequence ISAtc1 is clearly closely related, though not identical to ISAfe1 of At. ferrooxidans ATCC19859 and related bacteria. It has been proposed that movement of ISAfe1 is responsible for the phenomenon of phenotypic switching in At. ferrooxidans between a wild-type state in which both ferrous iron and reduced sulfur compounds can be oxidized and a mutant state during which the ability to oxidize ferrous iron is lost but the ability to oxidize reduced sulfur is retained [16]. ISAfe1 has been shown to insert within the resB gene which encodes for a putative cytochrome c-type biogenesis protein. It is proposed that this insertion results in loss of activity of this c-type cytochrome which is thought to be required for ferrous iron but not sulfur oxidation. Here we have shown that a copy of ISAtc1 exists on a plasmid as well as several copies in the chromosome of At. caldus. The presence of IS elements on both plasmid and chromosome provides several potential sites for the plasmid to integrate into the chromosome [17, 18 and references therein]. A small number of integrated plasmids may excise from the chromosome carrying pieces of chromosomal DNA (prime plasmid formation), which then may be transferred to new cells by conjugation. This is a mechanism by which chromosomal genes can enter the horizontal gene pool and IS elements have been associated with the assembly of sets of accessory genes [18]. IS elements can also confer an increased level of plasticity to a chromosome, serving as sites of chromosome rearrangments such as DNA recombination, inversion, integration and deletion.

Although an analysis of the accessory DNA from pTF-FC2 has been reported in 1995, we have reanalysed this DNA in the light of the greatly expanded database now available. The highest BLAST hits to the MerR-like regulator and ORF43.4 are particularly interesting. The MerR-like regulator has the closest match to the heavy metal response regulator (HmrR) from S. melitoli and that has been shown to regulate the protein AtcP a copper transporting ATPase [11]. Next highest matches are to MerR-family regulators, mostly of unknown function, but including a zinc-responsive transcriptional regulator (ZntR) of 141 amino acids in length from Salmonella typhimurium (NCBI accession number NP_462316, similarity 62%, identity 35% over 129 amino acids, e-16). ORF43.4 is clearly related to a large family of membrane located multidrug efflux proteins, and some of the multidrug efflux family of proteins are capable of conferring resistance to metal ions such as cobalt, nickel, cadmium or zinc [19]. Furthermore, many of the multidrug-like transporters are members of the MerR-like family of regulators [20]. There is


1258

therefore a possibility that the MerR-like regulator and associated 12 TMS multidrug resistance family-like ORF represent a metal ion transport mechanism. The reason for association of the functional glutaredoxin-like encoding gene (grx) with these two putative genes is uncertain, but its ability to substitute for thioredoxin as an electron donor in the reduction of arsenate, suggests that it could also be used as an electron donor for the reduction of other metals. ORF43.4 may not be functional in E. coli since it is a membrane protein and the pH gradient across the membrane is very different in E. coli compared with At. ferrooxidans. However, we intend to renew efforts to determine whether ORF43.4 and the MerR-like regulator are functional and to identify their target (s).

ACKNOWLEDGEMENTS This work was supported by grants from the National Research Foundation, The

Human Resource for Industry Programme (Pretoria, South Africa), BHP-Billiton as well as the University of Stellenbosch.

REFERENCES 1. Clewell, D.B. (ed) Bacterial conjugation. Plenum Press, New York and London.

(1993). 2. Thomas, C.M. (ed) The Horizontal Gene Pool. Harwood Academic Publishers,

Amsterdam. (2000). 3. Rawlings D.E. and E. Tietze. Microbiol. Mol. Biol. Rev. 65 (2001) 481-496. 4. Hallberg, K.B., and E.B. Lindström. Microbiol. 140, (1994) 3451-3456. 5. Butcher, B.G., S.M. Deane and D.E. Rawlings. Appl. Environ. Microbiol. 66 (2000)

1826-1833. 6. Johnson, D.B. Microbiol. Methods 23 (1995) 205-218. 7. Gardner, M.N., S.M. Deane and D.E. Rawlings. 2001. J. Bacteriol. 183 (2001) 3303-

3309. 8. Rawlings, D.E., I-M. Pretorius and D.R. Woods. J. Bacteriol. 159 (1984) 737-738. 9. Clennel, A-M., B. Johnston and D.E. Rawlings. Appl. Environ. Microbiol. 61 (1995)

4223-4229. 10. Mukhopadhyay, R., B.P. Rosen, L.T. Phung and S. Silver. FEMS Microbiology

Reviews 26 (2002) 311-325. 11. Reeve, W.G., R.P. Tiwari, N.B. Kale, M.J. Dilworth and A.R. Glenn. Mol. Microbiol.

43 (2002) 981-991’ 12. Holmes D.S., H-L. Zhao, G. Levican, J. Ratouchniak, V. Bonnefoy, P. Varela and E.

Jedlicki. J. Bacteriol. 183 (2001) 4323-4329. 13. Holmes, D.S. and R. Ul Haq. Biohydrometallurgy 1989. Salley, J., McCready, R.G.L.

Wichlacz, P.L. (eds) Canmet, Ottawa, Canada. (1989) pp 115-127. 14. Ochman, H., J.G. Lawrence and E.A. Groisman. Nature 405 (2000) 299-304. 15. Whittle, G., M.E. Katz, E.H. Clayton and B.F. Cheetham. Plasmid 43 (2000) 230-234. 16. Cabrejos, M-E., Zhao, M. Guacucano, S. Bueno, G. Levican, E. Garcia, E. Jedlicki

and D.S. Holmes. FEMS Microbiol. Lett 175 (1999) 223-229. 17. Neidhardt, F.C., R. Curtiss III, J.L. Ingraham, E.C.C. Lin, K.B. Low, B. Magasanik,

W.S. Reznikoff, M. Riley, M. Schaecter, H.E. Umbarger (eds) Escherichia coli and


1259

Salmonella: cellular and molecular biology. 2nd ed. ASM Press, Washington, D.C. (1996)

18. Mahillon, J. and M. Chandler. Microbiol. Mol. Biol. Rev. 62, (1998) 725-774 19. Paulsen, I.T., M.H. Brown and R.A. Skurray. Microbiol. Mol. Biol. Rev. 60, (1996)

481-496. 20. Putman, M., H. W. van Veen and W.N. Konings. Microbiol. Mol. Biol. Rev., 64

(2000) 672-693.



1261

Analysis of salt-induced outer membrane proteins in Acidithiobacillus ferrooxidans NASF-1

K. Kamimura, M. Yamakado, T. Shishikado and T. Sugio

Division of Science and Technology for Energy Conversion, Graduate School of Natural Science and Technology, Okayama University,

3-1-1 Tsushima-Naka 700-8530, Japan

Abstract Acidithiobacillus ferrooxidans is an acidophilic chemolithotrophic bacterium capable

of oxidizing ferrous ion or reduced inorganic sulfur compounds. Outer membrane proteins of this bacterium are probably involved in response to environmental changes. The clarification of molecular mechanisms involved in environmental adaptation is very important to understand the physiology of this acidophilic bacterium. Effects of salt on the composition of outer membrane proteins in At. ferrooxidans strain NASF-1 were examined by polyacrylamide gel electrophoresis. The amount of two proteins with apparent molecular masses of 30 kDa and 40 kDa increased in the outer membrane prepared from cells grown in Fe2+-medium supplemented with NaCl. The N-terminal amino acid sequence of 40 kDa protein had almost same sequence as that of Omp40 previously detected in phosphate-starved At. ferrooxidans strain ATCC 18959. Northern blot hybridization analyses revealed that the expression of omp40 gene was stimulated in cells incubated in Fe2+-medium supplemented with NaCl, but not in cells incubated in Fe2+-medium with KCl or Na2SO4. A search using the N-terminal sequence of the 30 kDa protein in the TIGR pre-released genomic data of At. ferrooxidans ATCC 23270 using the Blast algorithm revealed the presence of one open reading frame having the same N-terminal amino acid sequence as that of 30 kDa protein. The gene encodes a protein of 217 amino acids with a predicted molecular mass of about 20 kDa. The first 27 amino acids were not present in the mature protein and probably represent a signal peptide. Homology search in databases using the Blast algorithm revealed no protein with sequence similarity to the N-terminal part of the protein. The C-terminal part of the protein had strong sequence similarity with proteins of the OmpA family.

1. INTRODUCTION An outer membrane of Gram-negative bacterium is a structure exposed directly to

environmental changes by external stimuli. The outer membrane acts as a molecular sieve that allows the passage of ions and small hydrophilic organic molecules. This property is due to the presence of a major group of proteins, porins, that form diffusion pore [1-5]. Porins have been well characterized in Escherichia coli. Their primary and secondary structures are known especially for general diffusion porins, OmpC and OmpF, which had been well studied in response to osmotic pressure. OmpC and OmpF are similar in amino


1262

acid sequence [6], immunological reactivity [7] and ion selectivity [8], yet different in pore size [9], phage selectivity [10] and regulation [11]. The mechanism for response to osmotic pressure in E. coli involves two-component system, resulting in the qualitative and quantitative changes of outer membrane proteins. Cells in high-osmolarity medium have high levels of OmpC and low levels of OmpF, while the opposite is true in low-osmolarity medium. Two components, EnvZ and OmpR, are involved in the regulatory system for the expression of OmpC and OmpF proteins in E. coli. EnvZ is an inner-membrane protein responsible for sensing the external osmolarity and OmpR acts as a transcriptional regulator. As EnvZ senses high levels of osmolarity, it phosphorylates OmpR [12, 13]. The phosphorylated form of OmpR binds the ompF and ompC regulatory regions and regulates transcription [14].

Acidithiobacillus ferrooxidans is a Gram-negative, acidophilic chemolithotrophic bacterium capable of oxidizing ferrous ion or reduced inorganic sulfur compounds, and is involved in bacterial leaching of metals from sulfide ores [15-19]. It has been reported that the relative synthesis of proteins of At. ferrooxidans were influenced by environmental factors, such as pH [20], substrate [21-23] and phosphate source [24,25]. In At. ferrooxidans ATCC 18959, a major outer membrane protein having an apparent molecular mass of 40 kDa (Omp40) has been studied [24,26], and a possible role for the protein in forming small pores has been reported [27]. The studies on Omp40 protein from At. ferrooxidans ATCC 18959 have indicated that the protein was organized in a trimeric structure and formed a small ionic channel [27,28]. The degree of identity of amino acid sequence of Omp40 protein to porins from enterobacteria was only 22%. Nevertheless, multiple alignments of this sequence with OmpC porin from E. coli has shown several important features conserved in the At. ferrooxidans surface protein [28]. These results have strongly supported its role as a porin in the chemolithotrophic acidophilic bacterium [28]. However, little detailed information is available about the molecular mechanism by which At. ferrooxidans responds and adapts to external environmental changes. In this report, we examined effects of NaCl concentrations on the composition of outer membrane proteins, and found that the amount of two proteins increased in response to increasing concentration of NaCl. The expression of one of the proteins was examined by Northern blot hybridization analysis.

2. MATERIALS AND METHODS

2.1 Bacterial strain and growth conditions The iron-oxidizing bacterium used in this study was At. ferrooxidans strain NASF-1.

Cells were grown at 30°C under aerobic condition in Fe2+-medium as described previously [29].

2.2 Preparation of outer membrane proteins Outer membrane proteins from NASF-1 cells were prepared according to the method

of Silva et al. [27], although a slight modification was done. The cells were harvested in the mid- to late-exponential phase by centrifugation (15,000×g for 15 min at 4°C). The cell pellet was washed three times with 0.1M β-alanine-SO4

2- buffer (pH 3.0), two times with 20 mM 2-[4-(2-Hydroxyethyl)-1-piperazinyl] ethanesulfonic acid (HEPES) buffer (pH 8.0), and suspended in 20 mM HEPES buffer (pH 8.0). The cell suspension was sonicated (three times for 1 min). The lysate was centrifuged at 15,000×g for 10 min to remove cellular debris. The supernatant was centrifuged at 105,000×g for 1 h at 4°C. The precipitate was washed with 20 mM HEPES buffer (pH 8.0), resuspended in 20 mM


1263

HEPES buffer containing 1% (w/v) sodium N-laurylsarcosine (Sarkosyl), and incubated for 1 h at 30°C. The suspension was centrifuged at 105,000×g for 1 h at 4°C to pellet the detergent-insoluble outer membrane fraction. The precipitate was washed with 20 mM HEPES buffer (pH 8.0) and used as an outer membrane fraction.

2.3 Protein analysis and N-terminal amino acid sequencing Protein concentrations were determined by Lowry method with crystalline bovine

serum albumin as a reference protein [30]. Polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulphate (SDS-PAGE) was performed in 12.5% (v/v) polyacrylamide slab gel with the Tris-glysine buffer. Outer membrane proteins separated by SDS-PAGE were electroblotted to a PVDF membrane (Hybond-P, Amersham Biosciences) using a blotting apparatus (Trans-Blot Cell system, Bio-Rad, U.S.A) according to the manufacture’s recommendations. N-terminal amino acid sequences of outer membrane proteins were determined by Edman analysis using an automatic protein sequencer (Model 610A NH2-terminal sequencer, Perkin-Elmer Corporation, U.S.A).

2.4 DNA manipulations The genomic DNA (gDNA) from NASF-1 cells was prepared by phenol/chloroform/

isoamylalcohol after lysis by a solution containing 20 mM Tris-HCl (pH 8.0), 20 mM EDTA and 0.4% sodium dodecyl sulfate. The DNA was used as a template for PCR reaction to amplify the Omp40 gene, that is an outer membrane protein previously detected in At. ferrooxidans [28]. Primers used for a PCR-amplification of Omp40 gene were constructed by using a sequence reported by Guiliani and Jerez [28]. Taq polymerase from Takara was used according to the manufacture’s recommendations. The PCR reaction was as follows: 3 min at 95°C, followed by 25 cycles at 95°C for 25s, 55°C for 30s, and 72°C for 45s, and then 3 min at 72°C. After the electrophoresis of PCR-amplified DNA fragments, the DNA was purified with Geneclean Kit (Q BIOgene) and directly sequenced with Thermo Sequenase Fluorescent Labelled Primer Cycle Sequencing Kit (Amersham Biosciences) and an automated sequence analyzer (Model DSQ-1000L; Shumadzu Co.). The PCR product purified from gel with Geneclean Kit was labeled with digoxigenin by using DNA Labeling and Detection Kit (Roche) according to the manufacture’s recommendations, and used as a probe in Southern and Northern blot hybridization experiments.

Restriction enzyme digestions were performed according to the manufacture’s recommendations. Southern blotting was performed with total DNA digested with different restriction enzymes. After an electrophoresis, the DNA was denatured and transferred to a positively charged nylon membrane (Zeta-Probe, Bio-Rad) using a Trans-Blot Cell system. Prehybridization and hybridization with a DIG-labeled prove were performed under stringent conditions according to the manufacture’s recommendations (Roche). DNA was detected with the colorimetric reactions by using DNA labeling and Detection Kit (Roche) according to the manufacture’s recommendations.

2.5 RNA manipulations Total RNA of strain NASF-1 cells was extracted by using RNeasy Mini Kit (Qiagen)

according to the manufacture’s recommendations. After the electrophoresis of RNA on formaldehyde agarose gel, RNA was transferred to a positively charged nylon membrane (Hybond-N+, Amersham Biosciences) using a Trans-Blot Cell system. The DIG-labeled probe described above was used for the detection of specific mRNA. Prehybridizition and hybridization with DIG-labeled probe were performed under stringent conditions


1264

according to the manufacture’s recommendations (Roche). RNA hybridized with the probe was detected as described above in Southern blot hybridization experiment.

2.6 Database analysis Preliminary sequence data for genes of 30kDa and 40kDa proteins detected in this

report was obtained from The Institute for Genomic Research website at http:// www.tigr.org.

3. RESULTS

3.1 Effect of salts on the composition of outer membrane protein Strain NASF-1 cells were grown in Fe2+-media supplemented with different

concentrations of NaCl or Na2SO4. The growth was observed in Fe2+-media supplemented with NaCl at concentrations up to 0.3 M. Strain NASF-1 cells could grow in Fe2+-media supplemented with Na2SO4 at concentrations up to 0.5 M. Outer membrane fractions were prepared from NASF-1 cells grown in Fe2+-media supplemented with NaCl or Na2SO4 at concentration up to 0.3 M and analyzed by SDS-PAGE. Outer membrane proteins with apparent molecular masses of 30 kDa and 40 kDa increased in cells grown in Fe2+-medium supplemented with NaCl (Fig. 1A). The increases were not observed in the outer membrane fraction prepared from cells grown in Fe2+-medium supplemented with Na2SO4 (Fig. 1B). Proteins with molecular mass of 30 kDa and 40 kDa were designated as FopA (Acidithiobacillus ferrooxidans outer membrane protein A) and Fop40, respectively, in this report.

The composition of outer membrane proteins may be influenced by growth phases. Therefore, outer membrane fractions prepared from cell grown in Fe2+-medium in different growth phases were analyzed by SDS-PAGE. The compositions of outer membrane proteins did not change in cells grown in log phase (4 days-culture), stationary phase (7 days-culture), and late stationary phase (14 days-culture) (data not shown). These results indicated that the increases of Fop40 and FopA proteins were due to response of cells to the increasing concentration of NaCl.

Figure 1. Composition of outer membrane proteins prepared from At. ferrooxidans NASF-1 cells grown in various concentration of salts. A; Outer membrane fractions were prepared from cells grown in Fe2+-medium supplemented with 0 M (lane 1), 0.1 M (lane 2), 0.2 M (lane 3) NaCl, and analyzed by SDS-PAGE. Lane M corresponds to MW marker proteins. Numbers to the left indicate molecular masses in kDa. The gel was stained with Coomassie blue. B; Outer membrane fractions were prepared from cells grown in Fe2+-medium supplemented with 0 M (lane1), 0.1 M (lane 2), 0.2 M (lane 3), 0.3M (lane 4) Na2SO4. The gel was stained with silver


1265

3.2 N-terminal amino acid sequences of FopA and Fop40 protein The N-terminal amino acid sequences of FopA and Fop40 proteins were determined

to be DGGYVGYAVNHGAKPVVTSR and ADTSNANTGPVVFGYAQI, respectively. Although the expressions of FopA and Fop40 proteins were stimulated in response to the increasing concentration of NaCl in medium, no homology was observed in the N-terminal amino acid sequences between FopA and Fop40. Computer searches of available databases revealed that N-terminal amino acid sequence of FopA protein had no significant homology with any other known prokaryotic protein. The N-terminal amino acid sequence of Fop40 protein was almost the same as the outer membrane protein (Omp40) reported previously as an outer membrane protein influenced in At. ferrooxidans ATCC 18959 under phosphate starvation [24], except in one amino acid. The nucleotide sequence had been already analyzed by Guiliani and Jerez [28]. The determination of whole genome sequence of At. ferrooxidans ATCC 23270 is in progress now, and the sequence data can be available (http://www.tigr.org). A search using the N-terminal amino acid sequence of the Fop40 protein in TIGR pre-released genomic data using the Blast algorithm revealed only one reading frame encoding Omp40 protein. Therefore Fop40 protein was the product of the gene encoded Omp40 protein. On the other hand, a homology search to the N-terminal amino acid sequence of the FopA protein in TIGR pre-released genomic data also revealed only one open reading frame (651 bp) encoding the same N-terminal amino acid sequence. As expected for an outer membrane protein, the gene contained a signal peptide sequence corresponding to 27 amino acids as shown in Fig. 2. The deduced mature protein had 190 amino acids and molecular mass of 20,210 Da. The molecular mass deduced from the gene was smaller than the apparent molecular mass of FopA protein determined by SDS-PAGE. Our BLASTP search of the SwissProt database at the National Cancer for Biotechnology Information Web site identified 30 proteins homologous to FopA protein with scores exceeding 70 and E value of < 2e-11. Members of the OmpA family belong to this cluster. A protein with the highest score was the outer membrane protein of Fusobacterium nucleatum [31]. However, the N-terminal region of the putative FopA gene product was shorter than that of typical proteins of the OmpA family, such as OmpA of E. coli, OprF of Pseudomonas spp., and MopB of Methylococcus [32]. Peptidoglican-associated lipoprotein (Pal) also showed a low homology to FopA protein.

3.3 Amplification of Fop40 gene by PCR The N-terminal amino acid sequence of Fop40 protein from NASF-1 cell had almost

the same sequence as the Omp40 protein previously reported in response to phosphate starvation in At. ferrooxidans ATCC 18959 [24]. As the gene encoding Omp40 protein has already been sequenced [28], primers were designed to amplify Fop40 gene. The PCR-amplified product had an expected length (447 bp) of Omp40 gene on agarose gel. Therefore, the PCR-amplified product was purified, labeled with DIG, and used as a probe for hybridization experiments.

3.4 Specificity of Fop40-probe by Southern hybridization analysis A southern hybridization analysis was carried out to examine the specificity of the

DIG-labeled probe. The hybridizations were carried out with the genomic DNA (gDNA) of strain NASF-1, the PCR product of Fop40 gene and the gDNA fragments digested with Sal I, Sac I, or Sma I. Only one hybridization signal was observed in each gDNA digested with the different endonuclease. These results indicated that only one Fop40 gene was present in the genome of NASF-1 cell.


1266

Figure 2. Nucleotide sequence and derived amino acid sequence of FopA gene detected in TIGR pre-released database of At. ferrooxidans ATCC 23270 genome. The possible –10 and –35 regions are underlined. The putative ribosome-binding site is indicated in boldface. The signal sequence is underlined in bold. A putative transcription terminator (underlined with arrow heads) is shown after the coding sequence

3.5 Expression of mRNA of Fop40 protein in NASF-1 cells The expression of Fop40 protein was stimulated in response to the increasing

concentration of NaCl. The expression of mRNA was examined to clarify whether the increase of Fop40 protein was due to transcriptional activation or translational activation. The analysis of Fop40 gene obtained from TIGR pre-released genomic data of At. ferrooxidans ATCC 23270 revealed that the open reading frame was preceded by a plausible ribosome-binding site with a AGGA sequence and –10 and –35 promoter sequences. A stem-loop structure followed by a T-rich sequence was found downstream from the stopping UAA codon, representing an independent transcriptional terminator (data not shown). Therefore, the inferred length of transcribed mRNA is though to be about 1.3 kb. One hybridization signal having the expected length was observed by Northern blot hybridization. The expression of Fop40-mRNA was stimulated in cells grown in Fe2+-medium supplemented with 0.2 M NaCl as shown in Fig. 3A. To determine the induction period for the expression of Fop40-mRNA, RNAs were prepared from cells incubated in Fe2+-medium supplemented with 0.2 M NaCl for 0, 1, 3 or 5 h and analyzed by Northern blot hybridization. A relative strong hybridization signal was observed after the incubation for 5 hours as shown in Fig. 3B. The expressions of proteins of At. ferrooxidans have been reported to be influenced in the external medium pH [20]. Therefore, the effect of pH on the expression of Fop40-mRNA was examined. RNAs were prepared from cells incubated for 5 h in Fe2+-medium adjusted at pH 1.5, 2.5, 3.5, or 4.5, and analyzed. The expression of Fop40-mRNA was stimulated when cells were incubated at pH higher than 2.5 as shown in Fig. 3C. Although the expression of Fop40-mRNA was stimulated in cells grown in Fe2+-medium supplemented with NaCl, SDS-PAGE analysis revealed that the stimulation did not occur in cells grown in Fe2+-medium supplemented with Na2SO4. Therefore, the effect of salts on the expression of Fop40-mRNA was examined. mRNAs were prepared from cells incubated for 5 h in Fe2+-medium supplemented with 0.2 M NaCl, 0.2 M KCl or 0.1 M Na2SO4, and analyzed by Northern blot hybridization. A strong hybridization signal was observed only with mRNA prepared from cells grown in Fe2+-medium supplemented with 0.2 M NaCl as shown in Fig. 3D.


1267

Figure 3. Effects of NaCl (A), incubation periods (B), pH (C) and salts (D) on Fop40 gene expression analyzed by northern hybridization. A; RNAs were prepared from cells grown without (lane 1) or with (lane 2) 0.2 M NaCl. B; RNAs were prepared from cells incubated in Fe2+-medium supplemented with 0.2M NaCl for 0 (lane 1), 1 (lane 2), 3 (lane 3), or 5 h (lane 4). C; RNAs were prepared from cells incubated for 5 h in Fe2+-medium adjusted at pH 4.5 (lane 1), 3.5 (lane 2), 2.5 (lane 3), or 1.5 (lane 4). D; RNAs were prepared from cells incubated in Fe2+-medium supplemented with 0.2 M KCl (lane 1), 0.1 M Na2SO4 (lane 2), 0 M NaCl (lane 3), or 0.2 M NaCl (lane 4). Northern hybridizations were carried out with DIG-labeled Fop40 probe. Lower photograph is an ethidium bromide-stained gel, indicating equal loadings of rRNA

4. DISCUSSION The results obtained by SDS-PAGE analysis of outer membrane fractions prepared

from cells grown in Fe2+-medium supplemented with NaCl revealed the increase of two specific proteins, FopA and Fop40 proteins. The N-terminal amino acid sequence of Fop40 protein was almost the same as the membrane protein previously detected in At. ferrooxidans ATCC 18959 under phosphate starvation. Northern blot hybridization analyses using DIG-labeled PCR-product of Fop40 gene as a probe revealed that the expression of mRNA of Fop40 protein was stimulated when cells were exposed to NaCl, or pH 3-4. Although the synthesis of a protein having an apparent molecular mass of 36 kDa has been reported to increase when At. ferrooxidans cells grown at pH 1.5 were shifted to pH 3.5, the synthesis of a major membrane protein with a molecular mass of 40 kDa (Omp40) has not been significantly influenced with pH shift [20]. The result is inconsistent with the data obtained with NASF-1 cells. The reason for this contradiction is unclear. When the cells were incubated in Fe2+-medium supplemented with NaCl, the expression of Fop40-mRNA was stimulated after the incubation for 5 h. This long stimulation period for Fop40-mRNA transcription may be due to the long generation time (about 8 h) of this bacterium. The stimulation did not occur in Fe2+-medium supplemented with KCl or Na2SO4. The results was consistent with the data obtained by SDS-PAGE analysis shown in Fig. 2B, and may indicate that the increase of Fop40 is not due to an osmotic change in medium.


1268

Figure 4. Alignment of the amino acid sequence derived from the putative FopA gene from At. ferrooxidans ATCC 23270 with sequences of the homologous outer membrane proteins. OrpF; OmpA-like protein of P. fluorescens (AF117969), OmpA; outer membrame protein of E. coli (V00307), Fomp; outer membrane protein of F. nucleatum (N_003454), Pal; peptidoglycan-associated lipoprotein of E. coli (X05123). Residues asterisked under the sequences are conserved in all sequence. Residues dotted are conserved in OmpA-related proteins. The linker region between N-terminal and C-terminal region of OmpA is in italic. An underlined part indicated the peptidoglycan-binding domain of OmpA

The stimulation of Fop40 expression in At. ferrooxidans NASF-1 cells occurred with different stimuli, such as NaCl concentration and pH shift. Although it has been reported that Omp40 protein is a porin and has a pore-forming activity [28, 27], homologous proteins to Omp40 protein from At. ferrooxidans have not been detected in databases. In E. coli, different porins, OmpC or OmpF, function when cells are exposed to osmotic change, and the pH dependence of OmpC and OmpF expression is also well known [33, 34]. E. coli involves EnvZ and OmpR functioning as a sensor of osmotic change and as regulator, respectively. The homologous gene to EnvZ or OmpR could not be detected in the pre-released database of At. ferrooxidans ATCC 23270 genome. Therefore, the regulatory mechanism of Fop40 expression may be different from that of OmpC or OmpF expression in E. coli. The investigation of regulatory mechanism for the expression of Fop40 protein is very important to understand the mechanism of environmental adaptation of this acidophilic bacterium, as pointed previously [28].

On the other hand, the expression of FopA protein was also stimulated in NASF-1 cells grown in Fe2+-medium supplemented with NaCl. Although the deduced molecular mass of the gene product detected in the pre-released database of At. ferrooxidans ATCC 23270 genome was smaller than the apparent molecular mass of FopA protein estimated by SDS-PAGE, we could not find out any other homologous genes in the database. Therefore, the open reading frame detected in the database seems to be the gene encoding the FopA protein. The C–terminal region of FopA had strong sequence similarity with


1269

proteins of the OmpA family, although no homologous protein with the N-terminal region of FopA was observed in the database. The N-terminal region of FopA was shorter than that of other typical proteins in the OmpA family, such as OmpA, and OprF (Fig. 4). OmpA-related proteins from other bacteria have a function needed to maintain the structure of cell by interacting with peptideglycan [35-37]. FopA also seems to associate with peptideglycan. N-terminal domains of OmpA-related proteins have shown to cross the membrane eight times in antiparallel β-strand [38]. We cannot find at least 3 sequences capable to form β-strand in FopA. FopA contained two hydrophobic parts in the N-terminal region, although Pal does not contain any hydrophobic parts in the N-terminal region. The linker region observed in OmpA of E. coli is also conserved in FopA. Therefore, we concluded that FopA is a new OmpA-like protein associating with peptidoglycan. We can find many proteins having similar structure as FopA protein in databases. The functions of these OmpA-like proteins having a short N-terminal region have not been examined in detail, yet.

Some OmpA-related proteins have been known as a heat-modifiable proteins, which changes the mobility on SDS-PAGE due to the heat-induced conformational change. The difference between the apparent molecular mass estimated by SDS-PAGE and the molecular mass deduced from the putative gene of FopA may be due to the heat modifiability of FopA protein. The purification and analysis of FopA protein is now in progress to characterize the properties of FopA protein in detail.

ACKNOWLEDGMENTS We thank Hidenori Yamada (Graduate School of Natural Science and Technology,

Okayama University) for the N-terminal sequencing of FopA and Fop40 proteins. Preliminary sequence data for the At. ferrooxidans strain 23270 was obtained from The Institute for Genomic Research (http://www.tigr.org).

This work was supported in part by a grant (No.12876022) from The Ministry of Education, Culture, Sports, Science and Technology.

REFERENCES 1. W. Achouak, T. Heulin, and J. M. Pages, FEMS Microbiol. Lett., 199 (2001)1. 2. R. Benz, and K. Bauer, Eur. J. Biochem., 176 (1988) 1. 3. B. K. Jap, and P. J. Walian, Rev. Biophys., 23 (1990) 367. 4. B. K. Jap, and P. J. Walian, Physiol. Rev., 76 (1996) 1073. 5. H. Nikaido, and M. Vaara, Microbiol. Rev., 49 (1985) 1. 6. T. Mizuno, M. –Y. Chou, and M. Inouye, J. Biol. Chem., 258 (1983) 6932. 7. H. Hofstra, and J. Dankert, J. Gen. Microbiol., 119 (1980) 123. 8. R. Benz, A. Schmid, and R. E. W. Hancock, J. Bacteriol., 162 (1985) 722. 9. H. Nikaido, and E. Y. Rosenberg, J. Bacteriol., 153 (1983) 241. 10. D. B. Datta, B. Arden, and U. Henning, J. Bacteriol., 131(1977) 821. 11. L. A. Pratt, W. Hsing, K. E. Gibson, and T. J. Silhavy, Mol. Microbial., 20 (1996) 911. 12. H. Aiba, T. Mizuno, and S. Mizushima, J. Biol. Chem., 264 (1989) 8563. 13. S. Forst, J. Delgado, and M. Inouye, Proc. Natl. Acad. Sci. USA., 86 (1989) 6052. 14. H. Aiba, H., F. Nakasai, S. Mizushima, and T. Mizuno, J. Bacteriol., 106 (1989) 5. 15. C. L. Brierley, Crit. Rev. Microbiol., 6 (1978) 207. 16. J. G. Cobley, and J. C. Cox, Microbial. Rev., 47 (1983) 579. 17. A. P. Harrison, Jr. Annu. Rev. Microbiol., 38 (1984) 265. 18. W. J. Ingledew, Biochem. Biophys. Acta., 683 (1982) 89.


1270

19. O. H. Tuovinen and D. P. Kelly. Z. Allg. Mikrobial. 12 (1972) 311. 20. A. M. Amaro, C. Chamorro, R. Arredondo, I. Peirano, and C. A. Jerez, J. Bacteriol.,

173 (1991) 910. 21. V. Buonfiglio, M. Polidoro, L. Flora, G. Citro, P. Valenti, and N. Orsi, FEMS

Microbiol. Rev., 11 (1993) 43. 22. V. Buonfiglio, V., M. Polodoro, F. Soyer, P. Valenti, and J. Shively, J. Biotechnol., 72

(1999) 85. 23. N. Ohomura, K. Tsugita, J. –I. Koizumi, and H. Saiki, J. Bacteriol., 178 (1996) 5776. 24. A. C. Jerez, M. Seeger, and A. M. Amaro, FEMS Microbiol. Lett., 98 (1992) 29. 25. M. Seeger, and C. A. Jerez, FEMS Microbiol. Lett., 108 (1993) 35. 26. M. Rodriguz, S. Campos, and B. Gomz-Silva, Appl. Biochem., 8 (1986) 292. 27. M. Silva, A. Ferreira, M. Rodriguez, and D. Wolff. FEBS Lett., 296 (1992) 169. 28. N. Guiliani, C. A. Jerez, Appl. Environ. Microbiol., 66 (2000) 2318. 29. K. Kamimura, S. Fujii and T. Sugio, Biosci. Biotechnol. Biochem., 65 (2001) 63. 30. O. H. Lowry, N. J. Rosenbrough, A. L. Farr, and R. J. Randall, J. Biol. Chem., 193

(1951) 265. 31. V. Kapatral, I. Anderson, N. Ivanova, G. Reznik, T. Los, A. Lykidis, A.

Bhattacharyya, A. Bartman, W. Gardner, G. Grechkin, L. Zhu, O. Vasieva, L. Chu, Y. Kogan, E. Goltsman, A. Bernal, N. Larsen, M. D’Souza, T. Walunas, G. Pusch, R. Haselkorn, M. Fonstein, N. Kyrpides, and R. Overbeek, J. Bacteriol., 184 (2002) 2005-2018.

32. A. Fjellbirkeland, V. Bemanian, I. R. McDonald, J. C. Murrell, and H. B. Jensen, Arch. Microbiol., 173 (2000) 346.

33. M. Heyde, and R. Portalier, Mol. Gen. Genet., 208 (1987) 511-517. 34. M. Sato, K. Machida, E. Arikado, H. Saito, T. Kakegawa, and H. Kobayashi, Appl.

Environ. Microbiol., 66 (2000) 943-947. 35. R. Domot, and J. Vanderleyden, Mol. Microbiol., 12 (1994) 333. 36. L. Sonntag, H. Schwartz, Y. Hirota, and U. Henning, J. Bacteriol., 136 (1978) 280. 37. E. Sugawara, and H. Nikaido, J. Biol. Chem., 269 (1994) 17981. 38. A.Pautsch, G.E. Schulz, Nat. Struct. Biol. 5 (1998) 1013-1017.



1271

Bioinformatic analysis of biofilm formation in Acidithiobacillus ferrooxidans

M. Barreto1, M. Rivas2, D.S. Holmes1,3 and E. Jedlicki2* 1 Laboratory of Bioinformatics and Genome Biology, University of Santiago (USACH),

Santiago, Chile 2 Program of Cellular & Molecular Biology, ICBM, University of Chile, Santiago, Chile

3Millenium Institute of Fundamental and Applied Biology, Santiago, Chile

Abstract The role of biofilm formation in the growth of Acidithiobacillus ferrooxidans in

natural environments and on simulated laboratory mineral surfaces has been well documented. However, despite the fundamental and industrial interest of such biofilm formation, little has been done to investigate its underlying genetic and physiological basis in A. ferrooxidans. Using the almost complete genome sequence of A. ferrooxidans made available by The Institute for Genome Research (TIGR) and Integrated Genomics Inc. (IG), we have undertaken a preliminary evaluation of possible genes and pathways potentially involved in biofilm formation.

A. ferrooxidans appears to have a substantial repertoire of genes necessary to synthesize the polysaccharide building blocks of biofilms. It also has genes to polymerize these building blocks into complex polysaccharides on a membrane associated lipid anchor. In addition, it has genes to form this lipid anchor and also genes to export and mature the extracellular polysaccharides that are the major constituent of most biofilms. Using this information, a model is proposed for the biofilm formation in A. ferrooxidans. Future studies will seek to provide experimental evidence for the model.

Keywords: biofilm formation, Acidithiobacillus ferrooxidans, genome analysis, extra-cellular polysaccharides, galactose

1. INTRODUCTION The formation of biofilms on mineral surfaces and their probable role in mineral

dissolution has been an area of study not only for fundamental interest but also because of its relevance to the industrial activity of this microorganism. However, little has been established regarding the underlying genetics and physiology of biofilm formation.

* Corresponding author: Eugenia Jedlicki, [email protected]. Work supported by Fondecyt No. 1010623 and the Millenium Institute of Fundamental and Applied Biology, Santiago, Chile. We thank the Institute of Genome Research (TIGR) and Integrated Genomics, Inc. (IG) for the use of their partial sequence data of the Acidithiobacillus genome.


1272

A biofilm is a highly structured community of organisms typically enclosed in an extra-cellular matrix and separated from neighboring communities by water channels (1). A structured community can include regional differentiation of function, for example aerobically respiring bacteria near the outside with anaerobes inside, or bacteria with different tolerances to pH distributed in a gradient from the outside to the inside of the biofilm. Usually, regional differentiation utilizes complex inter-cellular signaling for its development and maintenance. A typical biofilm is illustrated in figure 1. This figure is a composite, constructed from an analysis of a compilation of confocal microscope images obtained using totally hydrated biofilms derived from a number of different locations such as mountain rivers and acid mine drainage (2).

One of the first and best characterized step in the formation of a biofilm is the event in which bacteria pass from a reversibly attached stage to one in which they are irreversible bound to their substrate. Reversible attachment includes substrate identification that sometimes, but not always, involves chemotaxis, followed by electrostatic interactions between the bacterial cell wall and the substrate. The switchover to irreversible attachment involves the production and excretion of extracellular polysaccharides or, more accurately, extracellular polymorphic substance (EPSs) (3). EPS is a term that refers to a diverse set of biopolymers that can contain substituted or non-substituted polysaccharides and substituted or non-substituted proteins and may include nucleic acids and phospholipids (4).

Several studies have shown that attachment and adherence of A. ferrooxidans to mineral surfaces can occur and that the latter process is accompanied by the production of EPS (5-10). EPS production has an important role in the bacterial-substratum interactions and subsequent biofilm formation (8). In the environment, it is most likely that A. ferrooxidans forms a part of natural biofilms that cover exposed rock and mineral surfaces.

Figure 1. Formation and maturation of a typical bacterial biofilm. (A) Initial adhesion of a cell to a charged (often positively charged) abiotic or biological surface. (B) Formation of a monolayer of cells. (C) Development of strong inter-cellular contacts and formation of microcolonies. (D) Differentiation of a mature biofilm within a matrix of exopolisaccharides (EPS) separated by water channels

A. ferrooxidans can also exist in the planktonic state and probable colonizes new substrates while in this state. In the process of bioleaching, especially in the case of dump leaching, solubilization of the mineral involves attachment of various bacteria, including A. ferrooxidans, to the mineral substrate followed by biofilm formation. Attachment of bacteria to the mineral substrate probably also occurs during heap leaching, but the extent of attachment and subsequent biofilm formation would depend on the length of time during which the heap bioleaching process is allowed to occur.


1273

Whereas the capacity of A. ferrooxidans to form biofilms has been well established, little is known about the underlying physiology, genetics and regulation of biofilm formation in this microorganism. The long-term objective of our work is to address this deficiency and in this paper we present preliminary evidence for the presence of genes potentially involved in the formation of EPS and we propose a working model for EPS formation. This information provides a first step for understanding the physiology of biofilm formation in A. ferrooxidans.

2. MATERIALS AND METHODS. Known metabolic pathways involved in the formation of galactosides were obtained

from BIOCYC (http://biocyc.org:1555/META/server.html), KEGG (http://genome.ad.jp/ kegg/kegg4.html) and ERGO (http://wit.integratedgenomics.com/WIT2/CGI). Amino acid sequences derived from genes identified as being involved in galactose utilization were used as query sequences to search the partial genome sequence of A. ferrooxidans ATCC 23270 in the TIGR (http:// www.tigr.org/) and ERGO data bases using TBlastN and BlastP respectively. When a prospective candidate gene was identified in TIGR or ERGO its predicted amino acid sequence was then used to formulate a BlastP (http://www.ncbi.nlm.nhi.gov/BlastP/) search of the non-redundant database at NCBI. Only bidirectional best hits were accepted as evidence for putative homologs. Candidate genes and their translated proteins were further characterized employing the following bioinformatic tools available in the web: primary structure similarity relations (http://www.ebi.c.uk/ClustalW/), secondary structure predictions (HMM-based Protein Sequence Analysis http://www.cse.ucsc.edu/research/ compbio/HMM-apps/T99-query.html; JPred http://www.compbio.dundee.ac.uk/Software/ JPred/jpred.html), transmembrane predictions (http://www.ch.embnet.org/software/ TMPRED_form.html), motif predictions (http://www.blocks.fhcrc.org/, http://www.ebi.ac.uk/interpro/, http://www.biochem.ucl.ac.uk/bsm/dbbrowser/PRINTS/printscontents.html/, http://www. sanger.ac.uk/Software/Pfam/) and prediction of protein localization sites (http://psort.nibb. ac.jp/).

3. RESULTS AND DISCUSSION Our search for possible genes in A. ferrooxidans, involved in EPS, started with the

assumption that such genes would be recognizable orthologs of genes in other organisms known to be involved in biofilm formation. This assumption is justified because of the known conservation of EPS formation genes among various bacterial species (11), although subsequent metabolic routes to mature biofilm formation are varied and not well understood (12).

The basic building blocks of the EPS are typically the two galactosides, UDP-glucose and UDP-galactose (13). The enzymes involved in their production are UDP-glucose-pyrophosphorylase, encoded by the gene galU and UDP-glucose-4-epimerase, encoded by galE. In addition, in lactic acid bacteria, the enzyme phosphoglucomutase, encoded by the gene pgm, is also involved (14). Recognizable orthologs of these genes were found in A. ferrooxidans (Figure 2A, Figure 3 and Table1).

Having established that A. ferrooxidans has the necessary genetic capacity to synthesize the galactoside building blocks of EPS, additional bioinformatic analysis revealed the presence of a suite of genes potentially involved in the polymerization of the building blocks into EPS and its resulting processing and exportation through the outer membrane (Figure 2B,C and D, Figure 3 and Table 1). These include genes for the


1274

synthesis of the glycosyltransferases (GTFs) that are responsible for the polymerization of the galactosides into EPS on a membrane associated lipid anchor (Figure 2B, Figure 3), the export of the EPS through the membrane (Figure 2C, Figure 3) and its attachment to the outer surface of the outer membrane (Figure 2D, Figure 3). In addition, genes have been identified that potentially encode functions related to the biosynthesis of the membrane associated lipid anchor transporter, the modification of EPS and the construction of the outer membrane exporter of the EPS (Table 1, Figure 3).

The identification of a suite of candidate genes in A. ferrooxidans that potentially encode functions related to EPS formation was based upon bioinformatic amino acid sequence similarity comparisons made with genes experimentally implicated in EPSformation. Corroborating evidence for these functional assignments comes from additional bioinformatic analyses that reveal structural and functional motifs and domains in a number of these candidate proteins characteristic of genes involved in EPS formation (data not shown).

An analysis of the genomic locations of the candidate genes in A. ferrooxidans suggests that a number of them are located in operon-like organizations typical of those found in other microorganisms involved in EPS formation. Three examples of such putative operons are illustrated in Figure 3. The case illustrated in Figure 3A presents the organization of a proposed operon that includes genes potentially encoding galE (synthesis of galactosides) wza, ywqE, mir, exoT and alr (polymerization of galactosides) and exoP (export EPS). This proposed operon has similarities in gene content to that involved in EPS formation in the nitrogen fixing bacterium Rhizobium melliloti (15). The proposed operon shown in Figure 3B includes lpxB (polymerization of galactosides) and nmb, cdsA, dxr, lpxD, fabZ and lpxA (modification of EPS). It also includes three predicted membrane proteins of unknown function. This proposed operon has similarities of gene content to operons found in Lactococcus lactis, Streptococcus thermophilus and E. coli (14, 16 and 17).

Figure 2. Proposed model for the biosynthesis and excretion of exopolysaccharides in A. ferrooxidans potentially capable of leading to the formation of a biofilm. This model is based on a similar model for the formation of EPS experimentally established in a wide variety of microorganisms (Boels et al 2001). An explanation of the steps A-D in EPS formation is provided in the text


1275

Table 1. Candidate genes involved in EPS biosynthesis in A. ferrooxidans. (A) Proposed function ordered in a way consistent with the pathway shown in Figure 2, (B) gene name, (C) proposed enzyme activity, (D) Organism with the best BlastP hit to the candidate gene and (E) the % similarity of candidate gene to that found in the organism listed in column D

A. Proposed function

B. Gene C. Proposed enzyme activity D. Best Blastp hit E. % Sim.

galE UDP-glucose epimerase M. thermautotrophicus 71% pgm Phosphoglucomutase B. melitensis 76% galK Galactokinase S. coelicolor 48%

Galactoside synthesis

galU UDP-glucose pyrophosphorylase

B. pseudomallei 74%

exoT Polysaccharide biosynthesis protein

G. xylinus 56%

ywqE Capsular polisacharide biosynthesis protein

B. subtilis 44%

mlr UDP-glucose/GDP-mannose dehydrogenase

P. aeruginosa 73%

alr Glycosyltransferase (GTF) Nostoc sp. 49% lpxB Lipid A-disaccharide synthase P. aeruginosa 50%

Polymerization of EPS

wza capsular polysaccharide transport

V. vulnificus 48%

nmb Lipid carrier synthetase N. meningitidis 64% lpxD Probable UDP-3-o-3-

hydroxymyristoyl glucosamine n-acyltransferase protein

R. solanacearum 60%

fabZ Probable 3R-hydroxymyristoyl-acyl carrier protein dehydratase

R. solanacearum 58%

lpxA UDP-N-acetylglucosamine acetyltransferase

E. coli K12 69%

cdsA Phosphatidate cytidilyltransferase

P.aeruginosa PA01 53%

Maturation and modification of EPS

dxr Xylulose 5-phosphatase R. solanacearum 68% Exportation exoP Exportation of EPS E. coli O157 79%

The marked similarity of the organization of the proposed EPS formation operons of A. ferrooxidans with those found in a variety of microorganisms provides additional supporting evidence for the assignations of gene functions listed in Table 1. It also suggests that there may be an underlying commonality of gene regulatory networks controlling the expression of genes involved in EPS formation. To substantiate this conjecture, we tried to compare, by bioinformatic analysis, known DNA regulatory components of established

EPS operons with the putative operons of A. ferrooxidans. Unfortunately, at present, such bioinformatic approaches are generally hampered by the typical shortness of regulatory DNA sequences. However, using methods that have revealed potential Fur binding sites in A. ferrooxidans (18), a possible catabolite activator (CAP) binding site was detected upstream of the proposed gal operon (Figure 3C). A CAP binding site has also been mapped in the galactose operon of E. coli where the CAP protein has been shown to serve as a transcriptional activator of the operon (19). The similarity of the


1276

organization of the proposed A. ferrooxidans and E. coli gal operons suggests that they may perform a similar function with, possibly, a closely related mechanism of regulation.

The model that we have proposed for the formation of EPS in A. ferrooxidans can be considered a first step in understanding the genetics, physiology and regulation of biofilm formation in these microorganisms and now it is important to validate experimentally the model. In addition, future work will investigate the relationship of the proposed excreted EPS to later stages of biofilm formation.

Figure 3. (A), (B) and (C) examples of operon-like organizations of A. ferrooxidans genes proposed to be involved in EPS formation. In addition, in (C), the E. coli galactose operon and separate pgm gene is shown for comparison with the two proposed equivalent A. ferrooxidans gal operons Scale is shown in kb (kilobases). Each gene is coded according to its proposed function (see Key) consistent with the functions shown in Figure 2 and Table 1

REFERENCES 1. J. Costerton and P. Stewart, Scientific American., 285 (2001) 75 2. P. Stoodley, K. Sauer, D. Davies and J. Costerton, Annu. Rev. Microbiol., 56 (2002)

187 3. W. Characklis, in Biofilms, ed. W. Characklis, K. Marshall, New York: Wiley, (1990)

195. 4. J. Windenger, T. Neu and H. Flemming, ed. J. Windenger, T; Neu, T, Flemming, H.

Berlin: Springer. (1999) 93 5. D. Karamanev, J. Biotechnol., 20 (1991) 51 6. N. Wakao, K. Endo, K. Mino, Y. Sakurai, H. Shiota, J. Gen. Appl. Microbiol., 40

(1994) 349 7. A. Schippers, T. Rohwerder and W. Sand, Appl. Microbiol. Biotechnol., 52 (1999) 104 8. T. Gehrke, J. Telegdi, D. Thierry and W. Sand, Appl. Environ. Microbiol., 64 (1998)

2743


1277

9. C. Pogliani and E. Donati, Process Biochemistry, 35 (2000) 997 10. K. Kinzler, T. Gehrke and W. Sand, in Biohydrometallurgy: Fundamentals,

Technology and Sustanable Development, V.S.T. Ciminelli, O. Garcia (eds.), Ouro Preto, Minas Gerais, Brazil (2001) 191.

11. C. Ingeborg, A. Ramos, M. Kleerebezem and W. De Vos, Appl. Environ. Microbiol., 67 (2001) 3033

12. J-M Ghigo, Research in Microbiology, (2003, in press) 13. K. Bettenbrock and C-A. Alpert, Appl. Environ. Microbiol., 64 (1998) 2013 14. B. Degeest and L. Vuyst, Appl. Environ. Microbiol., 66 (2000) 3519 15. M. Glucksmann, T. Reuber and G. Walker, J. Bacteriol., 175 (1993) 7043 16. V. Stout, J. Bacteriol., 178 (1996) 4273 17. P. Looijesteijn, I. Boels, M. Kleerebezem and J. Hugenholtz, Appl. Environ.

Microbiol., 65 (1999) 5003 18. R. Quatrini, F. Veloso, E. Jedlicki, and D.S. Holmes, International Biohydrometallurgy

Symposium, Greece (2003). This volume. 19. M. Weickert and S. Adhya, Mol. Microbiol., 10 (1993) 245



1279

Diversity of Gram-negative bacteria at Malanjkhand copper mine, India

S.R. Dave* and D.R. Tipre

Department of Microbiology, School of Sciences, Gujarat University, Ahmedabad 380 009, Gujarat, India

Abstract Samples collected from Malanjkhand open-pit copper mine, India showed major

variation in pH from 3.3 to 8.0, redox potential from 250 to 505 mV and soluble copper from 0.13 to 0.63 g/l. Shannon-Wiener diversity indices (H') of heterotrophic cultivable bacterial species was in the range of 1.19 to 2.17 corresponding to evenness of 0.57 to 0.91 respectively. The major heterotrophic Gram-negative bacteria, which grew on sodium thiosulphate medium supplemented with glucose or yeast extract, were identified as Pseudomonas stutzeri, Pseudomonas aeruginosa, Brevundimonas diminuta, Stenotrophomonas maltophilia and Alcaligenes species. Collected samples also showed the presence of acid tolerant heterotrophs capable of growing on reduced sulphur compounds. Autotrophic sulphur and iron oxidizers were successfully cultivated with sulphur, tetrathionate, thiosulphate, metal sulphide and ferrous in liquid as well as solid media. They were identified on the basis of morphological, biochemical and physiological characteristics as Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans, Thiobacillus thioparus, Thiobacillus versutus and Thiobacillus intermedius. The Malanjkhand open-pit copper mine habitats showed considerable diversity among mesophilic Gram-negative bacterial species. Presence of both heterotrophic and autotrophic iron oxidizing acidophilic bacteria was noted in various proportions at different sites of the mine. Addition of yeast extract in the medium proved to be the choice of organic material for overall ferrous oxidation by the enriched cultures.

Keywords: mesophilic bacteria, Gram-negative bacteria, diversity, copper mine

1. INTRODUCTION Microorganisms occupy important niches in all ecosystems and are responsible for the

cycling of elements, degradation and formation of minerals even in the extreme environments [1-3]. The information about the microbial community structure at mining environment is necessary in order to gain a thorough understanding of the functioning of these ecosystems and their impact on the surrounding environment [4, 5]. The mining ecosystems are dominated by acidophilic sulphur and iron oxidising organisms. But due to sharp physical and chemical gradients, microbial ecosystems offer a variety of habitats and microniches, which can potentially be inhabited by metabolically diversed

*Corresponding author: S.R. Dave, E-mail: [email protected]


1280

microorganisms. However, little is known about the distribution of such microbial population thriving in these environments [6]. Therefore, the interest in the biodiversity of the microorganisms, which inhabit such extreme environments, has increased significantly over the past few decades.

The most familiar and well-studied microbes of acidic mineral leaching environments are Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans and Leptospirillum ferrooxidans [5]. But various fungi and heterotrophic organisms can also accomplish metal dissolution from oxidised and sulphide minerals even at weakly acidic or alkaline pH [5, 7-10]. Therefore, the study regarding such microbial community at mining environments is essential.

The cultivation based methods are not well suited for the fastidious microbial community study at the same time molecular studies also suffer from some drawbacks and it cannot provide the information regarding the physiological information of microorganisms. Thus, cultivation and molecular methods compliment each other [6].

In this context, the present work was undertaken to study the microbial diversity of mesophilic Gram negative bacteria of Malanjkhand Copper Mine, as India has numerous base metal ore reserves among which Malanjkhand Copper Mine is an important reserve situated in Madhya Pradesh.


2.1 Sample collection Seven soil and water samples were collected from Malanjkhand Copper Mine. This

mine is located at 80° 43' longitude and 22° 2' latitude at Malanjkhand, Madhya Pradesh, India. It is an open pit operation producing 2 million tonnes per year of ore containing 1.2% grade of copper. The deposit is of Proterozoic age and consists of a large body of primary copper ore (chalcopyrite) in quartz veins and granite rocks. The secondary sulphides formed are covellite and chalcocite. The main ore mineral is chalcopyrite with minor sulphide minerals viz. pyrite, sphalerite, molybdenite, chalcocite and bornite. All the samples were collected in the month of October 2000 when the mean day temperature was 30±2°C. Samples were collected in sterilised containers and polythene bags with the help of sterile sampler. During sample collection, pH and oxidation-reduction potential at sites were recorded with portable instruments (model-Eutech Cybernetics). Samples were brought immediately to the laboratory and stored at 4°C temperature till analysed. Dissolved copper was estimated by standard methods [11].

2.2 Isolation and enumeration Neutrophilic heterotrophic bacterial diversity study was carried out using High Plate

Count medium [12]. For the isolation and enumeration of autotrophic sulphur oxidisers, inorganic Starkey's basal salt medium [13] containing 2.5% (w/v) sodium thiosulphate / potassium tetrathionate / sulphur powder as energy source was used. For sulphur oxidising mixotrophs the above media were supplemented with 0.02% (w/v) organic substrate viz. glucose/glycerol/yeast extract. For isolation and purification of isolates all the above solid media were prepared with 1% (w/v) washed agar-agar powder as solidifying agent [13]. In case of iron oxidisers, basal salt medium was prepared as described by Johnson [14] with ferrous sulphate as energy source. For heterotrophic iron oxidisers 0.02% (w/v) yeast extract was supplemented as organic substrate in the medium and for the solid medium 0.8% (w/v) washed agar-agar powder was used as solidifying agent. Cell count was


1281

carried out by standard 3-tube Most Probable Number (MPN) technique and results were recorded after 7, 14 and 21 days of incubation [15]. For the ferrous oxidation rate of isolated cultures, 100 ml system with 2% (w/v) ferrous sulphate was taken. For the identification of the heterotrophic sulphur oxidisers, the cultures were transferred on nutrient agar plates and various biochemical tests were performed as per the Bergey’s manual [16, 17] and identification of these cultures were done by Biolog® GN-2 identification microplates (Biolog Inc., USA). All the experiments were carried out in triplicates. Plates and tubes were incubated at 30±2°C.

2.3 Analysis Similarity index, Shannon Weiner diversity, richness and evenness was calculated by

the standard formula [18]. Soluble ferrous, sulphate, acidity-alkalinity and thiosulphate were determined by the standard titrimetric and spectrophotometric method [11].

3. RESULTS AND DISCUSSION Soil and water samples collected from Malanjkhand Copper Mine showed pH

variations between 3.3 to 8.0 and redox potential of 505 to 250 mV. In terms of copper concentration also, they showed nearly 10 fold variations in terms of minimum and maximum copper present (Table 1). The detail description of appearance, conductivity and sulphate concentration is reported elsewhere [18]. The observed variation in the various parameters was obviously due to the selective representative sites from different ecological niches. The sample MJ-5 showed the highest copper as it was water oozing out from the chalcopyrite rock where the upper layer of the rock was of blue colour indicating the formation of secondary copper minerals like covellite and chalcocite.

Table 1. Characteristics of sample collection sites at Malanjkhand Copper Mine

Sample No. Collection site and sample appearance pH

Redox potential

(mV)

Soluble copper

(g/l) MJ-1 Clear flowing water at base of open pit mine 7.4 250 0.21 MJ-2 Brown sediments from the base of open pit

mine 8.0 280 0.46

MJ-3 Clear water from water pond at base of open pit mine

6.6 290 0.13

MJ-4 Reddish brown mud from the mine pond 7.0 300 0.06 MJ-5 Light blue water oozing from chalcopyrite rock 4.9 355 0.63 MJ-6 Greenish blue turbid leachate of acid heap

leaching 3.3 505 0.42

MJ-7 Yellowish brown dry sediments of heap leaching from collection pond

4.5 325 0.13

Qualitative and quantitative determination of mesophilic neutrophilic heterotrophic

bacteria from the various sites of the Malanjkhand Copper Mine were carried out and results are shown in terms of variety and diversity indices in Table 2. The highest varieties of heterotrophic bacteria were isolated from sample MJ-1 that was having slightly alkaline pH. On the other hand sample MJ-5 having pH 4.9 also showed as high as ten varieties of neutrophilic bacteria indicating the acid tolerant nature of these isolates. The lowest variety observed was 6, even when the sample pH was as low as 3.3. This indicates quite


1282

substantial number of acid tolerant population in Malanjkhand Copper Mine. When the richness, evenness and diversity were considered, the sample MJ-1 showed the highest figure. This could be due to the reason that the sample was flowing water passing through various locations of the mine, thus having population from various sites. Similarly even sample MJ-5 (oozing water) showed second highest richness. When the overall data is consider acidic water showed higher indices compared to alkaline samples.

The diversity of the sample is also clear from the similarity matrix shown in Table 3. It can be seen from the data the highest similarity observed was just 42% while it was as low as 0% in three samples. This determination indicates the selection of diverse sites at a mine, which provides maximum possible microbial varieties. Table 2. Diversity indices of neutrophilic heterotrophic bacteria at Malanjkhand Copper Mine

Site Number of varieties Richness RMargalef

Shannon Weiner diversity (H') Evenness EPielou

MJ-1 11 1.40 2.17 0.92 MJ-2 8 0.85 1.19 0.57 MJ-3 9 0.98 1.49 0.68 MJ-4 7 0.85 1.60 0.82 MJ-5 10 1.30 1.51 0.66 MJ-6 6 0.74 1.20 0.67 MJ-7 8 1.07 1.91 0.92

Table 3. Similarity matrix of the collection sites for heterotrophic bacterial isolates

Site MJ-1 MJ-2 MJ-3 MJ-4 MJ-5 MJ-6 MJ-7 MJ-1 1 0.42 0 0 0.05 0 0.05 MJ-2 1 0.18 0.13 0.11 0.07 0.06 MJ-3 1 0.19 0.11 0.20 0.18 MJ-4 1 0.06 0.23 0.20 MJ-5 1 0.19 0.17 MJ-6 1 0.21 MJ-7 1

Table 4. MPN count of iron and sulphur oxidising bacteria in various media (21 days incubation)

Counts per ml Sampling site Substrate Group of

organism MJ-1 MJ-3 MJ-5 MJ-6 MJ-7

ST 2.8x103 7x102 2.4x104 4.3x103 0 Tetrathionate 0 0 4.3x103 2.3x103 0 Sulphur

Autotrophic 'S' oxidiser

0 0 2.3x103 2.3x103 0 ST + Y.E. 2.3x103 1.4x103 4.3x103 2.3x103 0 ST + Glucose 9.0x102 4.3x103 2.3x103 9.0x102 2.8x103 ST + Glycerol

Mixotrophic 'S' oxidiser

4.6x104 1.1x105 1.5x104 1.5x104 4.6x104 Ferrous Autotrophic

Fe2+ oxidiser 2.9x102 5.5x104 1.1x104 4.3x102 9.3x103

Ferrous + Y.E. Mixotrophic Fe2+ oxidiser 3.0x101 4.3x103 7.5x102 3.0x101 2.3x103

Y.E.:yeast extract, ST: sodium thiosulphate


1283

The quantitative distributions of auto- and heterotrophic sulphur and iron oxidisers at five different sites using most probable number technique is shown in Table 4. Presence of both, auto- and heterotrophic iron oxidisers as well as heterotrophic sulphur oxidisers were recorded from all the sites. The autotrophic sulphur oxidisers utilising thiosulphate were more prevalent as compared to those, which were utilising tetrathionate or sulphur as energy source. In spite of the diverse pH of the samples, all the sites showed presence of acidophilic iron oxidising organisms while the acidophilic sulphur oxidiser were more prevalent in sample MJ-5 and MJ-6, obviously due to the acidic pH of these samples. The MPN count analysis also indicate the presence of both autotrophic and mixotrophic iron and sulphur oxidisers. On the basis of studied ratio of inorganic to organic compounds at very low concentration such as thiosulphate / ferrous and glucose / yeast extract / acetate some isolates could be grouped as mixotrophs or facultative chemolithotrophs.

There were seven varieties of mesophilic Gram negative bacteria observed on Starkey's basal medium containing sodium thiosulphate supplemented with either glucose or yeast extract. Out of these seven isolates, five were grown on Nutrient agar medium and were differentiated depending on the basic characteristics as depicted in Table 5. When these isolates were further characterised by Biolog® GN-2 plates, they were identified as Pseudomonas stutzeri, Pseudomonas aeruginosa, Brevundimonas diminuta, Stenotrophomonas maltophilia and Alcaligenes spp. All the isolates could be grouped in the genus Pseudomonas except Alcaligenes, when they were examined for their classification in Bergey's manual of determinative bacteriology [16] and Bergey's manual of systematic bacteriology [17].

Table 5. Characteristic of identified heterotrophic thiosulphate oxidisers

Isolate number Test

1 2 3 4 5 Medium ST+Glu. ST+Y.E. ST+Y.E. ST+Y.E. ST+Glu. Motility + + + + + Fluorescence − + − − − Pigment Yellow Bluish green − − − Growth at 41°C ± + ± n.d. n.d. Oxidase + + + + + Gelatine − + − + − Starch + − − − − Glucose + + − + − Fructose + + − + + T.S.I. Ak/Ak Ak/Ak Ak/Ak Ak/Ak Ak/Ak Isolated from sample

MJ-3, MJ-5

MJ-1, MJ-5

MJ-1, MJ-3, MJ-5

MJ-1 MJ-3, MJ-5

Identification Ps. stutzeri Ps. aeruginosa B. diminuta S. maltophilia Alcaligenes spp.

ST: sodium thiosulphate; Y.E: yeast extract; Glu: glucose; Ak: alkaline; n.d: not determined

All this isolates grew on Starkey's medium indicating their role in thiosulphate oxidation. When they were grown in broth medium with various pH for thiosulphate oxidation, the maximum oxidation observed was in the range of 70 to 93% at 4.5 initial pH of the medium. They also oxidised thiosulphate upto pH 8.0. During the thiosulphate oxidation, first the pH of the medium increased and reached to as high as 8.5 to 9.0 and thereafter for two isolates, it decreased to acidic side as low as pH 4.0 (data not shown).


1284

In case of ferrous oxidation, direct growth on solid medium from the sample was not achieved. Therefore, positive tubes of the MPN count were selected for the isolation of iron oxidisers on solid media. Twelve different varieties of colonies were observed on ferrous and ferrous supplemented with yeast extract medium. Out of which 10 varieties were successfully purified and their ferrous oxidation patterns were studied between pH 1.0 and 3.0. The mg/l/h ferrous oxidation of these isolates at various pH are shown in Table 6. As can be seen from the data, all the isolates showed almost similar ferrous oxidation activity both at pH 2.3 and 3.1. The ferrous oxidation activity reduced by 5 to 20 folds at pH 1.2 except for the isolates 1 and 3, which did not show any activity at this pH. When the activity was compared between auto- and mixotrophs, the mixotrophs showed more activity irrespective of the pH studied. This finding once again shows the importance of mixotrophic organisms in mining activity. Various authors have reported the importance of heterotrophs in biomining [7, 19, 20].

Table 6. Iron oxidation rates of autotrophic and mixotrophic iron oxidising isolates Ferrous oxidation rate (mg/l/hr)

pH Isolate no. Growth substrate in medium 1.2 2.3 3.1

1 0 109.6 107.4 2 6.3 116.6 124.8 3

Ferrous 0 120.0 141.1

6 12.2 170.0 173.0 8 21.9 168.9 176.0 9 22.6 160.4 173.7

10 17.4 156.0 170.0 11 20.7 167.0 170.0 12 26.0 175.6 183.0 15

Ferrous +

yeast extract

29.3 156.3 153.7

The attempts were made for the identification of the mesophilic auto- and mixotrophic iron and sulphur oxidizers. On the basis of their growth pattern and some of the biological tests, they were identified as Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans, Thiobacillus thioparus, Thiobacillus versutus and Thiobacillus intermedius. Other mixotrophic iron oxidisers growing in the presence of yeast extract were not identified due to the limitation of the facility available.

4. CONCLUSION Malanjkhand Copper Mine represents quite diversed physico-chemical ecosystem.

Inspite of mining environment, the ecosystem showed considerable richness, evenness and diversity for neutrophilic heterotrophic bacteria. None of the selected site has more than 42% similarity. Almost all the sites showed considerable number of auto- and heterotrophic iron and sulphur oxidisers. Thiosulphate was proved to be better substrate for the study of sulphur oxidisers. The mining ecosystem showed Pseudomonas as a keystone genus among the heterotrophic sulphur oxidisers. In case of cultivable iron oxidisers on solid media, the mixotrophic group was found to be widespread and dominant as compared to autotrophs. The overall finding of mesophiles reveal that autotrophs, mixotrophs and heterotrophs may play equally important role in mining activity. These findings are very much encouraging and suggest that the mixotrophic and heterotrophic Gram-negative bacteria can be used for biohydrometallurgical processes along with the autotrophs.


1285

ACKNOWLEDMENTS We are thankful to Department of Biotechnology, New Delhi, India for the project

grant and Research Associateship to D. R. Tipre. We are grateful to Hindustan Copper Ltd., Malanjkhand for helping in sample collection. We also acknowledge the assistance provided by K.P. Ladhawala and V.V. Gajjar.

REFERENCES 1. D. B. Johnson, In: Biohydrometallurgy and the Environment toward the Mining of the

21st Century, Part A, R. Amils and A. Ballester (eds.), Proc. Intl. Biohydrometallurgy Symp., Elsevier, Amsterdam, (1999) 645.

2. Pandey and L. M. S. Palni, J. Sci. Indus. Res., 57 (1998) 668. 3. K. A. Natarajan, In: Microbes, Minerals and Environment, Geological Survey of India,

(1998). 4. S. R. Dave and K. A. Natarajan, Trans. I.I.M., 40 (4) (1987) 315. 5. D. B. Johnson and F. F. Roberto, In: Biomining: Theory, Microbes and Industrial

Processes, D. E. Rawlings (ed.), Landes Bioscience, USA, (1997) 302. 6. S. M. Sievert, T. Brinkhoff, G. Muyzer, W. Ziebis and J. Kuever, Appl. Environ.

Microbiol., 65 (9) (1999) 3834. 7. D. B. Johnson, FEMS Microbiol. Ecol. 27 (1998) 307. 8. S. R. Dave and K. A. Natarajan, Hydrometallurgy, 7 (1981) 235. 9. M. Hahn S. Willscher and G. Straube, In: Biohydrometallurgical Technologies I, A. E.

Torma, M. L. Apel and C. L. Brierley (eds.), IBS, TMS, USA, (1993) 99. 10. H. L. Ehrlich, In: Biohydrometallurgy and the Environment toward the Mining of the

21st Century, Part A, R. Amils and A. Ballester (eds.), Proc. Intl. Biohydrometallurgy Symp., Elsevier, Amsterdam, (1999) 3.

11. D. Eaton, L. S. Clesceri and A. E. Greenberg (eds.), Standard methods for the examination of water and waste water, 19th ed, APHA, USA, (1999).

12. The Himedia Manual for Microbiology Laboratory Practice, Himedia Laboratories Pvt. Ltd., Mumbai, India, (1998).

13. S. R. Dave, Ph. D. Thesis, The University of Mysore, Mysore, India, (1980). 14. D. B. Johnson, J. H. M. Macvicar and S. Rolfe, J. Microbio. Methods, 7 (1987) 9. 15. B. Escobar and I. Godoy, In: Biohydrometallurgy and the Environment toward the

Mining of the 21st Century, Part A, R. Amils and A. Ballester (eds.), Proc. Intl. Biohydrometallurgy Symp., Elsevier, Amsterdam, (1999) 681.

16. Bergey's Manual of Determinative Bacteriology, In: J. G. Holt, N. R. Krieg, P. H. A. Sneath, J. T. Staley and S. T. Williams (eds.), 9th ed., Lippincott Williams and Wilkins, USA, (1994).

17. Bergey's Manual of Systematic Bacteriology, In: J. T. Staley, M. P. Bryant, N. Pfennig and J. G. Holt (eds.), Vol 3, 1st ed., Williams and Wilkins, USA, (1989).

18. S. R. Dave, D. R. Tipre and V. V. Gajjar, Asian J Microbiol. Biotech. Env. Sc., 4 (3) (2002) 367.

19. Schippers, R. Hallmann, S. Wentzien and W. Sand, Appl. Environ. Microbiol., 61 (8) (1995) 2930.

20. M. A. Ghauri and D. B. Johnson, FEMS Microbiol. Ecology, 85 (1991) 327.



1287

Expression proteomics of Acidithiobacillus ferrooxidans grown in different metal sulfides: analysis of rhodanese-like proteins

P. Ramírez, L. Valenzuela, M. Acosta, N. Guiliani and C.A. Jerez

Laboratory of Molecular Microbiology and Biotechnology, Department of Biology, Faculty of Sciences, and Millennium Institute for Advanced Studies in Cell Biology and

Biotechnology, University of Chile, Santiago, Chile. [email protected]

Abstract By expression proteomics of Acidithiobacillus ferrooxidans ATCC 19859 we

characterized a set of proteins changing their levels of expression during growth of the microorganism in metal sulfides and elemental sulfur compared with growth in ferrous iron. By determination of the N-terminal amino acid sequences of these proteins present in proteomic arrays obtained after two-dimensional polyacrylamide gel electrophoresis and by using the available preliminary genomic sequence of A. ferrooxidans ATCC 23270 we identified several of them. The genomic context around these protein genes suggests their involvement in the sulfur metabolism of A. ferrooxidans. Amongst some of the proteins highly upregulated by growth in sulfur compounds (and downregulated by growth in ferrous iron) we found an outer membrane protein, an exported putative thiosulfate sulfur transferase (rhodanese) protein and a 33 kDa putative thiosulfate/sulfate binding protein amongst others. In the present work, we further analyzed the genome sequence from A. ferrooxidans and found two other rhodanase-like proteins: P14 and P16 whose genes did not contain signal peptides. The predicted tertiary structures of P21, P16 and P14 were very similar, especially in their putative active site for thiosulfate binding. The genomic context of the genes for these proteins was annotated in an attempt to suggest their possible roles. We further isolated from the DNA of A. ferrooxidans the gene coding for P14 and cloned and expressed the protein in E. coli, detecting a functional rhodanase activity for P14. This family of rhodanese-like proteins may be important in the sulfur metabolism of A. ferrooxidans.

Keywords: rhodanese, Acidithiobacillus ferrooxidans, sulfur metabolism, proteomics

1. INTRODUCTION Acidithiobacillus ferrooxidans is a chemolithoauthotrophic bacterium that obtains its

energy from the oxidation of ferrous iron, elemental sulfur, or partially oxidized sulfur compounds (1, 2, 3). The ability of these and other microorganisms present in their habitat to solubilize metal sulfides is succesfully applied in biomining operations (2). Recently, it has been proposed that pyrite (FeS2) and other metal sulfides are degraded by an indirect mechanism generating thiosulfate as the main intermediate (4). Iron (III) ions are exclusively the oxidizing agents for the dissolution. Thiosulfate would be consequently degraded in a cyclic process to sulfate, with elemental sulfur being a side product. This explains why only Fe(II) ion-oxidizing bacteria are capable of oxidizing these metal


1288

sulfides (4). In addition, enzymes for thiosulfate or sulfite oxidation from A. ferrooxidans or A. thiooxidans may succesfully compete with the chemical reactions with iron (III) ions as an oxidizing agent (4). A rhodanese activity has been previously described in A. ferrooxidans (5). This enzyme is a thiosulfate sulfur-transferase, which breaks the S-S bond present in thiosulfate, generating sulfur and sulfite. Other enzymes may also participate in the thiosulfate mechanism, such as the thiosulfate-oxidizing enzyme of A. ferrooxidans (6).

By proteomic analysis, we have previously studied the global changes in gene expression of A. ferrooxidans when the microorganism was grown under different conditions and have identified an exported rhodanese-like protein (P21) which is induced when A. ferrooxidans is grown in metal sulfides and different sulfur compounds but is almost entirely repressed by growth in ferrous iron (7). Unlike cytoplasmic rhodaneses, P21 was located in the periphery of A. ferrooxidans cells and was regulated depending on the oxidizable substrate. By using the available preliminary genomic sequence of A. ferrooxidans ATCC 23270, the genomic context around gene p21 showed the presence of other ORFs corresponding to proteins such as thioredoxins and sulfate-thiosulfate binding proteins, clearly suggesting the involvement of P21 in inorganic sulfur metabolism in A. ferrooxidans (7). Here, we extend our genomic analysis, and define two new rhodanese-like proteins, P14 and P16. The gene coding for P14 was isolated and after its cloning and expression in E. coli, its functional rhodanese activity was demonstrated.


2.1 Bacterial strains and growth conditions A. ferrooxidans strain ATCC 19859 was grown in ferrous iron-containing modified

9K medium or in sulfur or pyrite as described before (7). E. coli strain BL21(DE3) containing plasmid pGZ105 with the glpE insert coding for the E. coli rhodanese (8) was a kind gift of T. Larson. E. coli strains BL21(DE3) and derivatives were grown in LB medium (9).

2.2 2-D NEPHGE and SDS-PAGE Total cell proteins were separated by SDS-PAGE or two-dimensional non-equilibrium

pH polyacrylamide gel electrophoresis (2-D NEPHGE) as described before for A. ferrooxidans (7).

2.3 Primers and PCR conditions The oligonucleotide primers were purchased from Genset Corporation. Taq and Pwo

polymerases were from Promega and Roche, respectively, and were used according to the manufacturer's recommendations. The oligonucleotide primer sequences were deduced from the ORFs found in the available almost finished DNA genomic sequence of A. ferrooxidans strain ATCC 23270 (http://www.tigr.org). These primers were

P14NTER-NdeI (5´-gTTTTTAgTCATATggggAAggTCATgg-3´) and P14CTER-XhoIHT (5´-TAggCTCCggCTCTCgAgggAAACgAC-3´). To amplify the p14 gene we used a two-step HotPCR protocol: 3 min at 95°C

followed by 20 cycles at 95°C for 30s, 62°C for 30s and 45s at 72°C and finally 72ºC for 3 min.


1289

2.4 DNA manipulations Restriction enzyme digestions, T4 DNA ligase and recombinant DNA techniques were

carried out according to standard laboratory procedures (9). The dideoxy chain termination method was employed to sequence DNA using [γ−33P]ATP and the dsDNA Cycle Sequencing System from Gibco BRL. The DNA sequences were compiled and analysed with the University of Wisconsin GCG Package (Version 9.1, Genetics Computer Group, Madison, Wis.).

2.5 P14 gene cloning and expression We used pGEM-T (Promega) and the pET System (Novagen). The p14 gene was

obtained by PCR using P14NTER-NdeI and P14CTER-XhoIHT primers corresponding to the N-terminal and C-terminal end sequences of P14 and containing NdeI and XhoI restriction sites, respectively. The DNA fragments separated by electrophoresis in 1% agarose gels were recovered, purified with Wizard PCR Prep (Promega) and ligated to pGEM-T vector (Promega). The ligation products were used to transform E. coli JM109. The positive clones were analyzed by using colony PCR and the corresponding plasmids with inserts were purified. The DNA fragment of interest was ligated to pET21b(+) vector (Novagen), previously digested with NdeI and XhoI. The ligation product (p14H vector) was used to transform E. coli strain BL21(DE3). The recombinant clones were selected on LB solid medium supplemented with ampicillin (100 µg/ml). The induction/expression analysis was done in the presence or absence of 1 mM IPTG, added when the cultures reached an OD600 of 0.6. Expression of the recombinant P14 (rP14) was analyzed by SDS-PAGE of total cell extracts.

2.6 Determination of rhodanese activity Rhodanese (thiosulfate:cyanide sulfurtransferase; EC 2.8.1.1) activity was assayed in

crude enzyme extracts or with the purified recombinant protein rP21. As a control, we used the recombinant rhodanese GlpE from E. coli (8). The assay was done at pH 7.5 - 8.5 essentially as described before by Singleton and Smith (10), and Gardner and Rawlings (11).

2.7 Sequence analysis Identity/similarity searching in databases was done by using the BlastP program (12)

from NCBI (http://www.ncbi.nlm.nih.gov) and from the unfinished A. ferrooxidans ATCC 23270 genome site (http://www.tigr.org). Multiple alignments, molecular masses and isoelectric points of ORFs, the presence of transmembrane domains in the analyzed ORFs and the putative functions and predicted subcellular locations of the proteins coded by the different ORFs were analyzed as described before (7).

3. RESULTS AND DISCUSSION

3.1 Determination of rhodanese activity in A. ferrooxidans We could not find in vitro rhodanese activity in the rhodanese-like P21 protein that

we recently described (7). This lack of activity of the recombinant P21 could be to a number of reasons. However, one possibility is that P21 does not correspond to the previously described rhodanese activity in A. ferrooxidans (5). We therefore measured rhodanese activity in crude cell-free extracts from A. ferrooxidans ATCC 19859 grown under different conditions. Figure 1 shows that rhodanese activity in crude extracts from


1290

cells grown in sulfur, ferrous iron or pyrite, gave values in the range of those reported by Tabita et al. (5) (0.250 µMoles SCN-/min/mg of protein), the differences between iron- and sulfur-grown cells being only about 25%. On the other hand, the synthesis of P21 appeared to be regulated by the presence of iron in the growth medium of sulfur grown cells since P21 levels are decreased by more than 30 fold in the presence of 10 mM Fe (II) (7). This result is clearly different from that expected if the levels of P21 synthesized in ferrous iron- or sulfur-grown cells were responsible of the observed rhodanese activity. Recently, Gardner and Rawlings (11) detected thiosulfate-sulfur transferase activity in whole cells and crude extracts from A. ferrooxidans, A. thiooxidans, and A. caldus whereas this activity was absent from Leptospirillum ferrooxidans, since this microorganism is only capable of oxidizing ferrous iron or the iron contained in pyrite, but not its sulfur moiety (4). These results support the idea of rhodanese being involved during in vivo sulfur oxidation.

00.05

0.1

0.15

0.2

0.25

0.3

So Fe2+ FeS2

uMol

SCN

- /mg

depr

ot/m

in

00.05

0.1

0.15

0.2

0.25

0.3

So Fe2+ FeS2

00.05

0.1

0.15

0.2

0.25

0.3

So Fe2+ FeS2

uMol

SCN

- /mg

depr

ot/m

in

Figure 1. Rhodanese activity of crude cell extracts from A. ferrooxidans. Cells of A. ferrooxidans ATCC 19859 were grown as indicated in elemental sulfur, ferrous iron or pyrite and the corresponding cell-free extracts were prepared to determine rhodanese activity

In the studies of Gardner and Rawlings (11), the rhodanese activity levels in A. ferrooxidans were also about the same when cells were grown either in ferrous iron or in sulfur. Since rhodaneses have been reported as constitutive (13), the activity measured by Gardner and Rawlings most likely corresponded to the cytoplasmic rhodanese. The lack of rhodanase activity of P21 may be due to the need of additional polypeptides required for it to be active, as it occurs with the thiosulfate oxidizing complex from Paracoccus versutus (13). Alternatively, the regulated exported P21 may have a different role during sulfur metabolism.

3.2 Search in the genomic sequence of A. ferrooxidans of putative rhodanase genes and their genetic context In the unfinished A. ferrooxidans genome sequence we found at least two other small

sequences with rhodanese-like similarities: P14 and P16 (7). These two putative ORFs did not present signal peptides and the corresponding putative proteins had isoelectric points of 4.8 (P14) and 9.3 (P16). Figure 2 shows the genomic analysis of the regions surrounding genes p21, p14 and p16. Several putative ORFs related to sulfur metabolism were deduced in the context of p21 (7): upstream of p21 a terminal oxidase subunit (tox1) and a sulfate/thiosulfate binding protein (sbp1) were located.

These putative genes together with a putative C4-dicarboxilate transporter (cdt), an unknown ORF and a hypothetical protein ORF apparently form a cluster with the same orientation. On the other hand, a putative gene with high similarity to a periplasmic thioredoxin (trx), together with a terminal oxidase subunit (tox2), a sulfate/molybdate

µMol

SC

N- /m

g pr

ot/m

in


1291

binding protein (sbp2) and an unknown ORF were oriented in a divergent way from the p21 cluster. The existence in A. ferrooxidans ATCC 19859 of an exported protein P21 similar to a thiosulfate-sulfur-transferase and which is regulated depending on the oxidizable substrate is very interesting considering the proposal that the oxidation of pyrite generates thiosulfate as one of the main intermediates (4).

Figure 2. Schematic map of the contig regions containing the putative gene cluster contexts around genes p21(A), p14 (B) and p16 (C) from A. ferrooxidans. ORFs possibly related with sulfur metabolism are in gray. Coding regions containing putative signal peptides for the Sec system are indicated with black vertical rectangles. The names of the genes coding for P14, P16 and P21 are indicated in bold. The putative ORFs present in these regions are described in the text

On the other hand, it has been shown that A. ferrooxidans generates thiosulfate when grown in a medium containing elemental sulfur (15). This could explain why P21 is induced when cells are grown in elemental sulfur. If P21 is involved in thiosulfate metabolism, one should expect an increased expression of the protein when the cells are grown in pyrite, thiosulfate or sulfur, as we have observed (7). The lack of repression of P21 synthesis by growth in pyrite when compared with that obtained by growth in ferrous iron was unexpected. However, during pyrite attack, much smaller amounts of free ferrous iron are probably present, and as we have shown, the levels of P21 drastically decreased at higher concentration of ferrous iron in the growth medium. The studies on a small rhodanese-like protein from Wolinella succinogenes showed that it acts as a periplasmic sulfide dehydrogenase and uses the same catalytic cysteine involved in anion transferase and hydrolase activity (16). This suggests a possible redox function for rhodanese-like proteins similar to that of the thioredoxin proteins. This is supported by the presence on the C-terminal end of P21, and not in P14 or P16, a cysteine motif Cys-XX-Trp-XX-Cys known to bind iron-sulfur clusters in electron transport complexes (14). It is also possible that P21 from A. ferrooxidans has a dithiol-disulfide redox activity analogous to the one in W. succinogenes.

The ORFs coding for P14 and P16 were located in different contigs of the incomplete genome from A. ferrooxidans ATCC 23270 (contigs 7920 and 7913 respectively), and with entirely different neighbouring putative genes. Upstream of p14 a sugar kinase (sk) is located in a divergent direction and followed by three ORFs apparently forming a cluster

p14sahch sams skprk 5,10 mthfr gf 2,3 bfgkp14sahch sams sk gf 2,3 bfgk

p16gtxtrx acr1 acr2 tramid p16gtxtrx acr1 acr2 acr3 trpm

cdt sbp1 (p33) tox1 p21 trx tox2 sbp2

A

B

C

p14sahch sams skprk 5,10 mthfr gf 2,3 bfgkp14sahch sams sk gf 2,3 bfgk

p16gtxtrx acr1 acr2 tramid p16gtxtrx acr1 acr2 acr3 trpm

cdt sbp1 (p33) tox1 p21 trx tox2 sbp2

A

B

C


1292

with the same orientation: S-adenosylmethionine synthetase (sams), S-adenosyl-L-homocysteine hydrolase (sahch) and a 5, 10-methylene tetrahydrofolate reductase (5-10 mthfr). Downstream of p14 we found an unknown ORF with the same orientation followed in opposite direction by a putative glycogen phosphorylase (gf) and a 2,3-biphosphoglycerate kinase (2,3-bfgk). Upstream of p16 and with the same orientation we found ORFs coding for putatives glutarhedoxin (gtx), a thioredoxin (trx) and an N-acetylmuramoyl-L-alanine amidase (amid). Downstream of the putative rhodanese-like p16 we found with the same orientation, three ORFs coding for putative genes for acryflavin resistance (acr1, acr2 and acr3) and a possible transcriptional regulator (tr).

3.3 Structural comparison of the putative rhodanase-like proteins P14, P16 and P21 with the rhodanese GlpE from E. coli The comparative analysis of the amino acid sequences of P14, P16 and P21 with

several known thiosulfate-sulfur transferases, which activity has been demonstrated in vitro, showed a significant similarity (average 40%). The three proteins also contained the highly conserved structural domains CH2A, CH2B and a catalytic site with a Cys, typical of thiosulfate-sulfur transferases (Fig. 3).

Figure 3. Alignment of the amino acid sequences of the rhodanese-like proteins P14, P16 and P21 from A. ferrooxidans with GlpE, the rhodanese from E. coli. The active site and the structural domains CH2A and CH2B, which are conserved in all rhodaneses are enclosed by rectangles. The secondary structure elements are indicated above the alignment (black arrows, for β-strands and grey rectangles for the α-helices)

Recently, Spallarossa et al., (17) compared the crystalline structure of the GlpE protein or rhodanese from E. coli with that of other rhodaneses and described that the catalytic site for the thiosulfate sulfur transferase activity is formed by six amino acids containing a Cys-65. The loops forming part of the site contain the βD sheet and the D α-helix previously described (18). When we aligned the structure of GlpE present in the data


1293

banks (MMDB Id: 18023 PDB Id:1GN0) with those putative structures of P14, P16 and P21 by means of the program Cn3D (19), we found similar overall three-dimensional structures with a great conservation in the active sites where thiosulfate would be bound, as shown in Figure 4. In spite of the observed amino acid variability, the active site loop conformation is similar in all the proteins compared in Fig. 4. At least three polar (often charged) residues are observed at these six sites in rhodanese enzymes, contributing to the buildup of a positive electrostatic field, expected to lower the pKa of the catalytic Cys residue. An abundance of potentially functional rhodanese-like proteins has been observed in several genomes (20) and we have observed so far three such proteins in A. ferrooxidans. As pointed out by Spallarossa et al. (17), the amino acid variability observed for the putative active-site loops in all the identified homologs suggests a diversification of substrate specificity, while keeping the enzymatic activities related to the formation, interconversion and transport of compounds containing sulfane sulfur atoms. The three rhodanese-like proteins that we describe here belong to the ubiquitous rhodanese protein superfamily, and may have important roles in sulfur metabolism and or acquisition by A. ferrooxidans. Nevertheless, it is known that rhodanese-like proteins could show several alternative catalytic activities, amongst them, detoxification of toxic compounds such as arsenate and cyanide by either transferring anions or reducing them, and a chaperone activity to allow efficient assembly of iron-sulfur complex-containing proteins (20).

GlpE P21

p14P14 P16

Cys92Cys101

Cys65Cys147

P14P16GlpEP21

Active site

GlpE P21

p14P14 P16

Cys92Cys101

Cys65Cys147

P14P16GlpEP21

Active site

Figure 4. Three-dimensional structural comparisons of the regions containing the active site of rhodaneses. Taking the crystaline structure of GlpE as a model (17), the corresponding homolog active sites of P14, P16 and P21 are presented. The amino acid sequences of the compared structures are also indicated. Identical amino acids are in black and similar amino acids are in grey


1294

3.4 Isolation, cloning and expression of the p14 gene from A. ferrooxidans in E. coli Based on the greater similarities between P14 and GlpE, we decided to isolate and

clone the p14 gene from A. ferrooxidans in E. coli. By using PCR and the appropriate primers, we isolated the DNA fragment of A. ferrooxidans containing the p14 gene and cloned it in an expression vector to transform E. coli. Fig. 5A shows the in vivo overexpression of a protein band with the molecular mass expected for P14. To find out if this E. coli transformant showed an increased rhodanese activity, we determined the capacity of the crude extract overexpressing P14 to transfer the sulfane sulfur from thiosulfate to cyanide (Fig. 5B).

Figure 5. In vivo overexpression of A. ferrooxidans p14 gene in E. coli and determination of rhodanese activity in the crude E. coli cell extracts. A. The pET21b(+) plasmid containing the p14 gene insert (lanes a, b) or the vector without the insert (lanes c, d) were used to transform E. coli strain BL21(DE3). All of the strains were grown for 2 h in the presence (lanes b, d) or in the absence (lanes a, c) of 1 mM IPTG added at the half-logarithmic phase of growth. Total cell proteins were separated by SDS-PAGE and stained with Coomassie blue. The arrow head indicates the migrating position of protein P14. B. Rhodanase activity in crude cell-free extracts. Column a, activity of extracts from cells containing the plasmid vector carrying gene p14. Column b, activity of cell extracts from bacteria carrying only the vector. Both strains were grown up to the exponential phase and were then induced for 2 h with 1 mM IPTG

The transformed E. coli strain showed twice the activity of the control strain transformed with the plasmid without the p14 gene. Although the rhodanese activity observed was smaller than that seen in E. coli overexpressing GlpE from a plasmid (8), these results clearly indicate that gene p14 codes for a functional protein with rhodanese activity. Most likely, we conclude that P14 could be responsible for the rhodanese activity we detected in the crude extracts from A. ferrooxidans grown in sulfur, ferrous iron or pyrite (Fig. 1).

A working model which summarizes some of our previous findings and those presented here is shown in figure 6. It is possible that P21 is not a periplasmic rhodanase enzyme but it is rather part of a possible complex in charge of thiosulfate oxidation. This putative complex could be different from the Sox model proposed for sulfur oxidation in many bacteria (13) since so far, we have not found any Sox-like genes in the available unfinished genome of A. ferrooxidans.

µMol

SCN

- /mg

prot

/min


1295

Figure 6. Working model for thiosulfate metabolism in A. ferrooxidans. The thiosulfate generated from pyrite or by chemical reaction between elemental sulfur and sulfite would be oxidized in the periplasm by means of two possible pathways: by thiosulfate dehydrogenase (TD) to give tetrathionate (3, 6, 13) or by means of a thiosulfate sulfur transferase (TST) (3) or (P21) (3). The sulfite generated would be then oxidized by a sulfite oxido reductase (SOR) (3). Sulfate or thiosulfate would be transported to the cytoplasm by a sulfate/thiosulfate binding protein (SBP or P33) (7). OM, outer membrane; PS, periplasmic space; IM, inner membrane

4. CONCLUSIONS 1. We have found three genes coding for rhodanase-like proteins in A. ferrooxidans.

Their genomic context strongly suggests the involvement of these proteins in sulfur metabolim in this bacterium.

2. Protein P14 most likely is a rhodanese. However, due to the lack of an appropriate workable genetic system to perform functional genomics in A. ferrooxidans, at this point it is not possible to assign definitive roles to P14, P16 and P21 in sulfur metabolism in this bacterium.

Sº + H2SO3 FeS2

S2032-

Fe3+

Fe2+

S-SO32-

TD-O3S-S-S-SO3

- + 2e-

-O3S-S-S-SO3- + H2O

TH-O3S-S-S- + SO4

2- +2H+

S-SO32- + 2H2O Sº + H2SO3 + 2OH-

H2SO3 + H2OSOR

SO42- + 2e- + 4H+TST

(P21)SBP(P33) SO4

2-

SO42- S-SO3

2- Cysteinebiosynthesis Synthesis of sulfur oxidation enzymes

(TST, TD, TRX, GTX, CYT, etc.)

OM

PS

Cytosol

P14?

IM

Sº + H2SO3 FeS2

S2032-

Fe3+

Fe2+

S-SO32-

TD-O3S-S-S-SO3

- + 2e-

-O3S-S-S-SO3- + H2O

TH-O3S-S-S- + SO4

2- +2H+

S-SO32- + 2H2O Sº + H2SO3 + 2OH-

H2SO3 + H2OSOR

SO42- + 2e- + 4H+TST

(P21)SBP(P33) SO4

2-

SO42- S-SO3

2- Cysteinebiosynthesis Synthesis of sulfur oxidation enzymes

(TST, TD, TRX, GTX, CYT, etc.)

OM

PS

Cytosol

P14?

IM


1296

AKNOWLEDGEMENTS This work was supported in part by grants from FONDECYT (projects 1000967 and

1030767), and ICM- P99-031-F. P.R. was the recipient of a DAAD Ph.D. scholarship. Preliminary sequence data for the A. ferrooxidans strain 23270 was obtained from The Institute for Genomic Research website at http://www.tigr.org.

REFERENCES 1. A.P. Harrison, Annu. Rev. Microbiol., 38 (1984) 265. 2. D.G. Lundgren, Annu. Rev. Microbiol., 34 (1980) 263. 3. I. Suzuki, Can. J. Microbiol., 45 (1999) 97. 4. A. Schippers and W. Sand, Appl. Environ. Microbiol., 65 (1999) 319. 5. R. Tabita, M. Silver and D.G. Lundgren, Can. J. Biochem., 47 (1969) 1141. 6. M. Silver and D.G. Lundgren, Can. J. Biochem., 46 (1968) 1215. 7. P. Ramírez, H. Toledo, N. Guiliani and C.A. Jerez., Appl. Environ. Microbiol., 68

(2002) 1837. 8. W.K. Ray, G. Zeng, M.B. Potters, A.M. Mansuri and T.J. Larson, J. Bacteriol., 182

(2000) 2277. 9. J. Sambrook and D.W. Russell (eds.), Molecular cloning, A laboratory manual. Cold

Spring Harbor Laboratory Press, New York, 2001. 10. D. R. Singleton and D. W. Smith, Appl. Environ. Microbiol., 54 (1988) 2866. 11. M.N. Gardner and D.E. Rawlings, J. Appl. Microbiol., 89 (2000) 185. 12. S.F. Altschul, T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller and D.L.

Lipman, Nucleic Acids Res., 25 (1997) 3389. 13. C.G. Friedrich, Adv. Microb. Physiol., 39 (1998) 235. 14. B.C. Berks, S.J. Ferguson, J.W.B. Moir and D.J. Richardson, Biochim. Biophys. Acta.,

1232 (1995) 97. 15. Shrihari, S.R. Bhavaraju, J.M. Modak, R. Kumar and K.S. Gandhi, Biotechnol.

Bioeng., 41 (1993) 612. 16. V. Kreis-Kleinschmidt, F. Fahrenholz, E. Kojro, and A. Kröger, Eur. J. Biochem., 227

(1995) 137. 17. A. Spallarossa, J.L. Donahue, T.J. Larson, M. Bolognesi and D. Bordo, Structure, 9

(2001) 1117. 18. E.B. Fauman, J.P. Cogswell, B. Lovejoy, W.J. Rocque, W. Holmes, V.G. Montana, H.

Piwnica-Worms, M.J. Rink and M.A. Saper, Cell 93 (1998) 617. 19. C.W.V. Hogue, Trends Biochem. Sci., 22 (1997) 314. 20. G. Storz and R. Hengge-Aronis (eds.), Bacterial stress responses, ASM Press,

Washington, D.C., 2000.



1297

Integration of metal-resistant determinants from the plasmid of an Acidocella strain into the chromosome of Escherichia coli

DH5α

S. Ghosh*, N.R. Mahapatra*, S. Nandi+ and P.C. Banerjee++

Indian Institute of Chemical Biology, 4 Raja S. C. Mullick Road, Kolkata 700032, India

Abstract Integration of plasmid DNA into the chromosome of Escherichia coli DH5α

conferring Zn2+- and Cd2+-resistance was suggested when the strain was transformed with plasmid DNA preparation from Acidocella sp. strain GS19h [1]. As evidence, pulsed-field gel electrophoresis (PFGE) pattern of genomic DNA of the transformants was observed to differ markedly with that of the untransformed DH5α strain. Further, the recombinant plasmids constructed with plasmid DNA pieces of strain GS19h at BamHI site of pBluescript-II KS+/- when used to transform E. coli DH5α strain, no plasmid DNA was detected in some of the lactose-negative, ampicillin- and zinc-resistant clones. The PFGE pattern of a transformed clone differed from that of the parent strain suggesting chromosomal integration of the recombinant plasmid(s). That the recombinant plasmid DNA(s) containing both the resistant genetic markers was integrated into chromosome of the transformed E. coli strain was reflected from hybridization of chromosomal DNA with the probes made from the plasmid DNA of strain GS19h and the vector DNA.

Keywords: Acidocella strain, plasmid, chromosomal integration, metal resistance, E. coli

1. INTRODUCTION Metal resistance is a plasmid-borne property in many bacterial species [2-4]. This

property of the highly metal-resistant acidophilic heterotrophic bacterium Acidocella sp. strain GS19h was expressed in heterologous Escherichia coli system through transformation with the plasmid preparation from this strain [1]. Since existence of any plasmid in the transformed E. coli cells could not be detected, it was suggested that the metal-resistance conferring plasmid or a part of it was integrated into the E. coli chromosome rendering the transformants metal-resistance phenotype [1]. Integration of self and foreign plasmid DNA in both prokaryotic and eukaryotic microorganisma, viz. E. coli [5], Myxococcus xanthus [6], Streptomyces griseofulvus [7], Vibrio cholarae [8], Saccharomyces cerevisiae [9] and others [10-12] was reported earlier. Moreover, Inagaki

+ Department of Biochemistry, Molecular Biology & Cell Biology, Northwestern University, Evanston, IL 60208, USA ++ Corresponding author - Fax: 91-33-24735197/24730284; Email: [email protected] Present address: *Department of Medicine, University of California at San Diego, San Diego, CA 92161, USA


1298

et al [13] observed gradual disappearance of a 8.8 kb chimeric plasmid that was introduced by electroporation into an Acidocella facilis strain which retained donor’s property indicating chromosomal integration of the recombinant plasmid. However, further experimentation supporting this integration event was not conducted. In this report, we present evidences for such integration of plasmid(s) of Acidocella sp. GS19h strain into the chromosome of E. coli DH5α employing pulsed field gel electrophoresis (PFGE) of the E. coli chromosomal DNA before and after transformation with (i) the plasmids of strain GS19h [1] and (ii) the recombinant DNA molecules containing plasmid DNA fragments of strain GS19h [14].


2.1 Bacterial strains and culture conditions Acidocella sp. strain GS19h, E. coli DH5α and two of its plasmidless, Zn2+-resistant

derivatives were used in this study. One of the Zn2+-resistant derivatives was obtained via transformation of the E. coli strain with plasmids of the Acidocella strain [1]. The other derivative (also resistant to ampicillin) evolved during cloning of putative plasmid-mediated metal-resistant genes of Acidocella in this E. coli strain [14]. Medium and growth conditions of Acidocella sp. strain GS19h have been described [1]. The E. coli strain and its plasmidless derivatives were grown at 37°C on a rotary shaker in LB medium and the same containing either 12-16 mM Zn(SO)4 or 100 µg ml-1 ampicillin, respectively, as indicated in the text.

2.2 Plasmid purification Isolation and purification of plasmid DNA from the Acidocella sp. strain GS19h has

been described [1,15]. The pBluescript-II KS+/- (Strategene) plasmid was either purchased or purified from an E. coli transformant of the same following standard procedure [15]. Electrophoresis of DNA samples was carried out in 0.5-0.8% (w/v) agarose gels. DNA bands were detected by ethidium bromide staining, as usual [16].

2.3 Preparation of chromosomal DNA Chromosomal DNA from bacterial cells was prepared by CTAB method [17]. For

pulsed field gel electrophoresis (PFGE), genomic DNA was prepared in situ in 0.7% (w/v) low melting agarose gel plugs. Cells of logarithmic phase were suspended in 10 mM Tris-HCl (pH 7.6) and 1M NaCl. The suspension was mixed with equal volume of molten 1.4% (w/v) low melting agarose and allowed to set into plugs. The plugs were incubated at 37°C for 16 hr with gentle shaking in lysis solution [18]. The lysis solution was replaced by a solution containing 0.5 M EDTA (pH 9.0), sarkosyl (1%, w/v) and proteinase K (1 mg ml-1), and the incubation was continued at 50°C for 2 days or more until the blocks became transparent [19]. Agarose blocks were then treated with 1mM phenylmethylsulfonylfluoride (PMSF) and washed with TE (10 mM Tris, pH 8.0 and 1 mM EDTA) buffer. The blocks were digested with restriction enzyme for 4-12 hr. Enzyme- digested DNA was separated in 1% (w/v) PFGE-grade agarose gel using 0.5xTAE (20 mM Tris-acetate, pH 8.3 + 0.5 mM EDTA) as the running buffer at 10 Volt/cm and pulses ramping from 5-25 sec for 22 hr using Pulsaphor Plus System with a hexagonal electrode array (Pharmacia).


1299

2.4 Selection of metal-resistant clones from the miniplasmid library Construction of miniplasmid library and selection of lactose-negative, ampicillin- and

zinc-resistant (AmprZnr) E. coli DH5α clones have been described [14]. While some clones carried recombinant plasmid, others did not contain any plasmid indicating chromosomal insertion of resistant determinants. One of the plasmidless clones was selected for this study.

2.5 Hybridization Purified plasmid and chromosomal DNA samples were spotted on nylon membrane,

the latter after digestion with BglII, by dot blotting [20]. The plasmid DNAs were radiolabelled with [α-32

P] dATP by nick translation or random priming. Hybridization was carried out following standard methods [16].

3. RESULTS AND DISCUSSION It was previously suggested that the metal-resistant determinants from the plasmids of

Acidocella sp. strain GS19h were integrated into the chromosome of E. coli DH5α imparting stable metal-resistance characteristics to it [1]. In this event a change in PFGE pattern of the transformed compared to that of the parent E. coli strain should be observed. Figure 1 shows that a lot of changes were introduced into the E. coli DH5α chromosome after transformation supporting the view of plasmid integration into the chromosome of the strain.

Figure 1. Pulsed-field gel electrophoretogram of genomic DNA digested with SfiI. Lane 1, E. coli DH5α; lane 2, Acidocella sp. strain GS19h; lane 3, transformed E. coli DH5α; lane 4, concatameric DNA molecular weight marker

It is also evident from Figure 1 that many new sites for the sequence GGCC(N)5GGCC (for SfiI) were available in transformed E. coli chromosome after partial or full integration of plasmid(s) that conferred metal-resistance in E. coli DH5α. Major changes in the PFGE pattern were also observed (figures not shown) after digestion of the


1300

transformed chromosome with NotI (GC↑GGCCGC), AseI (AT↑TAAT) and XbaI (T↑CTAGA). Such drastic changes in PFGE pattern may occur for two reasons. First, if the metal resistance conferring genes are contained in a composite transposon, and the insertion element components of the same are capable of multiple insertions in the E. coli chromosome; second, due to mutations at multiple locations producing new sites for restriction enzymes and conferring metal-resistance characteristics.

Further, when a plasmidless, Zn2+- and ampicillin-resistant (ZnrAmpr) clone of E. coli DH5α was subjected to PFGE, a lot of difference was detected between the PFGE pattern of the clone and the parent strain (Figure 2). Several new bands appeared in the clone DNA while some original bands were missing in the same. The PFGE patterns also differed when the DNA samples were digested with AseI, NotI and SfiI individually (data not shown). These observations again suggest that plasmid-borne metal resistant determinants of the Acidocella strain can integrate into the chromosome of E. coli DH5α by a RecA independent recombination method.

Figure 2. PFGE profile of genomic DNA digested with XbaI. Lane 1, E. coli DH5α; lane 2, AmprZnr E. coli DH5α clone. Symbols denote some of the specific bands which are present in the respective lanes but are absent in the other lane

The ZnrAmpr E. coli DH5α clone might had acquired its ampicillin-resistance marker from the vector pBluescript-II KS+/-, while the other resistance determinant, i.e. for ZnSO4, might had come from the plasmids of the Acidocella strain. Hybridization of BglII-digested chromosomal DNA of the ZnrAmpr E. coli clone with the plasmid DNA preparation of the Acidocella strain (Figure 3) and pBluescript-II KS+/- (Figure 4) supported the view that partial or full integration of Acidocella plasmid(s) and pBluescript-II KS+/- had occurred into the chromosome of E. coli DH5α during transformation and cloning.


1301

Figure 3. Dot-blot hybridization of DNA samples using plasmid preparation from strain GS19h as probe. Lane 1, plasmid preparation from strain GS19h; lane 2, BglII digested chromosomal DNA of AmprZnr E. coli DH5α clone; lane 3, BglII digested chromosomal DNA of E. coli DH5α. Lanes a and b contained different amount of the same DNA sample

Figure 4. Dot-blot hybridization of DNA samples using pBluescriptII KS+/-. Lane 1, pBluescriptII KS +/- DNA; lane 2, BglII digested chromosomal DNA of E. coli DH5α; lane 3, BglII digested chromosomal DNA of AmprZnr E. coli DH5α clone. Lanes a and b contained different amount of the same DNA sample

This study confirms that plasmids of Acidocella sp. GS19h strain can integrate into the chromosome of E.coli, a bacterium distinctly unrelated to Acidocella in respect of physiology and habitat. This observation leads to interpret that bacteria of this and related genera having similar physiological properties, such as Acidiphilium [21], donate genetic elements to other microorganisms inhabiting the same acidic mine environment [22] enriching their genetic repository to combat metal stress. The chromosomally inherited metal resistance conferring genes of Acidithiobacillus ferrooxidans [23,24], the most widely studied biomining bacterium [25], might probably had come from such extraneous genetic sources like plasmids of Acidocella (or Acidiphilium?) that can integrate even into habitually quite unknown bacterium like E. coli (this article). Although strongly speculative, this wild assumption is supported by the very fact that none of the so many native plasmids of Acidithiobacillus ferrooxidans harbours metal resistant determinants [24,26] although most of its plasmidless or plasmid-bearing strains exhibit metal resistance to different extent depending on the growth conditions [25,27]. Further study on metal resistance conferring genetic elements of these acidophilic heterotrophs may unveil many interesting aspects of bacterial metal resistance and consequent application of these genes in research and biotechnology [28-30].


1302

ACKNOWLEDGEMENTS We are thankful to Late Dr. J. Das, Ex-Director, Dr. R. K. Ghosh and Dr. Rupak

Bhadra, Scientists, Mr. Partha Sarkar, Mr. Chirojyoti Deb and Mr. Amit Chakraborty, Research Fellows, and other staff members of Indian Institute of Chemical Biology for helping us in various ways. Fellowships provided by Council of Scientific and Industrial Research, New Delhi, to S.G., N.R.M. and S.N. are gratefully acknowledged.

REFERENCES 1. S. Ghosh, N. R. Mahapatra and P. C. Banerjee, Appl. Environ. Microbiol., 63 (1997)

4523. 2. J. T. Trevors, K. M. Oddie and B H Belliveau, FEMS Microbiol. Rev., 32 (1985) 39. 3. S. Silver and L. T. Phung, Annu. Rev. Microbiol., 50 (1996) 753. 4. K Suzuki, N Wakao, T Kimura, K Sakka and K. Ohmiya, Appl. Environ. Microbiol.,

64 (1998) 411. 5. R. C. Deonier and N. Davidson, J. Mol. Biol., 107 (1976) 207. 6. A M Breton, S Jaoua and J Guespin-Michel, J. Bacteriol., 161 (1985) 523. 7. J. L. Larson and C. L. Hershberger, Plasmid. 23 (1990) 252. 8. S. Kar, R. K. Ghosh, A. N. Ghosh and A. Ghosh, FEMS Microbiol. Lett., 145 (1996)

17. 9. Α. Sakai, Y. Shimizu and F. Hishinuma, Appl. Microbiol. Biotechnol., 33 (1990) 302. 10. J. Casey, C. Daly and G. F. Fitzgerald, Appl. Environ. Microbiol., 57 (1991) 2677. 11. D. K. Tang, S. Y. Qiao and M. Wu, Biochem. Mol. Biol. Int., 36 (1995) 1025. 12. D. K. Mercer, K. P. Scott, C. M. Melville, L. A. Glover and H. J. Flint, FEMS

Microbiol. Lett., 200 (2001) 163. 13. K. Inagaki, J. Tomono, N. Kishimoto, T. Tano and H. Tanaka, Biosci. Biotechnol.

Biochem., 57 (1993) 1770. 14. S. Ghosh, N. R. Mahapatra and P. C. Banerjee. In: R. Amils and A. Ballester (eds.),

Process Metallurgy 9B: Biohydrometallurgy and the environment toward the mining of the 21st century, Elsevier, Amsterdam, Part B, 1999, p. 21.

15. H. C. Birnboim and J. Doly, Nucleic Acids Res., 7 (1979) 1513. 16. J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular cloning: a laboratory manual,

2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbour, N.Y., 1989. 17. F. M. Ansubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith and

K. Struhl, Current protocols in molecular biology, vol. 1, John Wiley and Sons, New York, 1995.

18. S. Nandi, G. Khetawat, S. Sengupta, R. Majumder, S. Kar, R. K. Bhadra, S. Roychoudhury and J. Das, Int. J. Syst. Bacteriol. 47 (1997) 858.

19. R. Majumdar, S. Sengupta, G. Khetawat, R. K. Bhadra, S. Roychoudhury and J. Das, J. Bacteriol., 178 (1996) 1105.

20. N. J. Dyson. In: T. A. Brown (ed.), Essential molecular biology: a practical approach, vol. II, IRL Press, Oxford, 1993, p.111.

21. N. Kishimoto, Y. Kosako, N. Wakao, T. Tano and A. Hiraishi, Syst. Appl. Microbiol., 18 (1995) 85.

22. B. M. Goebel and E. Stackebrandt, Appl. Environ. Microbiol., 60 (1994) 1614. 23. B. G. Butcher, S. M. Deane and D. E. Rawlings, Appl. Environ. Microbiol.,66 (2000)

1826. 24. D. E. Rawlings and T. Kusano, Microbiol. Rev., 58 (1994) 39. 25. Α.E. Torma, Adv. Biochem. Eng. 6 (1977) 1.


1303

26. T. Shiratori, C. Inoue, M. Numata and T. Kusano, Curr. Microbiol., 23 (1991) 321. 27. S. Bhattacharyya, A. Das, B. K. Chakrabarti and P. C. Banerjee, Folia Microbiol. 37

(1992) 33. 28. D. E. Rawlings and S. Silver, Bio/Technol, 13 (1995) 773. 29. T. Barkay and J. Schaefer, Curr. Opinion Microbiol., 4 (2001) 318. 30. O. P. Dhankher, Y. Li, B. P. Rosen, J. Shi, D. Salt, J. F. Senecoff, N. A. Sashti and R.

B. Meagher, Nature Biotechnol., 20 (2002), 140.



1305

Involvement of Fe2+-dependent mercury volatilization enzyme system in mercury resistance of Acidithiobacillus Ferrooxidans

strain MON-1

Tsuyoshi Sugio1, Mitsuko Fujii1, Fumiaki Takeuchi2, Atsunori Negishi3, Terunobu Maeda4 and Kazuo Kamimura1

1 Graduate School of Natural Science and Technology, Science and Technology for Energy Conversion, Okayama University, Tsushima Naka 1-1-1, Okayama 700-8530

2 Administration Center for Environmental Science and Technology, Okayama University, Tsushima Naka 1-1-1, Okayama 700-8530,

3 Technical Research Institute, Hazama Corporation, 515-1 Nishimukai, Karima, Tsukuba 305-0822,

4 Civil Chemical Engineering Corporation, 3411 Sanuki-machi Ryugasaki 301-0033 Japan

Abstract The mechanism of mercury resistance in the highly mercury resistant strain

Acidithiobacillus ferrooxidans MON-1 was studied by comparing with the moderately mercury resistant A. ferrooxidans strain SUG 2-2. Strain SUG 2-2 grew in a Fe2+ medium containing 6µM Hg2+ with a lag time of 22 days. Eight times successive cultivation of SUG 2-2 in the medium markedly shortened the lag time to 4 days. From this adapted culture, strain SUP-1 was newly isolated as a single colony on a 1.0% gellan gum plate containing ferrous iron. Strain SUP-1 could grow in a Fe2+ medium containing 20µM Hg2+ with the lag time of 10 days. Five times successive cultivation of SUP-1 in a Fe2+ medium containing 20µM Hg2+ shortened the lag time to 4 days. From this adapted culture, strain MON-1 was isolated as a single colony. Strain MON-1 could grow in a Fe2+ medium containing 20µM Hg2+ with the lag time of 2 days. The ability of strain MON-1 to grow rapidly in a Fe2+ medium containing 20µM Hg2+ maintained stably after the strain was cultured many times in a Fe2+ medium without Hg2+. The activities of the enzymes involved mainly in mercury detoxification were compared between strains SUG 2-2 and MON-1. Similar levels of NADPH-dependent mercury reductase activity were observed in cell extracts from strains SUG 2-2 and MON-1. Fe2+-dependent mercury volatilization activity was measured in 20 ml of water acidified with sulfuric acid (pH 2.5) containing resting cells (1.0 mg) and 140 nmol HgCl2 by incubating for 3 hours at 30°C. The amounts of mercury volatilized from the reaction mixture were 4.7 nmol for strain SUG 2-2 and 27 nmol for strain MON-1, respectively. Addition of 100 µmol of ferrous sulfate to the reaction mixture containing MON-1 cells enhanced the level of mercury volatilization activity 2.5 fold. In contrast, a 1.2 fold enhancement was observed in the case of SUG 2-2. These results indicate that a marked enhancement of the Fe2+-dependent mercury volatilization enzyme system conferred strain MON-1 the ability to grow rapidly in a Fe2+ medium containing 20µM Hg2+.


1306

1. INTRODUCTION The iron-oxidizing bacterium, Acidithiobacillus ferrooxidans is an acidophilic

chemolithotrophic bacterium that can use both ferrous iron (Fe2+) and reduced inorganic sulfur compounds as energy sources. The bacterium is one of the most important bacteria for bioleaching of sulfide ores (1-3). A. ferrooxidans strains which possess a high iron-oxidizing activity in an environment with many kinds of and high concentrations of heavy metals are required for microbiological leaching of low grade ores. It has been known that A. ferrooxidans cells are in general resistant to many heavy metals including iron, copper, zinc and nickel, but sensitive to mercury, silver, molybdenum and tungsten (4-10). We have reported the growth inhibition of A. ferrooxidans cells by mercury, silver, molybdenum and tungsten and clarified inhibition sites for these toxic metals (7-11). Toxic metals such as mercury are highly toxic for almost all organisms because they have a strong affinity for thiol groups in proteins (12, 13). The bacteria that are resistant to Hg2+ and/or organomercurial compounds have the ability to volatilize metal mercury (Hg°) from inorganic and organic mercurial compounds (12, 14-16). A wide range of Gram-negative and Gram-positive bacteria has mercury reductases that reduce Hg2+ with NADPH as an electron donor (13, 17-20). A. ferrooxidans cells have mercury reductase activity (9, 21-23) and the genes involved in the volatilization of mercury have been cloned and characterized in detail (21, 24-28).

A. ferrooxidans SUG 2-2 was isolated as a mercury resistant strain among one hundred A. ferrooxidans strains isolated from natural environments (10). Strain SUG 2-2 has an ability to volatilize metal mercury from mercury-polluted wastewater and soil under acidic conditions in the presence of ferrous iron (29-31). We recently showed that A. ferrooxidans SUG 2-2 has not only NADPH-dependent mercury reductase activity but also a Fe2+-dependent mercury reductase activity in the cells (10) and cytochrome c oxidase purified from strain SUG 2-2 volatilizes mercury in the presence of Fe2+ (29). In this study, A. ferrooxidans strain MON-1 that is more resistant to mercuric chloride than strain SUG2-2 was isolated from a culture of SUG 2-2 to study the involvement of the iron oxidation enzyme system in mercury reduction of A. ferrooxidans.


2.1 Microorganisms, medium and growth conditions The iron-oxidizing bacteria used in this study were A. ferrooxidans AP19-3 (32) and

A. ferrooxidans SUG 2-2 (10). Each strain was cultivated at 30°C under aerobic conditions in a Fe2+ medium (pH 2.5) containing 30 g of FeSO4

.7H2O, 3 g of (NH4)2SO4, 0.5 g of K2HPO4, 0.5 g of MgSO4

.7H2O, 0.1 g of KCl and 0.01 g of Ca(NO3)2 per liter The resting cells were prepared as follows. Each strain of iron-oxidizing bacteria was grown in 70 l of Fe2+ medium under aeration for one week. The culture medium was filtered with a Toyo no.2 filter paper to remove the bulk of the ferric precipitates and then centrifuged with a Hitachi 18pR-52 continuous-flow rotor at 15,000 × g and a flow rate of 200 ml/min. Harvested cells were washed three times with 0.1 M β–alanine-SO4

2- buffer (pH 3.0) before use.

2.2 Analysis of mercury volatilized from the culture medium of A. ferrooxidans A 50-ml culture flask with a screw cap contained 19 ml of Fe2+ medium (pH 2.5)

supplemented with 1.0 or 5.0µM Hg2+ and 1 ml of an active seed culture of A. ferrooxidans. A small test tube containing 2 ml of a KMnO4 solution was inserted in the


1307

50-ml culture flask to trap the Hg2+ volatilized form the culture medium. The KMnO4 solution used (100 ml) was composed of a 10-ml solution containing 0.6 g of KMnO4, 5 ml of concentrated H2SO4, and 85 ml of deionized water. After the culture medium was aerated by shaking at 30°C and 100 rpm, the concentration of Hg° trapped in the KMnO4 solution was measured by cold-vapor atomic absorption spectroscopy.

2.3 Mercury reductase activity The reaction mixture (2.5 ml) contained 50 mM sodium phosphate buffer (pH 7.0),

0.5 mM EDTA, 0.2 mM MgSO4.7H2O, 1 mM β-mercaptoethanol, 0.2 mM NADPH, 1.5

mg bovine serum albumin, 0.1 mM HgCl2, and the cytosol prepared from A. ferrooxidans strain SUG 2-2 and MON-1. The cytosol was prepared by centrifugation of a cell extract at 105,000×g for 1 h. After the reaction mixture was incubated at 37°C for 60 min, the reaction was started by the addition of NADPH. The activity was measured by the rate of oxidation of NADPH by monitoring the decrease of absorbance at 340 nm.

2.4 Fe2+-dependent mercury volatilization activity Each of several 50-ml flasks with screw caps contained a reaction mixture plus 2 ml

of a KMnO4 solution described above. The gas phase was air, and the reaction mixture was shaken at 100 rpm at 30°. The reaction mixture used for the measurement of Fe2+-mercury volatilization activity was composed of water acidified with sulfuric acid (20 ml), resting cells of A. ferrooxidans (1 mg of protein), mercuric chloride (0.7-7 µM), and ferrous sulfate (100 µmol). After the reaction mixture was aerated by shaking at 30°C and 100 rpm, the concentration of Hg° trapped in the KMnO4 solution was measured by cold-vapor atomic absorption spectroscopy.

2.5 Protein content Protein content was determined by the method of Lowry et al. (33) with crystalline

bovine serum albumin as the standard.


3.1 Isolation of strain MON-1 from the culture medium of A. ferrooxidans SUG 2-2 The processes to isolate strain MON-1 which is more resistant to mercuric chloride

than the moderately mercury resistant A. ferrooxidans strain SUG 2-2 are shown in Table 1. Growth characteristics of mercury sensitive strain A. ferrooxidans AP19-3 (32) in a Fe2+ medium containing Hg2+ are also shown in the table as a reference. Mercury-sensitive strain AP19-3 cannot grow in a Fe2+ medium containing 0.7 µM Hg2+, but it can grow in Fe2+ medium containing 0.6 µM Hg2+ after a lag time of 24 days. In contrast, moderately mercury resistant strain SUG 2-2 grew in Fe2+ media containing 0.7 and 6µM Hg2+ with a lag time of 1 and 22 days, respectively. Eight times successive cultivations of SUG 2-2 in the medium markedly shortened the lag time to 4 days. From this adapted culture, strain SUP-1 was newly isolated as a single colony on a 1.0% gellan gum plate. Strain SUG 2-2 could not grow in a Fe2+ medium containing 10µM Hg2+. However, strain SUP-1 could grow in a Fe2+ medium containing 20µM Hg2+ with a lag time of 10 days. Five times successive cultivation of SUP-1 in a Fe2+ medium containing 20 µM Hg2+ shortened the lag time to 4 days. From this adapted culture, strain MON-1 was isolated as a single colony on a 1.0% gellan gum plate. Strain MON-1 could grow in a Fe2+ medium containing 20µM with a lag time of 2 days. Strain MON-1 slightly grew in a Fe2+ medium containing 40µM Hg2+, but could not grow in a Fe2+ medium containing 80 µM Hg2+. The


1308

ability of strain MON-1 to grow rapidly in a Fe2+ medium containing 20µM Hg2+ was stably maintained after the strain was cultured successively in a Fe2+ medium without Hg2+.

Table 1. Growth of A. ferrooxidans strains in Fe2+-medium containing mercuric ion

Cultivation time (days) Strain Number of cultivation

times

Con. of Hg2+ (µM) 2 4 6 8 10 12 14 16 18 20 22 24 26 28

AP19-3 1 0.6 - - - - - - - - - - - + ++ +++

AP19-3 1 0.7 - - - - - - - - - - - - - -

SUG 2-2 1 0.7 ++ +++ +++ SUG 2-2 1 6.0 - - - - - - - - - -- + ++ +++ SUG 2-2 8 6.0 - ++ +++ SUG 2-2 1 10 - - - - - - - - - - - - - -

SUP-1 1 20 - - - - + ++ +++

SUP-1 5 20 - +++ +++

MON-1 1 20 - +++ +++ MON-1 1 40 - + ++ +++ MON-1 5 40 - + + ++ MON-1 1 80 - - - - - - - - - - - - - -

3.2 Volatilization of metal mercury from a Fe2+ medium containing 1.0 or 5.0 µM Hg2+ by A. ferrooxidans cells The amounts of mercury volatilized from 20 ml of Fe2+ medium containing 1.0 or 5.0

µM of mercuric chloride were measured (Fig. 1). When cells of strains SUG 2-2 and MON-1 were cultured in a Fe2+ medium containing 1.0 µM of mercuric chloride for 2 days at 30°C, 10 and 19 nmol of mercury were volatilized from the culture medium. In contrast, no mercury was volatilized from the medium containing strain AP19-3 cells. When strains AP19-3, SUG 2-2 and MON-1 cells were cultured in a Fe2+ medium containing 5.0 µM of mercuric chloride for 2 days at 30°C, 0, 5 and 92 nmol of mercury were volatilized from the culture medium, indicating that mercury volatilization activity of strain MON-1 is much higher than that of SUG 2-2.

3.3 NADPH-dependent mercury reductase activity The activities of enzymes that are involved in detoxification of mercuric chloride

were compared between A. ferrooxidans SUG 2-2 and MON-1 cells using cell extracts prepared from the two strains. At first, NADPH-dependent mercury reductase activity was measured by the rate of Hg2+-dependent oxidation of NADPH and NADPH-dependent mercury volatilization activity. Mercury reductase activity measured with oxidation of NADPH increased in proportion to the concentration of cell extracts from strains SUG 2-2 nd MON-1. Similar levels of activities were observed in both strains (Fig. 3A). The activities of NADPH-dependent volatilization of mercury were nearly the same in both strains (Fig. 3B). These results indicate that strains SUG 2-2 and MON-1 have a similar level of NADPH-dependent mercury reductase activity in spite of the difference in mercury resistance.


1309

Hg0

vola

tiliz

ed (n

mol

)

Time ( d )

Hg0

vola

tiliz

ed (n

mol

)

Time ( d )

Hg2+ = 1.0 µ M Hg2+ = 5.0 µ M

Figure 1. Volatilization of metal mercury from a Fe2+ medium containing 1.0 or 5.0 µM Hg2+ by A. ferrooxidans strains AP19-3, SUG 2-2 and MON-1

3.4 Fe2+-dependent mercury volatilization activity We recently showed that A. ferrooxidans SUG 2-2 cells contain has not only

NADPH-dependent mercury reductase activity but also Fe2+-dependent mercury reductase activity and that the latter enzyme system markedly contributes to the mercury volatilization activity of strain SUG 2-2 (10). Fe2+-dependent mercury volatilization activity was measured in 20 ml of water acidified with sulfuric acid (pH 2.5) containing resting cells (1.0 mg) and 140 nmol HgCl2 by incubating for 3 h at 30°. The concentration of Hg2+ in the reaction mixture was 7 µM. The amounts of mercury volatilized from the reaction mixture were 4.7 nmol for strain SUG 2-2 and 27 nmol for strain MON-1, respectively (Fig. 4). Addition of 100 µmol of ferrous sulfate to the reaction mixture containing MON-1 cells enhanced the level of mercury volatilization activity by 2.5 fold. In contrast, an 1.2 fold of enhancement was observed in the case of SUG 2-2. Fe2+- dependent volatilization of mercury was also found in SUG 2-2 cells mg) when incubated in 20 ml of acidic water containing 14 or 100 nmol HgCl2. However, in contrast to strain MON-1, the amount of mercury volatilized from the reaction mixture in the presence of 100 µmol Fe2+ markedly decreased in the presence of 7 µM Hg2+, suggesting that Fe2+-dependent volatilization enzyme system of SUG 2-2 was inhibited by a high concentration of Hg2+. No remarkable enhancement of mercury volatilization was observed between strains SUG 2-2 and MON-1 when 100 µmol of ferrous sulfate was added to the reaction mixture containing 0.7 µM of Hg2+.

The results obtained in this work strongly suggest that marked enhancement of Fe2+-dependent mercury volatilization activity in strain MON-1 cells conferred on the strain the ability to grow rapidly in a Fe2+ medium containing 20µM Hg2+. We recently showed that cytochrome c oxidase purified from A. ferrooxidans strain SUG 2-2 can volatilize mercury using Fe2+ as an electron donor (29) and suggest that cytochrome c oxidase is involved in Fe2+-dependent mercury volatilization in A. ferrooxidans SUG 2-2 cells. Therefore, to further study the Fe2+-dependent mercury volatilization system of A. ferrooxidans strain MON-1 in relation to cell’s mercury resistance, purification and characterization of cytochrome c oxidase from strain MON-1 is now underway.


1310

∆A

340

/min

0 30 60 90 120

0

10

20

30

40

Time (min)

Hg0

vola

tiliz

ed (n

mol

)

SUG 2-2

MON-1

0 0.05 0.1

0

0.001

0.002

0.003

Protein (mg)

SUG 2-2

MON-1

(A) (B)

Figure 3. Mercury reductase activity measured in cell extracts of A. ferrooxidans strains SUG 2-2 and MON-1

0

20

40

60

80

0.7 5 70

20

40

60

80

0.7 5 7

Fe 2+= 0 mM , Fe 2+= 5.0 mM

Hg0

vola

tiliz

ed (n

mol

/3h)

Hg0

vola

tiliz

ed (n

mol

/3h)

Conc. of Hg2+ (∆ ╩M) Conc. of Hg2+ (∆ ╩M)

Strain SUG 2-2 Strain MON-1

Figure 4. Fe2+-dependent mercury volatilization by resting cells of A. ferrooxidans SUG2-2 and MON-1

REFERENCES

1. E. Torma. Adv. Biochem. Eng. 6 (1977) 1. 2. D. G. Lundgren and M. Silver. Ann Rev. Microbiol. 34 (1980) 263. 3. S R. Hutchins, M. S. Davidson, J. A. Brierley and C. L. Brierley. Ann. Rev. microbial.

40 (1986) 311. 4. O. H. Tuovinen, S. I. Niemela and H. G. Gyllenberg. Antonie van Leeuwenhoek 37

(1971) 489. 5. K. Imai, T. Sugio, T. Tsuchida and T. Tano. Agric. Biol. Chem. 39 (1975) 1349. 6. G. J. Olson, W. P. Iverson and F. E. Brinckman. Current Microbiol. 5 (1981) 115. 7. T. Sugio, T. Tano and K. Imai. Agric. Biol. Chem. 45 (1981) 2037. 8. K. Y. Ng, M. Oshima, R. C. Blake II and T. Sugio. Biosci. Biotechnol. Biochem. 61

(1997) 1523. 9. F. Takeuchi, K. Iwahori, K. Kamimura and T. Sugio. J. Biosci. Bioeng. 88 (1999) 387. 10. K. Iwahori, F. Takeuchi, K. Kamimura and T. Sugio. Appl. Environ. Microbiol. 66

(2000) 3823.


1311

11. T. Sugio, H. Kuwano, A. Negishi, T. Maeda, F. Takeuchi and K. Kamimura. Biosci. Biotechnol. Biochem. 65 (2001) 555.

12. J. B. Robinson and O. H. Tuovinen. Microbiol. Rev. 48 (1984) 95. 13. A. Velasco, P. Acebo and N. Flores. Extremophiles. 3 (1999) 35. 14. O. Summer and S. Silver. Ann Rev. Microbiol. 32 (1978) 637. 15. S. Silver and T. K. Misra. Ann Rev. Microbiol. 42 (1988) 717. 16. S. Silver and M. Walderhaug. Microbiol. Rev. 56 (1992) 195. 17. S. Silver and L. T. Pheng. Ann Rev. Microbiol. 50 (1996) 753. 18. J. L. Schottel, A. Mandal, D. Clark, S. Silver and R. W. Hedges. Nature 251 (1974)

335. 19. J. L. Schottel. J. Biol. Chem. 253 (1978) 4341. 20. K. Babich, M. Engle, J. S. Skinner and R. A. Laddaga. Can. J. Microbiol. 37 (1991)

624. 21. G. J. Olson, W. P. Iverson and F. E. Brinckman. Current Microbiol. 5 (1981) 115. 22. G. J. Olson, and F. D. Porter. J. Bacteriol. 151 (1982) 1230. 23. J. E. Booth and J. W. Williams. J. Gen. Microbiol. 130 (1984) 725. 24. D. G. Rawlings and T. Kusano. Microbiol. Rev. 58 (1994)39. 25. T. Kusano, G. Ji, C. Inoue and S. Silver. J. Bacteriol. 172 (1990) 2688. 26. Inoue, K. Sugawara, T. Shiratori, T. Kusano and Y. Kitagawa. Gene 84 (1989) 47. 27. Inoue, K Sugawara and T. Kusano. Gene 96 (1990) 115. 28. Inoue, T. Kusano and M. Silver. Biosci. Biotech. Biochem. 60 (1996) 1289. 29. T. Sugio, K. Iwahori, F. Takeuchi, A. Negishi, T. Maeda and K. Kamimura. J. Biosci.

Bioeng. 92 (2001) 44. 30. Takeuchi, K. Iwahori, K. Kamimura, A. Negishi, T. Maeda and T. Sugio. Biosci.

Biotechnol. Biochem. 65 (2001) 1981. 31. Takeuchi, A. Negishi, T. Maeda, K. Kamimura and T. Sugio. J. Biosci. Bioeng. (2003)

in press 32. S. Sugio, W. Mizunashi, K. Inagaki, and T. Tano. J. Bacteriol. 169 (1987) 4916. 33. O. H. Lowry, N. J. Rosebrough, A.L. Farr and R. J. Randall. J. Biol. Chem. 193 (1951)

265.

1312



1313

Microbial diversity of various metal-sulphides bioleaching cultures grown under different operating conditions using 16S-

rDNA analysis

P. d’Hugues, F. Battaglia-Brunet, M. Clarens and D. Morin

BRGM, 3 Av. Claude Guillemin, BP 6009 45060 Orléans Cedex 2, France

Abstract

The microbial diversity of various metal sulphides bioleaching cultures was studied using the Single-Strand Conformation Polymorphism (SSCP) technique. Two sets of SSCP analyses were carried out on microbial populations subcultured at laboratory scale on five sulphidic substrates. The SSCP technique was also used to study a population grown on a cobaltiferous pyrite in different operating conditions (laboratory, pilot and industrial scales, batch and continuous modes, air-lift reactor and mechanically-agitated reactors). The 16S rDNA sequencing of the predominant organisms (seven strains out of eleven) revealed the presence of organisms, respectively affiliated to Leptospirillum ferrooxidans (two strains), Acidithiobacillus caldus, Acidithiobacillus thiooxidans, Acidithiobacillus ferrooxidans, Sulfobacillus thermosulfidooxidans and Sulfobacillus montserratensis.

Whichever sulphide substrate used, organisms related to L. ferrooxidans and A. thiooxidans were always present amongst a microbial diversity of 2 to 7 bacterial strains. Depending on culture conditions or mineral characteristics, the occurrences of A. ferrooxidans, A. caldus, S. thermosulfidooxidans and S. montserratensis were more variable. In laboratory batch tests with pyrite, A. thiooxidans was significantly present at the beginning of the tests. Nevertheless, L. ferrooxidans-like organisms always appeared as the major contributor to the bioleaching efficiency, especially at industrial scale. The analysis of the biodiversity showed that the industrial culture contained strains that were also present in the cultures used for process development study. This work demonstrated that SSCP technique is a very convenient and reliable technique to monitor bioleaching populations.

Keywords: bioleaching, biodiversity, SSCP, 16S rDNA

1. INTRODUCTION Although bioleaching and biooxidation processes are an industrial reality,

considerable work remains to be carried out on microbial ecology of these systems. Characterisation of mixed bacterial populations by classical microbiological methods has been limited due to the difficulties in plating, isolating and enumerating individual species and strains [1].


1314

During the last decade, breakthrough in investigating microbial ecology was mainly achieved thanks to advances in molecular biology and phylogeny techniques [2,3]. Molecular tools developed to study microbial communities are essentially based on detection and analysis of 16S rDNA molecules [4,5]. Some of these molecular biology approaches were implemented in order to study iron- and sulphur- oxidisers from acidic mineral leaching environment. Goebel and Stackebrandt [1] published 16S rRNA sequence analysis of 33 strains of acidophilic bacteria obtained from both, acidic runoffs and laboratory scale bioreactors (batch and continuous-flow). The 16S-23S rDNA intergenic spacing method was used on a copper heap leaching system [6]. A PCR-based technique, using selected primers based on published 16S rRNA sequences, was implemented on a microbial population obtained from a silver-catalysed bioleaching column for chalcopyrite [7]. The bacteria present in commercial-scale biooxidation tanks, running to pre-treat gold-bearing arsenopyrite concentrate, were determined by implementing restriction enzyme patterns analysis [8]. Microbial populations, involved in the generation of acid mine drainage at Iron Mountain (California) were extensively studied by researchers of the University of Wisconsin using both clone-library generation using PCR and taxon specific hybridisation probes [9]. In 2002, BRGM published work for the monitoring of bioleaching operations using a recently developed PCR-based method, the Single-Strand Conformation Polymorphism (SSCP) technique [10]. It was applied on bioleached pulps sampled from two types of bioreactors, a bubble column and a mechanically stirred reactor.

These various studies have provided new insights into microbial ecology of acidic mineral leaching environment. It was demonstrated that Acidithiobacillus ferrooxidans (previously Thiobacillus ferrooxidans) was not the main catalyst in biomining processes and AMD production. Other organisms involved in sulphide oxidation were gradually identified and studied: Leptospirillum ferrooxidans, Acithiobacillus thiooxidans, Acithiobacillus caldus, Sulfobacillus thermosulfidooxidans and Acidiphilium cryptum.

The objective of the work presented in this paper was to investigate and compare the microbial diversity of various bioleaching cultures: (i) on 5 different mineral sulphide concentrates, and (ii) on a cobaltiferous pyrite in function of operating conditions (from laboratory scale up to industrial scale – Kasese Cobalt Company, KCC industrial plant located in Uganda). The originality of BRGM's studies lies on the implementation, for bioleaching samples, of the recently developed SSCP technique. The originality is also linked on the specific monitoring of identified bacterial strains in function of changes in operating conditions and on the first bioleaching industrial plant for base-metal recovery.

2. MATERIAL AND METHODS

2.1 Bacterial inocula description The bacterial population was originally obtained from an enrichment culture of mine

waters sampled by BRGM on a mining site, 15 years ago. Collinet-Latil [11] isolated strains of Thiobacillus ferrooxidans and Thiobacillus thiooxidans from this population. This first culture was then used as an inoculum for various studies carried out at BRGM on sulphide minerals (1 pyrite, 2 types of arsenopyrite, 1 chalcopyrite and 1 sphalerite). When these studies were achieved, the culture was maintained active by subculturing on the corresponding substrate.

The same inoculum was used at the beginning of the "KCC Project". For this project, bioleaching of a cobaltiferous pyrite was studied in batch tests at laboratory scale and in


1315

continuous operations with agitated tank reactors from 80 litres to 65m3 [12,13]. During continuous-bioleaching experiments, Leptospirillum-like bacteria associated with the initial rod-shape bacterial population were identified [14,15]. A culture originating from BRGM was used as the inoculum of the industrial operation that started on site in Uganda in 1998.

2.2 Description of the cultures used for SSCP studies Batch experiments were performed in (i) air-lift tubes of 200-ml effective capacity

[16] (ii) a 22-litre mechanically stirred reactor [13], (iii) a 17-litre suspended solid bubble column [17]. The industrial samples were collected on site in 1,350 m3 stirred reactors running in continuous mode. The description of the various tests carried out is presented in Table 1. For the bioleaching experiment carried out at BRGM, 0Km [12,13] media was used and contained in g.l-1 (NH4)2SO4 (3.7), H3PO4 (0.8), MgSO4,7H2O (0.52), KOH (0.48). The composition of the industrial medium was very similar in N, P, and K concentrations but composed of fertilisers at industrial grades. The initial pH of batch culture was 2, and maintained above 1.1 in 20-litre reactors. It ranged from approximately 1.5 to 1.7 in industrial scale reactors. The temperature was maintained at 35°C for BRGM experiments and 40°C in the industrial reactors. The solids concentration (w/w) was 10% for the batch test in air-lift tubes and 20% for the other tests at larger scale.

Table 1. Description of the bioleaching cultures used for SSCP analysis Culture

identification Operating system Sulphide substrate Test identification

Batch No1 CHES-Cu Air-lift tube (200 ml) Chalcopyrite concentrate (Cu 28%) Batch No2 Batch No1 CHES-Zn Air-lift tube (200 ml) Sphalerite concentrate (Zn 59%) Batch No2 Batch No1 SALS Air-lift tube (200 ml) Arsenopyrite (55%), Pyrite (20%) Batch No2 Batch No1 NIEJDA Air-lift tube (200 ml) Arsenopyrite (27%), Pyrite (26%) Batch No2 Batch No1 KCC - AL Air-lift tube (200 ml) Pyrite (80%) Batch No2 Batch No1 Batch No2 KCC - SSBC Suspended-solids

bubble column (25 l) Pyrite (80%) Batch No3

Inoculum (2 L) KCC - MAR Mechanically agitated reactor Pyrite (80%) BatchNo 2 (20 L)

KCC - Bioco Industrial stirred reactor (1350 m3) Pyrite (80%)

Continuous mode3 Primary tanks and 1 secondary

tank

Two sets of SSCP analyses were carried out on microbial populations subcultured at laboratory scale on five sulphide concentrates. The second SSCP analysis was carried out after a six-month subculturing period on each respective substrate. In all cases, the sampling was carried out at the end of the culture after 11 days. The SSCP technique was also used to study a population grown on a cobaltiferous pyrite in different operating conditions (laboratory, pilot and industrial scales, batch and continuous modes, air-lift reactor and mechanically agitated reactors).


1316

2.3 Microbial communities analysis The strategy of the microbial diversity analysis comprised two parts with a first and

common step being the extraction and purification of total genomic DNA of each sample tested. The details concerning the various experimental protocols used in this study were published previously [10]. They can be summarised as follows. The first part was based on the SSCP fingerprinting method and relies on the different electrophoretic mobility (in non-denaturing gel) of single strand DNA molecules according to the difference in their secondary structure. Thus, DNA fragments of the same size but with a single base modification can be separated. The SSCP-PCR amplification and SSCP electrophoresis of amplified target DNA (variable region V3 of 16S rRNA gene) was carried out. Proportions of each amplified V3 region (peak) on sample SSCP profiles varied during SSCP monitoring. The relative height of the peaks obtained was likened to the proportion of DNA from each species present in the PCR product. As it is known that potential biases can arise from DNA extraction, PCR amplification and 16S rDNA gene copy number, several DNA extractions and SSCP analyses were performed on the same bioleaching sample. Those showed good reproducibility in the ratio between specific peak heights. The second part was based on the 16S rDNA inventory of the population after screening, sequencing and identification of clones. The screening of clones to be used for total 16S rDNA sequence analysis was carried out using both restriction fragment length polymorphism technique (RFLP) and individual SSCP pattern. In order to assign peaks on SSCP patterns of a bacterial community, the V3 region of the different OTUs (Operational Taxonomic Unit) of the selected clones was also analysed by SSCP. The identification of SSCP peaks was realised thanks to the sequencing of the corresponding clones. The total sequence of 16S rDNA was used for sequence analysis. Sequences were compared with sequences available in databases (GenBank and RDP). The nucleotide sequence data reported in this work will appear in the GenBank nucleotide database under accession numbers AF460981 to AF460987.


3.1 Inventory of the bioleaching populations The first inventory of a BRGM bioleaching culture was performed using a sample

from an inoculum (prepared in a 2-litre mechanically agitated reactor)[10]. The other inventories were performed on the following bioleaching cultures when SSCP patterns revealed the presence of an unidentified representative peak. The results of the 4 inventory tests carried out are presented in Table 2. The different clones identified are classified in function of their electrophoretic mobility. Thanks to these inventory studies, 7 peaks out of the 11 peaks observed on the various SSCP tests could be assigned to 1 OTU (representing 1 bacterial strain represented by 1 clone).

Two peaks with different electrophoretic mobilities were found in SSCP patterns of the first sample tested by SSCP. A total of 53 clones were then screened by restriction fragment length polymorphism technique (RFLP) using HaeIII. Two RFLP patterns were found, 47 clones corresponded to one pattern and 6 to the other. Two clones, one for each pattern, were tested by individual SSCP. The two different OTUs represented by clones K01 and K13 showed an electrophoretic mobility that could be assigned to the two SSCP peaks observed in the sample. 16S rDNA sequences of K01 and K13 were compared to referenced sequences from Genbank and RDP. For K01, the closest 16S rDNA sequences were uncultivated bacteria from natural acidic environments (clone OS7) and L.


1317

ferrooxidans strain C-Lf30A. The closest sequences for K13 were the uncultured Acidithiobacillus sp. V1 and A. thiooxidans KCTC 8929P.

A third strain, not detected in the initial inoculum, was revealed by SSCP and identified from DNA extracted in the last sample of test KCC-SSCB (Batch No1). Clone K55, with an SSCP mobility corresponding to the unidentified bacterium, had a 16S rDNA sequence closely related to the uncultured bacterium detected in samples (BU138) from acid mine environments. The most similar 16S rDNA sequence of isolated organism diverged from more than 3% from clone K55 and was identified as S. thermosulfidooxidans str. AT-1 (DSM 9293).

When applied on industrial samples, SSCP patterns revealed the presence of 3 unidentified peaks. According to the semi-quantitative approach, one peak present in all samples probably corresponded to the major organism of the industrial samples. The SSCP mobility of the corresponding selected clone (KCC-IND) was very closely related to the one of K01 (1% divergence), identified as closely affiliated to L. ferrooxidans. The closest related 16S rDNA sequence was the one of L. ferrooxidans strain C-Lf30A.

The SSCP tests carried out on the laboratory scale cultures grown on various substrates showed SSCP patterns with 3 peaks sometimes observed as related to major organisms in the samples but that could not be assigned to any of the already identified clones. Clones corresponding to these unidentified 16S rDNA sequences were obtained from DNA extracted in the more appropriate cultures. Total 16S rDNA sequences of 3 representative clones, P3-5, P5-10 and P6-2, showed that there were respectively closely related to S. montserratensis, A. caldus and A. ferrooxidans.

Table 2. SSCP peaks identification

SSCP Peak identification

Culture and inventory

identification

Clone for SSCP-Peak assignation

Genbank Accession Number

Closest related clone and/or identified species

(% divergence) Uncultured bacterium BU138 -

(0.2%) Peak no 3 (S.t)

KCC-SSBC (inventory

n°2) K55 AF46098

4 S. thermosulfidooxidans str. AT-1 (DSM 9293) - (3.3%)

Peak No 4 (Sm)

NIEJDA (inventory

n°4) P3-5 AF46098

5 S. montserratensis L15 - (0.9%)

Peak No 5 (Lf-1)

KCC-IND (inventory

n°3) KCC-IND None L. ferrooxidans str. C-Lf30A (DSM

9468) - (0.4%)

Clone OS7 - (0.2%) Peak No 6

(Lf-2)

KCC-MAR (inventory

n°1) K01 AF46098

1 L. ferrooxidans str. C-Lf30A (DSM 9468) - (0.4%)

Peak No 8 (A.c)

CHES-Zn (inventory

n°4) P5-10 AF46098

6 A. caldus KU DSM8584 - (0.2%)

Uncultured Acidithiobacillus sp. V1 - (2.6%) Peak No 9

(At)

KCC-MAR (inventory

n°1) K13 AF46098

3 A. thiooxidans KCTC 8929P - (2.9%)

Peak No 10 (A.f)

SALS (inventory

n°4) P6-2 AF46098

7 A. ferrooxidans NFe4 (0.3%)


1318

3.2 Influence of sulphide substrates on microbial biodiversity The SSCP patterns observed on the various bioleaching cultures revealed the presence

of 9 different peaks that can be associated to the presence of 9 different bacterial strains (Table 3). The assignment of SSCP peaks to their respective 16S rDNA sequences was carried out for 5 of them. All SSCP patterns carried out on the first set of tests and some of them for the second set of tests were doubled (from the extraction step) and showed a good reproducibility in the ratio between specific peak heights (data not shown). The identification of SSCP peaks was undertaken if they were present in large proportion in any of the samples tested or if they were widely present in the samples.

Table 3. SSCP patterns for cultures carried out on 5 different sulphide concentrates

SSCP peaks identification (%) 1 2 3 4 5 6 7 8 9 10 11 Culture Test pH S.t S.m Lf.1 Lf.2 A.c A.t A.f

AL1 1.28 4 1 29 25 40 1 CHES-Cu

AL2 1.34 4 37 16 43

AL1 1.48 4 4 34 57 1 CHES-Zn

AL2 1.53 25 31 44

AL1 1.75 1 1 22 76 SALS

AL2 1.93 1 22 2 75

AL1 1.15 4 1 33 9 1 52 NIEJDA

AL2 0.9 2 81 17

AL1 1.10 12 2 45 2 38 1 KCC-AL

AL2 0.8 12 79 9

The SSCP peaks No 5 and No 9 were present in all cultures and corresponded

respectively to clones KCC-IND (closely related to L. ferrooxidans) and K13 (closely related to A. thiooxidans). The proportion of clone P3-5 (peak No 4, closely related to S. montserratensis) was important on the first batch test with concentrate Niejda (pyrite-arsenopyrite), but disappeared from SSCP pattern after 6 months of subculturing. It seems that it was essentially replaced by an important development of clone KCC-IND. Clone P5-10 (peak No 8, closely related to A. caldus) was only present on chalcopyrite and sphalerite concentrates and remained present after 6 months of subculturing. Clone P6-2 (Peak No 10, closely related to A. ferrooxidans) was one of the major organisms of the culture on arsenopyrite (Sals), but disappeared from SSCP pattern after 6 months of subculturing.

When looking at the 10 SSCP patterns carried out on the 5 substrates, the presence of a maximum of 6 strains and of a minimum of 3 strains can be observed. According to the semi-quantitative information given by the peak height, 2 or 3 bacterial strains seemed predominant in the culture, while the others occuring in very small proportions. The 2 SSCP patterns carried out on both on chalcopyrite and sphalerite demonstrated a good stability of the culture composition for the predominant organisms. The composition of cultures grown on the 2 arsenopyrite concentrates was different. For the same concentrate, they were also unstable when the SSCP patterns were compared after 6 months of subculturing. The difference of composition between the 2 arsenopyrite concentrates can


1319

be related to the presence of carbonate in one of them with a direct effect on pH trend. With a pH maintained above 1.7, the presence of an organism affiliated to A. ferrooxidans could be observed. The presence of this organism was not stable throughout the test. It seemed to be more or less replaced by an organism related to S. montserratensis. With the second arsenopyrite concentrate, a significant decrease of pH was always observed. The organisms related to S. montserratensis disappeared from SSCP patterns between the two batch tests. It was replaced in the second test, where the pH dropped below 1, by the emergence of an organism related to L. ferrooxidans. Below pH 1, the organism related to L. ferrooxidans seemed also to become predominant to the detriment of the organism related to A. thiooxidans. This result is particularly marked on the SSCP patterns carried out on KCC pyrite concentrate.

3.3 Influence of operating conditions on microbial biodiversity SSCP technique was used to study the changes in composition of a bacterial mixed

culture grown on the KCC sulphide concentrate under different operating conditions (Table 4). The results obtained in small-scale air-lift tubes (presented in the previous chapter) were obtained from samples collected at the end of the culture. In order to study the evolution of the bacterial consortium during batch oxidation, the same approach was implemented on pulp samples collected during the whole length of batch cultures.

Table 4. SSCP patterns on bioleaching cultures carried out on KCC concentrate

Test description SSCP peak proportions (%) SSBC Batch No1 1 2 3 4 5 6 7 8 9 10 11

Inoculum 0 100 0 8 days 15 49 36

15 days 20 61 19 21 days 18 74 8

23 days (inoculum batch 2) 22 74 4 SSBC Batch No2 1 2 3 4 5 6 7 8 9 10 11

7 days 2 35 63 17 days 37 49 14

MAR Batch No2 1 2 3 4 5 6 7 8 9 10 11 7 days 1 47 52

17 days 9 86 5 20 days (inoculum SSBC 100 0

SSBC Batch No3 1 2 3 4 5 6 7 8 9 10 11 12 days 75 25 19 days 86 14

KCC Industrial reactors 1 2 3 4 5 6 7 8 9 10 11 4 96 0 Bioco primary reactors -

Sampling Campaign 1 6 94 0 4 93 3 Bioco primary reactors -

Sampling Campaign 2 3 94 3 4 2 94 Bioco primary reactors -

Sampling Campaign 3 5 5 90 8 90 3 Bioco secondary reactor

Sampling Campaign 1 6 86 6 2


1320

When compared with results obtained in air-lift tubes, the SSCP patterns obtained from cultures carried out in larger devices (20 litres - 25 litres) showed 1 common SSCP peak and 2 different ones. Peak No 9, associated to the K13 clone (A. thiooxidans-like organism) is still widely represented. In contrast, peaks No 6 and No 3 were not present in SSCP patterns carried out on KCC cultures in air-lift tubes. The main differences between the two types of tests were solids concentration and agitation-aeration system. Both pH trend evolution and temperature were comparable.

The study of the bioleaching community dynamics showed that whereas L. ferrooxidans-like organism (K01) and A. thiooxidans-like organism (K13) were both almost equally represented in the first days of the culture, L. ferrooxidans-like organism became the predominant organism towards the end of the bioleaching process. In contrast to K01 and K13, the behaviour of K55 (Sulfobacillus-related organism) was significantly different from one test to another. Thus, K55 was not detected during the last batch test using the SSCB. However, SSCP monitoring revealed that the development of K55 was favoured in the column bioreactor as compared to the mechanically stirred reactor (batch 2 carried out in parallel with the same inoculum). The proportion of K55 usually increased at the end of the test. Using the same PCR-SSCP approach, a more detailed analysis was carried out on the same samples to determine the proportions of each organism attached on the solid particles or freely suspended in the medium [10]. In the liquid, the A. thiooxidans-related bacteria were dominant during the early phase of the batch, then supplanted by the L. ferrooxidans related bacteria. L. ferrooxidans related organisms were always in the majority on the solids. S. thermosulfidooxidans-related bacteria generally occurred more on the solids than in free suspension in the liquid phase. Whatever the changes in population composition and the changes in operating condition (reactor type, air flow-rate and inoculum) it is important to note that the pyrite oxidation kinetics were not significantly affected [17].

For this study, some samples had been also collected in the industrial KCC bioreactors. The temperature was 40°C on average and the pH maintained between 1.5 and 1.9 by limestone addition. The SSCP patterns showed the presence of 6 distinctive peaks. They were all present in BRGM laboratory scale studies, and not only on KCC pyrite cultures. L. ferrooxidans-like organism corresponding to peak No 5, seemed to be always the largely dominant organism of the industrial culture, both in the primary and secondary stages. Surprisingly, this peak No 5 was detected in all BRGM air-lift tests, including the one on KCC pyrite but absent from the batch tests carried out both in mechanically agitated reactor and column reactor. All the other organisms present in the industrial culture represented a very small proportion of the total population. Organisms corresponding to peak No 1 and peak No 2 could not be identified by a corresponding clone sequence analysis. Peak No 3 corresponding to clone K55 (Sulfobacillus - like organism) was also detected on KCC cultures carried out both in mechanically agitated reactor and column reactor. Peak No 8 assigned to an OTU corresponding to an A. caldus-like organism was largely present in chalcopyrite and sphalerite samples. Peak No 9 corresponding to an A. thiooxidans-like organism was present in all samples tested by SSCP.

3.4 Discussion on microbial diversity in bioleaching The 16S rDNA sequencing of the predominant organisms (seven strains out of eleven)

detected by the SSCP analysis, revealed the presence of organisms closely related to L. ferrooxidans (two strains), A. caldus, A. thiooxidans, A. ferrooxidans, S. thermosulfidooxidans and S. montserratensis. Considering that these tests were undertaken


1321

on 5 different sulphide concentrates, the important biodiversity of BRGM cultures was not really surprising. On the other hand, the presence of the same representative strains was more surprising. It can be assumed that through out the different subculturing and tests carried out, the composition of the original inoculum changed by crossed contamination and selection of the more appropriate strains which where naturally present in the original sulphide substrates tested. This result is important for the question highlighted in a recent review on the importance of microbial ecology in the development of new mineral technologies [2]. Is the acidophilic population responsible for mineral oxidation in industrial bioleaching operation the one, which are originally associated with the mineral deposit itself? From the test carried out on KCC industrial operation, it was shown that the industrial population was composed of microorganisms that were also present in laboratory scale cultures on different concentrates. As biodiversity assessment on the KCC deposit itself would required extensive studies, it was not possible at that stage to determine whether some of them were initially present on KCC concentrate and established themselves on other concentrates or conversely. The presence of similar strains in industrial and laboratory scale cultures gives sense to any extended process optimisation studies carried out prior to the implementation by the extractive mineral industry. Nevertheless, when the same substrate is treated in similar conditions by batch or continuous culture, the differences in terms of maximum oxidation rate are always significant. On KCC project, the gain by running continuous bioleaching was evaluated to a minimum of 30%. It shows the importance of running continuous bioleaching tests when the objective is to evaluate performances in view of an application to real scale. The difference in oxidation rates between batch and continuous cultures might be related to the difference of composition and dynamics of the bioleaching populations.

SSCP tests carried out in this study on batch cultures showed that both Acidithiobacillus-like organisms and Leptospirillum-like organisms coexisted during the sulphides oxidation process. When looking at their presence as pyrite oxidation progressed, an increasing contribution of Leptospirillum-like organisms was observed. In industrial continuous culture, Leptospirillum-like organisms were the dominant organism. Other authors already observed this phenomenon on industrial units for arsenopyrite concentrate biooxidation [3]. The predominance of Leptospirillum-like organisms over both A. thiooxidans and A. caldus in industrial cultures or at the end of the bioleaching process is surprising as they apparently do not compete for the same substrate. L. ferrooxidans-like organism was also found as the major solid coloniser on pyrite, where as sulphur-oxidizing Acidithiobacillus-like organisms are less represented on the solids fraction [10]. From these various observations on microbial community, it could be assumed that pyrite oxidation mainly results from an indirect oxidation by ferric iron, located at the interface between the pyrite surface and the attached Leptospirillum-like organisms. The role of Leptospirillum-like organism would be the subsequent re-oxidation of ferrous iron produced by pyrite oxidation. The development of A. thiooxidans or A. caldus would be of less (if not any) importance on the bioleaching efficiency. These two organisms would grow thanks to the elemental sulphur and the reduced sulphur compounds produced by the Leptospirillum sp. driven pyrite oxidation. Then, the question of whether or not their presence is of any importance on sulphide oxidation can be asked, especially when looking at industrial scale SSCP patterns where they were sometime not even detectable. In batch tests, the relatively smooth selective pressure would have, as a consequence, the development of both Leptospirillum-like organisms, the indirect but only pyrite oxidisers and of organisms able to use the products of the pyrite oxidation. At the end of a batch test or in continuous culture condition, with higher selective pressures, Leptospirillum-like organisms, the only adapted to the main substrate (ferrous iron from


1322

pyrite oxidation) would then outgrow the sulphur oxidisers. If this statement was confirmed, then the question of another acid production mechanism and elemental sulphur transformation (no accumulation of S° was observed in industrial scale reactors) would have to be considered. The idea of Leptospirillum-like organism as the only pyrite oxidiser by indirect mechanism makes sense when looking at pyrite-bearing sulphides. The oxidation mechanisms of chalcopyrite and sphalerite type of concentrates might be comparable. The development of A. thiooxidans or A. caldus would be a consequence of a prior oxidation process by an iron oxidiser.

The presence of members of the genus Sulfobacillus in the various cultures appeared as more uncertain. As they can oxidise either reduced sulphur compounds or ferrous, S. thermosulfidooxidans and S. montserratensis could be competing with both, A. thiooxidans and A. caldus, for sulphur and with L. ferrooxidans and A. ferrooxidans, for ferrous iron. However, experimental data on both pyrite and arsenopyrite suggested that Sulfobacillus-like organisms were more in competition with iron oxidisers than with sulphur oxidisers. On pyrite, the development of Leptospirillum-like organism to the detriment of S. thermosulfidiooxidans-like bacteria seemed to be related to a better resistance to more constraining agitation-aeration operating conditions. At laboratory scale, in air-lift tube, the development of Leptospirillum-like organism to the detriment of S. thermosulfidiooxidans-related bacteria seemed to be related to its ability to grow in very acidic (pH below 1) environment.

4. CONCLUSION The use of molecular biology tools, such as SSCP, are beneficial for both ecological

and industry-focused research into acidophilic microbiology, i.e.: (i) academic work on sulphide oxidation mechanisms and microbial interactions; and (ii) bioleaching processes studies from laboratory scale development up to monitoring of industrial operation. A more specific monitoring of iron and sulphur oxidising populations helps for the debate still open on the respective importance of direct and indirect mechanisms in the oxidation of sulphide minerals. The molecular techniques provide new insights on microbial interaction phenomena occurring within a consortium. More information will be then available to understand whether mixed populations are really more efficient than corresponding pure cultures. It will be also possible to determine whether microorganisms responsible for mineral oxidation in industrial bioleaching operations are those associated with the mineral deposit (endemic strains) or/and those used at laboratory-scale for process development steps. This phenomenon, like the difference observed on population dynamics between batch or continuous cultures is of great importance when implementing process development studies. In the future, a possible design of specific microbial consortia could be envisaged thanks to a better knowledge of acidophilic environments.

Even though the first tests using different molecular biology approaches led to quite promising, reproducible and coherent results, the work to be carried out on the ecology of iron- and sulphur- oxidisers remains considerable. First of all, because whatever the technique chosen, they always generate a panel of bias [4,5,9]. Studies of population sampled in similar environments have to be crosschecked with different techniques in order to establish a reliable picture of the reality. Furthermore, whereas numerous studies on the ecology of these systems were focused on the identification of the various strains present, only a few of them took into account the microbial population dynamics.


1323

ACKNOWLEDGEMENTS This paper is published with the permission of BRGM as scientific contribution

No.02499.

REFERENCES 1. Goebel, M.B. and Stackebrandt, E., Appl. Environ. Microbiol., 60, (1994), 1614. 2. Johnson D.B., Hydrometallurgy, 59, (1999), 147. 3. Rawling, D.E., Tributsh, H. and Hansford G.S., Microbiology, 145, (1999), 5. 4. Head, I.M., Saunders, J.R. and Pickup, R.W., Microbial Ecology, 35, (1998), 1. 5. Dabert, P., Delgenès, J.P., Moletta, R. and Godon J.J., Re/Views in Environmental

Science & Technology 1, (2002), 39. 6. Pizzaro J, Jedlicki E, Orellana O, Romero J, Espejo RT, Appl Environ Microbiol 62,

(1996), 1323. 7. De Wulf-Durand P, Bryant LJ, Sly L.I., Appl. Environ. Microbiol. 63, (1997) 2944. 8. Rawling, D.E., Biohydrometallurgical Processing, Volume II, University of Chili,

(1995), 9. 9. Edwards, K.J., Goebel, B.M., Rodgers, T.R., Schrenk, M.O., Gihring, T.M., Cardona,

M.C., Hu, B., McGuire, M.M., Hamers, R.J., Pace, N.R., Banfield, J.F, Geomicrobiology Journal, (1999), 16, 155.

10. Battaglia-Brunet, F., Clarens, M., d’Hugues, P., Godon, J.J., Foucher, S., and Morin, D., Appl. Microbiol. Biotechnol., 60, (2002), 206.

11. Collinet-Latil M.N., Morin D., Antonie van Leeuwenhoek 57, (1990), 237. 12. Morin, D., Ollivier, P., and Hau, J.M., Waste Processing and Recycling in Mineral and

Metallurgical Industries, II, The Canadian Institute of Mining, Metallurgy and Petroleum (1995), 23.

13. d'Hugues P., Cézac P., Cabral T., Battaglia F., Truong-Meyer X.M. and Morin D., Minerals Engineering, Vol. 10, n° 5 (1997), 507.

14. Battaglia, F., Morin, D., Garcia, J.L., and Ollivier, P., Antonie Van Leeuwenhoek 66, (1994) 295.

15. Battaglia-Brunet F., d'Hugues P., Cabral T., Cézac P., Garcia J.L. and Morin D., Minerals Engineering, Vol. 11, n°2, (1998) 195.

16. Battaglia, F., Morin, D., and Ollivier, P., J. Biotechnol. 32, (1994) 11. 17. Foucher, S., Battaglia-Brunet, F., d'Hugues, P., Clarens, M., Godon, J.J., and Morin,

D., Biohydrometallurgy: Fundamentals, Technology and Sustainable Development, Part A, Elsevier, (2001), 3.



1325

Molecular ecology of the Tinto River, an extreme acidic environment from the Iberian Prytic Belt

E. González-Torila, E. Llobet-Brossab, E.O. Casamayorb, R. Amannb, R. Amilsa,c

a Centro de Biología Molecular (CSIC-UAM), Cantoblanco, Madrid 28049, Spain b Max Planck Institut for Marine Microbiology, Celsiusstraβe 1, D-28359 Bremen,

Germany c Centro de Astrobiología (CSIC-INTA), Torrejón de Ardoz, Madrid 28850, Spain

Abstract Complementary molecular ecology techniques have been used to characterize the

Tinto River, an extreme environment with a rather constant acidic pH all along its course (mean pH 2.3) and high concentration of heavy metals (Fe, Cu, Zn, As and Cr). Comparative sequence analysis of amplified 16S rRNAs and 16S rRNA genes resolved by denaturing gradient gel electrophoresis (DGGE) allowed members of four bacterial genera: Acidithiobacillus, Leptospirillum, Acidiphilium and Ferrimicrobium, and two archaeal genera: Ferroplasma and Thermoplasma to be identified at different sampling stations along the river. The quantitative evaluation of the prokaryotic diversity using in situ hybridization with fluorescence labeled rRNA-targeted oligonucleotides (FISH) showed that the bulk prokaryotic biomass of the water column, up to 80%, corresponded to members of three bacterial species: Acidithiobacillus ferrooxidans, Leptospirillum ferrooxidans and Acidiphilium spp., all of them related to iron metabolism. Taking into consideration the characteristics of the habitat, the physiological properties and spatial distribution of the identified microorganisms, a model for the Tinto ecosystem based on the iron cycle is advanced and its biohydrometallurgical implications discussed.

1. INTRODUCTION The Tinto River, a 100 km-long river in Southwestern Spain, is an unusual ecosystem

due to its acidity and high concentration of metallic cations in solution (1, 2). The river springs up in the core of the Iberian Pyritic Belt (IPB) at Peña de Hierro (Iron Mountain), and flows into the Atlantic Ocean at Huelva (Fig. 1). The extreme conditions of the Tinto ecosystem are the product of the very active chemolithotrophic metabolism of microorganisms growing on the rich sulfidic mineral ores of the IPB and not, as formerly believed, the result of industrial mining contamination (3, 4, 5, 6). The existence of massive laminated iron bioformations (iron stromatolites) corresponding to old terraces of the river, predating the oldest mining activity reported in the area and similar to the laminar structures that are being currently formed in the river, is considered a strong argument in favour of a natural origin of the river (7). In spite of the extreme conditions of acidity and heavy metal content, the Tinto ecosystem holds a high level of unexpected eukaryotic diversity (2, 8).


1326

It was not surprising that the results obtained using conventional microbiological methods, isolation from enrichment cultures and phenotypic characterization, showed the presence in the Tinto ecosystem of sulfur and iron-oxidizing microorganisms, such as Acidithiobacillus ferrooxidans (formerly Thiobacillus ferrooxidans), in rather high numbers due to the acidic characteristics of the habitat (1, 2). Since its isolation in the early fifties At. ferrooxidans has been considered the principle agent of acid mine drainage (AMD), a problem of environmental concern in metal mining (9). The development of industrial bioleaching, facilitating the metabolism of acidic chemolithotrophic microorganisms, focussed attention on this microorganism. As a result a number of rather contradictory reports have been produced during the search for the basic mechanisms involved in the process (10). Recently it has been proposed that the properties of the substrate (sulfide minerals) rather than the microorganisms can explain most of the contradictory information in the field, giving to ferric iron a key role in the oxidation mechanism of sulfidic ores (11). Accordingly, molecular ecology studies have challenged the role of At ferrooxidans in bioleaching processes showing that strict iron-oxidizing microorganisms, like Ferroplasma spp. and Leptospirillum spp., were mainly responsible for AMDs generation and the main microbial populations in different bioleaching processes (12, 13, 14).

The recent introduction of molecular biology techniques into the field of microbial ecology has produced a significant advance (15, 16), especially in poorly characterized environments, such as extreme ecosystems. We present in this work a succinct report of the prokaryotic diversity of the Tinto River, a chemolithotrophically sustained ecosystem, using molecular ecology techniques (for a full report see reference 17). The combination of molecular ecology with the physiological characterization of isolated microorganisms has provided sufficient information to generate a geomicrobiological model of this unusual ecosystem of interest in different fields (18), particularly in biohydrometallurgy (19).


2.1 Sampling and analysis of physico-chemical parameters Samples were collected in triplicate from different sampling stations along the river

(Fig. 1) in June and October of 1999 and May of 2000. Total content of metals was measured by TXRF and ICP-MS. Sulfate concentrations were determined by a turbidimetric method, (2) and ferrous iron by a colorimetric method (2). Conductivity, pH and redox potential were measured in situ using specific electrodes. A Crison 506 pH/EH-meter was used to measure redox potential and pH, and an Orion-122 conductivity-meter for conductivity.

2.2 Nucleic acid extraction and cell fixation Samples for DNA extraction were collected into one liter bottles and kept on ice until

filtered through nitrocellulose Millipore filters (0.22 µm). Filters were stored at -20ºC until processed. Nucleic acid extraction was performed as described in (17). Samples for FISH were immediately fixed with 4% formaldehyde-minimal Mackintosh media and processed as described in (17).


1327

Figure 1. Geographical location of the Tinto River and the different sampling sites

2.3 PCR amplification, DGGE, sequencing and phylogenetic analysis PCR amplification of 16S rRNA gene fragments between E. coli positions 341 and

907 for the domain Archaea (20, 21) and between E. coli position 344 and 907 for the domain Bacteria (22), reverse transcription of 16S rRNA and amplification of the 16S rRNA gene, denaturing gradient gel electrophoresis (DGGE), excision of bands, and reamplification were performed as previously described (22). Taq Dyedeoxy Terminator Cycle Sequencing kit (Applied Biosystems, Forster City, USA) was used to sequence the 16S rRNA gene fragments. Sequencing reactions were run on an Applied Biosystems 373S DNA sequencer.

New partial sequences were added to an alignment of about 8,500 homologous 16S rRNA primary structures (23) by using the aligning tool of the ARB package (24). Aligned sequences were inserted within a stable tree using the parsimony tool ARB that enables reliable positioning of new sequences without alignment (25). Sequences of DGGE bands and 16S rRNA gene clones were initially compared with references sequences contained in the EMBL Nucleotide Sequences Database using the BLAST program and subsequently aligned with 16S rRNA reference sequences in the ARB package (http://www.mikro.biologie.tu-muenchen.de) (24). DGGE partial sequence dendrograms were obtained using the parsimony tool DNAPARS included in the ARB software.


1328

2.4 Cell counts and FISH Hybridization and microscopy counting of hybridized and 4',6'-diamidino-2-

phenylindole (DAPI)-stained cells were performed as described previously (15). Mean values were calculated by using ten to twenty randomly chosen fields for each filter section, which corresponded to 800 to 1,000 DAPI-stained cells. Counting results were corrected by subtracting signals observed with the control probe NON338. Probes used in this work are listed in Table 1. Hybridization conditions are described in (17). Cy3 labeled probes were synthesized by Interactiva (Ulm, Germany) and by Quiagen (Barcelona, Spain).

Table 1. Fluorescence labeled oligonucleotide probes used for in situ hybridization experiments

Probe Target Sequence (5’ to 3’) Specificity EUB338 16S GCT GCC TCC CGT AGG AGT Bacteria domain ALF968 16S GGT AAG GTT CTG CGC GTT α Proteobacteria ACD638 16S CTC AAG ACA ACA CGT CTC Acidiphillium spp. BET42a 23S GCC TTC CCA CTT CGT TT β Proteobacteria GAM42a 23S GCC TTC CCA CAT CGT TT γ Proteobacteria THIO1 16S GCG CTT TCT GGG GTC TGC Acidithiobacillus spp. ACT465a 16S GTC AAC AGC AGC TCG TAT Group a Acidithiobacillus spp. ACT465b 16S GTC AAC AGC AGA TCG TAT Group b Acidithiobacillus spp. ACT465c 16S GTC AAC AGC AGA TTG TAT Group c Acidithiobacillus spp. ACT465d 16S GTC AAT AGC AGA TTG TAT Group d Acidithiobacillus spp. NTR712b 16S CGC CTT CGC CAC CGG CCT TCC Nitrospira group LEP154 16S TTG CCC CCC CTT TCG GAG Group b L. ferriphilum LEP634 16S AGT CTC CCA GTC TCC TTG Group a Leptospirillum spp. LEP636 16S CCA GCC TGC CAG TCT CTT Group c L. ferrooxidans SRB385 16S CGG CGT CGC TGC GTC AGG δ Proteobacteria ACM1160 16S CCT CCG AAT TAA CTC CGG Acidimicrobium spp. ARCH915 16S GTG CTC CCC CGC CAA TTC CT Archaea domain FER656 16S CGT TTA ACC TCA CCC GAT C Ferroplasma spp. TMP654 16S TTC AAC CTC ATT TGG TCC Thermoplasma spp., Picrophilus spp.NON338 ----- ACT CCT ACG GGA GGC AGC Negative control


3.1 Physico-chemical characterization of the samples An important characteristic of the Tinto River is its constant acidic pH, a direct

consequence of the strong buffer capacity of ferric iron (2, 26). The mean pH value measured in the different samples used in this work was 2.4, with sampling site RT3 as the only exception, where the pH was always higher (mean 4.7), probably as a consequence of the lack of iron in solution to buffer the stream. The mean iron concentration for the different sampling sites was 4.9 g/l, although its concentration at the origin could be as high as 20 g/l. The concentration of iron decreases along the river as a consequence of its precipitation due to the dilution effect produced by tributaries or rain (19). A mean concentration of 9.2 g/l was found for total sulfur, most of it corresponding to sulfate (2). Redox potentials were high and relatively constant along the river, between +421 and +608 mV, except for station RT3 in which the values were always much lower. The dissolved oxygen varied in the different sampling stations depending on the hydrological regime of the river (7). Interestingly enough, anoxic conditions were found at the bottom


1329

of different sampling stations (e.g. RT7 and Berrocal). For complementary information concerning physico-chemical parameters measured in the Tinto ecosystem see references (2,17).

3.2 DGGE analyses Comparative DGGE analysis was performed to evaluate the level of microbial

diversity along the river (Fig. 1) in different seasons. Using specific primers for Bacteria and Archaea partial 16S rRNAs and 16S rRNA genes were amplified. The amplifications resulted in reproducible DGGE fingerprints with a small number of bands (Fig. 2). Out of fifty-seven sequenced bands, thirty-eight showed over 96% similarity with members of six genera, four from the bacterial domain: Acidithiobacillus, Leptospirillum, Acidiphilium and Ferrimicrobium, and two from the archaeal domain: Ferroplasma and Thermoplasma, all of them involved in the iron cycle. All the identified prokaryotes have been detected in previous studies in the Tinto River (2) and in different AMD systems (27).

The comparative analysis of all the Acidithiobacillus sequences retrieved from the Tinto ecosystem showed that they cluster with each of the four phylogenetic groups obtained for At. ferrooxidans (17). Accordingly, specific probes for each of the four groups were designed to follow their distribution along the river. All sequenced Leptospirillum clustered into three groups, a, b and c (17), which agrees with previously reported results (28, 29), although the retrieved Tinto’s leptospirilli sequences belong to a different group than the ones reported for Iron Mountain (28) and those found in industrial bioleaching processes (29). Specific probes have been designed to distinguish between these three groups (17).

Most of the Acidiphilium sequences showed high homology with the group represented by Acidophilium organovorum, Acidiphilium cryptum and Acidiphilium multivorum (17). The number of sequences corresponding to the gram-positive Ferrimicrobium/ Acidimicrobium group was rather low and they appeared mainly at the origin of the river. A similar situation was observed with the sequences homologous to the archaeal Ferroplasma/Thermoplasma group.

Figure 2. DGGE fingerprint of 16S rRNA gene and reverse transcribed 16S rRNA (*) using universal primers for members of domain Bacteria in different samples from October 1999. Numbers correspond to sampling sites of Fig. 1. Arrows label sequenced bands


1330

3.3 FISH analysis using group- and species-specific probes Total cell counts ranging between 105 and 107 cells/ml were found, regardless of the

sampling station and season. These values were similar to those reported previously by López-Archilla using the Most Probable Number (2). The majority of the DAPI-stained cells hybridized with the bacterial probe EUB338 (mean value of 78%). Very few Archaea were found throughout the river, which agrees with the DGGE results. Around 68% of the cells detected with the universal bacterial probe EUB338 could be assigned using group-specific probes (Fig. 3).

Variable percentages of hybridization, up to 69%, were obtained with the specific probe for γ-Proteobacteria (GAM42a), depending on the sampling station (Fig. 3). A specific probe for Acidithiobacillus (THIO1) was also used to detect members of this genus in the Tinto ecosystem. The yields for THIO1 and GAM42a were very similar in most of the samples (17), meaning that most of the γ-Proteobacteria found in the Tinto belong to the genus Acidithiobacillus, which agrees with the DGGE analysis. The use of specific probes designed for each of the four At. ferrooxidans groups gave positive hybridization results with different samples. Interestingly enough, variable populations of At. ferrooxidans, were found along the river (Fig. 4), suggesting that diverse groups of At. ferrooxidans have adapted to the different existing conditions (iron concentration, toxic heavy metals, oxygen concentration, etc.).

Values of hybridization up to 65% were obtained with probe NTR712, targeted to members of the Nitrospira phylum (Fig. 3). Former studies suggested that Leptospirillum spp. were the most likely genus of this phylum to be present in the Tinto River (2, 28, 29, 30, 31, 32). Using the specific probes designed for Leptospirillum spp. (17) it was found that the most representative group of leptospirilli along the river was group c (17), which agrees with the DGGE analysis and underlines the difference of the Tinto system from other reported bioleaching systems (28, 29). According to our clustering results, the leptospirilli identified and isolated from the Tinto River correspond to strains of L. ferrooxidans because they cluster with the type strain defined for this species (17). The total cell count detected with L. ferrooxidans specific probes was lower than that detected with NTR712 probe, meaning that some members of this group escaped detection.

ALF968 probe was used to detect α-Proteobacteria in the Tinto ecosystem. The yields relative to DAPI-stain reached values of 51%, corresponding to the third most representative group of bacteria in the Tinto River (Fig. 3). Previous studies have described Acidiphilium as the most probable α-Proteobacteria for this type of environment (27). This member of the α-Proteobacteria seems to be associated to At. ferrooxidans and L. ferrooxidans (33). Considering the results obtained with DGGE, a specific probe (ACD638) designed to identify members of the phylogenetically related species A. organovorum, A.multivorum and A. crytum was used to quantify this group of Acidiphilium spp. The percentage of positive hybridizations obtained with this probe was similar in most samples to the values obtained using the general ALF968 probe (17).

β- Proteobacteria were detected with probe BET42a. This group of bacteria was a minority in all samples from all stations with the exception of RT3, where a mean value of 73% of total cell was obtained (Fig. 3). Due to the high pH of this sampling site no further characterization of this group of bacteria has been pursued. To quantify Ferrimicrobium and the related genus Acidimicrobium, both characteristic bacteria in AMD systems, probe ACM1160 was designed. These Actinobacteria were found at rather low percentages in the different Tinto River samples (17).


1331

Probes FER656 and TMP654, specific for Ferroplasma and Thermoplasma genera respectively, were used for the detection of these iron-oxidizing Archaea associated to AMD systems (12, 13). In our case, both Ferroplasma and Thermoplasma cells were detected although in a rather small percentage, less than 3%.

Figure 3. Fraction of total cells detected with FISH using bacteria and group specific probes in different sampling sites

Figure 4. Variation of At. ferrooxidans populations along the Tinto River

3.4 Microbial ecology model of the Tinto ecosystem The identification and quantification of the main prokaryotic microorganisms thriving

in the Tinto River complements the physiological characterization of the respective isolates (1, 2, 34). This allows a geomicrobiological model for the Tinto River based on the physico-chemical characteristics of the system as well as on the physiological properties of the major species present in the river: At. ferrooxidans, L. ferrooxidans and


1332

Acidiphilium spp (Fig. 5) to be proposed. The Tinto ecosystem is under the control of an active iron cycle. Reduced iron, from mineral ores and solution, is the energy source for both, L. ferrooxidans and At. ferrooxidans, resulting in the production of ferric iron. Oxidized iron is responsible for maintaining a constant acidic pH along the river. On the other hand, At. ferrooxidans can grow under anaerobic conditions using reduced sulfur compounds as electron donors, such as those generated by the polysulfide oxidation mechanism of metal sulfides (11, 19), and ferric ion as an electron acceptor. Acidiphilium spp. have the capacity to respire reduced carbon compounds anaerobically using ferric iron as an electron acceptor, even at dissolved oxygen concentrations of 60% (35). Therefore, this member of the α-Proteobacteria may be, together with At. ferrooxidans, an important element for the reduction of ferric iron under anaerobic or microaerobic conditions, just the conditions found at several locations along the river (RT7, Berrocal). The iron cycle would be completed with these three species and the constant acidic pH would be also explained. Interestingly enough, preliminary results showed that some L. ferrooxidans isolates from the Tinto River are able to anaerobically oxidize (respire) iron using reduced metals as electron acceptors, which suggests that a complete anaerobic iron cycle is also operative in the Tinto ecosystem, with obvious biohydrometallurgical implications (Garcia-Moyano et al, personal communication).

Concerning the sulfur cycle, only At. ferrooxidans, able to oxidize sulfur aerobically and anaerobically, has been detected in important numbers using both conventional and molecular ecology techniques. Although isolation of At. thiooxidans from the Tinto River has been reported previously (1, 2), none of the molecular techniques used in this work (DGGE, FISH using specific probes) have been able to detect them. Given the close phylogenetic relationship between At. thiooxidans and At. ferrooxidans (17) further investigation is needed before a final conclusion concerning the status of this species in the river can be reached. As to sulfur reduction, this type of activity has been detected by in situ hybridization at several sampling sites of the Tinto ecosystem, although isolation and physiological characterization will be required to confirm the existence of this important activity in the acidic waters of the Tinto River (17). Different reports have described sulfate reducing activity in other acidic environments, thus it is reasonable to conceive that this activity is also occurring in the Tinto ecosystem, although at a rather low level, probably as a consequence of the high concentration of ferric iron present in the system (36).

The microbial ecology of the Tinto River corresponds to what can be expected from the coincidence of two important aspects: the role that iron seems to play in the oxidation of metal sulfides (11) and the mineral composition of the Iberian Pyritic Belt, in which pyrite is the dominant mineral. One noticeable difference between the Tinto ecosystem and other reported acidic systems is the relatively high number of active At. ferroxidans found in the sampling stations along the river, in contrast to the low numbers reported for this microorganism in other bioleaching systems. One possible explanation could be that in industrial bioleaching, aerobic oxidation of iron is favored, so the complete microbial iron cycle is not operative, while in the Tinto ecosystem the microbial oxidation and reduction of iron is performed along the length of the entire river. Probably the main role of At. ferrooxidans is to reduce iron rather than to oxidize it. In this context an interesting correlation has been found between the high concentration of reduced iron in the anoxic parts of the river and the relatively high number of active At. ferrooxidans, suggesting that the role of this microorganism is more closely related to iron reduction rather than to its oxidation (Malki et al, personal communication). Also, the population change of this bacteria along the river might be linked to its adaptation to different metabolic conditions.


1333

Further research has to be done in this line to verify these observations and to evaluate its possible implications in industrial bioleaching operations.

Figure 5. Suggested geomicrobiological model of the Tinto ecosystem. Only representative microorganisms are shown associated to their physiological role in the correspondent iron and sulfur cycles

Obviously many questions still remain unanswered (e.g., possible operation of an anaerobic iron cycle, the physiological and metabolic properties of the Leptospirillum spp. isolated in different acidic ecosystems, the low acidity of iron-oxidizing archaea in the Tinto River, etc.), but the tools designed for this study can be used to further explore the microbial ecology of the Tinto River and to compare it with other acidic environments. This information could then be used to generate DNA arrays to monitor the microbial population of industrial bioleaching processes, facilitating their control and detecting anomalous populations that could need correction. Currently, this methodology is being used to control microbial populations involved in coal biodesulfurization processes (see this volume). DNA micro-arrays using genomic libraries of key microorganisms could generate snapshots of gene expression during the process, helping to monitor its progress or to alert about possible malfunctions, facilitating their optimal performance. All these applications are in progress in our lab in collaboration with the Centro de Astrobiologia (Parro et al., personal communication). It is obvious that the application of molecular ecology techniques to biohydrometallurgy has been a watershed. We hope that these tools will help to expand the use of this environmentally friendly biotechnology in a near future.

4. CONCLUSIONS The use of molecular and conventional microbiological techniques allowed the

prokaryotic diversity and the relative concentration of the key microorganisms of an acidic ecosystem, the Tinto River to be studied. In spite of the high level of eukaryotic diversity found in this peculiar habitat, only three bacterial species seem to play an important role in the generation and maintenance of the extreme conditions of the habitat: At. ferrooxidans, L. ferrooxidans and Acidiphilium spp., all of them conspicuous members of the iron cycle.


1334

Other detected microorganisms may also be involved in this system, although they are present in lower numbers. This would be the case of Ferrimicrobium acidophilum and Ferroplasma acidiphilum, whose metabolism is very similar to L. ferrooxidans. Due to the characteristics of the habitat and given what is known about iron’s geomicrobiology, we postulate that the Tinto ecosystem is under the control of iron, a model with important biohydrometallurgical implications.

ACKNOWLEDGMENTS This work was supported by grants BIO99-0184 and BX2000-1385 from the

Ministerio de Educación y Cultura and 07M/0023/199 from the Comunidad Autónoma de Madrid, an institutional grant from the Fundación Areces to the CBM, and by the Max Planck Society.

REFERENCES 1. López-Archilla, A. I., I. Marín, and R. Amils. 1993. Geomicrobiology Journal, 11:223-

233. 2. López-Archilla, A. I., I. Marín, and R. Amils. 2001. Microbial Ecology, 41:20-35. 3. Davis Jr. R.A., A.T. Welty, J. Borrego, J. A. Morales, J.G. Pendon and J.G. Ryan.

2000. Environmen. Geol., 39:1107-1116. 4. Elbaz-Poulichet, F., C. Braungrardt, E. Achterberg, N. Morley, D. Cossa, J.M.

Beckers, P. Nomérange, A. Cruzado and M. Leblanc. 2001. Continental Shelf Research, 21:1961-1973.

5. Geen A. Van, J.F. Adkins, E.A. Boyle, C.H. Nelson and A. Palanques. 1997. Geology, 25:291-294.

6. Leblanc, M, J.A. Morales, J. Borrego and F. Elbaz-Poulichet. 2000. Econom. Geology, 95:655-662.

7. Fernández-Remolar, D.C., N. Rodríguez, F.Gómez and R. Amils. 2003. Journal of Geophysical Research, in press.

8. Amaral-Zettler, L.A., Gómez, F., Zettler, E., Keenan, B.G., Amils, R., Sogin, M.L. 2002. Nature, 417: 137

9. Colmer A.R., K. L. Temple, H.E. Hinkle. 1950. Journal of Bacteriology, 59:317-328. 10. Ehrlich H.L. 2001. Geomicrobiology, fourth edition, Marcel Dekker, Imc., New York. 11. Sand, W., T. Gehrke, P.G. Jozsa, and A. Schippers. 2001. Appl. Hydrometallurgy,

59:159-175. 12. Edwards, K. J., P. l. Bond, T. M. Gihrin, and J. F. Banfield. 2000. Science, 287:1796-

1798. 13. Golyshina, O. V., T. A. Pivovarova, G. I. Karavaiko, T. F. Kondrateva, E. R. Moore,

W. R. Abraham, H. Lunsdorf, K. N. Timmis, M. M. Yakimov, and P. N. Golyshin. 2000. International Journal of Systematic Bacteriology, 50:997-1006.

14. Rawlings, D. E., H. Tributsch, and G. S. Hansford. 1999. Microbiology, 145:5-13. 15. Amann, R. I., B.J. Binder, R.J. Olson, S.W. Chisholm, R. Devereux and D.A. Stahl..

1990.Applied and Environmental Microbiology, 56(6):1919-1925. 16. Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Microbiological Reviews,

59(1):143-169. 17. González-Toril, E., Llobet-Brossa, Casamayor E.O., Amann R., Amils R. 2003.

Applied and Environmental Microbiology, in press. 18. Amils R., E. González-Toril, D. Fernández-Remolar, F. Gómez, N. Rodríguez and C.

Durán. 2003. Reviews in Environmental Science and Technology, in Press.


1335

19. González-Toril, E., F. Gómez, N. Rodríguez, D. Fernández, J. Zuluaga, I. Marín, and R. Amils. 2002. Hydrometallurgy, in press.

20. Raskin, L., J. M. Stromley, B. E. Rittmann, and D. A. Stahl. 1994. Applied and Environmental Microbiology, 60:1232-1240.

21. Stahl, D. A., and R. Amann. 1991, pp. 205-248. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons Ltd., Chichester, UK.

22. Muyzer, G., S. Hottenträger, A. Teske, and C. Wawer. 1996, pp. 3.4.4.1-3.4.4.22. In A. D. L. Akkermans, J. D. van Elsas, and F. J. de Bruijn (ed.), Molecular Microbial Ecology Manual, 2nd ed. Kluwer Academic Publishers, Dordrecht, The Netherlands.

23. Maidak, B. L., J. R. Cole, T. G. Lilburn, C. T. Parker, P. R. Saxman, J. M. Stredwick, G. M. Garrity, B. Li, G. J. Olsen, S. Pramanik, T. M. Schmidt, and J. M. Tiedje. 2000. Nucleic Acids Research, 28(1):173-174.

24. Strunk, O., O. Gross, B. Reichel, M. May, S. Hermann, N. Stuckmann, B. Nonhoff, T. Ginhart, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, K.-H. Schleifer, and W. Ludwig. 1998-2000. http://www.mikro.biologie.tu-muenchen.de.

25. Ludwig, W., O. Strunk, S. Klugbauer, N. Klugbauer, M. Weizenegger, J. Neumaier, M. Bachleitner, and K. H. 16. Schleifer. 1998. Electrophoresis, 19(4):554-568.

26. González-Toril, E., F. Gómez, N. Rodríguez, D. Fernández, J. Zuluaga, I. Marín, and R. Amils. 2001. Part B: 639-650. In V.S.T. Cuminielly and O. García (ed.), Biohydrometallurgy: fundamentals, technology and sustainable development. Elsevier, Amsterdam.

27. Hallberg K.B. and D.B. Johnson. 2001. Advances in applied microbiology, 49:37-84. 28. Bond, P. L., S. P. Smriga, and J. F. Banfield. 2000. Applied and Environmental

Microbiology, 66:3842-3849. 29. Coram N.J. and Rawling D.E. 2002. Applied and Environmental Microbiology,

68:838-845. 30. Ehrich, S., D. Behrens, E. Lebedeva, W. Ludwig, and E. Bock. 1995. Archives of

Microbiology, 164:16-23. 31. Hippe, H. 2000. International Journal of Systematic and Evolutionary Microbiology,

50:501-503. 32. Edwards, K. J., T. M. Gihring, and Banfield. J.F. 1999. Applied and Enviromental

Microbiology, 65:3627-3632. 33. Harrison, J. A. P. 1985. Annual Review of Microbiology, 38:265-292. 34. Irazabal N., I. Marín and R. Amils. 1999. Journal of Bacteriology, 179:1946-50. 35. Johnson D.B. and Brige T.A.M. 2002. Journal of Applied Microbiology, 92:315-321. 36. Lovely D.R. 2000. Edited by Lovely. AMS Press. Washington D.C. Chapter 1, pp:3-

30.



1337

Phenotypic characterization and copper induced stress resistance in the extremely acididophilic Archaeon Ferroplasma

acidarmanus

Craig Baker-Austin1*, Mark Dopson1, Andrew Bowen1 and Philip Bond1,2

School of Biological Sciences1 and School of Environmental Sciences2, University of East Anglia, Norwich, England

Abstract The Ferroplasmales are a group of extremely acidophilic archaea believed to play a

significant role in the oxidization of sulfide minerals associated with the production of acid mine drainage. Here we present a characterization of the isolate Ferroplasma acidarmanus Fer1, and using a range of culture-based and proteomic techniques examine copper resistance and biofilm induction mechanisms adopted by this archaeon. Fer1 grows chemoorganotrophically utilizing yeast extract or sugars as a carbon and energy source, but grows optimally chemomixotrophically utilizing ferrous iron and yeast extract or sugars. Fer1 has temperature and pH optimums of 42°C and 1.2 respectively, but is capable of growing at near pH 0, which represents one of the most extreme examples of acidophily reported to date. Fer1 exhibits remarkably high tolerance to copper ions when adapted to growth at higher concentrations by multiple-step culturing in the presence of 1 g/l (0.0157 mol/l) copper. Exposure to sub-toxic concentrations of copper results in production of exopolysaccharides and the over and under-expression of cellular proteins as detected by 2-dimensional polyacrylamide gel electrophoresis. These results suggest that Fer1 possess a highly efficient Cu2+ homeostasis mechanism to deal with chronic metal stresses.

Keywords: Archaea, acidophile, proteomic, exopolysaccharide, metal resistance

1. INTRODUCTION Ferroplasma acidarmanus is a mesophilic, iron-oxidizing extreme acidophile of the

archaeal family Ferroplasmaceae. All of the characterized species within this family are cell-wall lacking obligate acidophiles that grow optimally around 40°C, in highly acidic conditions (~ pH 1-2) utilizing ferrous iron and yeast extract via a chemomixotrophic mode of growth [1, 2]. Ferroplasma acidarmanus strain Fer1 was isolated from the Iron Mountain superfund site in Northern California, where it was shown to constitute 85 ± 7% of a biofilm community by fluorescent in situ hybridization (FISH) [1]. The relative numerical dominance of this archaeon suggests that these organisms play a significant role in the production of acid mine drainage, a process previously thought to be dominated by bacterial iron-oxidizing species such as Acidithiobacillus ferrooxidans and Leptospirillum * [email protected]


1338

ferrooxidans. Geochemical data indicates pH values as low as -3.6, total dissolved metal concentrations as high as 200 g/l and sulfate values as high as 760 g/l having been recorded in the Iron Mountain superfund site [3]. The presence of biofilm-bound Fer1 communities in this environment implies it is extremely pH and metal tolerant as it is capable of thriving in one of the most acidic and metal-rich natural ecosystems reported to date [3, 4].

Cu2+ is an essential trace element involved in a number of fundamental cellular roles, acting as a cofactor for enzymes as diverse as cytochrome c oxidases, lysyl oxidases or tyrosinases, but can cause serious cell damage through radical formation [5]. Coping with this duality requires regulated pathways to control intracellular copper availability [6]. The levels of copper in the Iron Mountain site vary significantly depending on micro-scale seasonal and hydrological events, but ambient concentrations have been measured varying from 290-9800 mg/l [3]. Strain Fer1 must be tolerant to concentrations of copper within this range; however the underlying genetic and biochemical mechanisms of this resistance are unknown. The partially annotated Fer1 genome sequence (http://www.jgi.doe.gov/ index.html) contains a number of putative open reading frames involved in metal resistance [7], including a copper-transporting ATPase. Here we report initial investigations of copper-induced stress responses of Fer1 by examination of protein expression and exopolysaccharide (EPS) production. The findings have a direct relevance to understanding the characteristics of an extreme acidophilic archaeon involved in geochemical iron and sulfur cycling in bioleaching environments.


2.1 Archaeal strains and growth conditions F. acidarmanus strain Fer1 was used for all experiments. This strain was isolated

from the Iron Mountain superfund site via a series of enrichment cultures from a water and sediment sample obtained in July 1997 [1]. The inoculum for all batch culture experiments (unless otherwise stated) were steady state cells obtained from a chemostat while growing mixotrophically on ferrous iron and yeast extract. Details of chemostat growth conditions are described elsewhere [8]. Fluorescent in situ hybridization (FISH) using the Ferroplasma-specific genus probe Fer-656 (5’-CGTTTAACCTCACCCGATC-3’) was applied to samples originating from the chemostat to ensure the inoculum was a pure and uncontaminated Fer1 source [9]. Unless otherwise stated, batch cultures were carried out in 100 ml mineral salts medium (MSM) and trace elements. The MSM consisted of the basal salts (g l-1) (NH4)2SO4 (3.0), Na2SO4

.10H2O (3.2), KCl (0.1), K2HPO4 (0.05), MgSO4

.7H2O (0.5), Ca(NO3)2 (0.01) and filter sterilized trace elements (mg l-1): FeCl3

.6H2O (11.0), CuSO4.5H2O (0.5), HBO3 (2.0) and MnSO4

.H2O (2.0), Na2MoO4.2H2O

(0.8), CoCl2.6H2O (0.6), ZnSO4

.7H2O (0.9) and Na2SeO4 (0.1) and 0.02% (w/v) yeast extract. The medium was altered to pH 1.2 and supplemented with 70 g/l ferrous iron. All batch cultures were incubated on a rotary shaker at 150 r.p.m at 37°C for 63 hours unless otherwise stated. Growth was monitored by either cell counts with a hemocytometer (Hawksley) on an Olympus BX50 phase-contrast microscope or via protein concentration (Bio-Rad protein assay kit) [10]. All batch experiments were conducted in triplicate unless stated otherwise, with mean and ± standard deviation (SD) presented.

2.2 Batch toxicity and resistance induction experiments Cu2+ toxicity was tested by growth of Fer1 in MSM with the indicated Cu2+

concentrations. Inoculated batch cultures (10 µg of protein) were incubated for 72 hours at


1339

37°C and growth was measured as protein concentration (as above). To test for induction of Cu2+ resistance/adaptation 100 ml shake flasks were inoculated with 10 µg of Fer1 protein previously grown at a sub-toxic concentration of Cu2+ (1 g/l) into medium containing higher Cu2+ concentrations. These cultures were then incubated for a further 72 hours and growth was measured (as above).

2.3 Congo-Red quantitative exopolysaccharide determination assay Production of exopolysaccharide (EPS) during growth and biofilm formation was

monitored with Congo red [11]. Fer1 was grown mixotrophically in batch 1 l cultures (as described above) for 72 hours, then exposed to various levels of Cu2+ and incubated for a further 24 or 72 hours. A protein assay was performed and cell samples were centrifuged at 12 000 g for 30 min at 4°C and the supernatants decanted. Cell slurries containing 1 mg of protein were resuspended in 100 µl of 1 M Tris HCl (pH 6.9) and added to 50 µl of a saturated solution of Congo red in 75% ethanol. Mixtures were vortexed for 10 sec and incubated for 3.5 h at 4°C. The volume of each sample was adjusted to 1 ml with ultrapure H2O and centrifuged at 13 000 g for 15 min at 25°C to remove cells, biofilm, and bound Congo red. Supernatants were diluted 1:1 with distilled ultrapure H2O, and transmittance at 500 nm was determined on a Phillips PU8730 Spectrophotometer. All experiments were conducted in triplicate unless stated otherwise, with mean and ± SD presented.

2.4 2-Dimensional polyacrylamide gel electrophoresis

Fer1 batch cultures (1 l) inoculated with 100 µg of protein were grown in the absence and presence of 2 g/l Cu2+ for 72 hours. Following growth, cells were centrifuged (as above) and total cellular protein extracted using an urea/thiourea cell lysis buffer [12]. Cell extracts were sonicated and 200 µg protein loaded onto pH 4-7 immobilized pH gradient (IPG) strips (Amersham Pharmacia). The strips were focused for the first dimension separation using a Investigator 5000 focusing unit (Genomic Solutions) with a 24 hour programme that consisted of a maximum voltage of 5000 V, and a volt-hours setting of 80 µA/gel. Standard second-dimensional gel electrophoresis was performed as previously described [13]. 2D gels were either stained with EZ brilliant blue colloidal coomasie G-250 (Sigma) or silver stained as previously described [14]. Gels were scanned using the Proteomic Imaging System (Perkin Elmer Life Sciences) and analyzed using Proteomweaver version 1.3 (Definiens).

3. RESULTS

3.1 Phenotypic characterization experiments Fer1 was capable of growing chemomixotrophically on ferrous iron in the presence of

yeast extract, and chemoorganotrophically on yeast extract alone (Table 1). Fer1 grew to a higher cell density chemomixotrophically utilizing ferrous iron and yeast extract (2.74 ± 0.18 mg/l protein), as opposed to chemoorganotrophically on yeast extract alone (1.34 ± 0.38 mg/l protein). The difference in final protein concentration strongly suggests that Fer1 cells actively utilize ferrous iron as a primary energy source, and use yeast extract as a carbon source, but are capable of sub-optimally utilizing yeast for a chemoorganotrophic mode of growth. Fer1 was also capable of growth within the pH ranges 0.2-2.5, with an optimum at around 1.2, and grows between 32 to 51°C, with an optimum growth rate observed at 42°C (Table 1).


1340

Table 1. Optimal growth conditions of Fer1 compared to a range of other extremely acidophilic archaeal species

Species Growth µg protein ml-1 Temperature pH Fer1 Ae (Het) 1.34 ± 0.38 42°C (23-46) 1.2 (0.2-1.5) Fer1 Ae (Mixo) 2.74 ± 0.18 42°C (23-46) 1.2 (0.2-1.5) F. acidophilum Ae/An 1.18 ± 0.48 35°C (15-45) 1.7 (1.3-2.2) P. oshimae Ae - 40°C (45-65) 0.7 (0-3.5) T. acidophilum Ae/An - 59°C 1.8-2

Values for Fer1 are from this study; those for Ferroplasma acidophilum [2, and unpublished data], Picrophilus oshimae [15], and Thermoplasma acidophilum [16]. Abbreviations: Ae, aerobic, Ae/An, facultatively anaerobic. Brackets denote the range of temperature and pH where growth occurs.

3.2 Copper toxicity experiments In the absence of Cu2+ Fer1 grew to just under 8 µg/ml, but was strongly inhibited at

concentrations of Cu2+ of over 500 mg/l, indicating that Cu2+ detrimentally affected cell growth (Fig. 1A). Further increases of Cu2+ only marginally decreased the protein concentration (Fig. 1A) or cell counts (data not shown). At the highest Cu2+ concentration used (2400 mg/l) the protein concentration was approximately 1.8 µg/ml, and cells were still viable by subsequent inoculation into fresh MSM in the absence of Cu2+. Fer1 cells previously exposed to 1 g/l Cu2+ were capable of growth in MSM containing higher concentrations of Cu2+ (Fig. 1B). The results show a clear reduction in Fer1 protein concentration and cell counts (data not shown) when exposed to higher Cu2+ concentrations. The protein concentration of Fer1 cells grown for 72 hours at 12.8 g/l was 0.8 µg/ml, but these cells were unable to propagate in fresh MSM in the absence of Cu2+ (data not shown).

Figure 1. Growth of Fer1 cells in increasing concentrations of copper (A) and after a previous exposure to a sub toxic concentration of Cu2+ (B). Values in (A) are means ± SD (n = 3) and representative values in (B) (n = 1)

Copper (g/l) Copper (g/l)

A B

0 0.5 1 1.5 2 2.5 0 2 4 6 8 10 12 140

1

2

3

4

5

6

7

8

Pro

tein

(µg/

ml)

1

2

3

4

5

6

7

8

Pro

tein

(µg/

ml)

0

Copper (g/l) Copper (g/l)

A B

0 0.5 1 1.5 2 2.5 0 2 4 6 8 10 12 140

1

2

3

4

5

6

7

8

Pro

tein

(µg/

ml)

1

2

3

4

5

6

7

8

Pro

tein

(µg/

ml)

0


1341

-0.150

-0.100

-0.050

0.000

0.050

0.100

0.001 0.01 0.1 1 5

Copper (g/l)

Tran

s (5

00 n

m)

1 Day3 Days

Figure 2. EPS production in Fer1 cultures exposed to increasing Cu2+ stress. The data are means ± SD (n = 3)

3.3 Congo-Red quantitative EPS determination assay The Congo red assay detects EPS production. Cultures producing EPS show an

increase in transmittance because polysaccharide in biofilm binds Congo red, removing it from solution. Fer1 cells produce detectable amounts of EPS in response to Cu2+ stress, but no EPS was detected in the absence of Cu2+. Cultures inoculated with increasing concentrations of Cu2+, and cultures stressed for longer periods (3 days) showed marked increases in EPS production compared to control cultures grown for the same period of time (Fig. 2).

3.4 Proteomic analysis of Fer1 Cu2+exposed cells Total protein from Fer1 cells from the different growth cultures were separated using

2-dimensional polyacrylamide gel electrophoresis (2D PAGE). Approximately 600 protein spots are resolved from Fer1 cells cultured with 2 g/l Cu2+ (Fig. 3A). A portion of 2D gel electrophoresis separations from control cells (no Cu2+ exposure) and exposure to 2 g/l Cu2+ gel have been magnified to show examples of up and down regulated proteins in the absence (Fig. 4B) and presence of Cu2+ (Fig. 4C). By employing 2D PAGE we identified approximately 12 proteins up-regulated and 4 proteins down regulated compared to controls.

4. DISCUSSION The isolate Fer1 represents a species of mesophilic, chemohetero- and

chemomixotrophic archaea that grows under extremely acidic conditions. A draft annotation of the genome data (97% complete) has identified a range of incomplete amino acid biosynthetic pathways, an array of intra and extracellular proteases and amino acid uptake pumps. Those results are supported by our findings, which show that Fer1 grows optimally through the chemomixotrophic utilization of ferrous iron and yeast extract (Table 1). Fer1 is shown to grow optimally at pH 1.2, and is capable of growth at close to pH 0. Only two other archaea [15], a few eukaryotic fungi and an algal species have been reported to be capable of growth at pH values around 0 (16, 17].


1342

Figure 3. Representative silver stained 2D PAGE gel of Fer1 in the presence of 2 g/l Cu2+ (A). The inset area shows the approximate section magnified for Fer1 cultured in the absence (B) and presence of 2g/l Cu2+ (C). Relative isoelectric point and molecular masses shown. Arrows indicate putative up-regulated proteins

Microorganisms isolated from highly acidic environments such as acid mine drainage sites polluted with high concentrations of metals exhibit considerable tolerance to these elements. This tolerance may be due to abiotic factors (pH, temperature, nutrients in the environment or growth media) or to the physiological and genetic adaptations of these organisms [18]. Based on the results of batch toxicity and proteomic analysis Ferroplasma


1343

acidarmanus strain Fer1 appears to have developed an inducible and highly efficient Cu2+ resistance system. Fer1 cells grow efficiently at relatively low concentrations of dissolved Cu2+ (<500 mg/l) but growth appears to be inhibited at concentrations exceeding 1 g/l Cu2+. The apparent reduction in cell densities at higher Cu2+ concentrations suggests that Cu2+ exerts a significant toxicological effect. However, all of the cells harvested within these experiments, except those at 12.8 g/l, were shown to be viable via reinnoculation of cells into fresh, unspiked media. This suggests that relatively low-level exposure of Cu2+ to Fer1 cells does not exert a permanent toxicological effect, and that Fer1 cells are capable of withstanding acute, and relatively low-level exposure to Cu2+ ions with no long-term effect on viability. This resistance phenotype may have significant advantages for an organism that grows in a habitat characterized by significant Cu2+ fluxes [2]. Cells previously exposed to copper ions were significantly better adapted to growth in higher concentrations of this metal (Fig. 2), and for surviving for longer periods than that used during the toxicity experiments (2 weeks, data not shown). These data suggest that the Fer1 resistance phenotype is up-regulated or an adaptive response to exposure to copper. Results from the initial phase in our proteomic analysis of Cu2+ exposed Fer1 show significant variations in proteome expression compared to control cells cultured without Cu2+ (Fig. 3B and C). The up- and down regulation of numerous proteins in response to Cu2+ is detected.

Fer1 produced significant amounts of EPS when stressed with Cu2+ (Figure 3). The production of EPS appears to be increased when toxic concentrations of Cu2+ are applied to the culture media, and when the stress period was increased to 3 days. These results suggest Fer1 may produce EPS as a stress response to acute Cu2+ exposure, although the actual mechanisms and rationale for EPS production in this archaeon are unknown. Biofilm production has been observed in a wide variety of archaea from functionally and phylogenetically distinct taxonomic groups, and these observations point to the possibility that this is a widespread stress response among the archaea [10]. One explanation is that EPS production may be a population/community level mechanism of heavy metal resistance. Archaeal cultures stressed by high concentrations of metals are often able to incorporate metals into an insoluble matrix [10, 19]. Although the mechanism of sequestration is unknown, polypeptides found in biofilm may act like phytochelatins to trap metals [19], presumably reducing their bioavailability. Recently, there has been a broad recognition that microbial biofilms are an important mode of growth in natural environments [19, 21]. This is the preferred mode of growth for bacteria in many ecosystems because attached growth confers distinct advantages to the biofilm bacteria, such as enhanced nutrient gathering capacity and several-fold resistance to antimicrobials and biocides [22, 23]. This phenomenon has been the subject of intense research in medically important and pathogenic bacteria that produce biofilms, particularly Klebsiella pneumoniae and Pseudomonas aeruginosa (reviewed in [20]). Interestingly, little research has focussed upon biofilm formation within the archaea, or within extremophilic microorganisms, and this area requires further investigation. An understanding of acidophilic biofilm formation may provide insights into the structural stability of these organisms within these highly inhospitable and stochastic environments, and may increase our understanding of the population and community-level implications of surface attached growth, particularly with regards to metal resistance.

We are currently analyzing protein spots by trypsin digestion coupled with MALDI-TOF mass spectrometry. By comparison of protein mass-fingerprinting results to genome sequence data we will identify proteins and genes involved in EPS production and Cu2+ resistance. The recent sequencing and partial annotation of the Fer1 genome has facilitated a range of post-genomic techniques to be used to investigate this archaeon in considerable


1344

depth. We have also been using 2D PAGE to select and excise proteins of interest isolated from cells grown under a wide variety of culture conditions, including anaerobisis, chemoheterotrophy and variations in physio-chemical growth conditions such as temperature and pH. The sequences of these differentially expressed proteins are being determined, and a heterologous prokaryote system is currently being prepared for gene cloning experiments based on Fer1 transcripts. This approach should provide fascinating insights into the genetics, biochemistry and physiology of an extremely acidic archaeal lifestyle.

4. CONCLUSIONS This study demonstrates that the extremely acidophilic archaeal species Ferroplasma

acidarmanus isolate Fer1 grows optimally utilizing ferrous iron and yeast extract as growth substrates at 42°C and pH 1.2. Experimental data show Fer1 to be extremely resistant to Cu2+ and to produce significant and detectable amounts of EPS when exposed to Cu2+ ions. EPS production was also increased with longer stress periods in Fer1 cultures. Both biofilm and batch Cu2+ exposed cultures of Fer1 cells analyzed using 2D PAGE showed marked up- and down regulation of proteins compared to control cultures, suggesting significant genetic and biochemical adaptation to changing culture conditions.

ACKNOWLEDGEMENTS This work was supported by the BBSRC. We would also like to thank Francis

Mulholland for useful discussions, and the Institute of Food Research (Norwich, England) for use of 2D PAGE scanning equipment.

REFERENCES 1. K.J. Edwards, P.L. Bond, T.M. Gihring, and J.F. Banfield, Science, 287 (2000) 1796-

1799. 2. O.V. Golyshina, T.A. Pivovarova, G.I. Karavaiko, T.F. Kondrat'eva, E.R.B. Moore,

W.R. Abraham, H. Lünsdorf, T.M. Timmis, M.M. Yakimov, P.M. Golyshin, Int. J. Syst. Evol. Microbiol., No. 50 (2000) 997-1006.

3. D.K. Nordstrom, C.N. Alpers, C.J. Ptacek, D. Blowes, Environ. Sci. Technol., No. 34 (1999) 254-258.

4. D.K. Nordstrom., Ph.D. Dissertation. Stanford Univ., Stanford, CA (1977). 5. D. Strausak, and M. Salioz, J. Biol. Chem., No 272 14 (1997) 8932-8936. 6. F.W. Outten, D.L. Huffman, J.A. Hale, and T.V. O'Halloran, J. Biol. Chem., No. 276

(2001) 30670-30677. 7. T.M. Gihring, P.L. Bond, S.C. Peters, and J.F Banfield, Extremophiles, (2003) (in

press). 8. Dopson, M., Baker-Austin, C.M., Hind, A. & Bond, P.L., (unpublished data, 2003). 9. P.L. Bond, and J.F. Banfield, Micro. Ecol., No. 41 (2001) 149-161. 10. M. Bradford, Anal. Biochem., 72 (1976) 248. 11. C. LaPaglia, and P. Hartzell, Appl. Environ. Microbiol., No. 63 (1997) 3158-3163. 12. V. Santoni, M. Molloy and T. Rabilloud, Electrophoresis, No 21 (2000) 1054-1070. 13. A. Hesketh, D. Fink, and B Gust, Mol. Micro., No. 46 2 (2002) 319-330. 14. H. Blum, H. Beier, and H.J.Gross, Electrophoresis, 8 (1987) 93-99. 15. C. Schleper, G. Pühler, I. Holz, I. Gambacorta, D. Janekovic, U. Santarius, P.H. Klenk,

and W.J. Zillig, Bacteriol., No 177 (1995) 7050-7059.


1345

16. T.D. Brock, Thermophilic microorganisms and life at high temperatures. Springer-Verlag, New York (1978).

17. O. Sletten, and C. E. Skinner, J. Bacteriol., No 56 (1948) 679-681. 18. M.C. Romero, E.M Gatti, and D.E. Bruno, W. J. Micro. & Biotech., No 15 (1999) 179-

184. 19. S. Karthikeyan, and T.J., Beveridge, Env. Micro., No. 4 (2002) 667-675. 20. P.S. Stewart, and J. Costerton, Lancet, No. 358 (2001) 135-138. 21. J.W. Costerton, Z. Lewandowski, D. de Beer, D. Caldwell, D.R. Korber, and H.L

Lappin-Scott, Annu. Rev. Microbiol., No. 49 (1995) 711–745. 22. G.M. Wolfaardt, J.R. Lawrence, R.D. Robarts, and D.E. Caldwell, Can J. Microbiol.,

No 40 (1994) 331–340. 23. D.R. Korber, A. Choi, G.M. Wolfaardt, and D.E. Caldwell, Appl. Environ. Microbiol.,

No. 62 (1996) 3939–3947.



1347

Pyrite oxidation by halotolerant, acidophilic bacteria

P.R. Norris and S. Simmons

Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK

Abstract A pyrite enrichment culture of mesophilic Thiobacillus prosperus-like bacteria and

salt-tolerant Acidithiobacillus species was maintained through serial cultures over many months with up to 6% w/v NaCl. The dominant bacteria in the culture were indicated by analysis of ribosomal RNA genes that were amplified by PCR with DNA extracted from laboratory bioreactors. The potential of such cultures for mineral processing where freshwater is not available was confirmed by demonstration of pyrite oxidation rates equivalent to those obtainable with Acidithiobacillus ferrooxidans in the absence of salt.

Keywords: acidophiles, salt tolerance, Acidihalobacter

1. INTRODUCTION The inhibition of mineral sulfide-oxidizing bacteria by salt could preclude

biohydrometallurgical mineral processing where only saline water is available. Acidophilic bacteria are generally inhibited by anions (except sulfate) because they accumulate intracellularly in response to positive membrane potentials, the consequent reduction of which leads to denaturing acidification of the cytoplasm [1]. Well-studied mineral sulfide-oxidizing, acidophilic bacteria, such as Acidithiobacillus ferrooxidans, do not, therefore, grow in seawater. However, several strains of mineral sulfide-oxidizing bacteria that could grow with up to 3.5% w/v NaCl have been isolated from marine, geothermal sediments of Vulcano, one of the Aeolian Islands [2,3]. One strain was characterized and named Thiobacillus prosperus [3]. The phylogenetic placement of T. prosperus [4] some distance from the genus Acidithiobacillus which was created for acidophilic thiobacilli [5] has indicated the requirement for its transfer to a novel genus. Solubilization of metals from an ore mixture by T. prosperus was demonstrated and described as similar to that by At. ferrooxidans, but little mineral leaching data was presented [3].

Thiobacillus prosperus-like bacteria have been re-isolated from ferrous iron enrichment cultures of acidic, saline sediment samples from Vulcano [6]. These were divided into two types, initially by comparison of whole cell electrophoretic protein profiles and subsequently by sequencing of their 16S rRNA genes (Norris, unpublished work). One type (strain V6) appeared to be very similar to T. prosperus. However, it differed from the described behaviour of the type strain in that its growth rate on ferrous iron was very similar to that of Acidithiobacillus ferrooxidans, whereas growth of the type strain with ferrous sulfate has been described as poor [3]. The second type (strain V8)


1348

represents a closely related but new species of the genus, for which the name Acidihalobacter ferrooxidans will be proposed in a full description to be published elsewhere. Two Acidithiobacillus species were also isolated from tetrathionate enrichment cultures of the sediment and water samples. Strain V1 was a novel, sulfur- (but not iron-) oxidizing Acidithiobacillus species and strain V2 was a strain of Acidithiobacillus thiooxidans [6]. The experiments described in this paper used a 35°C pyrite enrichment culture that was established with the sample that also gave rise to the cultures from which these Acidithiobacillus species and strains V6 and V8 were isolated.


2.1 Culture conditions A pyrite enrichment culture was established at 35°C with water and sediment from an

acidic, geothermal site on Vulcano Island [4]. The medium used for enrichment, for maintenance of the culture through serial culturing, and for the growth experiments contained (g l-1) (NH4)2SO4 (0.4), MgSO4

.7H2O (0.4), K2HPO4 (0.2) and NaCl (30), adjusted to pH 2 with H2SO4. The NaCl concentration was varied as indicated in the text. The pyrite used was a finely ground concentrate (minus 75 µm) with approximately 40% w/v iron. Solubilization of iron from pyrite was followed in air-lift reactors containing a central draft tube, 440 ml medium and 2% w/v pyrite. Iron in supernatants of centrifuged samples was determined by atomic absorption spectrophotometry.

2.2 DNA extraction and analysis DNA extraction, polymerase chain reaction (PCR) amplification of 16S rRNA genes,

sorting of cloned genes on the basis of restriction fragment length polymorphisms (RFLPs) obtained from EcoRI/RsaI and EcoRI/Sau3AI double digests, and sequencing were carried out as described previously [6].

Clone libraries of rRNA genes were constructed using the TOPO TA Cloning Kit (Version J) vector (pCR 2.1-TOPO) and host Escherichia coli strain (Invitrogen). Clone libraries of rDNA from cultures in bioreactors were also used in dot blot hybridizations (using the digoxigenin labelling system (Boehringer) with oligonucleotide probes that allowed differentiation of bacterial strains V1, V2A, V6 and V8 (see later). Target sequences for the probes (with the Escherichia coli 16S rRNA gene numbering region equivalent in brackets) were 5'-GTGCTTGCACCTGGTGG-3' (78-99), 5'-GGGTGCTAATATCGCTGCTG-3' (459-479), 5'-GCGTGCGTAGGTGGTTGGGT-3' (576-595) and 5'-GCGTGTGTAGGCGGTTTAGT-5' (576-595) for strains V1, V2A, V6 and V8 respectively.


3.1 Effect of salt and temperature on pyrite dissolution by halotolerant acidophiles Growth of T. prosperus on mineral sulfides has been described as fastest in a mineral

medium without additional salt, with the medium already containing about 0.25% w/v chloride from ammonium, magnesium, calcium, potassium and sodium salts [2]. This contrasts with the observation that growth-associated pyrite oxidation by similar bacteria was enhanced when the medium contained 2 or 3% w/v NaCl compared to growth with 1% w/v salt (Fig. 1a). Although growth was clearly inhibited by 5% w/v NaCl (Fig. 1b), growth and pyrite oxidation was still maintained over many months with weekly serial


1349

culture in medium containing 6% w/v NaCl. Strain V8 showed slightly greater salt tolerance than strain V6 in further work with ferrous iron as substrate (data not shown). These results confirm a tolerance of salt by these strains far greater than that by At. ferrooxidans (< 1% w/v NaCl) and similar to that by some iron-oxidizing Alicyclobacillus-like bacteria [7].

Figure 1. The effect of salt on the solubilization of iron during growth of pyrite enrichment cultures at 35°C in a bioreactor with 2% w/v pyrite

Figure 2. Solubilization of iron during growth of a pyrite enrichment culture at different temperatures with 2.5% w/v NaCl and 2% w/v pyrite

The halotolerant enrichment culture was particularly active over a temperature range

of 25 to 40°C with maximum iron solubilization from pyrite at 40°C (Fig. 2). This is close to the optimum temperature for growth of strains V6 and V8 on ferrous iron, which has been determined as about 37°C (data not shown).


1350

3.2. Composition of the pyrite-oxidizing population The halotolerant pyrite enrichment culture was maintained in air-lift bioreactors for

many months through serial batch culture, with inoculation (10% v/v) into new medium every one to two weeks. The initial pyrite concentration was 2% w/v for each culture. One culture was maintained in this way for 19 months with a NaCl concentration of 3% w/v. After 11 months, an inoculum was taken to establish a second culture that was then maintained with 6% w/v NaCl for a further 8 months. DNA was extracted directly from these cultures, rRNA genes were PCR-amplified and analysed as described in the Materials and Methods. Representative clones with different RFLPs were sequenced to reveal the corresponding source strains (Fig. 3).

Figure 3. Clone types in libraries constructed from PCR-amplified rRNA genes extracted from a pyrite enrichment culture grown with 3% w/v NaCl. The time scale indicates time elapsed since inoculation of the first of the serial batch cultures. The key indicates the strains to which cloned rRNA sequences corresponded. The number of clones analysed by RFLP comparisons was 90 (after 5 months serial culturing), 60 (after 12 months) and 62 (after 15 months). 79 clones were analysed by dot-blotting with specific probes after 19 months

Only three strains were represented in the clone libraries, but others could have been present in the culture in relatively low numbers. Strain V8 was indicated as the principal (and possibly the only) ferrous iron-oxidizing bacterium in the culture. Two Acidithiobacillus strains were indicated, strain V1 and a strain (referred to as strain 2A) whose rRNA sequence was almost identical to that of Acidithiobacillus thiooxidans and to that of strain V2, previously isolated from Vulcano samples [6].

The culture grown with 6% w/v NaCl was analysed by dot blotting of plasmid DNA from clone libraries constructed after 5 months (76 clones) and 8 months (64 clones) of serial culture. The clone libraries were dominated by sequences corresponding to strain V8, with no clones corresponding to strain V1 and only 1% (after 5 months) and 8% (after 8 months) of the clones corresponding to strain V2A.

Sulfur-oxidizing Acidithiobacillus species, at least one of which is probably a strain of At. thiooxidans, were present in the mixed cultures with 3 or 6% w/v NaCl, although the


1351

type strain of At. thiooxidans does not possess such salt tolerance. The closely related At. ferrooxidans was not observed in any experiments with NaCl-supplemented medium.

4. CONCLUSIONS At the time of these analyses, rRNA sequences were available for three iron-oxidizing

T. prosperus-like bacteria: T. prosperus itself, strain V6 and strain V8. A fourth, related sequence (V3) was cloned from DNA extracted from a Vulcano sample but no source strain has yet been isolated [6]. This extra sequence, and a strain (VC15) that showed little DNA:DNA sequence hybridization with a T. prosperus isolate in the original description of such bacteria [3], indicates several species within this group of halotolerant acidophiles. Therefore, the apparently specific RFLP patterns and oligonucleotide probes used to assess the mixed population in bioreactors (Fig. 3) might not have revealed any further diversity if this was present as uncharacterized strains with similar 16S rRNA sequences. Further work is also required to establish whether strain V8 has any competitive advantage over strain V6 during growth on pyrite, as might be indicated from its dominance in the bioreactor population. Strains V6 and V8 appear to grow equally well on pyrite in pure culture. There appears to have been no reports of mineral oxidation by such bacteria since the description of T. prosperus fourteen years ago, but this paper confirms activity worthy of further consideration for mineral processing under particular (i.e. saline) conditions.

ACKNOWLEDGMENTS We gratefully acknowledge the support of a Biological and Biotechnology Research

Council studentship.

REFERENCES 1. B. Alexander, S. Leach and W.J. Ingledew, J. Gen. Microbiol., 133 (1987) 1171. 2. G. Huber, H. Huber and K.O. Stetter, pp. 239-251 in H.L. Ehrlich and D.S. Holmes

(eds.), Workshop on Biotechnology for the Mining, Metal-Refining and Fossil Fuel Processing Industries, Wiley, NewYork, 1985.

3. H. Huber and K.O. Stetter, Arch. Microbiol., 151 (1989) 479. 4. B.M. Goebel, P.R. Norris and N.P. Burton, pp. 293-314 in F.G. Priest and M.

Goodfellow (eds.), Applied Microbial Systematics, Kluwer, Dordrecht, 2000. 5. D.P. Kelly and A.P.Wood, Int. J. Syst. Evol. Microbiol., 50 (2000) 511. 6. S. Simmons and P.R. Norris, Extremophiles, 6 (2002) 201. 7. P.J. Holden, L.J. Foster, B.A. Neilan, G Berra, and Q.M. Vu, pp. 283-290 in V.S.T.

Ciminelli and O. Garcia Jr. (eds.), Biohydrometallurgy: Fundamentals, Technology and Sustainable Development, Part A, Elsevier, Amsterdam, 2001.



1353

Reversible loss of arsenopyrite oxidizing capabilities by Acidiothiobacillus ferrooxidans is associated with swarming

phenotype and presence of ISAfe1

Jasmin E. Hurtado

Laboratorio Biotecnología Ambiental, Departamento de Microbiología, Universidad Peruana Cayetano Heredia, A.P. 4314, Lima-Peru

E-mail: [email protected]

Abstract There is a direct relationship between swarming phenotype and loss of arsenopyrite

oxidizing capability in isolates of Acidiothiobacillus ferrooxidans. After several years of culturing A. ferrooxidans on arsenopyrite concentrates it was possible to isolate strains that show periodical decay on the level of arsenopyrite oxidation. This low activity is correlated with phenotypic changes in growth in solid media of the swarming phenotype and with the loss of the ability to use oxidation of ferrous to ferric iron as an energy source.

Previous work has shown that oxidation of ferrous iron and the swarming phenotype are associated with the presence of the insertion sequence ISAfe1. We hypothesize that the presence of this insertion sequence in our cultures may account for the phenotypic changes as well as the loss of ability to oxidize arsenopyrite.

Keywords: Acidiothiobacillus, arsenopyrite, swarming, ISAfe1

1. INTRODUCTION Acidiothiobacillus ferrooxidans is an acidophilic, obligately chemolithoautothrophic

Gram negative rod that oxidizes either ferrous to ferric iron or reduced sulfur compounds to sulfuric acid for energy generation. Initially isolated by Temple and Colmer in 1951 from water mine, its presence has been demonstrated in almost all acidic mining environments. Also, A. ferrooxidans possesses high resistance to toxic metal ions.

Acidiothiobacillus ferrooxidans exhibits considerable genetic variation [1, 2] and can rapidly adapt to a wide range to growth conditions [3, 4]. In 1987, the presence of two families (family 1 and family 2) of repetitive DNA sequences in the genome of A. ferrooxidans [5] was described. More recently, these were identified as insertion sequences IST1 and IST2 [6]. A phenotypic switching that includes loss of ability to oxidize ferrous iron and a swarming phenotype is associated with the transposition of IST1 [7]. In 1999, it was proposed that loss of Fe(II) oxidation is due to reversible transposition of the insertion sequence IST1(now named ISAfe1 [8]) into resB gene [9].

In 1995, the structure, sequence and biological activity related to a glutaredoxin of Tn5467, a Tn21-like Transposon located on the A. ferrooxidans plasmid pTF-FC2 were


1354

described [10]. In 1997 an insertion sequence, IST3091 in a T. ferrooxidans plasmid PTF91 was demonstrated [11]. The presence of a Tn7-like Transposon present in the glmUS region of A. ferrooxidans [11] has been reported. Finally, location of the pst operon, which encodes a phosphate-specific transport system, was reported to be downstream of the glmUS genes as in E. coli [12].

In recent years the most rapidly developing area of the byohidrometallurgy has been associated with the extraction of gold from refractory ores and concentrates. A number of commercial and semicommercial operations using arsenopyrite biooxidation tanks and piles are cited in literature [13,14].

During arsenopyrite leaching, high arsenic levels are present in the pregnant solution. In E. coli and other bacteria, arsenate is taken up by phosphate transport systems such as the ATP-coupled Pst pump, a member of the ArsABC superfamily of transport ATPases [15]. Recently, homologous genes of four Ars (arsenic resistance genes) have been identified in A. ferrooxidans [16].

In a previous work [17], we found that during two years of transfers in arsenopyrite, most strains of A. ferrooxidans showed changes in the levels of arsenopyrite leaching, and it was confirmed that degree of arsenopyrite leaching activity was directly related to iron oxidation. The aim of the present work was to examine the relationship between phenotypes associated with IST1 presence and the reversible loss of arsenopyrite oxidizing capabilities of A. ferrooxidans.

2. MATERIAL AND METHODS

2.1 Bacterial strains Six different strains of A. ferrooxidans were included in this study, namely (1) JH6-L,

(2)JH1-DP and (3) JH1-DA isolated from Coricancha gold mine, and (4) JH8A-CE, (5) JH8B-CE and (6) JH9-CE isolated from Centraminas Gold mine. Strains 1-3 and 6 have been previously reported [17]. Strains 4 and 5, variants isolated from JH8-CE, also have been reported [17].

2.2 Media used Liquid culture media for growth and leaching experiments were prepared according

Tuovinen and Kelly [18]. When arsenopyrite was used, ferrous iron was omitted in the preparation. Solid iron media were prepared as previously described [17].

Solid 10:10 medium and 100:10 medium (Medium 100:10 contains 100% of the thiosulfate concentration found in standard solid medium and 10% of the ferrous iron concentration found in standard 9K medium) were made as described by Schrader and Holmes [7] with the following modification: It was used 0.8% Purified Agar (L28, Oxoid Limited, Basingstoke, Hampshire, England.) as a solidifying agent. This purified agar was previously washed twice with distilled water, three times with alcohol and finally twice with distilled water, it was then autoclaved in order to eliminate additional impurities. Liquid 10:10 medium and 100:10 medium were prepared as described previously by Schrader and Holmes [7]. A modified 10:10 soft agar was prepared by using 0.5% Purified Agar washed as described before and plated onto the surface of a modified 10:10 agar.

2.3 Oxidation of iron and thiosulfate Oxidation of iron and thiosulphate was assayed as previously described [17].


1355

2.4 Arsenopyrite oxidation The procedure used for the arsenopyrite growth measurements has been previously

described [17]. In these experiments JH6-L, JH1-DA and JH1-DP were grown in arsenopyrite concentrates containing 21% arsenic and 0.5 Oz/ST gold. Strains JH8A-CE, JH8B-CE and JH9-CE were grown in arsenopyrites concentrates containing 30.1% arsenic, 0.6 Oz/ST gold and 0.7 0z/ST silver. During 7 years, these strains were periodically transferred to arsenopyrite containing medium.

2.5 DNA manipulation DNA isolation were carried out using standard procedures [19] from strains JH8-CE

and JH9-CE, which have been grown in liquid media containing iron and thiosulfate as energy sources. PCR amplification of ISAfe1 was done using the following primers derived from ISAfe1(NCBI U66246): A(5’TGCCCCGTCTGTGGTGAGGATG3’) and B(5’TGCCGGGCGTAGCGAACAAGAGT 3’). PCR amplification was carried out as follows: 2 min and 30s at 94° C followed by 30 cycles at 94°C for 30 s, 66°C for 30s, 72°C for 30s, and then 2 min and 30s at 72°C.

3. RESULTS

3.1 Arsenopyrite oxidation Two levels of arsenopyrite oxidation were exhibited over the years:(1) a low level of

arsenopyrite oxidation which had very low concentration of arsenic in solution (0.2-1 g/L), and (2) a high level of arsenopyrite oxidation with more than 12 g/L of arsenic in solution.

In a previous work [17] we showed that JH8-CE maintained a high level of ability to oxidize arsenopyrite over a period of two years. To maintain the strain, we streaked JH8-CE in a solid iron media. After a week, twenty typical A. ferrooxidans colonies were transferred to equal number of Erlemeyer flasks with arsenopyrite liquid media. After five years of transferring these 20 cultures, only five remain viable. Two of these, JH8A-CE and JH8B-CE were used in this study.

While JH8A-CE during these years always has shown a high level of oxidation, JH8B-CE has had three periods of low-level oxidation. One of these low-oxidation periods was eliminated by subculturing in thiosulfate medium.

JH1-DA, JH1-DP, JH6-L and JH9-CE have demonstrated continuous cycling between high and low levels of oxidation. We found that change from low to high level of oxidation which might occur spontaneously (sometimes after two to six months) could be induced by growing in thiosulfate.

3.2 Development on solid media and oxidation of iron and thiosulfate Fig. 1 shows the different bacterial colonies observed in this work. The solid media revealed for types of colonies in the media: Wild-type, white, large

spreading and iron-oxidizing slimy colonies. The wild type colonies are generally circular, 1 mm diameter, with entire or lobated

margin, with a pailla-like protusion in the center dark brown with a yellow-orange band just outside the brown colony.

The white colonies were circular, transparent, 1 mm colonies.


1356

The LSC colonies were flat and 1-3 cm in diameter. Growth seemed to be limited for the other colonies. They had a reddish- brown center, 1-2 diameter, surrounded by a 2-5 mm white yellow halo. The rest of the colony was white, with lobated borders (Fig. 1A and 1B).

The IOS colonies were convex, reddish brown to yellow, significantly larger than the wild type (JH6-L showed a 3 cm colony of this type), with a mucoid consistency (Fig. 1A and 1C).

In modified solid medium 100:10 JH1-DP formed white colonies. Two isolated colonies were picked and transferred to tubes containing 5 ml iron liquid media. In one of them, was obtained 20% iron oxidation whereas in the other the iron oxidation was total. Triplicate samples of one microliter of these cultures were poured on two plates of soft modified 10:10 agar. After 4 days, three of the plates from tubes that obtained 20% iron oxidation showed LSC (Large Spreading Colony) phenotype. Plates from 100% iron oxidation showed IOS (Iron- Oxidizing Slimy) variants.

JH1-DA and JH6-L in modified 10:10 soft agar showed LSC colonies and IOS colonies.

JH8B-CE showed wild type colonies, iron oxidation slimy variants, and, in some cases circular clearings visible against a lawn of wild type colonies (Fig. 2).

3.3 Presence of ISAfe1 The presence of ISAfe1 in JH8-CE and JH9-CE was evaluated by PCR amplification

using ISAfe1 internal primers. The expected PCR product for ISAfe1 is 407 pb, which was confirmed by agarose gel electrophoresis.

Figure 1. Colonies of A. ferroxidans. Upper left: LSC limited by IOS variants, upper right: LSC and wild type colonies (WT), lower left: IOS and lower right: wild type colonies. JH8A-CE always showed typically A. ferrooxidans colonies: flat, 1-2 mm, reddish brown


1357

Figure 2. Colonies of A. ferroxidans in modified 10:10 iron media. Arrow points to circular clearings observed in this media

Figure 3. Characterization of PCR amplified products. Lane 1 shows molecular weight marker DNA (400 pb), lane 2 and 3 show JH9-CE and lanes 4 and 5 show JH8-CE

4. DISCUSSION A. ferrooxidans is a microorganism which, under toxic conditions, grows resistant

forms and is able to survive. Nature has helped it. To date three insertion sequences and two transposes in different strains of A. ferrooxidans, have been reported [6, 10, 11, 12].

However, only few phenotypes may be related to the presence of these elements. One of them ISAfe1 is related to a swarming phenotype. ISAfe1 also is associated with loss of Fe(II) oxidation due to the reversible transposition of the insertion into resB, encoding a putative cytochrome c-type biogenesis protein [9]. As JH1-DP, JH1-DA, JH6-L and JH9 have showed the LSC phenotype directly related to loss of iron oxidation and loss of arsenopyrite oxidation ability, it is very probable that these strains also have the insertion sequence ISAfe1in the resB gene. Phenotypes related to movement of ISAfe1 have been shown by these strains with very high frequency Additional studies are needed in order to find factors inducing these insertion movements

Several species are able to form expanding colonies on the surface of semisolid growth media by means of swarming motility. Development of a swarming phenotype requires a series of environmental and intracellular signals [20], including polysaccharide formation [21]. Large Spreading Colonies (LSC) are directly associated to ISAfe1. However, the mucoid consistency of the iron-oxidation slimy (IOS) variants might be related to special insertion zones ISAfe1 or other IS. Our results have shown that IOS variants are related to the formation of LSC.


1358

A Tn5468 transposon which has been reported in A. ferrooxidans [12], can be located in the glmU gene. This gene lies upstream to the pst operon, which encodes a phosphate-specific transport system. Phosphate is very important in the arsenopyrite leaching process, because is one of the few nutrients added in industrial operations [21]. In our strains, transfer of one strain with low activity to a fresh medium where more phosphate is available does not always result in a change of activity; this will suggest that activity might not be related to the Tn5468.

All the strains reported here showed very high level of arsenic resistance. The oxyanions of arsenic are quite toxic. In E. coli and other bacteria, bacterial operons encoding resistance to arsenicals and antimonials can be found on transmissible plasmids and in chromosomes. These operons usually have either three (arsRBC) or five (arsRDABC) genes [15]. In A. ferrooxidans chromosomal arsenic resistance genes arsBCH as well as a putative ars R gene has been demonstrated [16].

The present work also reports the presence of ISAfe1 in JH8-CE, who shows a very stable arsenopyrite oxidation during these years. Insert of ISAfe1 does not ocurr into genes related to iron oxidation.

One of our strains presented clearing zones in A. ferrooxidans solid cultures. This strain showed wild type phenotype clearing zones resembling plaques from bacteriophages or bdellovibrios. Schrader and Holmes [7] described plaques resembling bacteriophages in LSC colonies.

Five years ago, we inoculated 20 flasks of arsenopyrite cultures from JH8-CE and one flasks of each JH1-DA, JH1-DP, JH9-CE and JH6-L. During these years, all 24 cultures were transferred periodically and were provided with identical care and environmental conditions. However, 25% of JH8-CE cultures, whereas 100% survival was observed for all other cultures. JH1-DA, JH1-DP and JH6-L have phenotypes related to movement of ISAfe1.

ACKNOWLEDGMENTS This work represents part of the research for a PhD in the Universidad Peruana

Cayetano Heredia (J. Hurtado). I thank BH Consultores for chemical assays.

REFERENCES 1. A.P. Harrison, Arch. Microbiol.,131 (1982), 3451. 2. D.P. Kelly and A.P. Wood, Int. J. Syst. Evol. Microbiol. 50 (2000) 511. 3. D.S. Holmes and R.U. Haq. In: J. Salley, R.G.L. McCready and P.L. Wichlacz (eds.)

Biohydrometallurgy, Otawa: Canadian Centre for Mineral and Energy Technology, 1989.

4. T. F. Kondratyeva, L.N.Muntyan and G.I. Karavaiko, Microbiol., 141 (1995) 1157 5. Yates, J.R. and D.S. Holmes, J. Bacteriol. 169 (1987) 1861 6. D. S. Holmes, J.R. Yates and J. Schrader. In: P. R. Norris and D.P. Kelly (eds.)

Biohydrometallurgy. Science and Technology Letters. 1988 7. J. A. Schrader and D.S. Holmes, J. Bacteriol., 170 (1988) 3915. 8. D.S. Holmes, H. Zhao, G. Levican, J, Ratouchnick, J. Bonnefoy, P. Varela and E.

Jedlicki. J. bacteriol., 183 (2001) 4323. 9. M.E. Cabrejos, H. Zhao, M. Guacucano, S. Bueno, G. Levican, E. García, E. Jedlicki

and D. S. Holmes, FEMS Microbiol. Let. 175 (1999) 223 10. Α. Clennel, B. Johnston and D. E. Rawlings, App. Environ. Microbiol., 61(1995)

4223.


1359

11. L. Chakravarty, J.D. Kittle and O.H. Tuovinen, Can. J. Microbiol., 43 (1997) 503 12. J. C. Oppon, R.J. Sarnovsky, Nancy L. Craig and D. E. Rawlings, J. Bacteriol., 180

(1998) 3007. 13. S. A. Shuey, Eng. & Min. J., pp 16. May 1999. 14. J.E. Hurtado, J.L. Bauer, H. Maldonado, E. Cruz and E. Lazcano, In: G.I.Karavaiko,

G. Rossi and Z.A. Avakyan (eds.) International Seminar on Dump and underground bacterial leaching metals from ores. UNEP/USSR Centre for International Projects. 1990.

15. C. Rensing, M. Ghosh and B.P. Rosen, J. Bacteriol., 181 (1999) 5891. 16. B. G. Butcher, S.M. Deane and D.E. Rawlings, App. Environ. Microbiol. 66 (2000)

1826. 17. J.E. Hurtado and A. Berastain, In: Biohidrometallurgical Processing, T. Vargas, C.A.

Jerez and H. Toledo (eds.) University of Chile, 1995. 18. 0.H. Tuovinen and D.P. Kelly, Arch. Microbiol., 88 (1973) 285. 19. Ausubel, F.M., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K.

Strhul.1992, Current protocols in Molecular biology, Greene Publishing, N.Y.. 20. P.W. Lindum, U. Anthoni, C: Christophersen, l. Eberl, S. Molin and M. Givskov, J.

Bacteriol., 180 (1998) 6384. 21. A. Toguchi, M. Siano, M. Burkhart and R.M. Harshey, J. Bacteriol., 182 (2000) 6308. 22. D.E. Rawlings and S. Silver, Bio/Technology, 13 (1995) 773.



1361

Searching for physiological functions regulated by the quorum sensing autoinducer AI-1 promoted by afeI/afeR genes in

Acidithiobacillus ferrooxidans

C. Farah, A. Banderas, C.A. Jerez and N. Guiliani*

Millenium Institute for Advanced Studies in Cell Biology and Biotechnology, Faculty of Sciences, University of Chile, Santiago, Chile

Abstract Acidithiobacillus ferrooxidans (former Thiobacillus ferrooxidans) is one of the main

acidophilic chemolithotrophic bacteria involved in the bioleaching of metal sulfide ores. Different reports revealed the capacity of A. ferrooxidans to develop biofilms and the use of immobilized A. ferrooxidans cells seems to be a promising method especially to improve the rate of ferrous iron oxidation.

Gene regulation mediated by acyl homoserine lactone (acyl-HSL) (also known as AI-1) has been shown to influence many physiological functions in Gram-negative and Gram-positive bacteria. Biofilm formation is one of them, and interest in acyl-HSL-mediated quorum sensing and bacterial biofilm formation has increased in recent years. Biofilm maturation requires the synthesis of AI-1 by a member of the LuxI protein family and a member of the transcriptional regulator LuxR protein family which senses AI-1 in a cell-density-dependent manner. The purpose of our study was to identify the physiological functions of A. ferrooxidans regulated by AI-1 quorum sensing with a specifical interest in biofilm formation.

The bioinformatic analysis of the incomplete genomic sequence of A. ferrooxidans ATCC 23270 allowed us to identify two open reading frames encoding for proteins with high similarities to LuxI and LuxR family members. We called these ORFs afeR and afeI. They are both located in the same genetic locus but have opposite orientations, as it has been described for Aeromonas hydrophila. Looking for a sequence similar to a lux box, we identified an 18 bp inverse repeat sequence upstream of the afeR gene which could correspond to the putative DNA binding site for a transcriptional regulator. We have successfully isolated the afeR and afeI genes by PCR procedures. Both genes and subsequences encoding different parts of the AfeR carboxyl domain have been cloned independently in overexpression vectors. We are currently studying the regulation of the expression of these genes and the functionality of AfeR in A. ferrooxidans.

Keywords: quorum sensing, Acidithiobacillus ferrooxidans, biofilm

* Corresponding author: [email protected]


1362

1. INTRODUCTION Acidithiobacillus ferrooxidans is a chemolithoautotrophic acidophilic Gram-negative

bacterium that belongs to the γ subdivision of the proteobacteria group (1) and obtains its energy from the oxidation of ferrous iron or reduced sulfur compounds. From the different studies of A. ferrooxidans, it is possible to underline two important points: the role of the interaction bacteria/ore in bioleaching process (2) and the second one, is the lack of an efficient and readily available technique to transfer genetic material with a high frequency (3).

A. ferrooxidans develops biofilm structures and presents morphological modifications during the cellular adhesion process (4-6). Moreover, A. ferrooxidans active biofilms have been described during pyrite oxidation (7, 8) and it has been demonstrated that A. ferrooxidans biofilms are resistant to various acid washes (9).

An analysis of the unfinished bacterial genomes database has revealed the presence of different open reading frames encoding for proteins involved in type IV secretion system in A. ferrooxidans (10). Independently, it is accepted that A. ferrooxidans has a flagellum apparatus (also known as type III secretion system) which seems to be involved in adhesion mechanisms (11, 12).

In many Gram-negative bacteria, development of biofilm structure and the secretion system are controlled by a quorum sensing response (13, 14). Initially described in the marine bacterium Vibrio fischeri (15), it is now accepted that quorum sensing is a widespread phenomenon in bacteria. Quorum sensing is a cell density-dependent process that enables bacterial cells to establish a cell-cell communication and to regulate the expression of specific genes in response to local changes in cell-population density. This provides bacteria the means to coordinate their activities in order to function as a multicellular unit (16, 17). Among Gram-negative bacteria and depending of the auto-inductor (AI) molecule, two quorum sensing processes have been described: AI-1 which is involved in intraspecies communication and AI-2, related to interspecies communications (17, 18).

In V. fischeri, the quorum sensing AI-1 regulatory system is composed of the activator LuxR, a cis-acting DNA inverted repeat called the lux box, and the AHL signal molecule which is synthetized by the bacterial LuxI protein. LuxR and LuxI protein families have been initially defined based on the different studies on the lux operon from Vibrio sp. (19, 20) and confirmed by a phylogenetic study of 76 individual LuxI and LuxR homologues which have demonstrated an early origin during the evolution of Proteobacteria and assumed coevolution for the LuxI/LuxR regulatory cassettes (21). The signal diffuses freely between the cellular and external environments and complexes with LuxR protein only at high population density (22). The AHL-LuxR complex then binds to the lux box: 20-nucleotide inverted repeat centered 44 nucleotides upstream of the start site of the luminescence operon. In Agrobacterium tumefaciens similar 18-bp boxes, tra boxes, are found upstream the TraR-regulated promoters (23).

Our working hypothesis is that A. ferrooxidans, like many Gram-negative bacteria, possesses a quorum sensing mechanism that could regulate some important physiological functions such as biofilm formation and secretion apparatus synthesis which are important in bioleaching process. We have just started research to determine if A. ferrooxidans possesses a quorum sensing system and the kind of physiological functions it would control.


1363


2.1 Bacterial strains, growth conditions and cloning vectors The A. ferrooxidans ATCC 19859 and ATCC 23270 strain were used in this work.

Growth in ferrous iron was done at 30°C in modified 9K medium as described before (24, 25). The E. coli strains TOP10F’ and BL21(DE3) were grown in Luria-Bertani (LB) medium (26) at 37°C.

We used the pCRT7/NT (Invitrogen®) expression vector to clone the different amplified DNA fragments.

2.2 Genomic analysis Genomic analysis was done by using ORF finders, Blast and Structural Domain

Database from NCBI site (http://www.ncbi.nlm.nih.gov/) and the GCG software package (27) to walk on the genome up- and downstream to the afe locus and to analyse the intergenic sequence.

2.3 DNA manipulations The different recombinant clones were selected by PCR in colony. The plasmids from

positive recombinant clones were purified by Wizard Miniprep Kit (Promega®) and by QUIAGEN® plasmid Kit according to the manufacturer’s recommendations. The different recombinant plasmids used in expression experiments were sequenced using the Applied Biosystems Hitachi technologies in the laboratory of Genetics, Faculty of Sciences, University of Chile and transformed in E. coli BL21(DE3) strain.

2.4 Primers and PCR conditions The oligonucleotide primers were designed on the basis of the genome sequence and

purchased from PROLIGO Corporation®. Taq (Promega®) and Pwo (Roche®) polymerases were used according to the manufacturer’s recommendations. The general PCR conditions were as follows: 3 min at 95°C, followed by 20 cycles at 95°C for 30s, X°C for 30s, 72°C for Ys, and then 3 min at 72°C. For each fragment we used a specific couple [X,Y] depending of the primer Tm and fragment size: afeI gene [65ºC, 30 s], afeR gene [72ºC, 40 s] and for the afeR carboxy-subdomain [69ºC, 40 s].

2.5 Western immunoblotting The total cell proteins separated by SDS-PAGE were electroblotted onto a

polyvinylidene difluoride (PVDF) Immobilon P (Millipore®) membrane as described by Towbin (28), by employing the Trans-Blot Cell System (BioRad®). For the antigen-antibody reaction, the membrane was treated with mouse antibody against His-Tag (Amersham®) serum, as the primary antibody (1:2,500 dilution), and monoclonal anti-mouse antibodies conjugated with peroxidase (Amersham®) as the secondary antibody (1:3,000 dilution).


3.1 Genome analysis By analyzing the incomplete genome sequence from A. ferrooxidans ATCC 23270,

we found two open reading frames located in the same locus but in opposite orientations


1364

(Fig. 1A). We called them afeI and afeR. Upstream afeR coding region, there were a Shine and Delgarno sequence and a promoter box. More interestingly, an 18-nucleotide inverted repeat centered 52 nucleotides upstream of putative afeR transcription site was seen (Fig. 1B). We called this sequence r-box since it could play a regulatory role similar to that of lux- and tra boxes. In a similar way, AfeR could form a dimeric asymmetric structure to be functional, as it occurs with LuxR and TraR (29).

Both afeI and afeR ORFs encode for two putative proteins which present 60% and 64% similarity with proteins BveR and BveI from Burkholderia cepacia respectively, both members of the LuxI and LuxR proteins family (Figs. 2 and 3). The deduced proteins AfeI and AfeR have 183 and 215 amino acids, molecular masses of 19.9 kDa and 23.7 kDa and theorical isoelectric points of 5.77 and 8.96, respectively.

Figure 1. Identification of the A. ferrooxidans putative genes afeR and afeI and a putative afe box. A, The bioinformatic analysis of the A. ferrooxidans ATCC 23270 incomplete genome revealed the presence of two ORFs, afeR and afeI. B, the sequence analysis of the intergenic region revealed the presence of a putative afe box (boxed bold letters) which is typically centered 52 nucleotides upstream of a putative +1 transcription start site (arrow). Underlined bold nucleotides represent a putative –10 box. SD underlined nucleotides represent a putative Shine and Delgarno site located 8 bp upstream the afeR initiation codon (bold ATG)

Figure 2. Multiple protein sequence alignments of N-acyl-L-homoserine lactone synthase (AHLS). The putative AHLS from A. ferrooxidans (AfeI) was aligned using the NCBI conserved domain database with consensus sequence (Cons) which was generated by multiple alignments of 12 protein sequences belonging to the LuxI protein family. Identical and conserved residues are denoted by * and º respectively


1365

3.2 Structural Analysis of The Transcriptional Regulator AfeR Like the LuxR-type proteins, AfeR appeared to be composed of two functional

domains (Fig. 3): the AHL binding domain located in the 2/3 amino terminal part and the DNA binding domain in the carboxyl terminal third (30, 31). Based on this result, we assume that the structure of AfeR could be similar to the TraR structure (Fig. 4) and deletion of the N-terminal domain of AfeR could result in a constitutively active transcriptional regulator without autoinducer (29, 32, 33). The crystal structure presents an asymmetric homodimer (Fig. 4A) whereas the Agrobacterium auto-inductor (AAI) is completely embedded in an enclosed cavity of 200 Å between five-stranded antiparallel β-Sheets and three helices in the amino-terminal domain (Fig. 4B). While the DNA binding domain is conformed by four α-helices where the two central helices conform the HTH motif.

Figure 3. Characterization and location of the two putative AfeR functional subdomains. The two putative AfeR functional subdomains have been aligned with the consensus sequences (Cons) for the Autoinducer Binding Domain (A) and the HTH-LuxR Domain (B) by the NCBI conserved domain database. Both subdomain consensus sequences were generated by multiple alignments of protein sequences belonging to the LuxR protein family. Identical and conserved residues are denoted by * and º, respectively. Boxes denote the putative α-helices involved in the HTH motif. C, protein sequence location of the autoinducer and HTH subdomains


1366

Figure 4. AAI-TraR complex structure. Structural representations of the AAI-TraR asymmetric dimeric complex (A) and AAI binding domain (B). The structures were obtained by using the Swiss-PdbViewer program (33) and the data file 1H0M (28) from the Protein Data Base (PDB). The structure of the autoinducer domain enclosed in the broken line square (A) was amplified in B

3.3 In vivo expression of the afeI and afeR genes in E. coli The PCR-amplified DNA fragments corresponding to the complete afeI and afeR

genes and a partial afeR sequence encoding for 141 amino acids of the AfeR carboxyl subdomain were cloned in the pCRT7/NT vector and used to overproduce in E. coli BL21(DE3) the A. ferrooxidans recombinant proteins including His-Tag in their N-terminal ends. All the recombinant plasmids were analysed by sequencing to confirm the constructions (results not shown). As Fig. 5A shows, there was an increased level of synthesis of three protein bands (arrows) with the expected molecular weights for the different recombinant polypeptides AfeI, AfeR and AfeR141. For an unknown reason, these products were not strictly under the control of the lac promoter and they were expressed with or without 1 mM IPTG. To confirm that these different protein bands corresponded to the expected chimeric polypeptides, the total proteins of the corresponding cells were subjected to Western Blotting by using an antibody against His-Tag (Fig. 5B). All the protein bands overexpressed clearly gave a positive result with the antibody against His-Tag.

4. CONCLUSION By genome sequence analysis and PCR techniques, we have isolated and cloned in an

overexpression vector the afeI and afeR genes and DNA fragments from A. ferrooxidans encoding for 78 (result not shown) and 141 amino acids of AfeR carboxyl-terminal subdomain. All the polypeptides were overexpressed in E. coli.

This is the first report about quorum sensing studies in A. ferrooxidans. Obviously, further studies will be necessary to understand the regulation of the expression of the afeRI genes and the role of this quorum sensing system in the regulation of other important physiological functions in A. ferrooxidans.


1367

Figure 5. Expression of AfeI, AfeR and AfeR141 proteins from A. ferrooxidans in E. coli BL21(DE3). The afeI (1) and afeR (2) genes and an afeR141 DNA subfragment (3) were amplified by PCR using Pwo Polymerase and a low number of cycles. The amplified fragments were cloned in the pCRT7/NT expression vector which were employed to transform E. coli strain BL21(DE3). All the recombinant strains were grown until D.O = 0.4-0.5 and induced (+) or not (-) with 1 mM IPTG for 6 h. The total cell proteins from each recombinant bacterial strains were separated by SDS-PAGE and stained with Coomassie Blue (A) or were subjected to Western Blotting employing antibodies against His-Tag (B). The black symbols ( , •, g) indicate the different overproduced recombinant proteins

ACKNOWLEDGMENTS This research was supported by grants DID I-02/4-2 from the Universidad de Chile

and ICM P99-031-F.

REFERENCES 1. D. Kelly and A. Wood Int. J. Syst. Evol. Microbiol., 50 (2000) 511. 2. R. Arredondo, A. Garcia and C.A. Jerez Appl. Environ. Microbiol., 60 (1994) 2846.


1368

3. Z. Liu, N. Guiliani, C. Appia-Ayme, F. Borne, J. Ratouchniak and V. Bonnefoy J. Bacteriol., 182 (2000) 2276.

4. D. Karamanev J. Biotechnol., 20 (1991) 51. 5. J. Blais, R. Tyagi, N. Meunier and J. Auclair Process Biochem., 29 (1994) 475. 6. W. Sand, T. Gehrke, R. Hallmann and A. Schippers Appl. Microbiol. Biotechnol., 43

(1995) 961. 7. J. Rojas, M. Giersig and H. Tributsch Arch. Microbiol. 163 (1995), 352. 8. C. Pogliani and E. Donati, Process. Biochem. 35 (2000) 997. 9. M. Oprime and O. Garcia Jr. In International Biohydrometallurgy Symphosium, Part

A. Ouro Preto, Minas Gerais. Brazil (2001), 369. 10. P. Christie and J. Vogel Trends Microbiol., 8 (2000) 354. 11. A. DiSpirito, M. Silver, L. Voss and O. Tuovinen Appl. Environ. Microbiol., 43

(1982) 1196. 12. N. Ohmura, K. Tsugita, J. Koizumi and H. Saiki J. Bacteriol., 178 (1996) 5776. 13. V. Sperandio, M. Jay, W. Nguyen, S. Shin and J. B. Kaper Proc. Natl. Acad. Sci.

U.S.A., 96 (1999) 15196. 14. K. Sauer, A. Camper, G. Ehrlich, J. W. Costerton and D. J. Davies Bacteriol., 184

(2002) 1140. 15. K. Nealson and J. Hastings Microbiol. Rev., 43 (1979) 496. 16. N. Whitehead, A. Barnard, H. Slater, N. Simpson and G. Salmond FEMS Microbiol.

Rev., 25 (2001) 365. 17. S. Winans and B. Bassler J. Bacteriol., 184 (2002) 873. 18. B. Bassler Cell., 109 (2002) 421. 19. J. Engebrecht and M. Silverman Nucleic Acids Res. 15 (1987), 10455. 20. B. Bassler, M. Wright, R. Showalter and M. Silverman Mol. Microbiol., 9 (1993) 773. 21. K. Gray and J. Garey Microbiology., 147 (2001)2379. 22. C.Fuqua, S. Winans and E. Greenberg J. Bacteriol., 176 (1994) 269. 23. C. Fuqua and S. Winans J. Bacteriol., 178 (1996) 435. 24. P. Ramírez, H. Toledo, N. Guiliani and C. A. Jerez Appl. Environ. Microbiol., 68

(2002) 1837. 25. N. Guiliani and C. A. Jerez, Appl. Environ. Microbiol., 66 (2000) 2318. 26. J. Sambrook, E. F. Fritsch and T. Maniatis (eds.), Molecular cloning; a laboratory

manual, Cold Spring Harbor, N. Y. (1989). 27. Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wisc. 28. H. Towbin, T. Staehelin and J. Gordon, Proc. Natl. Acad. Sci. U.S.A., 76 (1979) 4350. 29. A.Vannini, C. Volpari, C. Gargioli, E. Muraglia, R. Cortese, R. De Francesco, P.

Neddermann and S. Marco EMBO J., 21 (2002) 4393. 30. S. Choi and E. Greenberg J. Bacteriol., 174 (1992) 4064. 31. Z. Luo and S. Farrand Proc. Natl. Acad. Sci., 96 (1999) 9009. 32. R. Zhang, T. Pappas, J. Brace, P. Miller, T. Oulmassov, J. Molyneaux, J. Anderson,

J.Bashkin, S. Winans and A. Joachimiak Nature., 417 (2002) 971. 33. S. Choi and E. Greenberg Proc. Natl. Acad. Sci. U.S.A., 88 (1991) 11115. 34. N. Guex and M.C. Peitsch Electrophoresis 18 (1997) 2714.



1369

Systematic analysis of our culture collection for "genospecies" of Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans

and Leptospirillum ferrooxidans

D. Mitchell1, K. Harneit1, G. Meyer1, W. Sand1*, E. Stackebrandt2 1 Universität Hamburg, Institut für Allgemeine Botanik, Abteilung Mikrobiologie,

Ohnhorststr. 18, 22609 Hamburg, Germany 2 Deutsche Sammlung von Mikroorganismen und Zellkulturen, DSMZ,

Mascheroder Weg 1b, 38124 Braunschweig, Germany

Abstract A strain collection of leaching bacteria containing 42 strains of Acidithiobacillus (At.)

ferrooxidans, 17 strains of At. thiooxidans, and 26 strains of Leptospirillum ferrooxidans was investigated by genomic methods. The strains originate from mining sites all over the world. In previous studies, some of these strains have been characterised physiologically and partly genetically resulting in the notion that these species need to be subdivided on the basis of genomic differences. Following extraction of genomic DNA, a 566 bp fragment of the 16S rRNA gene was amplified by the polymerase chain reaction (PCR) and the resulting fragments analysed by denaturing gel electrophoresis (DGGE) in a 40 to 70% urea-formamide gradient. In case of At. ferrooxidans and L. ferrooxidans, 5 different subgroups emerged, while 3 subgroups were found among strains of At. thiooxidans. For sequence analyses of the 16S rRNA genes, one strain of each ermerging subgroup was chosen. The findings confirmed the results of the DGGE analyses. The subgroups 1 to 4 of At. ferrooxidans showed a similarity between 98.2% and 99% with each other. The representative of subgroup 5 is only distantly related to the type strain of At. ferrooxidans ATCC 23270T, but comparably close to strain DSM 2392, which in turn is related to the genus Nevskia (although lithotrophic growth at pH 2 with ferrous iron occurs). The 3 subgroups of At. thiooxidans were only distantly related among each other. In case of L. ferrooxidans subgroups 1 and 3 had a rDNA identity of 99.5% and 98.8% with the type strain DSM 2705T. The only strain of subgroup 2 had a value of 98.5% to the recently defined type strain L. ferriphilum (ATCC 49881T). The remaining 2 subgroups 4 and 5 were not included in this analysis.

Keywords: DGGE, 16S rRNA, At. ferrooxidans, At. thiooxidans, L. ferrooxidans

* Corresponding author. Mailing address: Universität Hamburg, Institut für Allgemeine Botanik, Abteilung Mikrobiologie, Ohnhorststr. 18, 22609 Hamburg, Germany. Phone: + 49 40 42816 423, Fax: + 49 40 42816 423. Email: [email protected]


1370

1. INTRODUCTION The interest in biodiversity of prokaryotic microorganisms from extreme habitats has

increased constantly during the past decades. One reason is the understanding that, once isolated from these locations, these microorganisms may represent life in the early periods of earth. Another reason is the potential application of these extremophilic bacteria in various industrial and biotechnological processes, e.g. as suppliers for enzymes or as biocatalysts. Among these, acidophilic prokaryotes from habitats with extreme low pH are of great interest [1] for the industrial exploitation of metals or coal. Though more gentle than chemical leaching, bioleaching may result in environmental pollution of the surroundings of piles and mines, termed "acid mine drainage" [2-4]. The bacteria involved in this processes belong to the genus Thiobacillus, Acidithiobacillus and Leptospirillum [5-10].

Since the first description by Beijerinck [11], taxonomists were aware about the heterogeneity of the genus Thiobacillus. However, reclassification into different species or genera was not possible due to insufficient information about genetic and physiological differences [12]. Only when DNA-DNA hybridisation and sequence analysis of 16S rRNA genes were introduced into systematics, it became possible to analyse the degree of interrelationship within the genus Thiobacillus. As a result, it became obvious that the members of the genus Thiobacillus are distributed in the α-, β- and γ-subclasses of the proteobacteria [13-15]. As a consequence, Thiobacillus versutus was transferred into the genus Paracoccus [16,17], and Thiobacillus acidophilus was moved to the genus Acidiphilium [18]. Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thermosulfatus and Thiobacillus cuprinus were reclassified by Moreira and Amils [19] as species of the new genus Thiomonas. Kelly and Wood [20] established three new genera, embracing eight Thiobacillus species: Halothiobacillus was described for Thiobacillus neapolitanus, Thiobacillus halophilus, and Thiobacillus hydrothermalis; Thermithiobacillus contained the former Thiobacillus tepidarius; Acidithiobacillus was established for the phylogenetically very closely related species Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus caldus, and Thiobacillus albertis. The genera Acidithiobacillus, Thermithiobacillus, and Halothiobacillus belong in the γ-subclass of the proteobacteria [20]. Further analysis indicated that even the species At. ferrooxidans and At. thiooxidans were phylogenetically heterogeneous [21-23].

The polyphyletic genus Leptospirillum was suggested by Lane et al. [13], De Wulf-Durand et al. [24], and Hippe [25] to constitute an independent class of the proteobacteria. Also L. ferrooxidans consists of genetically different strains [26].

Using denaturing gradient gel electrophoresis (DGGE) and sequence analysis of 16S rRNA genes it was the goal of this study to analyse the degree of genomic heterogeneity of At. ferrooxidans, At. thiooxidans and L. ferrooxidans.


2.1 Bacterial strains, media and growth Cultures of At. ferrooxidans, At. thiooxidans, and L. ferrooxidans are listed in Tables

1, 2 and 3, respectively. Growth of iron-II-ion oxidizing bacteria was done in a medium as described by Mackintosh [27] at pH 2.0 and 28°C. Sulfur-oxidizing bacteria were cultivated according to Hutchinson [28] at pH 4.5 and 28°C. Acidiphilium acidophilum


1371

was grown according to Harrison [29] and Ferromicrobium acidophilus was kept according to Johnson [30].

Table 1. Designation and origin for strains of At. ferrooxidans Strain Origin R1 Ilba mine, Romania R2 Ilba mine, Romania R4 Ilba mine, Romania R5 Ilba mine, Romania R6 Ilba mine, Romania R7 Ilba mine, Romania R8 Ilba mine, Romania R9 Ilba mine, Romania R10 Ilba mine, Romania WVa Coal mine, Preston County, West Virginia, USA WR1 Uranium waste heap, Ronneburg, Germany WR2 Uranium waste heap, Ronneburg, Germany WR3 Uranium waste heap, Ronneburg, Germany A1 Ore from Rammelsberg, Goslar, Germany A2 Ore from Rammelsberg, Goslar, Germany A-4 Copper mine, Rincón Andacollo, Chile A-6 Copper mine, Vista Hermosa, Andacollo, Chile C-52 Copper mine, St.Rita Combarbala, Chile D-26 Copper mine, Disputa de las Condos, Chile AS1 Hamburg, Germany AS2 Garbage dump, Hamburg, Germany 2Y Yellowstone, USA Yellow3 Yellowstone, USA Yellow4 Yellowstone, USA Yellow7 Yellowstone, USA Yellow8 Yellowstone, USA SPIII/3 Cartagena, Spain SPIII/7 Cartagena, Spain F221 Uranium mine, Forstau, Austria Chile 1 unknown Van IB Ilba, Valea Ardeleana, Romania DECp Sulfur spring, New Mexico, USA LP Coal mine, West Pennsylvania, USA 2B Copper mine, Rammelsberg, Goslar, Germany DSM 583 Coal mine, Pennsylvania, USA ATCC 19859 Copper mine drainage, British Columbia, Canada ATCC 23270* Copper mine drainage, USA 13598 p Copper mine, Bingham Canyon, Utah, USA BKM-b-458 Coal pile, Moscow, Russia F 427 Ore heap, Düsseldorf, Germany RAM 6F Rammelsberg, Goslar, Germany PH Coal seam, Randolph county, Missouri, USA


1372

Table 2. Designation and origin for the strains of At. thiooxidans Strain Origin W R A Uranium waste heap, Ronneburg, Germany W R B Uranium waste heap, Ronneburg, Germany W R C Uranium waste heap, Ronneburg, Germany DSM 504 Soil, New Yersey, USA DSM 622 Lake, Göttingen, Germany DSM 9463 Bioreactor, Australia ATCC 19377* Sulfur lake, Libya RAM 8T Copper mine drainage, Goslar, Germany K6 Sewage pipeline, Hamburg, Germany K16 Sewage pipeline, Hamburg, Germany 365 Minzenschwand, Germany R20 Ilba mine, Romania B Ore from Rammelsberg, Goslar, Germany BKM-b-460 Sulfur deposit, Razdol, Russia Van IB Yellowstone, USA IY-3 Coal mine, Pennsylvania, USA AS3 Yellowstone, USA

Table 3. Designation and origin for the strains of L. ferrooxidans Strain Origin R3 Ilba mine, Romania (ATCC 49879) R30 Ilba mine, Romania (ATCC 49880) R31 Ilba mine, Romania R32 Ilba mine, Romania R33 Ilba mine, Romania R34 Leach heap, Rosia Poieni, Romania R35 Leach heap, Rosia Poieni, Romania R36 Leach heap, Rosia Poieni, Romania R37 Leach heap drainage, Roisa Poieni, Romania R38 Baia Sprie mine, Romania R39 Baia Sprie mine, Romania R40 Baia Sprie mine, Romania AS1 Yellowstone, USA US1 unknown BKM-b-1339 Copper deposit, Lagerdy, Armenia Van IB Ilba, Valea Ardeleana noua, Romania Robin Stockpile, Romania DSM 2705* Copper deposit, Armenia DSM 2391 Copper mine drainage, Gramatikovo, Bulgaria ATCC 49879 Ilba mine, Romania(=R3) ATCC 49880 Ilba mine, Romania(=R30) ATCC 49881 Isolated from mixed culture (=P3A), origin Peru P3A Isolated from mixed culture (ATCC 49881), origin Peru Lf ag unknown 29 Opencast mining, Ronneburg, Germany S53 Rammelsberg, Goslar, Germany


1373

2.2 DNA extraction Bacterial DNA was extracted according to Jayarao et al. [31]. Enzymatic lysis of

bacterial cells was followed by phenolic extraction and alcoholic precipitation of DNA. Yield and quantity was checked by agarose gel electrophoresis. The DNA extract was resuspended in 15 µl TAE buffer and stored until processing at -20°C.

2.3 PCR amplification PCR amplifications were carried out to synthesize 566 bp long 16S rRNA gene

fragments, using the primer pair 341 F GC (5'-CGCCCGCCGCGCGCGGCGG GCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-3') and 907 R (CCGT CAATTC(AC)TTTGAGTT-3'). 2 µl of extracted chromosomal DNA was mixed in a 0,5 ml PCR-tube with 50 pmol oligonucleotide primers each, 200 µmol of dNTPs each, 1 mmol of MgCl2, 5µl of 10x PCR-Buffer (Peqlab), and 2,5 units of TaqPolymerase (Peqlab). The reaction mixture was filled up to a total volume of 50 µl with sterile PCR-water and coated with two drops of mineral oil as evaporation protection. The PCR reaction was performed in a thermocycler (Minicycler PTC 150, Biozym) as a touchdown program [32]. Amplification steps were as follows: Initial denaturation of genomic DNA at 92°C for 180s followed by primer annealing at 68°C and elongation at 72°C for 60s. Then, denaturation was performed during cycles 2 to16 at 92°C for 45 s each, elongation at 72°C for 60s each, while simultaneously stepwise the annealing temperatur was decreased down to 57°C. The next 13 cycles were run at 92°C for 45s, 57°C for 60s und 72°C for 60s. A terminal elongation step was at 72°C for 300s.

2.4 Denaturing gradient gel electrophoresis DGGE analysis was carried out in a vertical gel chamber (Protean II, Biorad) using

16x18 cm glas sheets and 1.5 mm spacers as well as 25 well loading combs. Further details relating to experimental construction are described in [33-37]. The gradient used for DGGE analysis was in the range between 40% to 70% urea-formamide. Each lane was loaded with approximately 100 ng of a PCR product. Gels were run in 1x TAE buffer (40 mmol Tris, 20 mmol Na-acetate, and 1 mmol Na-EDTA at pH 7.4) at 60°C. Initially, 200 volts for 10 minutes were applied to allow the DNA migrate into the gel, followed by 100 volts for 18 hours. DNA patterns were visualised by silver staining.

2.5 DNA sequencing Sequencing of PCR products was carried out as described by Rainey et al. [38].

Purified PCR products were sequenced directly using the Taq DyeDeoxy Terminator Cycle sequencing kit (Applied Biosystems). An Applied Biosystems 373A DNA genetic analyser was used for the electrophoresis of the sequence reaction products. The ae2 editor [39] was used to align the 16S rDNA sequences of the strains analyzed against the sequences available in public databases. Pairwise evolutionary distances were computed using the correction of Jukes and Cantor [40].

3. RESULTS The 42 strains of At. ferrooxidans could be divided into 5 subgroups, due to the

different melting points of their 16S rDNA gene fragments. Figure 1 shows a DGGE profile of subgroup 2 plus the type strain ATCC 23270T, which is a member of subgroup 1. Each DGGE gel contained a G+C ladder in lane 1 to facilitate orientation and comparability between gels. This ladder was made from 16S rDNA gene fragments of the


1374

type strains of: 1. At. ferrooxidans ATCC 23270 (G+C content of 56,7 mol%); 2. At. thiooxidans DSM 9463 (57,2 mol%); 3. L. ferrooxidans DSM 2705 (57,4 mol%); 4. Acidiphilium acidophilum DSM 700 (57,6 mol%); and 5. Ferromicrobium acidophilus T-2 (60,4 mol%).

Figure 1. DGGE-pattern of 19 strains of At. ferrooxidans. The PCR-amplified 16S rDNA fragment is about 566 bp long and correlates with position 341 to 907 in the 16S rRNA gene of E. coli. Strain designations and origin see Table 1. DGGE-gel with urea-formamide gradient (40 to 70%), 18h at 100V. Lane 1 contains G+C ladder from 1: At. ferrooxidans ATCC 23270, 2: At. thiooxidans DSM 9463, 3: L. ferrooxidans DSM 2705, 4: Acidiphilium acidophilum DSM 700, 5: Ferromicrobium acidophilus T-23

An overview of the distribution of 42 strains of At. ferrooxidans in five subgroups is

shown in Table 4.

Table 4. Distribution of 42 strains of At. ferrooxidans into 5 subgroups. Strains selected for 16S rRNA gene sequence analyses are in bold Subgroup 1: 13598 p, A1, A2, AS2, ATCC 19859, ATCC 23270, BKM-b-458, DSM 583, F

427, R6, RAM 6F, WR1 Subgroup 2: 2B, A-4, C-52, Chile 1, DECp, F221, LP, R1, R2, R4, R5, R7, R8, R9, R10, Van

IB, Wva, WR3 Subgroup 3: 2Y, A-6, AS1, D-26, PH, Yellow 3, Yellow 4, Yellow 7, Yellow 8 Subgroup 4: SPIII/7, WR2 Subgroup 5: SPIII/3

For subsequent 16S rDNA sequence analysis one strain of each of the 5 subgroups were selected (Table 4). Representatives of subgroups 1 to 4 exhibited between 98.2% to 99.0% sequence similarity among themselves. Strain SPIII/3, however, shows 99.6%


1375

sequence identity to strain DSM 2392, which belongs to a separate line within the γ-proteobacteria, comprising members of Gallionella and Nevskia.

The 17 strains of At. thiooxidans were subdivided into three subgroups (Table 5) (DGGE-gels not shown).

Table 5. Distribution of 17 strains of At. thiooxidans into 3 subgroups. Strains selected for 16S rRNA gene sequence analyses are in bold Subgroup 1: 365, AS3, ATCC 19377, BKM-b-460, DSM 504, DSM 622, DSM 9463, K6,

K16, R20, RAM 8T, Van IB, WRA, WRB, WRC Subgroup 2: B Subgroup 3: 1Y-3

For further sequence analysis the strains R20, B, and 1Y-3 were selected. The data

(not shown) indicate that these strains are only quite distantly related to each other. It may thus be speculated that strain B and strain 1Y-3 are probably not related with the species At. thiooxidans, but represent two as yet undescribed species.

DGGE analyses of the 26 strains of L. ferrooxidans yielded 5 subgroups (Table 6) (gels not shown).

Table 6. Distribution of 26 strains of L. ferrooxidans into 5 subgroups. Strains selected for 16S rRNA gene sequence analyses are in bold Subgroup 1: AS1, ATCC 49879, ATCC 49880, BKM-b-1339, DSM 2705, R3, R30, R32,

R33, R34, R35, R36, R37, Robin, US1, Van IB Subgroup 2: 29, ATCC 49881, LF ag, P3A, R38, R39, R40 Subgroup 3: R31 Subgroup 4: S53 Subgroup 5: DSM 2391

The subgroups 4 and 5 could not be analysed due to technical problems. R30 and R31 have 99.5% and 98.8% sequence identity, respectively, to the type strain DSM 2705T of L. ferrooxidans. Strain R38 shows a 98.5% sequence similarity to the recently described second species within the genus Leptospirillum, L. ferriphilum [26].

4. DISCUSSION Research performed within the past decades aimed at characterizing the physiological

and genomical variability of strains of At. ferrooxidans, At. thiooxidans, and L. ferrooxidans. The findings revealed a considerable heterogeneity of strains contained under these species [21-26]. Having this in mind, the strain collection of these three species were characterized by an molecular approach. The results clearly indicate that the 42 strains of the "species" At. ferrooxidans fall into one of 5 different subgroups. While strains of subgroups 1 to 4 seem to be closely related, strain SPIII/3 represents an own line within the γ-proteobacteria, branching adjacent to members of the iron-bacterium Gallionella and to Nevskia. The 17 strains of At. thiooxidans were subdivided into 3 groups. Following 16S rRNA gene sequence analysis data we postulate that the strains B and 1Y-3 belong to two new species. Strains of the species L. ferrooxidans are also not genomically homogeneous as at least five subgroups were determined. Strains of subgroup 2 belong to the species L. ferriphilum, recently described by Coram and Rawlings [26].

In conclusion, the assignment of strains included in this study to DGGE-pattern-defined subgroups, is in total agreement with the cluster analysis based on 16S rDNA gene


1376

sequences. Thus the "species" At. ferrooxidans, At. thiooxidans and L. ferrooxidans embrace several "genospecies" that need to be subjected to thorough phenotypic testing in order to decide whether they can be described as individual species or subspecies.

REFERENCES 1. Johnson, D. B. 1998. Biodiversity and ecology of acidophilic microorganisms. FEMS

Microbiol. Ecol. 27: 307-317. 2. Colmer, A. R., and Hinkle, H. E. 1947. The role of microorganisms in acid mine

drainage: a preliminary report. Science 106: 253-256. 3. Lowell, H. L. 1983. Coal mine drainage in the United States - an overview. Water. Sci.

Techn. 15: 1-25. 4. Schippers, A., Hallmann, R., Wentzien, S. and Sand, W. 1995. Microbial diversity in

uranium mine waste heaps. Appl. Environ. Microbiol. 61: 2930-2935. 5. Touvinen, O. H. and Kelly, D.P. 1972. Biology of Thiobacillus ferrooxidans in

relation to the microbiological leaching of sulfide ores. Z. Allg. Microbiol. 12: 311-346.

6. Sand, W., Rohde, K., Sobotke, B. and Zenneck, C. 1992. Evaluation of Leptospirillum ferrooxidans for leaching. Appl. Environ. Microbiol. 58: 85-92.

7. Hallmann, R., Friedrich, A., Koops, H. P., Pommering-Röser, A., Rohde, K., Zenneck, C. and Sand, W. 1992. Physiological characteristics of Thiobacillus ferrooxidans and Leptospirillum ferrooxidans and physicochemical factors influence microbial metal leaching. Geomicrobiol. J. 10: 193-206.

8. Rawlings, D. E. and Kusano, T. 1994. Molecular Genetics of Thiobacillus ferrooxidans. Microbiol. Rev. 58: 39-55.

9. Schrenk, M. O., Edwards, K. J., Goodman, R. M., Hamers, R. J. and Banfield, J. F. 1998. Distribution of Thiobacillus ferrooxidans and Leptospirillum ferrooxidans: Implications for Generation of Acid Mine Drainage. Science 279: 1519- 1522.

10. Rawlings, D. E., Tributsch, H. and Hansford, G.S. 1999. Reasons why `Leptospirillum´-like species rather than Thiobacillus ferrooxidans are the dominant iron-oxidizing bacteria in many commercial processes for the biooxidation of pyrite and related ores. Microbiology 145: 5-13.

11. Beijerinck, M. W. 1904. Über die Bakterien, welche sich im Dunkeln mit Kohlensäure als Kohlenstoffquelle ernähren können. Centralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. II 11: 593-599

12. Kelly, D. P. and Harrison, A. P., JR.. 1989. Genus Thiobacillus. In Bergey’s Manual of Systematic Bacteriology, 1st edn, vol.3, pp 1842-1458. Edited by J. T. Staley, M. P. Bryant, N. Pfennig and J. G. Holt. Baltimore: Williams and Wilkins.

13. Lane, D. J., Harrison, A. P., JR., Stahl, D., Pace, B., Giovannoni, S. J., Olsen, G. J. and Pace, N. R. 1992. Evolutionary Relationships among Sulfur- and Iron-Oxidizing Eubacteria. J. Bacteriol. 174: 269-278.

14. Donald, I. R., Kelly, P. D., Murrell, J. C. and Wood, A. P. 1997. Taxonomic relationship of Thiobacillus halophilus, T. aquaesulis, and other species of Thiobacillus, as determined using 16S rDNA sequencing. Arch. Microbiol. 166:394-398.

15. Goebel, B. M., Norris, P. R. and Burton, N.P. 1999. Acidophiles in biomining. Appl. Microbial Sys. Edited by F. G. Priest and M. Goodfellow. Dordrecht: Kluwer.

16. Katayama, Y., Hiraishi, A. and Kuraishi, H. 1995. Paracoccus thiocyanatus sp. nov., a new species of thiocyanate-utilizing facultative chemolitotroph, and transfer of


1377

Thiobacillus versutus to the genus Paracoccus as Paracoccus versutus comb. nov. with emendation of the genus. Microbiology 141: 1469-1477.

17. Rainey, F. A., Kelly, D. P., Stackebrandt, E., Burghardt, J., Hiraishi, A., Katayama, Y. and Wood, A. P. 1999. A re-evaluation of the taxonomy of Paracoccus denitrificans and a proposal for the creation of Paracoccus pantotrophus comb. nov. INT. J. Syst. Bacteriol. 49: 645-651.

18. Hiraishi, A., Nagashima, K. V. and Katayama, Y. 1998. Phylogeny and photosynthetic features of Thiobacillus acidophilus and related acidophilic bacteria: its transfer to the genus Acidiphilium as Acidiphilium acidophilum comb. nov. Int. J. Syst. Bacteriol. 48: 1389-1398.

19. Moreira, D. and Amils, R. 1997. Phylogeny of Thiobacillus cuprinus and other mixotrophic thiobacilli: proposal for Thiomonas gen. nov.. Int. J. Syst. Bacteriol. 47: 522-528.

20. Kelly, D. P. and Wood, A. P. 2000. Reclassification of some species of Thiobacillus to the newly designated genera Acidithiobacillus gen. nov., Halothiobacillus gen. nov. and Thermithiobacillus gen. nov.. Int. J. Sys. Evol. Microbiol. 50: 511-516.

21. Harrison, A.P., JR. 1982. Genomic and Physiological Diversity Amongst Strains of Thiobacillus ferrooxidans, and Genomic Comparison with Thiobacillus thiooxidans. Arch. Microbiol. 131: 68-76.

22. Pizarro, J., Jedlicki, E., Orellana, O., Romero, J and Espejo, R. T. 1996. Bacterial Populations in Samples of Bioleached Copper Ore as Revealed by Analysis of DNA Obtained before and after Cultivation. Appl. Environ. Microbiol. 62: 1323-1328.

23. Paulino, L. C., Bergamo, R. F., De Mello, M. P., Garcia, O., Manfio, G. P. and Ottoboni, L. M. 2001. Molecular characterization of Acidithiobacillus ferrooxidans and A. thiooxidans strains isolated from mine wastes in Brazil. Antonie van Leeuwenhoek 80: 65-75.

24. De Wulf-Durand, P., Bryant, L. J. and Sly, L. I. 1997. PCR-Mediated Detection of Acidophilic, Bioleaching-Associated Bacteria. Appl. Environ. Microbiol. 63: 2944-2948.

25. Hippe, H. 2000. Leptospirillum gen. nov. (ex Markosyan 1972), nom. rev., including Leptospirillum ferrooxidans sp. nov. (ex. Markosyan 1972), nom. rev. and Leptospirillum thermoferrooxidans sp. nov. (Golovacheva et al. 1992). Int. J. Sys. Evol. Microbiol. 50: 501-503.

26. Coram, N. J. and Rawlings, D. E. 2002. Molecular Relationship between Two Groups of the Genus Leptospirillum and the Finding that Leptospirillum ferriphilum sp. nov. Dominates South African Commercial Biooxidation Tanks That Operate at 40°C. Appl. Environ. Microbiol. 68: 838-845.

27. Mackintosh, M.E. 1978. Nitrogen fixation by Thiobacillus ferrooxidans. J. Microbiol. 105: 215-218.

28. Hutchinson, D. N. and Thompson, K. M. 1965. The taxonomy of certain thiobacilli. J. Gen. Microbiol. 3: 357-366.

29. Harrison, A. P., JR. 1981. Acidiphilium cryptum gen. nov., sp. nov., heterotrophic bacterium from acidic environments. Int. J. Syst. Bacteriol. 31: 327-332.

30. Johnson, D. B. 2002 (pers. comm.) 31. Jayarao, B. M., Dore, J. J., Baumbach, G. A., Matthews, K. R. and Oliver, S. P. 1991.

Differentiation of Streptococcus uberis from Streptococcus parauberis by polymerase chain reaction and restriction fragment length polymorphism of 16S ribosomal DNA. J. Clin. Microbiol. 12: 2774-2778.


1378

32. Don, R. H., Cox, P. T., Wainwright, B. J., Baker and K., Mattick, J. S. 1991. Touchdown PCR to circumvent spurious priming during gene amplification. Nucl. Acids Res. 19: 4008.

33. Muyzer, G. 1999. DGGE / TGGE a method for identifying genes from natural ecosystems. Current Opinion in Microbiology 2: 317-322.

34. Muyzer, G., Brinkhoff, T., Nübel, U., Santegoeds, C., Schäfer, H. and Wawer, C. 1998. Denaturing gradient gel electrophoresis (DGGE) in microbial ecology. Mol. Microbial Ecol. Manual 3.4.4: 1-27.

35. Muyzer, G., De Waal, E. C. and Uitterlinden, A. G. 1993. Profiling of Complex Microbial Populations by Denaturing Gradient Gel Electrophoresis Analysis of Polymerase Chain Reaction-Amplified Genes Coding for 16S rRNA. Appl. Environ. Microbiol. 59: 695-700.

36. Muyzer, G., Ramsing, N. B. 1995. Molecular Methods to Study the Organization of Microbial Communities. Wat. Sci. Tech. 32: 1-9.

37. Muyzer, G. and Smalla, K. 1998. Application of denaturing gel electrophoresis (DGGE) and temperature gel electrophoresis (TGGE) in microbial ecology. Antonie van Leeuwenhoek 73: 127-141.

38. Rainey, F.A., Ward-Rainey, N., Kroppenstedt, R.M. and Stackebrandt, E. 1996. The genus Nocardiopsis represents a phylogenetically coherent taxon and a distinct actinomycete lineage: proposal of Nocardiopsaceae fam. nov. Int J Syst Bacteriol 46, 1088-1092.

39. Maidak, B.L., Cole, J.R., Parker, C.T., JR and 11 other authors. 1999. A new version of the RDP (Ribosomal Database Project). Nucleic Acids Res 27, 171-173.

40. Jukes, T.H. and Cantor, C.R. 1969. Evolution of protein molecules. In Mammalian Protein Metabolism, vol. 3, pp21-132. Edited by H.N. Munro. New York: Academic Press.



1379

The strain genotypic heterogeneity of chemolithotrophic microorganisms

T.F. Kondrat’eva, T.A. Pivovarova, L.N. Muntyan, S.N. Ageeva and G.I. Karavaiko

Institute of Microbiology, Russian Academy of Sciences, Pr. 60-letiya Oktyabrya 7, k. 2, Moscow, 117312 Russia*

Abstract The study on the role of bacterial strain diversity and variability in

biohydrometallurgical processes is one of the key tasks on a way to increase the rate and efficiency of leaching of valuable metals from sulfide ores and concentrates. More than 100 strains of Acidithiobacillus ferrooxidans and other bacteria (A. thiooxidans, Sulfobacillus thermosulfidooxidans, S. sibiricus, Leptospirillum ferrooxidans) and archae (Acidianus brierleyi, Ferroplasma acidiphilum) were isolated from various econiches and dense pulps of the concentrates used in bacterial-chemical technologies under mesophilic conditions. The strain heterogeneity of chemolithotrophic bacteria A. ferrooxidans was evidenced from the genotype characteristics, such as: (i) the G+C content in DNA (56-58%); (ii) genome size (2.2⋅109 – 2.8⋅109 Da); (iii) DNA-DNA homology values (4 genomovars and 6 strains with the relatedness level of 13 to 43% were distinguished between); (iv) 16S rDNA sequence (all the studied strains were subdivided into 3 phylogenetic groups lying in just the same cluster); (v) chromosomal DNA structure (each strain is characterized by a unique chromosomal DNA structure analyzed by pulsed-field gel electrophoresis of native DNA digested by the same restriction endonuclease); (vi) plasmid profile (the strain were shown to differ in the number and size of plasmids). The main environmental factors that cause the genotype diversity of chemolithotrophic microorganisms are energy substrate and metal ions. Mutation and insertion processes result in the intraspecies variability and microevolution of bacteria.

Keywords: chemolithotrophic microorganisms, strain polymorphism, chromosomal DNA, plasmids, adaptation

1. INTRODUCTION As is well known, the species diversity of acidophilic chemolithotrophic

microorganisms, capable to obtain energy from oxidation of Fe2+, S2-/S° and sulfide minerals, is relatively minor in mesophilic communities. Thus, our studies have demonstrated that the Gram-negative bacteria Acidithiobacillus ferrooxidans hold the

* This work was supported by grants nos. 00-15-97765 and 01-04-48270 from the Russian Foundation for Basic Research and by grant within the scope of the Federal Central Scientific and Technical Program "Technology of the Living Systems".


1380

dominating position among the members of microbial communities isolated from natural habitats or dense pulps of sulfide ores and concentrates used in bacterial-chemical processes of gold recovery and non-ferrous metal leaching. The second place in terms of the number is occupied usually by A. thiooxidans. Also, representatives of the Gram-positive bacteria of the genus Sulfobacillus are almost always found in these communities, along with Leptospirillum ferrooxidans and the archae belonging to Acidianus brierleyi and Ferroplasma acidiphilum species. The quantitative proportions of these microorganisms are changed depending upon the surrounding conditions in natural habitats.

In general, not species but the strains, possessing the maximum growth rate and the highest activity of oxidizing an energy source in given conditions in comparison with the other strains, participate in biohydrometallurgical processes, as well as in other microbial technologies. This is why selection of highly efficient strains that are resistant to extreme factors under permanently changing surrounding conditions and have great adaptive potentialities is a very important task.

Yet, the study on a role of bacterial strain diversity and variability in biohydrometallurgical processes has not attracted a proper attention, albeit, in our view, is one of the key issues in solving the problems related to increasing the efficiency of valuable metals recovery from sulfide ores and concentrates.

The aim of this work was to study the genotypic diversity of acidophilic chemolithotrophic bacterial strains with a focus on revealing such characteristics as the G+C content in DNA, the genome size, the DNA-DNA homology level, nucleotide sequences of 16S rRNA genes, the chromosomal DNA structure, and plasmid profiles and to elucidate a role of energy substrates and content of metal ions in microevolution of these bacteria.

2. MATERIALS AND METHODS More than 100 strains of different species of microorganisms: Acidithiobacillus

ferrooxidans, A. thiooxidans, Sulfobacillus thermosulfidooxidans, S. sibiricus, Leptospirillum ferrooxidans, Acidianus brierleyi, and Ferroplasma acidiphilum were isolated from various environments (mine waters, ore deposits and ore concentrates, dens pulps obtained by processing complex sulfide concentrates). Batch cultivation of these microorganisms was performed on a shaker (180 rpm) in 250-ml Erlenmeyer flasks, containing 100 ml medium or in 5 l flasks containing 3 l medium at temperature: 28°C for A. ferrooxidans, A. thiooxidans, L. ferrooxidans; (42-48)°C for S. thermosulfidooxidans; 55°C for S. sibiricus; 65°C for A. brierleyi and (35-42)°C for F. acidiphilum. The composition of media used for cultivation of A. ferrooxidans, A. thiooxidans and L. ferrooxidans was described in [1]; for S. thermosulfidooxidans in [2], for A. brierleyi in [3], for F. acidiphilum in [4]. The initial pH of the medium was from 1.8-2.0 to 4.5 depending on the microorganism. Inoculum was introduced into the growth medium in amounts 10% v/v.

Strain polymorphism in chromosomal DNA was analyzed by pulsed-field gel electrophoresis [5]. The G+C content of DNA, genome size, analysis of the total genome by DNA-DNA hybridization, nucleotide sequences of the 16S rDNA were studied as in [6]; interaction of chromosomal and plasmid DNA - as in [7].


1381

3. RESULTS

3.1 Strain polymorphism in chromosomal DNA from chemolithotrophic microorganisms

3.1.1 Chromosomal DNA structure Most clearly, the genotypic polymorphism of chemolithotrophic microbial strains

manifested itself in the structure of their chromosomal DNA analyzed by pulsed-field gel electrophoresis (PFGE) of fragments formed upon cleavage of native DNA by restriction endonucleases. Earlier, the strain polymorphism of chromosomal DNA structure was noted in strains of the Gram-negative bacteria A.ferrooxidans [5], of the Gram-positive bacteria S thermosulfidooxidans [2], and in strains of archae A.brierley [3]. As seen from the restriction patterns (fig. 1), each strain of A. thiooxidans, S. sibiricus, and F. acidiphilum were characterized by the specific profile - the number and size of chromosomal DNA fragments. The PFGE analysis of chromosomal DNA can successfully be used to identify new strains, to detect the known strains in biotechnological processes and experiments, and to gain more insight into factors and mechanisms responsible for the strain variability.

Figure 1. Restriction patterns of chromosomal DNA from different strains of acidophilic chemolithoautotrophic microorganisms: A – A. thiooxidans: (1) TTA, (2) TTMt, (3) TTN-d, (4) size marker. B – S. sibiricus: (1) N1, (2) size marker, (3) B2, (4) OSSO. C – F. acidiphilum: (1) Y-1, (2) size marker, (3) Y-2, (4) Y-3, (5) Y-4. Restriction endonucleases: (A) XbaI, (B) NotI, (C) XhoI. PFGE conditions were 13 V/cm, 10-s pulse, 68 h run at 12-14°C. At the right side is indicated a size of DNA fragments, Kbp


1382

3.1.2 The G+C content of DNA and genome size The studied A. ferrooxidans strains differed in the G+C content in DNA which varied

from 56.1 to 58.1 mol % and in the genome size (2.2⋅109 - 2.8⋅109Da). The most frequent genome size was (2.3 – 2.4)⋅ 109Da, and the most frequent G+C content was about 57 mol%.

3.1.3 Similarity analysis of the total genomes by DNA-DNA hybridization The DNA-DNA hybridization analysis of twenty-three A. ferrooxidans strains showed

their considerable genetic heterogeneity (Fig. 2). The strains were divided into four groups characterized by a high degree of genome similarity. Such genome groups are presently called as genomovars. The studied A. ferrooxidans strains were divided into four genomovars, and six strains with the relatedness level of 13 to 43% could be referred to none of the genomovars. The data of DNA-DNA hybridization indicated a high genotypic divergence of A. ferrooxidans strains.

Figure 2. The approximate relatedness dendrogram of A. ferrooxidans strains derived from the DNA-DNA hybridization data. The scale bar corresponds to the level of genome similarity

3.1.4 Nucleotide sequences of the 16S rDNA We determined nearly complete nucleotide sequences (about 1450 nucleotides) of the

16S rRNA genes of five A. ferrooxidans strains: the type strain ATCC 23270T (genomovar 1), strain TFN-d (genomovar 2), strain TFY (genomovar 3), and strains TFI and TFD (genomovar 4). According to the results of this analysis, most of A. ferrooxidans strains fell into three phylogenetic groups [6]. All newly studied A. ferrooxidans strains belonged to the major phylogenetic cluster, which included also A. thiooxidans strains. The type


1383

strain A. ferrooxidans fell within phylogenetic group I, strain TFN-d fell within group II, and strains TFI, TFD, and TFY fell within phylogenetic group III.

Strains of the species A. ferrooxidans isolated from different habitats exhibited a considerable genotypic diversity, which manifested itself in a noticeable divergence of their 16S rRNA gene sequences, a low similarity level of the total DNA, and significant differences in the structure of chromosomal DNA revealed by PFGE.

3.2 Polymorphism of A. ferrooxidans plasmid profiles We studied plasmid profiles of twenty-seven A. ferrooxidans strains, which were

isolated from various geographic sites and substrates with different composition of main sulfide minerals or were selected in experiments and possessed an elevated resistance to heavy metal ions [8]. Of twenty strains isolated from various substrates, cells of sixteen A. ferrooxidans strains harbored one to four plasmids of different size. Plasmids were found in all the strains from gold-containing arsenopyrite ores and concentrates, in nine of eleven strains isolated from non-ferrous metal ores and concentrates, and only in half the strains from mine waters, pyrite-containing coals, and active sludge. A proportion of plasmid-free strains was as greater as the simpler was composition of substrates. It is not excluded that plasmids participate in regulation of energy substrate oxidation.

3.3 Changes in chromosomal DNA structure of chemolithotrophic microorganisms during adaptation to new energy substrates or increased concentrations of metal ions Earlier, the changes in chromosomal DNA structure in the result of an adaptation to

new energy substrates were noted in strains of the Gram-negative bacteria A. ferrooxidans [9, 10] and the Gram-positive bacteria S. thermosulfidooxidans [2]. In this work, changes in the structure of chromosomal DNA at a metabolic switch from Fe2+ oxidation for S° oxidation were demonstrated also for representatives of the other kingdom - Archae. Thus, an additional 75⋅103 -bp fragment appeared in a XhoI-restriction pattern of chromosomal DNA from the archae F.acidiphilum strain Y-4 (fig. 3).

As to several A.ferrooxidans strains, we studied a correlation of experimentally acquired resistance to copper, arsenic, nickel, mercury, zinc, and ferric oxide ions to the chromosomal DNA structure. Each strain was characterized the specific threshold concentration of metal ions at which it could grow and oxidize ferrous iron. Changes in the chromosomal DNA structure were revealed only for the TFI-Fe strain with a greater experimentally acquired resistance to 50 g Fe3+ /l [11]. These changes did not disappear after multiple passages on a medium with 9 g/l of ferrous iron. In such a way, a new strain with changed chromosomal DNA structure (in comparison to the parent strain) was obtained under experimental conditions using the medium with a great content of Fe3+ ions. Evidently, the formation of new microbial strains under an influence of varying metal ion concentrations may occur in natural conditions.


1384

Figure 3. XhoI-restriction patterns of chromosomal DNA from strains of F. acidiphilum Y-4: (1) size marker, (2) on the medium with S°, (3) on the medium with Fe2+. PFGE conditions are as in legend to fig. 1

3.4 Changes in plasmid profiles of A. ferrooxidans strains adapted to new energy substrates In a next series of experiments, we studied the plasmid profiles of A. ferrooxidans

strains that were grown on the medium with ferrous iron and then adapted to various oxidation substrates: S°, FeS2, or sulfide concentrate. Cells of the A. ferrooxidans strain TFL-2 grown on Fe2+-containing medium harbored one plasmid, whereas two plasmids occurred in the strains TFO, TFBk, and TFV-1 and three plasmids, in the strain TFN-d. Several strains, i.e. TFL-2, TFO, and TFBk, displayed the unchanged plasmid copy number depending upon the oxidized substrate. While, adaptation of the strain TFN-d to sulfide concentrate or adaptation of the strain TFV-1 to sulfur, pyrite, or sulfide concentrate was followed by changes in the number of plasmids.

Evidently, there are no common patterns in response of different strains to changing oxidation substrates, but a metabolic switch for the oxidation of a new substrate sometimes was accompanied by changes in the plasmid profile. Albeit plasmids of this species are considered as cryptic, our data suggest their possible participation in adaptation to changing environmental factors and in exchange of genetic information between plasmid and chromosomal DNA. This exchange manifested itself, for example, in localization of expressed genes responsible for Hg-resistance on chromosomal DNA and localization of single defect operone genes on a plasmid pTF-FC2 of A. ferrooxidans [12].

3.5 Interaction of chromosomal and plasmid DNA in cells of A. ferrooxidans strains adapted to new energy substrates Plasmids of the strain TFBk served as probes for Southern hybridization with blots of

chromosomal DNA fragments from several A. ferrooxidans strains adapted to various energy substrates. In particular, the pattern of hybridization of chromosomal DNA fragments from the strain TFBk, adapted to S°, FeS2, or sulfide concentrate, to pTFK2 isolated from this strain is presented in Figure 4. Many fragments of chromosomal DNA from all the studied strains showed weak hybridization signals. In some cases, we


1385

observed the changes in localization of weakly signaling hybridization bands (indicated with double arrows) if A.ferrooxidans cells were pre-adapted to new substrates. Chromosomal DNA of all the studied strains TFBk, TFN-d, TFL-2, TFO, TFV-1 contained multiple nucleotide sequences complementary to those in the plasmid of the strain TFBk. Due to the relatively small size as judged by a low intensity of hybridization signals, multiplicity, and localization on chromosomal and plasmid DNA, these sequences can be referred to IS-elements that previously were found in the A. ferrooxidans genome by Holmes et al. [13]. The changes in localization of IS-elements in the result of an adaptation to new energy substrates led us to assume the participation of these elements in such an adaptive mechanism. Earlier, it was assumed by Holmes et al. [13] that these transposable elements of the genome are involved in the mechanism of adaptation to changing environmental conditions, in evolution of gene structure and functions, in regulating the gene expression, and in genetic information exchange between different strains.

More intense signals of DNA hybridization to plasmid pTFK2 were noted (fig. 5, indicated by arrows) in comparison to multiple low-intensity signals as in the case of pyrite-adapted strains TFO and TFN-d. Possibly, cells of the above listed strains contained plasmids with long nucleotide sequences, homologous to plasmid pTFK2 of the strain TFBk. Intense hybridization signals may arise due to an insertion of plasmid DNA into the chromosomal DNA at the metabolic switch for oxidation of a new energy substrate.

Thus, our studies demonstrated the possibility of chromosomal and plasmid DNA interaction in A. ferrooxidans strains during adaptation to new energy sources. This mechanism may be invoked in intraspecies variability that underlies the microevolution processes, resulting in the appearance of strain genotypic polymorphism.

Figure 4. А. XbaI-restriction patterns of chromosomal DNA from A. ferrooxidans strain TFBk adapted to new energy substrates: (1) size marker, (2) plasmid DNA of the strain TFBk, (3) Fe2+, (4) S°, (5) FeS2, (6) sulfide concentrate. PFGE conditions were 12 V/cm, 25-s pulse, 44 h run at 13°C (here and on Fig. 5). B. Radioautograph of XbaI-fragments of chromosomal DNA from A. ferrooxidans strain TFBk hybridized with pTFK2 DNA of this strain


1386

Figure 5. A. XbaI-restriction patterns of chromosomal DNA from A. ferrooxidans strains TFO (1) and TFN-d (2), adapted to FeS2 В. Radioautograph of XbaI-fragments of chromosomal DNA from the strains hybridized with pTFK2 DNA of TFBk strain

4. CONCLUSION Taken together, the obtained data support that the strains of acidophilic

chemolithotrophic microorganisms possess the high adaptive potentiality and widely ranging reaction norms due to their evolution in extreme and frequently changing environmental conditions in nature. Furthermore, microevolution of these microorganisms is accelerated in biohydrometallurgical processes in which highly dense pulps, great concentrations of metal ions, and ultra-low pH values are rather common. For this reason, the genotypic strain polymorphism of acidophilic chemolithotrophic microorganisms should be considered in biotechnology. As demonstrated in our numerous studies, the introduced strains, if they were not isolated from an oxidized substrate, are replaced by the natural aborigine strain, which is better adapted to a given substrate and a complex of conditions created in pulps.

Undoubtedly, an intimate "substrate-strain" relation must be considered when trying to achieve the maximum rate and efficiency of biohydrometallurgical processes.

ACKNOWLEDGEMENTS Authors thanks T.I. Bogdanova, V.S. Melamud and T.A. Tsaplina for supplying

Sulfobacillus sibiricus strains.

REFERENCES 1. G.I. Karavaiko, G. Rossi, A.D. Agate, S.N. Groudev, and Z.A. Avakyan (eds.),

Methods of isolation, evaluation and studying of microorganisms, Centre for international projects GKNT, Moscow, 1988.

2. T.F. Kondrat'eva, V.S. Melamud, I.A. Tsaplina, T.I. Bogdanova, A.A. Senyushkin. T.A. Pivovarova and G.I. Karavaiko, Microbiology, 67 (1998) 13.

3. T.F. Kondrat'eva, T.A. Pivovarova and G.I. Karavaiko, Microbiology, 68 (1999) 443.


1387

4. O.V. Golyshina, T.A. Pivovarova, G.I. Karavaiko, T.F. Kondrat,eva, E.R.B. Moore, W.-R. Abraham, H. Lunsdorf, K.N. Timmis, M.M. Yakimov and P.N. Golyshin, Int. J. Syst. Evol. Microbiol., 50 (2000) 997.

5. T.F. Kondrat'eva, L.N. Muntyan and G.I. Karavaiko, Microbiology UK, 141 (1995) 1157.

6. G.I. Karavaiko, T.P. Turova, T.F. Kondrat'eva, A.M. Lysenko, T.V. Kolganova, S.N. Ageeva, L.N. Muntyan and G.I. Karavaiko, Int. J. Syst. Evol. Microbiol, 53 (2003) 113.

7. T.F. Kondrat'eva, V.N. Danilevich, S.N. Ageeva and G.I. Karavaiko, Microbiology, 73 (2004) 308.

8. T.F. Kondrat'eva, S.N. Ageeva, L.N. Muntyan, T.A. Pivovarova and G.I. Karavaiko, Microbiology, 71 (2002) 319.

9. T.F. Kondrat'eva, T.A. Pivovarova, L.N. Muntyan and G.I. Karavaiko, Microbiology, 65 (1996) 59.

10. T.F. Kondrat'eva, T.A. Pivovarova and G.I. Karavaiko, Microbiology, 65 (1966) 675. 11. T.F. Kondrat'eva, T.A. Pivovarova, L.N. Muntyan and G.I. Karavaiko,

Biohydrometallurgy and the environment toward the mining of the 21st century, R. Amils, A. Ballester (eds.), Elsevier, Amsterdam, Part B (1999) 89.

12. D.E. Rawlings and T. Kusano, Microbiological Reviews, 58 (1994) 39. 13. D.S. Holmes, J.R. Yates and J. Schrader, Biohydrometallurgy, P.R.Norris and

D.P.Kelly (eds.), Antony Rowe Ltd., Chippenham, Wiltshire, Great Britan (1988) 153.

Documents

Molecular Biology and Taxonomy - NTUAold-2017.metal.ntua.gr/uploads/4434/5_taxonomy.pdf · Molecular Biology and Taxonomy 1252 Likewise the location of these proteins with respect