1  

PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE

Facultad de Ciencias Biológicas Programa de Doctorado en Ciencias Biológicas

Mención Genética Molecular y Microbiología

MOLECULAR AND FUNCTIONAL CHARACTERIZATION OF NPR1 IN

PLANT RESPONSES TO ABIOTIC STRESS CONDITIONS

Thesis submitted to the Pontificia Universidad Católica de Chile as a partial requirement to qualify to the Ph.D. degree in Biological Sciences with mention in

Molecular Genetics and Microbiology

By: EMA OLATE

Thesis directors:

Dra. Loreto Holuigue Dr. Julio Salinas

October, 2017

 

 

2  

 

 

3  

ACKNOWLEDGMENTS

First and foremost, I wish to thank my advisor Dra. Loreto Holuigue for receiving me

in her laboratory, support me since the days I began working with her constant patience,

attention and professionalism. She given me the opportunity to collaborate and perform my

thesis in the laboratory of Dr. Julio Salinas. I thank Dr. Salinas for getting involved in my

investigation, directing and teaching me to get the best of it.

I remember my first partners in the Holuigue’s lab, and thank them for sharing the

beginnings of this thesis: Loreto, Eva, Marcela, Javier, Grace, Daniel, Anita, Aldo, Ariel and

my great friend Nathy. I also wish to extend many thanks to Salinas’s lab: Tamara, Raul,

Peter, Carlos, Diego, Almudena and especially to the best post docs: Nandy, Javier and

Rafa, all of them for help me in the emotional and academic field.

Finally, special recognition goes out to my family, for their support, encouragement

and patience during my very long Doctorate: Marcos, Jacqueline and Arturo. To my lovely

husband Rafa, who provided constant encouragement during the entire process.

This research was supported by grants BIO2013-47788-R from MINECO and

BIO2016-79187-R from AEI/FEDER, UE to Julio Salinas and by the FONDECYT regular

projects 1141202 (2014-2017) and 1100656 (2010-2013), and the Millennium Nucleus in

Synthetic Biology and Plant Systems Biology (2015-2017, NC130030), to Loreto Holuigue. I

was supported by the National PhD scholarship and a PhD Thesis Support scholarship

(24121288) from CONICYT and by CSIC, i-COOP+ (COOPA20054). I also received support

for my stay period by Vicerrectoría de Investigación of the Pontificia Universidad Católica de

Chile.

 

 

4  

SUBJECT INDEX

SUBJECT INDEX    

ACKNOWLEDGMENTS_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _3  SUBJECT INDEX _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _4  FIGURE INDEX_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 6  TABLE INDEX _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 7  ABREVIATIONS _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 8  EPIGRAPH _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 10  SUMMARY_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _11  ABSTRACT _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 14    SECTION 1  

1. THEORETICAL FRAMEWORK  1.1. Plant responses to stress _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __ _15 1.2. Acclimation to low temperature in plants _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _16 1.3. Signaling pathways involved in cold acclimation _ _ _ _ _ _ _ _ _ _ _ _ _17 1.4. Common mechanisms in response to cold and other abiotic and biotic

stress _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _20  1.5. Role and molecular mechanism of NPR1 in Arabidopsis _ _ _ _ _ _ _ _ 22  

2. REFERENCES _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _25   3. HYPOTHESIS AND OBJECTIVES _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 31    SECTION 2  Manuscript “NPR1 MEDIATES A NOVEL REGULATORY PATHWAY IN COLD ACCLIMATION BY INTERACTING WITH HSFA1 FACTORS IN ARABIDOPSIS THALIANA”   1. INTRODUCTION _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 33   2. RESULTS  

2.1.  NPR1 accumulates in response to low temperature _ _ _ _ _ _ _ _ _ _ _ 38  2.2. NPR1 positively regulates cold acclimation _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 43  2.3. Low temperature-induced monomerization and nuclear import of NPR1 are required for full development of cold acclimation _ _ _ _ _ _ _ _ _ _ _ _ _ _ _47 2.4. NPR1 activates cold-induced gene expression independently of the TGA transcription factors_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 50  2.5.    NPR1 promotes the cold induction of HSFA1-regulated genes_ _ _ _ _ 53  2.6.   HSFA1 transcription factors positively regulates cold acclimation by inducing heat stress-responsive gene expression under low temperature conditions _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _56 2.7. NPR1 interacts with HSFA1 transcription factors to activate cold-induced heat stress-responsive gene expression and cold acclimation _ _ _ _ _ _ _ _60  

3. DISCUSSION _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 64 4. MATERIALS AND METHODS  

 

 

5  

4.1. Plant materials _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 72  4.2.    Growth conditions and treatments _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 74  4.3.    Gene expression analysis and RNAseq experiments _ _ _ _ _ _ _ _ _ _ 75  4.4.    SA measurements _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 77  4.5.    Determination of GUS activity _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 77  4.6. Microscopy analysis _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 77  4.7.    Immunoblot analysis and subcellular fractionation _ _ _ _ _ _ _ _ _ _ _ _78  4.8.    Pull down assays_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 79  4.9.    Statistical analyses_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 80  4.10. Accession numbers _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _81  

5. LITERATURE_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 96    

SECTION 3  1. Conclusions _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 101  2. Projections _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _104  

 

 

6  

 FIGURE INDEX  

 Figure 1_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 41  Figure 2 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 45  Figure 3_ _ __ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _49  Figure 4 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 52  Figure 5 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 55  Figure 6 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 59  Figure 7 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 62  Figure 8 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 71  Figure Supplementary 1 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _42  Figure Supplementary 2 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _46  Figure Supplementary 3 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _63  Figure Supplementary 4 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _70    

 

 

7  

 TABLE INDEX  

Supplemental Data Set 1 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 82  Supplemental Data Set 2 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 87  Supplemental Data Set 3 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 89  Supplemental Data Set 4 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 90  Supplemental Data Set 5 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 93  Supplemental Data Set 6 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 94    

 

 

8  

ABREVIATIONS

ABA : Abscisic acid ABREs : ABA-responsive elements acd6 : Accelerated cell death 6 as-1 : Activation sequence 1 BOP2 : Blade-on-petiole 2 BRs : Brassinosteroids BTB/POZ : Bric-a-brac/POX virus and Zinc finger CBF : C-Repeat/DRE Binding factor Cks : Cytokinins Col-0 : Columbia COR : Cold-regulated CPR : Constitutive expresser of PR genes CRE : Cold-responsive elements CUL3 : Cullin-3 adapter for ubiquitin ligases proteins

DNA : Deoxyribonucleic acid DRE : Dehydration responsive elements EDTA : Ethylenediaminetetraacetic acid  ET : Ethylene Gas : Giberellins GFP : Green fluorescent protein HSFA1s : Heat Shock Transcription Factors 1 HSP : Heat Shock Proteins ICS1 : Isochorismate synthase 1 IPTG : Isopropyl β-D-1-thiogalactopyranoside JA : Jasmonic acid mRNA : Messenger RNA MS : Murashige-Skoog medium NahG : bacterial gene coding for salicylate hydroxylase NPR1 : Nonexpresser of PR Genes 1 PMSF : Phenylmethylsulfonyl fluoride PR : Pathogenesis-related PVDF : Polyvinylidene difluoride qPCR : Quantitative polymerase chain reaction ROS : Reactive oxygen species SA : Salicylic acid SAR : Systemic acquired resistance SDS : Sodium lauryl sulfate Siz : Small ubiquitin-like modifier E3 ligase SnRK2.8 : Snf1-Related Protein Kinase Tfs : Transcription factors TGA : Transcription factor family with conserved bZIP region TRXH3 : Thioredoxin H3

 

 

9  

TRXH5 : Thioredoxin H5 Ws : Wassilewskija  WT : Wild type YFP : Yellow fluorescent protein ZAT6 : Zinc finger of Arabidopsis thaliana 6

 

 

10  

EPIGRAPH

This scientific work contributed to the molecular knowledge of plant responses

to low temperature, describing a new signaling pathway for regulation of cold

acclimation. This pathway is mediated by Nonexpresser of PR Genes 1 (NPR1), the

master coregulator of the systemic response to pathogens attack. We demonstrate

that NPR1, which is transcriptionally and post-transcriptionally regulated by cold,

interacts with Heat Shock Transcription Factors 1 (HSFA1s), regulating a

transcriptional cascade to promote cold acclimation. Therefore, NPR1 represents an

integration node for pathogen and cold signaling, allowing plants to respond and

adapt to their fluctuating environment.

The first section of this thesis considers a discussion of the background

information that gives context and theoretical support to the main biological questions,

the hypothesis and objectives of this research.

The second section includes the manuscript entitled “NPR1 MEDIATES A

NOVEL REGULATORY PATHWAY IN COLD ACCLIMATION BY INTERACTING

WITH HSFA1 FACTORS IN ARABIDOPSIS THALIANA”, that will be submitted for

publication. This manuscript considers all the work done in this thesis.

Finally, the third section includes the main conclusions and projections of this

thesis work, considering the hypothesis and specific aims that motivated it.

 

 

11  

SUMMARY

Plants are sessile organisms that throughout evolution have developed

complex mechanisms to survive adverse environmental conditions, such as extreme

temperatures and pathogens attack. Plants exposed to low temperatures are able to

activate different adaptive response. One of them is cold acclimation, by which many

plants from temperate regions increase their constitutive freezing tolerance after

exposure to low, nonfreezing temperatures. Low temperature triggers signaling

pathways that activate transcriptional reprogramming and elicit a variety of

physiological and metabolic changes to promote cold acclimation. In Arabidopsis, two

best understood regulatory pathways involved in the regulation of transcriptional

reprogramming under cold acclimation have been extensively studied, which are

mediated by CBFs and ABA. However, these pathways regulate only a small

proportion of the transcription changes occurring under cold stress. In addition, the

transcriptional reprogramming induced by low temperatures prepare plants for other

abiotic stresses (salt, dehydration and drought) and also for biotic stress, but the

molecular mechanism of the last is poorly understood.

In Arabidopsis, NON EXPRESSER PATHOGENESES RELATED GENES1

(NPR1) is the master regulator that control SA-mediated genes activation in response

to systemic acquired resistance (SAR) activated by pathogens. Under basal

conditions, NPR1 is mainly found in the cytoplasm forming oligomers. When SAR is

activated, NPR1 undergoes posttranslational modifications, an internal disulfide bond

 

 

12  

is reduced by THIOREDOXIN H3 and H5 (TRXH3 and TRXH5 respectively) and is

phosphorylated by SnRK2.8. These structural changes trigger the transition oligomer-

to-monomer and NPR1 is translocated to the nucleus. NPR1 in to nucleus is

associated TGAs transcription factors (TFs) activating SAR transcriptional response,

including PRs genes. Despite the relationship between SAR and low temperatures,

the role of NPR1 in cold stress is unknown.

Here we report the molecular and functional characterization of NPR1 in

response to cold. We identified that NPR1 is induced by low temperature and we

found that NPR1 is a positive regulator of cold acclimation, controlling cold-induced

gene expression. However, our study shows that SA levels do not increase during

cold acclimation in Arabidopsis, and that mutants deficient in SA are not affected in

their capacity to cold acclimate. Furthermore, we analyzed the post-translational

regulation of NPR1 in response to cold and found that the oligomer-to-monomer

transition occurs, and therefore NPR1 is mainly accumulated in the nucleus in

response to low temperatures. This regulation is controlled by TRXH3, TRXH5 and

SnRK2.8, and like in SAR, are necessary for the nuclear import of NPR1. We

analyzed the role of TGAs transcription factor in the regulation of the genes controlled

for NPR1 in cold. We found that NPR1 does not require TGAs for transcriptional gene

regulation under low temperature. Subsequently, we identified cold-regulated genes

controlled by NPR1 through RNAseq and detected an overrepresentation of heat

shock response genes among the genes downregulated in npr1-1 under cold

conditions. These genes are mainly controlled by a redundant family of four

transcription factors HSFA1s (HSFA1a, HSFA1b, HSFA1d, HSFA1e), and we

 

 

13  

analyzed the expression of these genes in to hsfa1s quadruple mutant. We found that

these genes are controlled by HSFA1s in cold. Finally, we analyzed the interaction of

NPR1 with HSFA1s and we found that this occurs mainly in the nucleus under cold

conditions. In sum, in this study we described a novel signaling pathway dependent of

NPR1 and HSFA1s factors that is required for cold acclimation.

 

 

14  

ABSTRACT

NPR1 is a master regulator of plant response to pathogens that confers

immunity through a transcriptional cascade mediated by salicylic acid (SA) and the

TGA transcription factors. Little is known, however, about its implication in plant

response to abiotic stress. Here, we provide genetic and molecular evidence

supporting that Arabidopsis NPR1 plays an essential role in cold acclimation by

regulating cold-induced gene expression independently of SA and TGA factors. Our

results demonstrate that, in response to low temperature, cytoplasmic NPR1

oligomers release monomers that translocate to the nucleus where they interact with

heat shock transcription factors HSFA1 to promote the induction of HSFA1-regulated

genes and cold acclimation. As expected, Arabidopsis mutants deficient in HSFA1

factors display reduced capacity to cold acclimate, and cold induction of heat stress-

responsive genes is required for correct development of cold acclimation. All these

findings unveil an unexpected function for NPR1 in plant response to low

temperature, reveal a new regulatory pathway for cold acclimation mediated by NPR1

and HSFA1 factors, and place NPR1 as a central hub integrating cold and pathogen

signaling for a better adaptation of plants to their ever-changing environment.

 

 

15  

SECTION 1

1. THEORETICAL FRAMEWORK

1.1. Plant responses to stress

Plants, as sessile organisms, are constantly affected by environmental

changes. Furthermore, the proportion of plants affected by multiple stresses is

expected to rise significantly under a climate change scenario (Ahuja et al., 2010).

Abiotic stresses, particularly drought and temperature fluctuations, are more sever

than ever before and are considered to be the major factors limiting crop productivity.

In fact, it has been estimated that approximately 70% of yield losses are due to

unfavorable environmental conditions, as it has been reported for many

socioeconomically important crop species such as maize, wheat, and rice (Liu et al.,

2014; Johnová et al., 2016). Plants have evolved complex mechanisms to survive

under this kind of adverse environmental conditions. Responses to stress are usually

accompanied by major molecular changes, which finally lead to transcriptional

reprogramming (Kaplan et al., 2004). Recent research has made efficient use of

‘omics’ approaches to identify transcriptional, proteomic and metabolic networks

linked to abiotic stress perception and response. Interestingly, cold, drought and

salinity appear to have common sets of biological and molecular responses. Cold is

one of the most important abiotic stress conditions that limit plant geographical

distribution and crop productivity (Liu et al., 2014; Johnová et al., 2016).

 

 

16  

1.2. Acclimation to low temperature in plants

In this thesis work, we particularly focused in the mechanisms of cold

acclimation in Arabidopsis. Interestingly, some plant species from temperate regions,

such as Triticum aestivum (wheat), Avena sativa (oats), Hordeum vulgare (barley),

Pisum sativum (pea), and Arabidopsis thaliana, have developed the adaptive capacity

to acclimate to cold (Ruelland et al., 2009). This adaptive process allows plants to

increase their constitutive freezing tolerance after exposure to low nonfreezing

temperatures, preparing them for the consequences produced by freezing (Levitt,

1980).

The perception of cold signal seems to begin with changes in the fluidity of

the plasma membrane, cytoskeletal reorganization and imbalance in the

photosynthetic apparatus (Murata and Los, 1997; Wang and Nick, 2001; Gray et al.,

1997). The signal is detected by sensors such as membrane proteins (Ca2+ channels,

phospholipases, histidine kinases) and photosystem II respectively (Ruelland et al.,

2009). This results in the generation of second messengers including Ca2+ and

reactive oxygen species (ROS) (Solanke and Sharma, 2008). The cold signal is then

perceived by different transduction components (Phosphatases, Calmodulins,

Mitogen activated protein kinases) and results finally in a transcriptional

reprogramming of many genes (Solanke and Sharma, 2008).

In 1970, it was proposed that cold acclimation involves alterations in genes

expression (Weiser, 1970). Today, it is well known that most of the physiological and

biochemical changes necessaries for cold acclimation are triggered by cold via

 

 

17  

changes in gene expression. These changes produce accumulation of stress-related

proteins (dehydrins, antifreeze and cold shock proteins), increase in the stability of

membranes (higher proportion of unsaturated fatty acids and a decrease of

cerebrosides and free sterols), accumulation of sugars (sucrose, galactinol, fructose,

glucose and threalose), amino acids (Ala, Gly, Pro, Ser), polyamines, and betaines,

modification of the photosynthetic machinery (limiting CO2 assimilation, accumulation

of zeaxanthin and flavonoids), increase of ROS scavenging systems (enzymes,

Vitamin E and other antioxidants), and changes in the cell architecture (cell wall

composition, microtubules stabilization) (Ruelland et al., 2009). In fact, in Arabidopsis,

an intensive transcriptional reprogramming that involves 4,087 of the 27,416 genes

(approximately 15% of the genome) is the reason of all of these changes (Zhao et al.,

2016). This massive transcriptional change alters the expression of diverse classes of

genes with a wide range of biological functions. The identification and

characterization of these genes is contributing to the knowledge of the molecular

circuits involved, and potentially will provide tools that can be used to improve plant

tolerance to low temperature.

1.3. Signaling pathways involved in cold acclimation

Research over the last 30 years, primarily using Arabidopsis thaliana as a

model, has identified a large number of genetic changes that take place during cold

acclimation (Medina et al., 2011; Zhao et al., 2016). Many Cold-Regulated genes

(COR) have been identified and characterized in Arabidopsis and other cold tolerant

plant species (Chinnusamy et al., 2007). The best understood pathway that regulates

 

 

18  

the expression of COR genes in Arabidopsis is mediated by a family of three AP2-

type transcription factors named C-REPEAT (CRT)/DEHIDRATION (DRE)

RESPONSIVE BINDING FACTORs (CBF1, CBF2 and CBF3) (Medina et al., 2011;

Zhao et al., 2016). The expression of the corresponding CBF genes is induced at

early times after the plant is exposed to low temperatures (Medina et al., 2011; Zhao

et al., 2016). These CBFs recognize the cold- and dehydration-responsive elements

(CRT/DRE) in the promoter of several COR genes, which are considered as the CBF

regulon (Liu et al., 1998; Jaglo-Ottosen et al., 1998). CBFs factors regulate only 10%

of the genes differentially expressed during cold acclimation (414 of the 4087 genes

affected under low temperatures), suggesting that other regulatory pathways are also

involved in this regulation (Zhao et al., 2016).

Recent studies have shown that, in parallel with CBF genes, other genes

coding for transcription factors are also up-regulated at early times of cold treatment

(Park et al., 2015). Analysis of transgenic plants overexpressing some of these

transcription factors, such as HSFC1, ZAT12, ZF, ZAT10, and CZF1, showed that

they are also involved in the regulation of COR genes (Park et al., 2015).

Interestingly, some COR genes were found to be coordinately regulated by two or

more transcription factors (Park et al., 2015; Zhao et al., 2016). These results suggest

that COR genes are regulated by a complex low-temperature regulatory network. In

spite of the importance of these discoveries, the expression of the major percentage

of COR genes is still poorly understood.

Plant hormones are important regulators of stress defense responses. In

Arabidopsis, the regulatory pathway mediated by abscisic acid (ABA) has been

 

 

19  

extensively studied (Xue-Xuan et al., 2010). This hormone accumulates in plant

exposed to low temperature and mutants affected in ABA biosynthesis and perception

show reduced cold acclimation, indicating that ABA is a positive regulator of this

process (Lang et al., 1994; Llorente et al., 2000). Several studies have suggested that

other hormones are also involved in cold signaling. For example, giberellins (GAs)

and cytokinins (CKs) negatively regulate cold acclimation (Barrero-Gil and Salinas,

2017). Accordingly, plants affected in GAs and CKs perception and signaling show

more cold acclimation capacity (Achard et al., 2008; Jeon et al., 2010; Jeon and Kim,

2013). On the other hand, ethylene (ET), jasmonic acid (JA) and brassinosteroids

(BRs) positively regulate cold acclimation. Accordingly, mutants deficient in

biosynthesis or signaling of these hormones display decreased capacity to cold

acclimate (Catalá et al., 2014; Hu et al., 2013; Eremina et al., 2016).

The role of salicylic acid (SA) in cold acclimation is controversial. It has been

reported that SA levels increase in response to cold in many plant species such as

Arabidopsis, cucumber, wheat, and grape berry (Scott et al., 2004; Wan et al., 2009;

Kosova et al., 2012), suggesting that SA may be involved in cold responses.

Nevertheless, although in Arabidopsis the SA accumulation after cold treatment is

mediated by the isochorismate synthase 1 (ICS1) pathway, the ics1 mutant is not

affected in cold acclimation (Kim et al., 2013). In contrast, it has been reported that

some mutants that accumulate SA, such as small ubiquitin-like modifier (SUMO) E3

ligase (siz1) and accelerated cell death 6 (acd6), are more sensitive to freezing

temperatures after cold acclimation, suggesting a negative control of SA on this

 

 

20  

process (Miura and Ohta, 2010). In sum, further investigations are needed to precise

the role of SA signaling in plant responses to cold.

1.4. Common mechanisms in response to cold and other abiotic and biotic

stress

As mentioned above, it has been reported that plant responses to cold,

salinity and drought share common regulatory elements (Huang et al., 2012). This is

the case of the phytohormone ABA, which main function seems to be the regulation

of plant water balance and osmotic stress tolerance, influencing therefore the

response to cold, salinity and drought (Xue-Xuan et al., 2010). For instance, ABA

deficient mutants are highly susceptible to drought, salinity and cold stress conditions

(Huang et al., 2012). Furthermore, some stress responsive genes such as COR

genes (COR78/RD29A/LTI78, COR47, COR15a, COR 6.6) show transcriptional

activation in response to dehydration, cold stress and ABA treatments (Huang et al.,

2012). The promoter of these COR genes contain dehydration responsive elements

(DRE), C-Repeats (CRT) or ABA response elements (ABREs) (Yamaguchi-Shinozaki

and Shinozaki, 1994; Stockinger et al., 1997). Furthermore, constitutive or stress-

inducible overexpression of CBF1 or CBF3 in transgenic plants enhance freezing,

drought and salt-stress tolerance in Brassica, tomato, tobacco, wheat and rice

(Huang et al., 2012).

Mutants that have impaired the signaling mediated by other hormones such as ET

and JA, not only are deficient in cold acclimation, but also in defense responses to

salinity and drought stress (Kazan, 2015).

 

 

21  

Interestingly, common mechanisms in the responses to cold and biotic stress

have been also found. For instance, exposure of plants to low temperatures activates

plant immunity and protects plants to pathogen infection, and vice versa, pathogens

attack provided plant freezing tolerance (Cheng et al., 2013; Seo et al., 2010).

Indeed, some regulated genes activated during transcriptional reprogramming in cold,

show important connection with biotic stresses (Kim et al., 2012). For example,

pathogenesis-related (PR) genes that are activated in response to low temperatures

(Wang et al., 2005; Uknes et al., 1992), such as pathogenesis related gene 1 (PR1),

beta 1,3 glucanase 2 (PR2), and pathogenesis related gene 5 (PR5), have been

described to play an antimicrobial role (Janská et al., 2010; Uknes et al., 1992).

Furthermore, other genes such as constitutive expresser of PR genes 1 and 5 (CPR1,

CPR5) and zinc finger of Arabidopsis thaliana 6 (ZAT6), are positive regulators of

acquired freezing tolerance and resistance against pathogenic bacteria (Bowling et

al., 1994, 1997; Shi et al., 2014; Yang et al., 2010). Other studies showed that some

mutants, such as siz1 and acd6, that are defective in their capacity of cold

acclimation, are also more resistant to bacterial infections (Miura and Ohta, 2010).

This evidence supports the existence of signaling crosstalk that integrate low

temperatures and pathogens infections.

1.5. Role and molecular mechanism of NPR1 in Arabidopsis

This thesis work reports that NPR1, a transcriptional co-activator that control

SA-mediated genes activation in response to pathogens, also plays a crucial role in

the genetic development of cold acclimation.

 

 

22  

NPR1 belongs to the family of BTB-ankryin proteins, which contain two

conserved protein-protein interaction motifs: a BTB/POZ domain (for Broad Complex,

Tramtrack, and Bric-a-brac/POX virus and Zinc finger) at the N-terminus and four

ankryin motifs near the C-terminus (Khan et al., 2014). The Arabidopsis genome

codes for six BTB-ankryin proteins: NPR1 and three NPR1-like proteins (NPR2,

NPR3 and NPR4) that are involved in the response to pathogens, and BOP1 and

BOP2 (blade-on-petiole 1 and 2) that comprise a separate subclade in the

phylogenetic tree (Khan et al., 2014). NPR1 is the best characterized protein from this

family and is the master coactivator of SA signaling pathway in response to pathogen

infections. NPR1 regulates most of the SA-induced genes, being a key node in the

signaling pathway downstream SA (Wang et al., 2006; Blanco el at., 2009 Fu and

Dong, 2013). NPR1 is transcriptionally activated by SA and this regulation involves

direct binding of WRKY transcription factors to a W-box in NPR1 gene promoter (Yu

et al., 2001). NPR1 is a coactivator that does not have a known DNA-binding

domains, but has BTB/POZ and ANKIRIN domains that are able to interact with other

proteins such as transcription factors (Cao et al., 1997). Interestingly, NPR1 levels

and nuclear translocation in response to pathogens is mainly controlled by

posttranslational modifications, such as reduction of internal disulfide bonds,

phosphorylation, nitrosylation, ubiquitination and sumoylation (Withers and Dong,

2016).

Under basal conditions, NPR1 protein is found mainly in the cytoplasm of cells

as an oligomer (Tada et al., 2008). Upon pathogen attack, SA promotes the reduction

of a disulfide bond formed among two conserved cysteine residues of NPR1 (Mou et

 

 

23  

al., 2003). This reduction is catalyzed by thioredoxin H3 and H5 (TRXH3 and TRXH5

respectively), and by phosphorylation by SNF1-related protein kinase 2.8 (SnRK2.8),

which allows the transition from oligomeric to monomeric forms (Tada et al., 2008;

Lee et al., 2015). The monomeric form of NPR1 is then translocated from the

cytoplasm to the nucleus, where it activates gene expression (Kinkema et al., 2000).

For this function, it has been described that NPR1 is able to interact with TGA motif-

binding proteins (TGA transcription factors), producing the activation of PR genes

expression (Saleh et al., 2015; Fu and Dong, 2013). The interaction of NPR1 with

TGAs has been extensively studied. In Arabidopsis, the TGA factors family has 10

members, but only redundant class II (TGA2, TGA5, TGA6) showed strong affinity for

NPR1 and are necessary for the induction of NPR1-dependent genes in SAR

(Subramaniam et al., 2001; Fan and Dong, 2002; Zhang et al., 2003). In addition,

recent studies on the NPR1 homologs NPR3 and NPR4, showed that they are

adaptor proteins for the CUL3 E3 ligase, which specifically target NPR1 for

degradation in a SA concentration-dependent manner (Fu et al., 2012). Under basal

conditions, SA levels are low and NPR1 is constantly ubiquitinated through NPR4 and

degraded by CUL3NPR4, but under pathogens attack SA increases and NPR1 interacts

directly with NPR3, then NPR1 degradation is mediated by CUL3NPR3 (Fu et al.,

2012). Nuclear accumulation of NPR1 is required for basal defense gene expression

(Fu et al., 2012).

The role of NPR1 in plant responses to abiotic stress conditions is poorly

understood. It has been described that upon salt stress NPR1 is important for ionic

homeostasis in Arabidopsis roots, but it seems that it does not play a role in salt

 

 

24  

tolerance (Jayakannan et al., 2015; Hao et al., 2012). In addition, in transcriptomic

data bases NPR1 transcripts do not appears accumulate under in salt and drought

stress conditions, but this is not case under low temperatures where NPR1 mRNAs is

seen to accumulate (Kilian et al., 2007; Seo et al., 2010).

Here, we report the novel molecular and functional characterization of

Arabidopsis NPR1 in the cold acclimation process. Results from this work discovered

a novel signaling pathway controlled by NPR1 in the response to low temperature.

 

 

25  

2. REFERENCES

Achard, P., Gong, F., Cheminant, S., Alioua, M., Hedden, P., and Genschik, P. (2008). The cold-inducible CBF1 factor-dependent signaling pathway modulates the accumulation of the growth-repressing DELLA proteins via its effect on gibberellin metabolism. Plant Cell 20: 2117–2129.

Ahuja, I., de Vos, R.C.H., Bones, A.M., and Hall, R.D. (2010). Plant molecular

stress responses face climate change. Trends Plant Sci. 15: 664–674. Barrero-Gil, J. and Salinas, J. (2017). CBFs at the Crossroads of Plant Hormone

Signaling in Cold Stress Response. Mol. Plant 10: 542–544. Blanco, F., Salinas, P., Cecchini, N.M.N.M., Jordana, X., Van Hummelen, P.,

Alvarez, M.E.M.E., and Holuigue, L. (2009). Early genomic responses to salicylic acid in Arabidopsis. Plant Mol. Biol. 70: 79–102.

Bowling, S. a, Clarke, J.D., Liu, Y., Klessig, D.F., and Dong, X. (1997). The cpr5

mutant of Arabidopsis expresses both NPR1-dependent and NPR1-independent resistance. Plant Cell 9: 1573–1584.

Bowling, S. a, Guo, a, Cao, H., Gordon, a S., Klessig, D.F., and Dong, X. (1994).

A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 6: 1845–1857.

Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., and Dong, X. (1997). The

Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88: 57–63.

Catalá, R., López-Cobollo, R., Mar Castellano, M., Angosto, T., Alonso, J.M.,

Ecker, J.R., and Salinas, J. (2014). The Arabidopsis 14-3-3 protein RARE COLD INDUCIBLE 1A links low-temperature response and ethylene biosynthesis to regulate freezing tolerance and cold acclimation. Plant Cell 26: 3326–3342.

Cheng, C., Gao, X., Feng, B., Sheen, J., Shan, L., and He, P. (2013). Plant immune

response to pathogens differs with changing temperatures. Nat Commun 4: 2530.

Chinnusamy, V., Zhu, J.-K., and Sunkar, R. (2010). Gene regulation during cold

stress acclimation in plants. Methods Mol. Biol. 639: 39–55. Chinnusamy, V., Zhu, J., and Zhu, J.-K. (2007). Cold stress regulation of gene

expression in plants. Trends Plant Sci. 12: 444–451.

 

 

26  

Eremina, M., Unterholzner, S.J., Rathnayake, A.I., Castellanos, M., Khan, M., Kugler, K.G., May, S.T., Mayer, K.F.X., Rozhon, W., and Poppenberger, B. (2016). Brassinosteroids participate in the control of basal and acquired freezing tolerance of plants. Proc. Natl. Acad. Sci. U. S. A. 113: E5982–E5991.

Fan, W. and Dong, X. (2002). In vivo interaction between NPR1 and transcription

factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 14: 1377–1389.

Fu, Z.Q. and Dong, X. (2013). Systemic acquired resistance: turning local infection

into global defense. Annu. Rev. Plant Biol. 64: 839–863. Fu, Z.Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N., Mohan, R., Spoel, S.H.,

Tada, Y., Zheng, N., and Dong, X. (2012). NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486: 228–232.

Gray, G.R., Chauvin, L.P., Sarhan, F., and Huner, N. (1997). Cold Acclimation and

Freezing Tolerance (A Complex Interaction of Light and Temperature). Plant Physiol. 114: 467–474.

Hao, L., Zhao, Y., Jin, D., Zhang, L., Bi, X., Chen, H., Xu, Q., Ma, C., and Li, G.

(2012). Salicylic acid-altering Arabidopsis mutants response to salt stress. Plant Soil 354: 81–95.

Hu, Y., Jiang, L., Wang, F., and Yu, D. (2013). Jasmonate regulates the inducer of

cbf expression-C-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis. Plant Cell 25: 2907–2924.

Huang, G.-T., Ma, S.-L., Bai, L.-P., Zhang, L., Ma, H., Jia, P., Liu, J., Zhong, M.,

and Guo, Z.-F. (2012). Signal transduction during cold, salt, and drought stresses in plants. Mol. Biol. Rep. 39: 969–987.

Jaglo-Ottosen, K.R., Gilmour, S.J., Zarka, D.G., Schabenberger, O., and

Thomashow, M.F. (1998). Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280: 104–106.

Janská, A., Maršík, P., Zelenková, S., and Ovesná, J. (2010). Cold stress and

acclimation - what is important for metabolic adjustment? Plant Biol. 12: 395–405.

Jayakannan, M., Bose, J., Babourina, O., Shabala, S., Massart, A.,

Poschenrieder, C., and Rengel, Z. (2015). The NPR1-dependent salicylic acid signalling pathway is pivotal for enhanced salt and oxidative stress tolerance in Arabidopsis. J. Exp. Bot. 66: 1865–1875.

Jeon, J. and Kim, J. (2013). Arabidopsis Response Regulator1 and Arabidopsis

 

 

27  

Histidine Phosphotransfer Protein2 (AHP2), AHP3, and AHP5 Function in Cold Signaling. Plant Physiol. 161: 408–424.

Jeon, J., Kim, N.Y., Kim, S., Kang, N.Y., Novák, O., Ku, S.J., Cho, C., Lee, D.J.,

Lee, E.J., Strnad, M., and Kim, J. (2010). A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsis. J. Biol. Chem. 285: 23371–23386.

Johnová, P., Skalák, J., Saiz-Fernández, I., and Brzobohatý, B. (2016). Plant

responses to ambient temperature fluctuations and water-limiting conditions: A proteome-wide perspective. Biochim. Biophys. Acta - Proteins Proteomics 1864: 916–931.

Kaplan, F., Kopka, J., Haskell, D.W., Zhao, W., Schiller, K.C., Gatzke, N., Sung,

D.Y., and Guy, C.L. (2004). Exploring the Temperature-Stress Metabolome of Arabidopsis. Plant Physiol. 136: 4159–4168.

Kazan, K. (2015). Diverse roles of jasmonates and ethylene in abiotic stress

tolerance. Trends Plant Sci. 20: 219–229. Khan, M., Xu, H., and Hepworth, S.R. (2014). BLADE-ON-PETIOLE genes: Setting

boundaries in development and defense. Plant Sci. 215–216: 157–171. Kilian, J., Whitehead, D., Horak, J., Wanke, D., Weinl, S., Batistic, O., D’Angelo,

C., Bornberg-Bauer, E., Kudla, J., and Harter, K. (2007). The AtGenExpress global stress expression data set: protocols, evaluation and model data analysis of UV-B light, drought and cold stress responses. Plant J. 50: 347–363.

Kim, M.J., Park, M.-J., Seo, P.J., Song, J.-S., Kim, H.-J., and Park, C.-M. (2012).

Controlled nuclear import of the transcription factor NTL6 reveals a cytoplasmic role of SnRK2.8 in the drought-stress response. Biochem. J. 448: 353–363.

Kim, Y., Park, S., Gilmour, S.J., and Thomashow, M.F. (2013). Roles of CAMTA

transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis. Plant J. 75: 364–376.

Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear Localization of NPR1 Is

Required for Activation of PR Gene Expression. Plant Cell 12: 2339-2350 Kosová, K., Prášil, IT., Vítámvás, P., Dobrev, P., Motyka, V., Floková, K., Novák,

O., Turečková, V., Rolčik, J., Pešek, B., Trávničková, A., Gaudinová, A., Galiba, G., Janda, T., Vlasáková, E., Prášilová, P., Vanková, R. (2012). Complex phytohormone responses during the cold acclimation of two wheat cultivars differing in cold tolerance, winter Samanta and spring Sandra. J. Plant Physiol. 169: 567–576.

 

 

28  

Lang, V., Mantyla, E., Welin, B., Sundberg, B., and Palva, E.T. (1994). Alterations in Water Status, Endogenous Abscisic Acid Content, and Expression of rab18 Gene during the Development of Freezing Tolerance in Arabidopsis thaliana. Plant Physiol. 104: 1341–1349.

Lee, H.-J., Park, Y.-J., Seo, P.J., Kim, J.-H., Sim, H.-J., Kim, S.-G., and Park, C.-M.

(2015). Systemic Immunity Requires SnRK2.8-Mediated Nuclear Import of NPR1 in Arabidopsis. Plant Cell 1: 3425-3428

Levitt, J. (1980). Responses of Plants to Environmental Stress. Chilling, Freezing,

and High Temperature Stresses, 2nd ed. (New York: Academic Press). Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K.,

and Shinozaki, K. (1998). Two Transcription Factors, DREB1 and DREB2, with an EREBP/AP2 DNA Binding Domain Separate Two Cellular Signal Transduction Pathways in Drought- and Low-Temperature-Responsive Gene Expression, Respectively, in Arabidopsis. Plant Cell 10: 1391-1406.

Liu, Y., Yu, D., Su, Y., and Hao, R. (2014). Quantifying the effect of trend,

fluctuation, and extreme event of climate change on ecosystem productivity. Environ. Monit. Assess. 186: 8473–8486.

Llorente, F., Oliveros, J.C., Martínez-Zapater, J.M., and Salinas, J. (2000). A

freezing-sensitive mutant of Arabidopsis, frs1, is a new aba3 allele. Planta 211: 648–655.

Medina, J., Catalá, R., and Salinas, J. (2011). The CBFs: Three arabidopsis

transcription factors to cold acclimate. Plant Sci. 180: 3–11. Miura, K. and Ohta, M. (2010). SIZ1, a small ubiquitin-related modifier ligase,

controls cold signaling through regulation of salicylic acid accumulation. J. Plant Physiol. 167: 555–560.

Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired

resistance Regulate NPR1 function through redox changes. Cell 113: 935–944.

Murata, N. and Los, D.A. (1997). Membrane Fluidity and Temperature Perception.

Plant Physiol. 115: 875–879. Park, S., Lee, C.M., Doherty, C.J., Gilmour, S.J., Kim, Y., and Thomashow, M.F.

(2015). Regulation of the Arabidopsis CBF regulon by a complex low-temperature regulatory network. Plant J. 82: 193–207.

Ruelland, E., Vaultier, M.N., Zachowski, A., and Hurry, V. (2009). Chapter 2 Cold

Signalling and Cold Acclimation in Plants. Adv. Bot. Res. 49: 35–150.

 

 

29  

Saleh, A., Withers, J., Mohan, R., Marqués, J., Gu, Y., Yan, S., Zavaliev, R.,

Nomoto, M., Tada, Y., and Dong, X. (2015). Posttranslational modifications of the master transcriptional regulator NPR1 enable dynamic but tight control of plant immune responses. Cell Host Microbe 18: 169–182.

Scott, I.M., Clarke, S.M., Wood, J.E., and Mur, L. a J. (2004). Salicylate

accumulation inhibits growth at chilling temperature in Arabidopsis. Plant Physiol. 135: 1040–1049.

Seo, P.J., Kim, M.J., Park, J.-Y., Kim, S.-Y., Jeon, J., Lee, Y.-H., Kim, J., and

Park, C.-M. (2010). Cold activation of a plasma membrane-tethered NAC transcription factor induces a pathogen resistance response in Arabidopsis. Plant J. 61: 661–671.

Shi, H., Wang, X., Ye, T., Cheng, F., Deng, J., Yang, P., Zhang, Y., and Chan, Z.

(2014). The Cysteine2/Histidine2-Type Transcription Factor ZINC FINGER OF ARABIDOPSIS THALIANA6 Modulates Biotic and Abiotic Stress Responses by Activating Salicylic Acid-Related Genes and C-REPEAT-BINDING FACTOR Genes in Arabidopsis. Plant Physiol. 165: 1367–1379.  

Solanke, A.U. and Sharma, A.K. (2008). Signal transduction during cold stress in

plants. Physiol. Mol. Biol. PlantsPhysiol. Mol. Biol. Plants 14: 69–79. Stockinger, E.J., Gilmour, S.J., and Thomashow, M.F. (1997). Arabidopsis thaliana

CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. U. S. A. 94: 1035–1040.

Subramaniam, R., Desveaux, D., Spickler, C., Michnick, S.W., and Brisson, N.

(2001). Direct visualization of protein interactions in plant cells. Nat. Biotechnol. 19: 769–772.

Tada, Y., Spoel, S.H., Pajerowska-Mukhtar, K., Mou, Z., Song, J., Wang, C., Zuo,

J., and Dong, X. (2008). Plant immunity requires conformational changes [corrected] of NPR1 via S-nitrosylation and thioredoxins. Science 321: 952–956.

Uknes, S., Mauch-Mani, B., Moyer, M., Potter, S., Williams, S., Dincher, S.,

Chandler, D., Slusarenko, A., Ward, E., and Ryals, J. (1992). Acquired resistance in Arabidopsis. Plant Cell 4: 645–56.

Wan, S.B., Tian, L., Tian, R.R., Pan, Q.H., Zhan, J.C., Wen, P.F., Chen, J.Y.,

Zhang, P., Wang, W., and Huang, W.D. (2009). Involvement of phospholipase D in the low temperature acclimation-induced thermotolerance in grape berry. Plant Physiol. Biochem. 47: 504–510.

 

 

30  

Wang, D., Amornsiripanitch, N., and Dong, X. (2006). A genomic approach to

identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. PLoS Pathog 2: 1042-1050.

Wang, D., Weaver, N.D., Kesarwani, M., and Dong, X. (2005). Induction of protein

secretory pathway is required for systemic acquired resistance. Science 308: 1036–1040.

Wang, Q.Y. and Nick, P. (2001). Cold acclimation can induce microtubular cold

stability in a manner distinct from abscisic acid. Plant Cell Physiol. 42: 999–1005. Weiser, C.J. (1970). Cold Resistance and Injury in Woody Plants. Science 169.

1269-78 Withers, J. and Dong, X. (2016). Posttranslational Modifications of NPR1: A Single

Protein Playing Multiple Roles in Plant Immunity and Physiology. PLoS Pathog. 12: 1-9.

Xue-Xuan, X., Hong-Bo, S., Yuan-Yuan, M., Gang, X., Jun-Na, S., Dong-Gang, G.,

and Cheng-Jiang, R. (2010). Biotechnological implications from abscisic acid (ABA) roles in cold stress and leaf senescence as an important signal for improving plant sustainable survival under abiotic-stressed conditions. Crit. Rev. Biotechnol. 30: 222–230.

Yamaguchi-Shinozaki, K. and Shinozaki, K. (1994). A novel cis-acting element in

an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 6: 251–64.

Yang, H., Shi, Y., Liu, J., Guo, L., Zhang, X., and Yang, S. (2010). A mutant CHS3

protein with TIR-NB-LRR-LIM domains modulates growth, cell death and freezing tolerance in a temperature-dependent manner in Arabidopsis. Plant J. 63: 283–296.

Yu, D., Chen, C., and Chen, Z. (2001). Evidence for an important role of WRKY DNA

binding proteins in the regulation of NPR1 gene expression. Plant Cell 13: 1527–1540.

Zhang, Y., Tessaro, M.J., Lassner, M., and Li, X. (2003). Knockout Analysis of

Arabidopsis Transcription Factors TGA2, TGA5, and TGA6 Reveals Their Redundant and Essential Roles in Systemic Acquired Resistance. Plant Cell 15: 2647–2653.

Zhao, C., Zhang, Z., Xie, S., Si, T., Li, Y., and Zhu, J.-K. (2016). Mutational

Evidence for the Critical Role of CBF Genes in Cold Acclimation in Arabidopsis. Plant Physiol. 171: 2744-2759

 

 

31  

3. HYPOTHESIS AND OBJECTIVES

HYPOTHESIS

NPR1 regulates abiotic stress responses in Arabidopsis thaliana.

GENERAL AIM

To characterize the role of Arabidopsis NPR1 in abiotic stress responses.

SPECIFIC AIMS: 1. Molecular characterization of NPR1 in response to abiotic stress in Arabidopsis

1.1. To determine the accumulation of NPR1 transcript in response to abiotic stresses.

1.2. To evaluate the subcellular localization of NPR1 under control and low temperature conditions.

2. Functional characterization of NPR1 in the cold acclimation response

2.1. To evaluate the cold acclimation capacity of NPR1 mutants (npr1-1 and npr1-2), complemented mutants (c-npr1), and overexpressing NPR1 (35S-NPR1-GFP) plants.

2.2. To determine the regulatory pathways through which NPR1 regulates cold acclimation.

 

 

32  

SECTION 2

Short title: NPR1 is a positive regulator of cold acclimation in Arabidopsis thaliana.

TITLE

NPR1 MEDIATES A NOVEL REGULATORY PATHWAY IN COLD

ACCLIMATION BY INTERACTING WITH HSFA1 FACTORS IN ARABIDOPSIS THALIANA

Authors: Ema Olate1,3, José M Jiménez-Gómez2, Loreto Holuigue1. and Julio Salinas3,* 1Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia

Universidad Católica de Chile. 2Institut Jean-Pierre Bourgin, INRA, AgroParisTech, CNRS, Université Paris-Saclay, RD10, 78026

Versailles Cedex, France 3Departamento de Biología Medioambiental, Centro de Investigaciones Biológicas, CSIC, 28040

Madrid, Spain

* Corresponding author

 

 

33  

1. INTRODUCTION

Low temperature is a major environmental stress that adversely affects the growth

and development of plants, determines their geographic distribution and limits

crop productivity. Many plants from temperate regions, including Arabidopsis,

have evolved an adaptive process whereby their constitutive freezing tolerance

increases after being exposed to low nonfreezing temperatures (Levitt, 1980). This

process, named cold acclimation, is complex and involves many physiological and

biochemical changes (Ruelland et al., 2009). Research over the last decades has

shown that most of these changes are controlled by low temperature through

changes in gene expression. Arabidopsis, for instance, reprograms its

transcriptome during cold acclimation involving more than 3000 genes (Zhao et

al., 2016). Unfortunately, however, the role that the vast majority of these genes

play in this adaptive process and the signaling pathways through which they

operate remain to be elucidated. The best characterized pathway is mediated by a

family of three transcription factors, named CBF1 to CBF3, that are estimated to

control the induction of around 12% of the Arabidopsis cold-responsive genes (Jia

et al., 2016). Plant hormones also have a significant function in cold signaling.

Low temperature induces changes in the levels of abscisic acid (ABA), ethylene

(ET), jasmonic acid (JA) and gibberellins (GA), and it has been shown that ABA,

ET, JA, GA and brassinosteroids (BRs) signaling contribute to the regulation of

cold acclimation (Barrero-Gil and Salinas, 2017). Salicylic acid (SA) accumulates

 

 

34  

in response to cold in several species (Miura and Tada, 2014) but its function in

the process still needs further investigation.

In plants, accumulating evidence indicate that low temperature interacts with other

environmental cues. Interestingly, several studies support that cold signals are

closely associated with defense responses. Thus, a number of pathogenesis-

related (PR) proteins, such as β-1,3-glucanases, endochitinases, and thaumatin-

like proteins, accumulate in winter rye during cold acclimation (Hon et al., 1995;

Pihakaski-Maunsbach et al., 2001). It is worth mentioning that these proteins, in

addition of having a role in freezing tolerance, function in pathogen resistance

(Griffith and Yaish, 2004). How low temperature induces their accumulation and

triggers pathogen resistance is still largely unknown. In Arabidopsis, some cold-

regulated transcription factors, including the plasma membrane-bound NAC

transcription factor NTL6 and the C2H2-type Zinc finger transcription factor

AtZAT6, have been reported to directly binding to the promoter regions of PR

genes thus inducing PR expression and enhancing resistance to pathogen

infection (Seo et al., 2010; Shi et al., 2014). Other cold-related proteins from

Arabidopsis, such as the vascular plant one-zinc-finger proteins (VOZs), the

Mediator subunit SFR6/MED16, and the DREB and EAR motif protein 1 (DEAR1),

also control PR expression and promote tolerance to pathogens (Tsutsui et al.,

2009; Wathugala et al., 2012; Nakai et al., 2013). Nonetheless, the molecular

mechanisms whereby these cold-related proteins control the expression of PR

genes to induce defense responses remains to be uncovered. It has been

 

 

35  

proposed that the accumulation of PR proteins under low temperature conditions

ensures an adequate strategy of defense against the pathogens that frequently

propagate during cold seasons (Griffith and Yaish, 2004). All these data indicate

the existence of a wide range of signaling crosstalk between cold and pathogen

responses.

NONEXPRESSER OF PATHOGENESIS-RELATED GENES 1 (NPR1) is a

master regulator of basal and systemic acquired resistance in plants, which

confers immunity through a transcriptional cascade leading to massive induction

of antimicrobial genes (Fu and Dong, 2013). In unchallenged Arabidopsis, NPR1

is sequestered in the cytoplasm as an oligomer maintained by redox-sensitive

intermolecular disulfide bonds. The oligomerization of NPR1 is preserved by S-

nitrosylation through S-NITROSOGLUTATHIONE (GSNO) (Tada et al., 2008).

Upon pathogen challenge, the levels of SA increase inducing the expression of

NPR1 gene and the accumulation of the NPR1 protein (Fu and Dong, 2013). In

addition, the increase in SA levels generates changes in the cellular redox state,

which, in turn, lead to the reduction of the disulfide bonds in NPR1. The reduction

of the NPR1 oligomers release monomers that translocate to the nucleus where

they activate PR gene expression (Kinkema et al., 2000). The SA-induced NPR1

oligomer-to-monomer reaction is catalyzed by THIOREDOXINS H3 and H5

(TRXH3, TRXH5), as well as by the SNF1-RELATED PROTEIN KINASE 2.8

(SnRK2.8) (Tada et al., 2008; Lee et al., 2015). The NPR1 protein holds, at least,

two domains involved in protein-protein interactions, the BTB/POZ and the

 

 

36  

ankyrin-repeat domains, and a nuclear localization sequence, but it does not

contain a canonical DNA-binding domain (Fu and Dong, 2013). Consistent with

this structure, monomeric NPR1 acts as a transcriptional coactivator interacting

with bZIP transcription factors of the TGAs family that have been shown to directly

bind to the as-1 elements in the promoters of PR genes to induce their expression

and the subsequent defense response (Fu and Dong, 2013). In addition to

interacting with TGA factors, NPR1 also interacts with NIMIN proteins to attenuate

PR gene expression (Hermann et al., 2013). Monomeric NPR1 is specifically

targeted for degradation by the CUL3 E3 ligase and its adaptors, the NPR1

paralogs NPR3 and NPR4 (Fu et al., 2012).

Intriguingly, despite the tight connections existing between cold and pathogen

responses in plants, any implication of NPR1 in plant response to low temperature

has been overlooked. In this study, we show that Arabidopsis NPR1 positively

regulates cold acclimation by promoting cold-induced gene expression

independently of SA and TGA factors. Our results demonstrate that the

expression of NPR1 is induced in response to low temperature and this induction

is followed by an increase of NPR1 protein that accumulates in the nucleus in its

monomeric form. In the nucleus, NPR1 interacts with HSFA1 transcription factors,

the master regulators of heat shock response, to activate the expression of

HSFA1-regulated genes and, as a consequence, cold acclimation. Indeed, we

further demonstrate that the HSFA1 factors also function as positive regulators of

cold acclimation, and that the cold induction of heat stress-responsive genes is

 

 

37  

crucial for full development of this adaptive process in Arabidopsis. Collectively,

the data reported here uncover an unanticipated function for NPR1 in cold

response, triggering a new transcriptional cascade through its interaction with the

HSFA1 factors to promote cold acclimation. NPR1, therefore, represents an

integration node for pathogen and cold signaling, allowing plants to better respond

and adapt to a fluctuating environment.

 

 

38  

2. RESULTS

2.1. NPR1 accumulates in response to low temperature

Given the close relationship that exists between cold and pathogen signaling in

plants, we decided to examine whether the master regulator of pathogen response,

NPR1, could also play a role in cold response. Encouragingly, results from the eFP

Browser database (bar.toronto.ca) indicated that the expression levels of NPR1 gene

from Arabidopsis (At1G64280) increased in response to low temperature (Kilian et al.,

2007). Quantitative PCR (qPCR) experiments confirmed that, in fact, NPR1 mRNAs

accumulated transiently in 2-week-old Col-0 (WT) plants subjected to 4ºC, reaching a

peak after 6 hours of treatment (Figure 1A). This accumulation was mainly detected in

the leaves of adult Arabidopsis plants (Figure 1B). NPR1 transcripts, however, did not

increase in plants exposed to other related abiotic stresses, such as drought (300mM

sorbitol) or high salt (150mM NaCl) (Supplementary Figure 1A, B).

To further investigate the accumulation of NPR1 transcripts in response to low

temperature, we generated Arabidopsis transgenic lines containing a fusion between

a NPR1 promoter fragment (NPR1PRO; -1986 to +3) and the UidA (GUS) reporter

gene (NPR1PRO-GUS). Three independent transgenic lines (L2.4, L3.7, L4.9)

containing a single copy of the fusion in homozygosity were analyzed. In all cases,

the levels of GUS mRNAs increased significantly when exposed to 4ºC, mirroring the

expression pattern of the endogenous NPR1 gene (Figure 1C). As expected,

 

 

39  

transgenic lines showed weak GUS activity under control conditions, but after 6 h of

exposure to 4ºC strong GUS staining was detected in the leaves of all lines (Figure

1D). These data pointed out that the accumulation of NPR1 mRNAs by low

temperature is regulated at the transcriptional level.

Since the expression of NPR1 is induced by SA (Fu and Dong, 2013), whose levels,

in turn, have been described to increase under cold conditions (Kim et al., 2013a), we

tested the possibility that the accumulation of NPR1 mRNAs by low temperature

could be mediated by SA. This hormone is mainly synthesized from chorismate

through the isochorismate synthase (ICS) pathway (Wildermuth et al., 2001). In

Arabidopsis, ICS is encoded by two genes, ICS1 and ICS2, with ICS1 having the

primary role in cold-induced SA biosynthesis (Kim et al., 2013a). We, therefore,

analyzed the content of NPR1 transcripts in WT plants and mutants sid2-1 and sid2-

2, two loss-of-function alleles of ICS1 (Wildermuth et al., 2001), exposed 6h to 4ºC.

We also analyzed the content of NPR1 transcripts in cold-treated transgenic

Arabidopsis expressing NahG, a bacterial gene encoding a salicylate hydroxylase

that converts SA to catechol, (Lawton et al., 1995). No significant differences were

found between WT, sid2 and NahG plants (Supplementary Figure 1C), evidencing

that messengers corresponding to NPR1 accumulate in response to low temperature

independently of SA. In addition, we investigated whether the cold induction of NPR1

was dependent on the CBF transcription factors and/or on ABA, which mediate the

two main signaling pathways controlling cold-induced gene expression (Xue-Xuan et

al., 2010). Expression analyses in cold-treated CBF- and ABA-deficient Arabidopsis

 

 

40  

mutants (cbf123-1 and aba2-11; Zhao et al., 2016; González-Guzmán et al., 2002)

revealed that the increase of NPR1 transcripts under low temperature conditions was

also independent of CBFs and ABA (Supplementary Figure 1C).

Next, we assessed if the cold accumulation of NPR1 mRNA was followed by an

increase of the corresponding protein. Western blot (WB) experiments using

Arabidopsis plants containing a single copy of a functional genomic fusion NPR1PRO-

NPR1-MYC (see below) showed that the levels of NPR1-MYC protein were also more

abundant after some hours of cold treatment, correlating with those of NPR1

transcripts (Figure 1E). All in all, these results indicated that the levels of NPR1

augment under low temperature conditions independently of SA, ABA and the CBFs.

 

 

41  

Figure 1. Arabidopsis NPR1 accumulates in response to low temperature. (A and B) Expression of NPR1 in leaves from 2-week-old Col-0 plants (A), and in leaves, roots, stems and flowers from 6-week-old Col-0 plants (B), exposed to 4ºC for the indicated hours (h). In all cases, transcript levels, determined by qPCR, are represented as relative to the values of leaves at 0h. (C) Expression of NPR1 and GUS in leaves from 2-week-old Col-0 (WT) plants and NPR1PRO-GUS lines, respectively, exposed to 4ºC for the indicated hours (h). Transcript levels, determined by qPCR, are represented as relative to the values at 0h. (D) Histochemical analysis of GUS activity in 3-week-old plants from the NPR1PRO-GUS line L4.9 grown under control conditions (20ºC) or exposed 6h to 4ºC. (E) Levels of NPR1-MYC fusion protein in 2-week-old c-npr1 plants exposed to 4ºC for the indicated hours (h). α-Tubulin (α-TUB) was used as a loading control. Results are representative of 3 independent experiments. In (A), (B) and (C), data represent the mean of three independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between cold-treated and control (0h) plants, as determined by t-test.

 

 

42  

Supplementary Figure 1. NPR1 expression is induced by low temperature independently of SA, ABA and CBFs but not by drought or high salt. (A) and (B) Expression of NPR1 in leaves from 2-week-old Col-0 plants exposed to drought (A) or high salt conditions (B) for the indicated hours (h). The efficiency of drought and high salt treatments was controlled by analyzing the expression of RD29A. In all cases, expression levels, determined by qPCR, are represented as relative to the values at 0h. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (**P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between cold-treated and control (0h) plants for RD29A expression, as determined by t-test. No significant differences between cold-treated and control (0h) plants were observed in any case for NPR1 expression. (C) Expression of NPR1 in leaves from 2-week-old Col-0 (WT), sid2-1, sid2-2, NahG, aba2-11 and cbf123-1 plants exposed 6h to 4ºC. Expression levels, determined by qPCR, are represented as relative to the value in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. No significant differences between mutants and WT were observed.

 

 

43  

2.2. NPR1 positively regulates cold acclimation The results described above suggested that NPR1 could be involved in the response

of Arabidopsis to low temperature. To test this assumption, we examined the capacity

of two NPR1 loss-of-function mutant alleles, npr1-1 (Cao et al., 1994) and npr1-2

(Shah et al., 1997), to cold acclimate. Two-week-old mutant plants were cold-

acclimated (7d, 4ºC) and subsequently exposed for 6h to different freezing

temperatures. Survival was scored after 7 days of recovery under controlled growth

conditions. Interestingly, cold acclimated npr1 mutants exhibited a significantly lower

freezing tolerance than cold acclimated WT plants, the LT50 (temperature that causes

50% of lethality) values being -9.4ºC and -10.1ºC, respectively (Figure 2A, C). npr1-1

mutants transformed with the NPR1PRO-NPR1-MYC fusion (c-npr1) recovered the

wild-type capacity to cold acclimate (Figure 2B, D), validating the fusion and

establishing that the decreased capacity of npr1-1 and npr1-2 mutants to cold

acclimate was a direct consequence of the absence of NPR1. Furthermore, we

evaluated the capacity to cold acclimate of an Arabidopsis line containing a 35S-

NPR1-GFP construct (Kinkema et al., 2000). The overexpression of NPR1

significantly increased the freezing tolerance of cold-acclimated Arabidopsis (Figure

2B, D). The LT50 value of 35S-NPR1-GFP plants was estimated to be about -10.5ºC.

Although NPR1 transcripts did not accumulate in Arabidopsis plants exposed to

drought or high salt, we also explored a possible role of NPR1 in Arabidopsis

tolerance to these cold-related abiotic stresses. Drought and high salt tolerance was

examined in 5-day-old npr1-1 and npr1-2 seedlings, one week after being transferred

 

 

44  

to plates containing 300mM sorbitol or 200mM NaCl. In both cases, mutants exhibited

similar tolerance as WT seedlings as revealed by the quantification of their fresh

weights and main root lengths (Supplementary Figure 2A, B). Together, all these data

provided genetic evidence that NPR1 functions specifically in cold acclimation by

positively regulating this adaptive response in Arabidopsis.

 

 

45  

Figure 2. NPR1 positively regulates cold acclimation in Arabidopsis (A) and (B) Freezing tolerance of 2-week-old Col-0 (WT), npr1-1 and npr1-2 plants (A), and WT, 35S-NPR1-GFP and c-npr1 plants (B) exposed for 6h to the indicated freezing temperatures after being acclimated for 7d at 4°C. Freezing tolerance was estimated as the percentage of plants surviving each specific temperature after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.01, **P ≤ 0.001, ***P ≤ 0.0001) from WT plants, as determined by t-test. (C) and (D) Freezing tolerance of representative cold-acclimated plants 7d after being exposed to -10ºC for 6h.

 

 

46  

Supplementary Figure 2. NPR1 is not involved in drought or salt tolerance. (A) and (B) Drought (A) and salt (B) tolerance of 5-day-old Col-0 (WT), npr1-1 and npr1-2 seedlings. Tolerances were calculated as the relative fresh weights and main root lengths of seedlings exposed 7d to 300mM sorbitol or 200mM NaCl respect to seedlings grown under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. No significant differences between mutants and WT were observed in any case. (C) Representative seedlings grown on GM or exposed 7d to 300mM sorbitol or 200mM NaCl.

 

 

47  

2.3. Low temperature-induced monomerization and nuclear import of NPR1 are

required for full development of cold acclimation

As mentioned above, in response to pathogens, cytoplasmic NPR1 oligomers release

monomers by the action of TRXH3, TRXH5 and SnRK2.8 that translocate to the

nucleus where they activate PR gene expression (Tada et al., 2008; Lee et al., 2015).

Thus, we investigated the possibility that low temperature could also trigger the

monomerization and nuclear translocation of NPR1. First, we studied the subcellular

distribution of NPR1 in Arabidopsis plants exposed to control or low temperature

conditions by cell fractionation followed of WB experiments. Cytoplasmic and nuclear

protein extracts were obtained from control and cold-treated c-npr1 plants, and the

NPR1-MYC fusion protein was detected immunologically in each fraction. In plants

grown under standard conditions, NPR1 was primarily localized in the cytoplasm.

After cold exposure, however, NPR1 was clearly detected in the nuclear fraction

(Figure 3A). The cold-induced nuclear accumulation of NPR1 was practically

disrupted in trxh3trxh5 (see Methods) and snrk2.8-1 (Lee et al., 2015) mutants

transformed with the NPR1PRO-NPR1-MYC construct (Figure 3B), evidencing that

TRXH3, TRXH5 and SnRK2.8 are critical for its nuclear import in response to low

temperature. Then, we performed WB assays with total protein extracts from control

and cold-treated c-npr1 plants under non-reducing conditions to determine if low

temperature promoted nuclear accumulation of monomeric NPR1. Indeed, after 24h

of exposure to 4ºC, the levels of monomeric NPR1 were notably higher than at 20ºC

(Figure 3C). When these assays were carried out with extracts from trxh3trxh5 and

 

 

48  

snrk2.8-1 plants containing the NPR1PRO-NPR1-MYC fusion, the cold-induced

accumulation of monomeric NPR1 in the nucleus was not detected, therefore

indicating that it was mediated by TRXH3, TRXH5 and SnRK2.8 (Figure 3C).

The results described above suggested that the monomerization and nuclear import

of NPR1 could be necessary for proper development of the cold acclimation

response. To test this hypothesis, we analyzed the freezing tolerance of 2-week-old

cold acclimated (7d, 4ºC) WT plants and npr1, trxh3trxh5 and snrk2.8-1 mutants.

After 6h at -10ºC, trxh3trxh5 and snrk2.8-1 mutants exhibited a survival rate

significantly lower than WT plants, similar to that shown by npr1 mutants (Figure 3D).

These data demonstrated that TRXH3, TRXH5 and SnRK2.8 are required to ensure

full development of cold acclimation and, therefore, that the low temperature-induced

monomerization and nuclear import of NPR1 are needed for its function as a positive

regulator of the adaptive response.

 

 

49  

Figure 3. Monomerization and nuclear localization of NPR1 depends on TRXH3, TRXH5 and SnRK2.8, and are required for cold acclimation. (A) Levels of NPR1-MYC fusion protein in cytoplasmic (Cyt) and nuclear (Nuc) fractions from 2-week-old c-npr1 plants grown under control conditions (20ºC) or exposed to 4ºC for 24h. α-Tubulin (α-TUB) and Histone H3 were used for control of fractionation. (B) Levels of NPR1-MYC fusion protein in cytoplasmic (Cyt) and nuclear (Nuc) fractions from 2-week-old c-npr1 plants and trxh3trxh5 and snrk2.8-1 mutants containing the NPR1PRO-NPR1-MYC fusion grown under control conditions (20ºC) or exposed to 4ºC for 24h. α-TUB and H3 were used for control of fractionation. (C) Levels of oligomeric and monomeric NPR1-MYC fusion protein in 2-week-old c-npr1 plants and trxh3trxh5 and snrk2.8-1 mutants containing the NPR1PRO-NPR1-MYC fusion grown under control conditions (20ºC) or exposed to 4ºC for 24h. α-TUB was used as a loading control. (D) Freezing tolerance of 2-week-old Col-0 (WT), trxh3trxh5, snrk2.8-1 and npr1-1 plants exposed 6h to -10ºC after being acclimated at 4°C for 7d (left panel). Freezing tolerance was estimated as the percentage of plants surviving each specific temperature after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (***P ≤ 0.001) from WT plants, as determined by t-test. The right panel shows the freezing tolerance of representative cold-acclimated WT, trxh3trxh5, snrk2.8-1 and npr1-1 plants 7d after being exposed to -10ºC for 6h. In (A), (B) and (C), results are representative of 3 independent experiments.

 

 

50  

2.4. NPR1 activates cold-induced gene expression independently of the TGA

transcription factors

Now, the arising question was how NPR1 positively regulated cold acclimation. Since

cold acclimation involves an extensive transcriptome reprogramming (Chinnusamy et

al., 2007) and NPR1 has been implicated in regulating gene expression (Blanco et al.,

2009), we considered the possibility that it could activate the adaptive response by

promoting cold-induced gene expression. High-throughput RNA sequencing

(RNAseq) was used to estimate the impact of the npr1-1 mutation on the

transcriptome of Arabidopsis plants exposed 24h to 4ºC. To this, we sequenced

cDNA libraries prepared from cold-treated npr1-1 and WT plants. The resulting reads

(2.6 Gb/sample) were mapped to the Arabidopsis genome (TAIR10 version) and gene

expression changes in the mutant were evaluated. The top 200 downregulated genes

in npr1-1, based on fold change ratios with respect to their corresponding controls,

were considered for analysis. The expression levels of these genes in mutant plants

were decreased at least 2-fold compared with the WT (Supplementary Table 1).

Remarkably, 71 out of the 200 downregulated genes (35.5%) had been reported to be

induced (≥2-fold) in response to cold (Kilian et al., 2007) (Supplementary Table 2)

and, therefore, could account for the impaired capacity of npr1-1 to cold acclimate.

These findings were validated analyzing the expression of several downregulated

cold-inducible genes in independent RNA samples from WT, npr1-1 and npr1-2

mutant plants grown at 20ºC or subjected 24h to 4ºC by means of qPCR experiments

(Figure 4A). We concluded that NPR1 is required for cold-induced gene expression.

 

 

51  

In response to pathogens, NPR1 interacts with class II redundant TGA transcription

factors (TGA2, TGA5 and TGA6) to foster PR gene expression (Fu and Dong, 2013).

To determine whether the role of NPR1 in promoting cold-induced gene expression

was also mediated by the TGA transcription factors, we evaluated the cold induction

of the genes whose downregulated expression in npr1 we had validated by qPCR

assays (Figure 4A) in tga2-1tga5-1tga6-1 (tga2/5/6) triple mutants (Zhang et al.,

2003). Results uncovered that the cold induction of all genes, including PR2, whose

expression by pathogens is mediated by NPR1 through the TGA factors (Fan and

Dong, 2002), was not significantly affected in the triple mutant (Figure 4B). These

observations indicated that NPR1 activates cold-induced gene expression

independently of the class II TGA transcription factors.

 

 

52  

Figure 4. NPR1 promotes cold-induced gene expression independently of TGA class II transcription factors. (A) and (B) Expression of different cold-inducible genes in 2-week-old plants from Col-0 (WT), npr1-1 and npr1-2 (A), and WT and tga2/5/6 (B) grown under control conditions (C) or exposed to 4ºC for 24h. Transcript levels, determined by qPCR, are represented as relative to their corresponding values in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between npr1 mutants and WT exposed to 4ºC, as determined by t-test. No significant differences between tga2/5/6 mutants and WT were observed in any case.

 

 

53  

2.5. NPR1 promotes the cold induction of HSFA1-regulated genes

Intriguingly, gene ontology (GO) analysis revealed that a significant number of the 71

cold-inducible genes identified in our RNAseq experiments whose expression was

downregulated in npr1 mutants were related with response to heat stress. In fact, out

of the first five enriched GO categories, “response to heat” (GO: 0009408) was the

one with higher value of fold enrichment (fold change=12.2; P=1.2E-6) (Figure 5A).

This category consisted of nine heat stress-inducible genes, including HSFA2,

HSP101, DNAJ, HSP90.1, HSP17.6A, HSP70, HSP17.6II, FES1A and WRKY33. It is

worth noting that the expression of all these genes, except that of WRKY33, had been

described to be regulated by the class A1 heat shock factors (HSFA1s) (Yoshida et

al., 2011), a family of four partially redundant transcriptional activators in Arabidopsis

(HSFA1a, HSFA1b, HSFA1d, HSFA1e), that work as master regulators of the heat

shock response (Liu et al., 2011). More interesting, a detailed analysis of the 71 cold-

inducible genes downregulated in npr1 mutants unveiled that, indeed, 16 (22.5%)

(Supplementary Table 3) belonged to the HSFA1 regulon (Yoshida et al., 2011). That

these genes were really downregulated in npr1 mutants in response to low

temperature, as assumed from the RNAseq data, was confirmed by analyzing their

expression in independent RNA samples from WT, npr1-1 and npr1-2 mutant plants

grown at 20ºC or exposed 24h to 4ºC through qPCR assays (Figure 5B).

Furthermore, as expected, the cold-induction of these genes was independent of the

TGA transcription factors since it was not affected, in any case, in tga2/5/6 triple

mutants (Figure 5C). Therefore, these results provided evidence that NPR1 promotes

 

 

54  

the cold induction of HSFA1-regulated genes independently of the class II TGA

factors.

 

 

55  

 

Figure 5. NPR1 activates the cold-induction of HSFA1-regulated genes.

(A) First five gene ontology (GO) terms enriched in cold-inducible genes downregulated in npr1-1 mutant exposed 24h to 4ºC. (B) and (C) Expression of cold-inducible genes belonging to the HSFA1 regulon in 2-week-old plants from Col-0 (WT), npr1-1 and npr1-2 (B), and WT and tga2/5/6 (C) grown under control conditions or exposed to 4ºC for 24 or 6h. Transcript levels, determined by qPCR, are represented as relative to their corresponding values in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between npr1 mutants and WT exposed to 4ºC, as determined by t-test. No significant differences between tga2/5/6 mutants and WT under cold conditions were observed in any case.

 

 

56  

2.6. HSFA1 transcription factors positively regulates cold acclimation by

inducing heat stress-responsive gene expression under low temperature

conditions

The HSFA1 factors have been reported to play essential roles in other abiotic stress

responses than heat shock, such as water and salt stress responses, by mediating

the induction of heat stress-responsive genes (Liu et al., 2011). Given the very close

relationship existing between these responses and the response to low temperature,

and the results described above, we considered the possibility that the HSFA1 factors

could be involved in cold acclimation by promoting the cold-induced expression of

heat stress-responsive genes. This assumption was first assessed by comparing the

expression levels of the 16 cold-inducible genes that were downregulated in cold-

treated npr1 mutants and belonged to the HSFA1 regulon in a hsfa1a/b/d/e quadruple

knockout mutant (QK) (Liu et al., 2011) and WT plants Wassilewskija (Ws) for hsfa1a

and hsfa1b mutants and Col-0 for hsfa1d and hsfa1e] subjected to 4ºC for 24h. The

cold induction of all genes was significantly lower in the QK mutant than in WT plants,

indicating that, in fact, the HSFA1 factors mediated the induction of heat stress-

responsive genes during cold acclimation (Figure 6A).

The implication of the HSFA1 factors in the adaptive process was definitively

established by examining the capacity of different hsfa1 mutant plants to cold

acclimate. Because of the very small size and pleiotropic phenotype of 3-week-old

QK mutants (Liu et al., 2011), for these experiments we used the four triple mutants,

hsfa1a/b/d (eTK), hsfa1b/d/e (aTK), hsfa1a/b/e (dTK) and hsfa1a/d/e (bTK), which do

 

 

57  

not show significant morphological differences with WT plants (Liu et al., 2011). The

prefixed letters in the triples represent the remaining functional HSFA1 gene. All

mutants displayed significantly reduced freezing tolerance compared to WT plants

after being acclimated 7d at 4ºC and subsequently exposed 6h to -10ºC (Figure 6B).

The impaired ability to cold acclimate exhibited by all triple mutants was consistent

with the proposed partial functional redundancy for the HSFA1 factors (Liu et al.,

2011). Nonetheless, the different mutants showed different abilities, the most affected

being the eTK mutant (Figure 6B) whose survival percentage (≈30%) was similar to

that of npr1 mutants under the same freezing conditions (Figure 2). The low ability of

the eTK mutant to cold acclimate suggested that factors HSFA1a, HSFA1b and

HSFA1d should play a prominent role in the adaptive process.

Our data, therefore, pointed out that the HSFA1 factors would act as positive

regulators of cold acclimation by inducing the expression of heat stress-responsive

genes. That the heat stress-responsive gene expression regulated by these factors

was indeed involved in cold acclimation was determined by analyzing the ability to

acclimate of two null mutant alleles for HSFA2, hsfa2-1 and hsfa2-2 (Nishizawa et al.,

2006). HSFA2 is one of the 16 cold-inducible genes downregulated in cold-treated

npr1 mutants (Figure 5B), a target of HSFA1 factors (Yoshida et al., 2011) and

encodes a secondary regulator of the heat shock response (Liu et al., 2011).

Compared to WT, cold-acclimated (7d, 4ºC) hsfa2-1 and hsfa2-2 mutants showed a

low percentage of survival (≈40%) after being subjected to -10ºC for 6h (Figure 6C),

evidencing that, indeed, the cold-induced heat stress-responsive gene expression

 

 

58  

mediated by the HSFA1 factors is essential for full development of cold acclimation.

Taken together, these results demonstrated that HSFA1 factors positively regulate

cold acclimation in Arabidopsis by promoting heat stress-responsive gene expression

under low temperature conditions.

 

 

59  

Figure 6. HSFA1 factors promote cold acclimation by inducing heat stress-responsive gene expression under low temperature conditions. (A) Expression of cold-inducible genes belonging to the HSFA1 regulon in 2-week-old Col-0 (WT), Wassilewskija (Ws) and QK plants grown under control conditions or exposed to 4ºC for 24 or 6h. Transcript levels, determined by qPCR, are represented as relative to their corresponding values under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between QK mutants and WT and Ws exposed to 4ºC, as determined by ANOVA (Bonferroni’s post hoc test). No significant differences between WT and Ws plants were observed in any case. (B) and (C) Freezing tolerance of 2-week-old plants from WT, Ws, aTK, bTK, dTK and eTK (B), and WT, hsfa2-1 and hsfa2-2 (C) exposed 6h to -10ºC after being acclimated at 4°C for 7d (left panels). Freezing tolerance was estimated as the percentage of plants surviving -10ºC after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001) between TK mutants and WT and Ws, as determined by ANOVA (Bonferroni’s post hoc test) (B), and between hsfa2 mutants and WT, as determined by t-test (C). No significant differences between WT and Ws plants were observed in any case. Right panels show the freezing tolerance of representative cold-acclimated plants from WT, Ws, aTK, bTK, dTK and eTK (B), and WT, hsfa2-1 and hsfa2-2 (C) 7d after being exposed to -10ºC for 6h.

 

 

60  

2.7. NPR1 interacts with HSFA1 transcription factors to activate cold-induced

heat stress-responsive gene expression and cold acclimation

Taking into account that NPR1 functions as a coactivator of gene expression (Fu and

Dong, 2013) and the capacity of the HSFA1 factors to activate transcription and

interact with other proteins (Scharf et al., 2012), we hypothesized that NPR1 could

activate cold-induced heat stress-responsive gene expression, and consequently the

cold acclimation process, by interacting with HSFA1 factors. The interaction between

NPR1 and HSFA1a, HSFA1b and HSFA1d, the factors with a more relevant role in

the process, was first studied by means of bimolecular fluorescence complementation

(BiFC) analysis in Nicotiana benthamiana leaves exposed 24h to 4ºC. Results

revealed that a significant proportion of cells transformed with nYFP-NPR1 and cYFP-

HSFA1a, cYFP-HSFA1b or cYFP-HSFA1d displayed intense yellow fluorescence

(Figure 7A), denoting interaction between these proteins. Consistent with the

subcellular localization of NPR1 in response to low temperature (Figure 3A, B),

NPR1-HSFA1s interactions were mainly observed in the nuclei of cold-treated N.

benthamiana cells (Figure 7A). These interactions were also detected under control

conditions, but, as expected given the low levels of NPR1 at 20ºC (Figure 1E) and its

main cytoplasmic localization (Figure 3A, B), they were much less evident than those

observed in the cold (Figure 7A). No interaction, however, was noticed between

NPR1 and LSM8, a nuclear protein (Perea-Resa et al., 2012) used as a negative

control in the experiments (Figure 7A). In consonance with these observations, we

found that, paralleling NPR1, the HSFA1 factors also localized preferentially in the

nucleus when transiently expressed in leaves of N. benthamiana under low

 

 

61  

temperature conditions (Supplementary Figure 3). The interaction between NPR1 and

HSFA1s was confirmed by in vivo pull-down assays using recombinant purified HIS-

HSFA1a, HIS-HSFA1b and HIS-HSFA1d fusion proteins and extracts from c-npr1

plants grown under control conditions or subjected to 4ºC for 24h. As observed in the

BiFC experiments, NPR1 was clearly pulled down by all His-HSFA1 proteins, the

efficiency being higher when using extracts from cold-treated c-npr1 plants (Figure

7B).

Our results suggested that the NPR1/HSFA1s interaction is essential for the cold

induction of the heat stress-responsive gene expression mediated by the HSFA1

transcription factors and, therefore, for the full development of cold acclimation. To

provide further support to this assumption, the expression levels of the 16 cold-

inducible genes downregulated in cold treated npr1 mutants that belonged to the

HSFA1 regulon were analyzed in trxh3trxh5 and snrk2.8-1 plants, which were

deficient in NPR1 oligomer-to-monomer transition and nuclear translocation (Figure

3B, C), exposed 24h to 4ºC. In all cases, the cold induction of these genes was

significantly lower in trxh3trxh5 and snrk2.8-1 than in WT plants (Figure 7C),

indicating that the nuclear localization of NPR1 and, therefore, its interaction with

HSFA1 factors is necessary to activate cold-induced heat stress-responsive gene

expression. Overall, these data demonstrate that NPR1 acts as a coactivator together

with HSFA1 transcription factors to promote cold-induced heat stress-responsive

gene expression and the cold acclimation response.

 

 

62  

Figure 7. NPR1 interacts with HSFA1 factors to activate cold-induced heat stress-responsive gene expression. (A) In vivo interaction between NPR1 and HSFA1a, HSFA1b and HSFA1d proteins by BiFC assays in N. benthamiana leaf cells under control (20ºC) or cold conditions (4ºC, 24h). Reconstitution of YFP is shown. The interaction of NPR1 with LSM8 was also assayed as a negative control. Scale bars, 75µm. (B) Interactions between NPR1 and HSFA1a, HSFA1b and HSFA1d proteins by in vivo pull down experiments. Input lanes contain protein extracts from c-npr1 plants grown at 20ºC or exposed 24h to 4ºC. Pull down lanes contain reactions using protein extracts from c-npr1 plants grown at 20ºC or exposed 24h to 4ºC and resin-bound recombinant HIS-HSFA1 proteins (HSFA1s) or unbound resin (Resin). Levels of NPR1-MYC were detected by immunoblotting with anti-c-MYC antibody. Anti-α-Tubulin (α-TUB) and anti-HIS antibodies were employed to verify that equal amounts of protein extracts and HSFA1-HIS proteins were used in each reaction, respectively. (C) Expression of cold-inducible genes belonging to the HSFA1 regulon in 2-week-old Col-0 (WT), trxh3trxh5 and snrk2.8-1 plants grown under control conditions or exposed to 4ºC for 24 or 6h. Levels, determined by qPCR, are represented as relative to their corresponding values in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between mutants and WT exposed to 4ºC, as determined by t-test. In (A) and (B), results are representative of 3 independent experiments.

 

 

63  

Supplementary Figure 3. HSFA1 factors localize in the nucleus under low temperature conditions. Subcellular localization of GFP-HSFA1a, GFP-HSFA1b and GFP-HSFA1d fusion proteins in N. benthamiana leaf cells under control (20ºC) or cold conditions (4ºC, 24h). Scale bars, 75µm. Results are representative of 3 independent experiments.  

 

 

64  

3. DISCUSSION

We present genetic and molecular evidence that NPR1, a master regulator of plant

response to pathogen infection, is also involved in regulating plant response to low

temperature. Our results demonstrate that Arabidopsis NPR1 plays a critical role in

cold acclimation by promoting cold-induced gene expression. This role is

accomplished, in part, by interacting with HSFA1 transcriptional activators, the master

regulators of the heat shock response, which leads to the induction of a number of

HSFA1-regulated genes. Consistently, we also demonstrate that the HSFA1 factors

act as positive regulators of cold acclimation and that the cold induction of heat

stress-responsive genes is required to ensure full development of this adaptive

process in Arabidopsis. These findings unveil an unexpected role for NPR1 in plant

adaptation to freezing temperatures that is performed through a novel regulatory

pathway independent from that used by this factor to mediate plant pathogen

response, and suggest that it constitutes an integration node for plant responses to

biotic and abiotic stresses.

Currently, the expression of NPR1 is considered to be exclusively induced in

response to pathogen infection. The expression analysis presented in this work

revealed that in Arabidopsis, NPR1 transcripts also accumulate in response to low

temperature. This accumulation is transient and seems to be stress specific, since

NPR1 transcripts do not accumulate by other cold-related stresses such as drought or

high salt. In contrast to what happens in response to pathogens, SA does not mediate

 

 

65  

the increase of NPR1 mRNAs by low temperature. Furthermore, the levels of NPR1

transcripts in CBF- and ABA-deficient mutants exposed to 4°C are identical to those

in WT plants, denoting that they increase in response to low temperature through a

CBF- and ABA-independent pathway. We show that the cold accumulation of NPR1

mRNAs is regulated at the transcriptional level and that the cis-acting element(s)

implicated are contained within its proximal promoter region (<2 kb). Intriguingly,

however, this region does not contain any described low-temperature responsive

element. Understanding the molecular mechanisms underlying the induction of NPR1

transcripts by low temperature needs further investigation. As expected from the

expression data, the levels of NPR1 protein also increase after cold treatment,

mirroring those of NPR1 transcripts. According to what has been previously reported

(Tada et al., 2008), we found that under control conditions NPR1 preferentially

localizes to the cytoplasm of Arabidopsis cells in its oligomeric form. Remarkably, in

response to low temperature it accumulates chiefly in the nucleus as monomer.

Phosphorylation and redox modifications of NPR1 by SnRK2.8 kinase and

thioredoxins TRXH3/TRXH5, respectively, have been shown to be necessary for the

oligomer to monomer transition and its subsequent nuclear translocation that occurs

after pathogen infection (Tada et al., 2008; Lee et al., 2015). Our data demonstrate

that SnRK2.8 and TRXH3/TRXH5 also mediate the cold-induced monomerization and

nuclear localization of NPR1.

Consistent with the accumulation of NPR1 in response to low temperature, our

genetic analyses provide evidence that it acts as a positive regulator for cold

 

 

66  

acclimation. In fact, loss-of-function npr1 mutants show a significantly lower capacity

to cold acclimate compared to WT plants. In line with these results, Arabidopsis

plants with increased levels of NPR1 display increased capacity to cold acclimate.

NPR1, however, does not seem to be implicated in the ability of Arabidopsis to

tolerate other important abiotic stresses such as drought and high salt. Thus, it does

not play a general role in Arabidopsis tolerance to abiotic stresses but seems to have

a specific function in cold acclimation. The cold induction of NPR1 is independent of

SA, which strongly suggests that this phytohormone does not mediate the role of

NPR1 in cold acclimation. This assumption is further supported by the fact that SA

levels do not increase during cold acclimation in Arabidopsis, and that Arabidopsis

mutants deficient in SA are not affected in their capacity to cold acclimate

(Supplementary Figure 4A, B). Still, the role of NPR1 in cold acclimation requires its

monomerization and subsequent nuclear translocation since Arabidopsis mutants

deficient in SnRK2.8 and TRXH3/TRXH5 activities show impaired cold acclimation

ability, similar to that of npr1 mutants.

The global transcriptome profiles indicate that NPR1 positively regulates cold

acclimation in Arabidopsis by promoting cold-induced gene expression. After 24h of

exposure to 4°C, 71 cold-inducible genes display lower induction (≥2.0-fold) in npr1

than in WT plants. The reduced levels of the corresponding transcripts should

account for the reduced capacity of the npr1 mutants to cold acclimate. Unexpectedly,

almost one fourth (16) of the 71 cold-inducible genes whose induction was mediated

by NPR1 corresponded to heat stress-responsive genes belonging to the HSFA1

 

 

67  

regulon. In Arabidopsis, there are four partially redundant HSFA1 transcription factors

(HSFA1a, b, d, e) that function as the master regulators of the heat shock response

(Liu et al., 2011). The corresponding genes are constitutively expressed (Yoshida et

al., 2011), and it has been estimated that more than 65% of the heat stress-induced

genes are HSFA1 dependent (Liu et al., 2011). It is worth noting that one of the 16

NPR1-mediated cold-inducible genes that belong to the HSFA1 regulon is HSFA2, a

direct target of the HSFA1 factors that encodes a secondary regulator of the heat

shock response (Liu et al., 2011; Yoshida et al., 2011). In addition to activate the heat

shock response, HSFA1 and HSFA2 factors have been described to enhance plant

response to other adverse environmental conditions, including anoxia, salt and

osmotic stresses (Liu et al., 2011). The implication of these transcription factors in

plant response to low temperature, however, has not been still documented. Here, we

show that Arabidopsis plants deficient in HSFA1 or HSFA2 are unable to cold

acclimate properly, evidencing that they also play a positive role in regulating cold

acclimation and that heat stress-responsive gene expression mediated by the HSFA1

factors is required for full development of this adaptive process. In this regard, it has

been proposed that the heat shock proteins operate as buffers against environmental

stresses (Carey et al., 2006). HSFA1 and HSFA2, therefore, represent molecular

integrators of plant responses to extreme temperatures. In the case of HSFA1 factors,

consistent with their functional redundancy, all of them work in promoting cold

acclimation although their contribution to the process is not the same. Our results

suggest that HSFA1a, HSFA1b and HSFA1d have a more relevant role than

HSFA1e.

 

 

68  

As already mentioned, Arabidopsis NPR1 does not contain a canonical DNA binding

domain and must interact with other transcription factors to act as coactivator to

enhance gene expression (Fu and Dong, 2013). To date, NPR1 has only been

described to interact with transcription factors from the TGA family, principally with

TGA2, TGA5 and TGA6, after pathogen attack to induce PR gene expression and the

subsequent defense response (Fu and Dong, 2013). The data obtained in this work

reveal that the NPR1 function in cold response as coactivator of cold-induced gene

expression is fully independent of the TGA class II factors. Actually, the cold-induced

gene expression that is promoted by NPR1 during cold acclimation is not affected in

tga2/5/6 triple mutants, indicating that NPR1 must interact with different factor(s) than

the TGAs to operate in this process. We present compelling evidence that the HSFA1

factors constitute novel clients of Arabidopsis NPR1 through which cold acclimation is

established. In line with these results, the tomato HSFA1 factors have also been

reported to be able of interacting with coactivator proteins to induce transcription

(Bharti et al., 2004). Our findings demonstrate that NPR1 interacts with HSFA1a,

HSFA1b and HSFA1d transcription factors in the nucleus in response to low

temperature to promote cold-induced heat-stress responsive gene expression and

cold acclimation in Arabidopsis. Nevertheless, in addition to promote the induction of

HSFA1-regulated genes under low temperature conditions, NPR1 also fosters the

induction of other genes related to cold response, indicating that it must have

additional roles in cold acclimation through different regulatory pathways. The nature

 

 

69  

of these roles and the corresponding underlying molecular mechanisms remain to be

established.

Based on the data described here, a hypothetical model for NPR1 function in

Arabidopsis cold acclimation is proposed in Figure 8. In response to low temperature,

the expression of NPR1 would be induced independently of SA, ABA and the CBFs.

Concomitantly with this induction there would be an increase of NPR1 protein that

would translocate to the nucleus in its monomeric form in a TRXH3/TRXH5-SnRK2.8-

dependent way. In the nucleus, monomeric NPR1 would operate as a coactivator

promoting cold-induced gene expression and, therefore, cold acclimation by

interacting with different transcription factors, including the HSFA1s. The interaction

of NPR1 with the HSFA1 factors would induce the expression of numerous heat

stress-responsive genes encoding chaperones that would act as powerful buffers to

minimize the impact of low temperatures, and would be essential for the full

development of the cold acclimation process. Hence, NPR1 seems to serve as a

regulatory hub where pathways mediating biotic and abiotic stress responses

converge and integrate to guarantee the precise development of Arabidopsis

tolerance to adverse challenging conditions. Identifying the complete repertoire of

clients through which NPR1 mediates cold acclimation, and the molecular

mechanisms that determine NPR1 involvement in pathogen and/or cold signaling

constitutes a remarkable goal for future studies that will provide new insights on how

plants respond and adapt to fluctuating, and often adverse, natural environments.

 

 

70  

Supplementary Figure 4. The role of NPR1 in cold acclimation is not mediated by SA. (A) Levels of free SA in 2-week-old Col-0 (WT) plants exposed to 4ºC for the indicated hours (h) or days (d). As a positive control, SA levels were also measured in 2-week-old plants of cpr5 mutant grown under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (***P ≤ 0.001) between cpr5 and WT plants, as determined by t-test. No significant differences between cold-treated and control (0h) WT plants were observed. (B) Freezing tolerance of 2-week-old WT, sid2-1, sid2-2 and npr1-1 plants exposed 6h to -10ºC after being acclimated at 4°C for 7d (left panel). Freezing tolerance was estimated as the percentage of plants surviving each specific temperature after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (**P ≤ 0.01) between npr1-1 and the rest of plants analyzed, as determined by t-test). No significant differences between sid2 mutants and WT plants were observed. The right panel shows the freezing tolerance of representative cold-acclimated plants from WT, sid2-1, sid2-2 and npr1-1 plants after being exposed to -10ºC for 6h.

 

 

71  

Figure 8. Proposed model for the function of NPR1 in cold acclimation response.

 

 

72  

4. MATERIALS AND METHODS

4.1. Plant materials

Arabidopsis thaliana Col-0 and Ws ecotypes, and mutants npr1-2 (Shah et al., 1997),

sid2-2 (Wildermuth et al., 2001), trxh3 (SALK_111160), trxh5 (SALK_144259),

snrk2.8-1 (SALK_073395), hsfa2-1 (SALK_008978) and hsfa2-2 (GK-650B06) were

obtained from the Nottingham Arabidopsis Stock Centre. The trxh3trxh5 double

mutant was generated by crossing trxh3 and trxh5 single mutants, and homozygous

lines were confirmed by PCR amplification with suitable primers (Supplementary

Table 4). WT transgenic plants containing the fusion 35S-NPR1-GFP (Kinkema et al.,

2000) as well as the npr1-1 and cpr5 mutants (Bowling et al., 1997) were provided by

Xinnian Dong. The sid2-1 mutant (Adie et al., 2007) was procured by Roberto Solano.

The aba2-11 mutant (González-Guzmán et al., 2002) was received from Pedro

Rodriguez. The tga2-1tga5-1tga6-1 triple mutant (Zhang et al., 2003) was obtained

from Xin Li. The aTK, bTK, dTK, eTK and QK mutants (Liu et al., 2011) were

supplied by Yee-Yung Charng. NahG transgenic plants (Lawton et al., 1995) were

furnished by María Elena Alvarez. The cbf123-1 mutant (Zhao et al., 2016) was

obtained from Jian-Kang Zhu. To generate the NPR1PRO-GUS fusion, a 1989-bp

(−1986 to +3) promoter fragment from NPR1 was amplified with appropriate primers

(Supplementary Table 4) and cloned into the pMDC162 Gateway™ binary vector

(Invitrogen). The NPR1PRO-NPR1-MYC fusion was obtained by amplifying the NPR1

genomic region, including the NPR1PRO fragment, with pertinent primers

 

 

73  

(Supplementary Table 4) and cloning the resulting PCR product into the pGWB616

binary vector (Nakagawa et al., 2007). The NPR1PRO-GUS fusion was then introduced

in WT, and the NPR1PRO-NPR1-MYC fusion in npr1-1 (c-npr1), trxh3trxh5 and

snrk2.8-1 mutants via Agrobacterium tumefaciens (GV3101 strain), using the floral

dip method (Zhang et al., 2006). All transgenic lines were genetically determined to

have the fusions integrated at a single locus in homozygosis. For BiFC assays, full-

length cDNAs corresponding to NPR1, HSFA1a, HSFA1b, HSFA1d and LSM8 genes

were amplified with suitable primers (Supplementary Table 4) and the resulting PCR

products cloned into the pDONOR207 Gateway™ binary vector (Invitrogen)

(Nakagawa et al., 2007). Subsequently, they were transferred to pYFN43 and

pYFC43 binary vectors (Belda-Palazón et al., 2012) using the Gateway™ cloning

system to generate the nYFP-NPR1 and the cYFP-HSFA1a, cYFP-HSFA1b, cYFP-

HSFA1d and cYFP-LSM8 fusions, respectively. For the subcellular localization of

HSFA1a, HSFA1b and HSFA1d factors, the corresponding cDNAs cloned in

pDONOR207 were transferred to the pMDC43 Gateway™ binary vector to obtain

GFP-HSFA1 fusions. Plasmids containing the YFP and GFP fusions were introduced

into Agrobacterium strain GV3101 for agroinfiltration in 3-week-old N. benthamiana

leaves (see below). For in vivo pull-down assays (see below), the HSFA1a, HSFA1b

and HSFA1d cDNAs cloned in pDONOR207 were transferred to the pDEST17

Gateway™ vector, to generate HIS-HSFA1 fusions. All constructs used in this work

were validated by sequencing.

 

 

74  

4.2. Growth conditions and treatments

Seeds were surface-sterilized, germinated, and grown under standard conditions

[20ºC under long-day photoperiods (16h light, of cool-white fluorescent light, photon

flux of 90 µmol m−2 s−1)] in pots containing a mixture of organic substrate and

vermiculite (3:1, v/v) or in Petri dishes containing Murashige and Skoog medium

supplemented with 1% sucrose (GM) and solidified with 0.9% (w/v) plant agar. Low-

temperature treatments for gene expression and immunoblot analyses were

performed by transferring plants growing in pots or Petri dishes under standard

conditions to a growth chamber set to 4°C for different times under a long-day

photoperiod (16h of cool-white fluorescent light, photon flux of 40µmol m−2 s−1). Water

and salt stress treatments for gene expression assays were accomplished by

transferring plants growing in Petri dishes under standard conditions to plates

containing GM medium supplemented with 300mM sorbitol or 150mM NaCl,

respectively, for different periods of time. In all cases, tissue samples were frozen in

liquid nitrogen after treatment and stored at -80°C until use. For histochemical

analysis of GUS activity, cold treatments were performed on 2-week-old plants

expressing the NPR1PRO-GUS fusion grown under standard conditions and

subsequently transferred to a growth chamber set to 4°C for one additional day.

Tolerance to freezing temperatures was determined on 2-week-old plants grown on

soil under standard conditions and subsequently exposed to 4ºC for 7d (cold

acclimated) as described (Catalá et al., 2011). Tolerance to water and salt stresses

was assessed on 5-day-old seedlings grown on GM medium under standard

conditions and then transferred to new plates containing GM medium supplemented

 

 

75  

with 300mM sorbitol or 200mM NaCl for one week. In both cases, tolerance was

estimated as the percentage of the main root length and fresh weight of the plants

after treatments. All data reported about tolerances are expressed as standard

deviations of the means of at least three independent experiments with 50 plants

each.

4.3. Gene expression analysis and RNAseq experiments

For gene expression, total RNA was obtained using Purezol™ reagent (Bio-Rad)

according to the manufacturer’s instructions. RNA samples were treated with DNase I

(Roche) and quantified with a Nanodrop spectrophotometer (Thermo Scientific).

cDNA was synthesized from each sample with the iScript™ cDNA synthesis kit (Bio-

Rad), and qPCRs were performed with SsoFast™ EvaGreen Supermix (Bio-Rad) in a

Bio-Rad iQ2 thermocycler. The relative expression values were calculated using the

At4g24610 gene as a reference (Czechowski et al., 2005). Primers used are listed in

Supplementary Table 4. All reactions were realized in triplicate employing three

independent RNA samples.

For RNAseq experiments, total RNA was obtained from 2-week-old WT and npr1-1

plants exposed to 4ºC for 24h using TRIzol™ Reagent (Invitrogen) and cleaned with

the RNeasy Plant Mini Kit (Qiagen). cDNA libraries were generated from three

independent RNA preparations each. RNA quality, library preparation, and

subsequent sequencing were performed by the staff of Life Sequencing (Valencia,

Spain). RNAseq reads were aligned to the TAIR10 WT reference genome using

 

 

76  

TopHat2 (Kim et al., 2013b) with default parameters. Uniquely mapped reads

(Supplementary Table 5) were counted per representative gene model (excluding

introns) according to the TAIR10 annotation using custom R scripts. Only genes with

reads per kilobase per million >1 in at least one sample were used for differential

expression analysis between WT and npr1-1 plants using DEseq2 (Love et al., 2014).

This package internally estimates size factors for each sample, calculates dispersion

for each gene, and then fits a negative binomial GLM to detect differentially

expressed genes taking into account the size factors and dispersion values.

The Expression Browser tool of The Bio-Analytic Resource for Plant Biology

(http://bar.utoronto.ca) was used to determine the genes from our RNAseq data that,

in addition of being downregulated in the npr1-1 mutant, were cold induced. Selected

settings were “AtGenExpress-stress series” as data set and “cold stress” as research

area (Kilian et al., 2007). All tissue types, growth stages, and time points were

considered, output options were set to “Average of replicate treatments relative to

average of appropriate control”, and induction was only contemplated when fold

change was equal to or higher than 2-fold. Gene ontology (GO) categorization was

done with the ThaleMine data mining tool from Araport (www.araport.org).

Significantly enriched GO terms (P-value ≤ 2E-6) were established using the

Benjamini Hochberg corrected hypergeometric test.

 

 

77  

4.4. SA measurements

For total SA measurements, leaves from 2-week-old WT and cpr5 plants were frozen

in liquid nitrogen, ground and extracted as previously described (Kim et al., 2013a).

Instrumental set up, data acquisition and calculations were performed as reported

(Pastor et al., 2012).

4.5. Determination of GUS activity

GUS activity in Arabidopsis transgenic plants containing the fusion NPR1PRO-GUS

was detected and measured as described (Medina, 2001).

4.6. Microscopy analysis

Subcellular localization of the NPR1-GFP fusion protein was performed by confocal

microscopy in roots from 6-day-old transgenic seedlings containing the 35S-NPR1-

GFP construct grown in petri dishes under control conditions or exposed 24h to 4ºC.

Transient expression of fusion proteins for BiFC assays and for subcellular

localization of HSFA1 factors was analyzed, also by confocal microscopy, 3d after

agroinfiltration in leaves of 3-week-old N. benthamiana plants exposed to 20°C or 24h

to 4ºC, as reported by English et al. (1997). Microscopy images were collected using

a TCS SP2 confocal laser spectral microscope (Leica Microsystems). The excitation

lines for imaging GFP and YFP fusions were 488 and 514 nm, respectively. All

microscopy analyses were performed, at least, in triplicate with independent samples.

 

 

78  

4.7. Immunoblot analysis and subcellular fractionation

Total proteins were extracted from 2-week-old c-npr1 plants grown under control

conditions or exposed to 4ºC for different periods of time. Plants were ground in

extraction buffer [50mM TRIS pH 7.5, 150mM NaCl, 5mM EDTA, 0.1% Triton X-100,

0.2% Nonident P-40] with inhibitors [40µM MG132, protease inhibitor cocktail EDTA-

free (Roche), 0.6mM PMSF], and cell debris were pelleted by centrifugation (16000g,

4ºC, 20 min) to obtain clear protein extracts. Protein concentration was determined by

Bradford, using the BioRad Protein Assay (Bio-Rad). Loading buffer containing 6mM

beta-mercaptoethanol was added to protein extracts for visualizing total NPR1 protein

(reducing conditions). To visualize both monomeric and oligomeric NPR1 forms, we

employed loading buffer without beta-mercaptoethanol (non-reducing conditions).

Proteins (50µg) were resolved by electrophoresis on 12% SDS-polyacrylamide gels

and transferred to Hybond P 0.45 PVDF membranes (Amersham), according to the

manufacturer’s protocol. To detect the NPR1-MYC protein, we used anti-c-MYC

monoclonal antibody (sc-40; Santa Cruz Biotechnology). α-Tubulin, employed as a

protein loading control, was detected using anti-α-tubulin monoclonal antibody

(T60T4; Sigma).

Subcellular fractionation was performed as reported previously (Locascio et al., 2013)

using extracts from 2-week-old c-npr1 plants and transgenic trxh3trxh5 and snrk2.8-1

plants containing the NPR1PRO-NPR1-MYC fusion grown under control conditions or

exposed 24h to 4ºC. Isolated proteins were fractionated by electrophoresis,

transferred to membranes as described above, and analyzed by immunoblotting

 

 

79  

using anti-α-tubulin monoclonal (see above) and anti-Histone H3 polyclonal (sc-

10809, Santa Cruz Biotechnology) antibodies for control of the cytoplasmic and

nuclear fractions, respectively.

In all cases, horseradish peroxidase-conjugated secondary antibodies were used for

primary antibody detection. Signals were always detected with the ECL Western

Blotting Detection Kit (Amersham), and assays were performed in triplicate employing

three independent protein samples.

4.8. Pull down assays

HIS-HSFA1a, HIS-HSFA1b and HIS-HSFA1d constructs were expressed in

Escherichia coli BL21-CodonPlus (DE3). Cells were grown in 250 ml of Terrific Broth

medium at 28ºC until reaching an OD600 0.4-0.5. The induction of fusion proteins

was performed by addition of 0.1mM IPTG and incubation at 28ºC for 12 h. Cells

were then centrifuged at 13000g for 30min at 4ºC and pellet was resuspended in 3

ml/gr of resuspension buffer [50 mM Tris-HCl pH 8.0, 300mM NaCl, 1mM PMSF,

10mM Imidazole and protease inhibitor cocktail EDTA-free (Roche)]. After lysis by

French press and centrifugation (13000g, 4ºC, 30 min), supernatants (70mg of

protein) were mixed with 400 µl of ProBond™ Nickel-Chelating Resin (Thermo Fisher

Scientific) and gently shaken for 2h at 4ºC. Resins were finally washed three times

with resuspension buffer containing 0.5% Nonidet P-40 before used. Two-week-old

WT and c-npr1 plants grown under control conditions or exposed 24h to 4ºC were

ground in liquid nitrogen and homogenized in pull-down extraction buffer [50mM Tris-

 

 

80  

HCl pH 7.5, 150mM NaCl, 1mM PMSF, 0.5% Nonidet P-40, 0.05% Triton X100, 10%

Glycerol, 25 µM MG132 and protease inhibitor cocktail EDTA-free (Roche)].

Homogenates were centrifuged (13000g, 4ºC, 15 min) and supernatants collected.

For in vivo pull-down assays, 40µl of resin-bound HSFA1-His fusion proteins were

added to 3 mg of total protein extracts and incubated 1h at 4ºC with gentle agitation.

Then, resins were washed 3 times in pull-down extraction buffer, loaded on 12%

SDS-PAGE gels, transferred to Hybond membranes and incubated with anti-His

monoclonal antibody (H1029, Sigma), to verify that equal amounts of HIS-fused

proteins were used in each assay, or with anti-c-MYC monoclonal antibody (see

above), to detect the NPR1-MYC protein recovered in those assays. We employed

anti-α-tubulin monoclonal antibody (see above) to confirm equal protein loading from

control and cold exposed plant extracts in the pull-downs. In all cases, horseradish

peroxidase-conjugated secondary antibodies were used for primary antibody

detection. Pull-down assays were always realized in triplicate employing three

independent protein samples.

4.9. Statistical analyses

The statistical significance of the results was determined by using PRISM 6.0

(GraphPad Software Inc., USA: http://www.graphpad.com). Comparisons between

two groups of data were realized employing Student's t-test. Comparisons between

multiple groups of data were made by means of one-way ANOVA and Bonferroni’s

post hoc test, taking P < 0.05. The values of control conditions or WTs were

considered as references.

 

 

81  

4.10. Accession numbers

Sequence data from this article can be found in the GenBank/EMBL data libraries

under the accession numbers listed in Supplementary Table 6. The full names of the

genes mentioned in this article are also included in Supplementary Table 6. The

RNAseq data from this article have been submitted to the Gene Expression Omnibus

database (www.ncbi.nlm.nih.gov/geo) and assigned the identifier accession

GSE101483.

 

 

82  

Supplemental Data Set 1 Top 200 downregulated genes in npr1-1 mutant in response to low temperature

AGI Fold Change Gene Name AT2G26020 -19,9 PLANT DEFENSIN 1.2B (PDF1.2b) AT2G37430 -16,4 AT3G63088 -16,0 ROTUNDIFOLIA LIKE 14 (RTFL14) ATMG00665 -15,5 NADH DEHYDROGENASE 5B (NAD5B) AT1G24000 -14,5 AT1G33055 -14,5 AT3G29370 -14,5 P1R3 (P1R3) AT4G37290 -14,5 AT5G12030 -9,2 HEAT SHOCK PROTEIN 17.6A (HSP17.6A) AT2G14610 -7,3 PATHOGENESIS-RELATED GENE 1 (PR1) AT5G15360 -6,4 AT3G01345 -5,5 AT3G55920 -5,5 AT1G14880 -5,3 PLANT CADMIUM RESISTANCE 1 (PCR1) AT5G12020 -4,9 17.6 KDA CLASS II HEAT SHOCK PROTEIN (HSP17.6II) ATMG00650 -4,8 NADH DEHYDROGENASE SUBUNIT 4L (NAD4L) AT1G07400 -4,5 AT5G52640 -4,4 HEAT SHOCK PROTEIN 90.1 (HSP90.1) AT4G12400 -4,2 HOP3 (Hop3) AT5G48570 -4,0 ROF2 AT3G09940 -3,9 MONODEHYDROASCORBATE REDUCTASE (MDHAR) ATMG01120 -3,9 NADH DEHYDROGENASE 1B (NAD1B) AT5G44430 -3,8 PLANT DEFENSIN 1.2C (PDF1.2c) AT1G53480 -3,8 MTO 1 RESPONDING DOWN 1 (MRD1) AT3G22231 -3,7 PATHOGEN AND CIRCADIAN CONTROLLED 1 (PCC1) AT3G22235 -3,7 AT1G15010 -3,5 ATMG01080 -3,4 MITOCHONDRIAL F0-ATPASE SUBUNIT 9 (ATP9) AT3G26200 -3,4 CYTOCHROME P450, FAMILY 71, SUBFAMILY B,

POLYPEPTIDE 22 (CYP71B22) AT5G44420 -3,4 PLANT DEFENSIN 1.2 (PDF1.2) AT2G22880 -3,2 AT2G01021 -3,2 AT3G12580 -3,2 HEAT SHOCK PROTEIN 70 (HSP70) AT3G22240 -3,2 AT2G07671 -3,1 ATMG00160 -3,1 CYTOCHROME OXIDASE 2 (COX2) AT4G18250 -3,1 ATMG01130 -3,0 ORF106F AT2G24850 -3,0 TYROSINE AMINOTRANSFERASE 3 (TAT3) AT1G13470 -3,0 AT1G53490 -3,0 HOMOLOG OF HUMAN HEI10 ( ENHANCER OF CELL

INVASION NO.10) (HEI10) AT1G74310 -3,0 HEAT SHOCK PROTEIN 101 (HSP101) AT2G14560 -2,8 LATE UPREGULATED IN RESPONSE TO

 

 

83  

HYALOPERONOSPORA PARASITICA (LURP1) ATMG00080 -2,8 RIBOSOMAL PROTEIN L16 (RPL16) AT2G32030 -2,8 AT1G21326 -2,8 AT1G57630 -2,7 ATMG01190 -2,7 ATP SYNTHASE SUBUNIT 1 (ATP1) AT1G71000 -2,6 DNAJ ATMG00480 -2,5 ORFB AT4G34770 -2,5 AT3G46230 -2,5 HEAT SHOCK PROTEIN 17.4 (HSP17.4) AT2G07707 -2,5 AT3G41762 -2,5 AT3G57460 -2,5 ATMG01360 -2,4 CYTOCHROME OXIDASE (COX1) AT3G50770 -2,4 CALMODULIN-LIKE 41 (CML41) AT1G19960 -2,4 AT2G43570 -2,4 CHITINASE, PUTATIVE (CHI) AT3G28210 -2,4 PMZ AT2G26010 -2,4 PLANT DEFENSIN 1.3 (PDF1.3) AT1G63980 -2,3 AT5G25260 -2,3 ATMG00070 -2,3 NADH DEHYDROGENASE SUBUNIT 9 (NAD9) AT3G20395 -2,3 AT5G45310 -2,3 AT3G26830 -2,2 PHYTOALEXIN DEFICIENT 3 (PAD3) ATMG00060 -2,2 NADH DEHYDROGENASE SUBUNIT 5C (NAD5C) AT2G32680 -2,2 RECEPTOR LIKE PROTEIN 23 (RLP23) AT2G26150 -2,2 HEAT SHOCK TRANSCRIPTION FACTOR A2 (HSFA2) AT5G19100 -2,2 AT1G66700 -2,2 PXMT1 AT2G20560 -2,2 AT2G01008 -2,2 AT4G23150 -2,1 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 7

(CRK7) AT5G25440 -2,1 ATMG01370 -2,1 ORF111D AT3G14620 -2,1 CYTOCHROME P450, FAMILY 72, SUBFAMILY A,

POLYPEPTIDE 8 (CYP72A8) AT2G39030 -2,1 N-ACETYLTRANSFERASE ACTIVITY 1 (NATA1) ATMG00640 -2,1 ORF25 AT2G18690 -2,1 AT3G26210 -2,1 CYTOCHROME P450, FAMILY 71, SUBFAMILY B,

POLYPEPTIDE 23 (CYP71B23) AT3G57260 -2,1 PATHOGENESIS-RELATED PROTEIN 2 (PR2) AT3G50480 -2,0 HOMOLOG OF RPW8 4 (HR4) ATMG00030 -2,0 ORF107A AT2G07698 -2,0 AT1G52690 -2,0 LATE EMBRYOGENESIS ABUNDANT 7 (LEA7) AT1G63990 -2,0 SPORULATION 11-2 (SPO11-2)

 

 

84  

AT2G34600 -2,0 JASMONATE-ZIM-DOMAIN PROTEIN 7 (JAZ7) AT1G28640 -2,0 AT1G74929 -2,0 AT4G14365 -1,9 XB3 ORTHOLOG 4 IN ARABIDOPSIS THALIANA (XBAT34) AT3G07195 -1,9 AT4G14400 -1,9 ACCELERATED CELL DEATH 6 (ACD6) AT4G04745 -1,9 AT1G56060 -1,9 AT3G09350 -1,8 FES1A (Fes1A) AT5G59310 -1,8 LIPID TRANSFER PROTEIN 4 (LTP4) AT3G58200 -1,8 AT2G18660 -1,8 PLANT NATRIURETIC PEPTIDE A (PNP-A) AT2G29500 -1,8 AT1G52890 -1,8 NAC DOMAIN CONTAINING PROTEIN 19 (ANAC019) AT5G22380 -1,8 NAC DOMAIN CONTAINING PROTEIN 90 (NAC090) AT2G32160 -1,8 AT4G10910 -1,8 AT4G23140 -1,8 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 6

(CRK6) AT1G14870 -1,7 PLANT CADMIUM RESISTANCE 2 (PCR2) AT2G15220 -1,7 AT1G35230 -1,7 ARABINOGALACTAN PROTEIN 5 (AGP5) AT4G11890 -1,7 ABA- AND OSMOTIC-STRESS-INDUCIBLE RECEPTOR-LIKE

CYTOSOLIC KINASE1 (ARCK1) AT2G20142 -1,7 AT1G24140 -1,7 AT1G17870 -1,7 ETHYLENE-DEPENDENT GRAVITROPISM-DEFICIENT AND

YELLOW-GREEN-LIKE 3 (EGY3) AT4G11000 -1,7 AT3G44860 -1,7 FARNESOIC ACID CARBOXYL-O-METHYLTRANSFERASE

(FAMT) AT1G65690 -1,7 AT3G45860 -1,7 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 4

(CRK4) AT3G29000 -1,6 AT2G30770 -1,6 CYTOCHROME P450, FAMILY 71, SUBFAMILY A,

POLYPEPTIDE 13 (CYP71A13) AT1G36622 -1,6 AT1G67810 -1,6 SULFUR E2 (SUFE2) AT4G11521 -1,6 AT2G01170 -1,6 BIDIRECTIONAL AMINO ACID TRANSPORTER 1 (BAT1) AT5G24110 -1,6 WRKY DNA-BINDING PROTEIN 30 (WRKY30) AT3G26230 -1,6 CYTOCHROME P450, FAMILY 71, SUBFAMILY B,

POLYPEPTIDE 24 (CYP71B24) AT5G39670 -1,6 AT2G46430 -1,6 CYCLIC NUCLEOTIDE GATED CHANNEL 3 (CNGC3) AT5G39020 -1,5 AT1G49000 -1,5 AT2G25735 -1,5 AT1G14120 -1,5 AT4G09649 -1,5

 

 

85  

AT1G11740 -1,5 AT2G17040 -1,5 NAC DOMAIN CONTAINING PROTEIN 36 (NAC036) AT5G45630 -1,5 AT2G18680 -1,5 AT5G44260 -1,5 AT1G66090 -1,5 AT3G18590 -1,5 EARLY NODULIN-LIKE PROTEIN 5 (ENODL5) AT4G20110 -1,5 VACUOLAR SORTING RECEPTOR 7 (VSR7) AT1G51780 -1,5 IAA-LEUCINE RESISTANT (ILR)-LIKE GENE 5 (ILL5) AT2G29350 -1,5 SENESCENCE-ASSOCIATED GENE 13 (SAG13) AT3G17520 -1,5 AT1G21250 -1,5 CELL WALL-ASSOCIATED KINASE (WAK1) AT5G51990 -1,5 C-REPEAT-BINDING FACTOR 4 (CBF4) AT4G16590 -1,5 CELLULOSE SYNTHASE-LIKE A01 (CSLA01) AT1G02920 -1,5 GLUTATHIONE S-TRANSFERASE 11 (ATGSTF11) AT1G19020 -1,5 AT4G39670 -1,5 AT2G04495 -1,5 AT2G39330 -1,5 JACALIN-RELATED LECTIN 23 (JAL23) AT5G49120 -1,5 AT1G47760 -1,4 AGAMOUS-LIKE 102 (AGL102) AT1G51055 -1,4 AT5G10760 -1,4 AT5G25250 -1,4 FLOTILLIN 1 (FLOT1) AT2G15390 -1,4 FUCOSYLTRANSFERASE 4 (FUT4) AT5G16570 -1,4 GLUTAMINE SYNTHETASE 1;4 (GLN1;4) AT5G59220 -1,4 HIGHLY ABA-INDUCED PP2C GENE 1 (HAI1) AT2G47130 -1,4 SHORT-CHAIN DEHYDROGENASE/REDUCTASE 2 (SDR3) AT2G05915 -1,4 AT1G74930 -1,4 ORA47 AT5G20030 -1,4 AT4G35770 -1,4 SENESCENCE 1 (SEN1) AT5G54610 -1,4 ANKYRIN (ANK) AT1G75050 -1,4 AT1G35710 -1,4 AT5G42530 -1,4 AT3G55970 -1,4 JASMONATE-REGULATED GENE 21 (JRG21) AT4G21850 -1,4 METHIONINE SULFOXIDE REDUCTASE B9 (MSRB9) AT5G41750 -1,4 AT5G24530 -1,4 DOWNY MILDEW RESISTANT 6 (DMR6) AT4G23220 -1,4 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 14

(CRK14) AT5G23830 -1,4 AT1G62580 -1,4 NITRIC OXIDE-DEPENDENT GUANYLATE CYCLASE 1

(NOGC1) AT3G25010 -1,3 RECEPTOR LIKE PROTEIN 41 (RLP41) AT3G04720 -1,3 PATHOGENESIS-RELATED 4 (PR4) AT3G45851 -1,3 AT1G61580 -1,3 R-PROTEIN L3 B (RPL3B)

 

 

86  

AT4G02520 -1,3 GLUTATHIONE S-TRANSFERASE PHI 2 (GSTF2) AT1G47370 -1,3 AT2G46400 -1,3 WRKY DNA-BINDING PROTEIN 46 (WRKY46) AT2G44290 -1,3 AT1G30755 -1,3 AT5G27420 -1,3 CARBON/NITROGEN INSENSITIVE 1 (CNI1) AT5G52760 -1,3 AT1G26800 -1,3 AT2G02930 -1,3 GLUTATHIONE S-TRANSFERASE F3 (GSTF3) AT2G29460 -1,3 GLUTATHIONE S-TRANSFERASE TAU 4 (GSTU4) AT3G21780 -1,3 UDP-GLUCOSYL TRANSFERASE 71B6 (UGT71B6) AT2G30432 -1,3 TRICHOMELESS1 (TCL1) AT3G06895 -1,3 AT2G38470 -1,3 WRKY DNA-BINDING PROTEIN 33 (WRKY33) AT5G59320 -1,3 LIPID TRANSFER PROTEIN 3 (LTP3) AT5G66650 -1,3 AT1G76650 -1,2 CALMODULIN-LIKE 38 (CML38) AT3G52400 -1,2 SYNTAXIN OF PLANTS 122 (SYP122) AT3G16530 -1,2 AT4G23170 -1,2 EP1 AT1G28370 -1,2 ERF DOMAIN PROTEIN 11 (ERF11)

 

 

87  

Supplemental Data Set 2 Cold-inducible genes downregulated in npr1-1 mutant in response to low temperature

AGI Gene Name AT5G12020 17.6 KDA CLASS II HEAT SHOCK PROTEIN (HSP17.6II) AT4G11890 ABA- AND OSMOTIC-STRESS-INDUCIBLE RECEPTOR-LIKE

CYTOSOLIC KINASE1 (ARCK1) AT5G10760 APOPLASTIC, EDS1-DEPENDENT 1 (AED1) AT1G35230 ARABINOGALACTAN PROTEIN 5 (AGP5) AT2G01170 BIDIRECTIONAL AMINO ACID TRANSPORTER 1 (BAT1) AT1G76650 CALMODULIN-LIKE 38 (CML38) AT5G27420 CARBON/NITROGEN INSENSITIVE 1 (CNI1) AT1G71000 CHAPERONE DNAJ-DOMAIN SUPERFAMILY PROTEIN (DNAJ) AT2G43570 CHITINASE, PUTATIVE (CHI) AT3G26210 CYTOCHROME P450, FAMILY 71, SUBFAMILY B, POLYPEPTIDE

23 (CYP71B23) AT5G51990 C-REPEAT-BINDING FACTOR 4 (CBF4) AT4G23220 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 14

(CRK14) AT4G23140 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 6

(CRK6) AT4G23150 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 7

(CRK7) AT5G24530 DOWNY MILDEW RESISTANT 6 (DMR6) AT1G28370 ERF DOMAIN PROTEIN 11 (ERF11) AT1G47370 RESPONSE TO THE BACTERIAL TYPE III EFFECTOR PROTEIN

HOPBA1 (RBA1) AT3G44860 FARNESOIC ACID CARBOXYL-O-METHYLTRANSFERASE (FAMT) AT3G09350 FES1A (Fes1A) AT5G25250 FLOTILLIN 1 (FLOT1) AT2G15390 FUCOSYLTRANSFERASE 4 (FUT4) AT1G02920 GLUTATHIONE S-TRANSFERASE 11 (ATGST11) AT1G74310 HEAT SHOCK PROTEIN 101 (HSP101) AT5G12030 HEAT SHOCK PROTEIN 17.6A (HSP17.6A) AT3G12580 HEAT SHOCK PROTEIN 70 (HSP70) AT5G52640 HEAT SHOCK PROTEIN 90.1 (HSP90.1) AT2G26150 HEAT SHOCK TRANSCRIPTION FACTOR A2 (HSFA2) AT5G59220 HIGHLY ABA-INDUCED PP2C GENE 1 (HAI1) AT4G12400 HOP3 (Hop3) AT3G55970 JASMONATE-REGULATED GENE 21 (JRG21) AT2G34600 JASMONATE-ZIM-DOMAIN PROTEIN 7 (JAZ7) AT1G52690 LATE EMBRYOGENESIS ABUNDANT 7 (LEA7) AT1G52890 NAC DOMAIN CONTAINING PROTEIN 19 (ANAC019) AT2G17040 NAC DOMAIN CONTAINING PROTEIN 36 (ANAC036) AT5G22380 NAC DOMAIN CONTAINING PROTEIN 90 (ANAC090) AT1G65690 NDR1/HIN1-LIKE 6 (NHL6) AT1G74930 ORA47 AT3G57260 PATHOGENESIS-RELATED PROTEIN 2 (PR2) AT1G14870 PLANT CADMIUM RESISTANCE 2 (PCR2)

 

 

88  

AT2G18660 PLANT NATRIURETIC PEPTIDE A (PNP-A) AT3G28210 PMZ AT4G35770 SENESCENCE 1 (SEN1) AT4G34770 SMALL AUXIN UPREGULATED RNA 1 (SAUR1) AT3G52400 SYNTAXIN OF PLANTS 122 (SYP122) AT5G44260 TANDEM CCCH ZINC FINGER PROTEIN 5 (TZF5) AT5G24110 WRKY DNA-BINDING PROTEIN 30 (WRKY30) AT2G38470 WRKY DNA-BINDING PROTEIN 33 (WRKY33) AT2G46400 WRKY DNA-BINDING PROTEIN 46 (WRKY46) AT4G14365 XB3 ORTHOLOG 4 IN ARABIDOPSIS THALIANA (XBAT34) AT2G37430 ZINC FINGER OF ARABIDOPSIS THALIANA 11 (ZAT11) AT2G20142 AT3G17520 AT1G24140 AT2G32030 AT5G45630 AT4G10910 AT1G66090 AT2G18690 AT1G33055 AT5G39670 AT5G52760 AT5G66650 AT1G19020 AT1G75050 AT5G49120 AT4G39670 AT2G25735 AT1G57630 AT1G15010 AT2G20560 AT4G18250

 

 

89  

Supplemental Data Set 3 Cold-inducible genes whose expression is regulated by HSFA1 transcription factors

AGI Gene Description Primary Gene

Symbol

All Gene Symbols

AT5G45630 senescence regulator (Protein of unknown function, DUF584);(source:Araport11)

AT1G71000 Chaperone DnaJ-domain superfamily protein;(source:Araport11) DNAJ DNAJ

AT1G57630 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)

AT2G20560 DNAJ heat shock family protein

AT2G18690 transmembrane protein

AT3G28210 Encodes a putative zinc finger protein (PMZ). PMZ PMZ; SAP12

AT5G12020 17.6 kDa class II heat shock protein HSP17.6II HSP17.6II

AT3G09350 Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). Fes1A is cytosolic and associates with cytosolic Hsp70. Mutants showed increased heat-sensitive phenotype suggestion the involvement of Fes1A in acquired thermotolerance. Does not have nucleotide exchange factor activity in vitro.

FES1A FES1A (Fes1A)

AT1G74310 Encodes ClpB1, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Involved in refolding of proteins which form aggregates under heat stress. Also known as AtHsp101. AtHsp101 is a cytosolic heat shock protein required for acclimation to high temperature.

HSP101 HSP101; ATHSP101; HOT1

AT5G12030 Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development.

HSP17.6A HSP17.6A; AT-HSP17.6A; HSP17.6

AT3G12580 heat shock protein 70 HSP70 HSP70; HSC70-4; ATHSP70

AT5G52640 Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile.

HSP90.1 HSP90.1; HSP83; AtHsp90-1; HSP81-1; ATHS83

AT2G26150 member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay.

HSFA2 HSFA2; ATHSFA2

AT4G12400 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.

HOP3 HOP3

AT1G14870 PCR2 encodes a membrane protein involved in zinc transport and detoxification.

PCR2 PCR2; AtPCR2

AT5G44260 Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs).

TZF5 TZF5; ATTZF5

 

 

90  

Supplemental Data Set 4 Specific primers used for gene expression by qPCR Gene AGI Type Sequence (5'- 3') NPR1 AT1G64280 qRT-F TTTGTTCTCGTTTGTCTTC

qRT-R TATGGCGGTTGAATGTAA

GUS qRT-F GCGCGTTACAAGAAAGCCGG

qRT-R AGTCCCGCTAGTGCCTTGTC

ANAC019 AT1G52890 qRT-F CGGTCTTGCGGATACTTCTAACT

qRT-R CGTCTTCAGGTAGCCACAGT

LEA7 AT1G52690 qRT-F GTGAGACACAGAGGAAGTGAAGAG

qRT-R CTCACGAACGCAACAAACACTAATC

XBAT34 AT4G14365 qRT-F GTTGGAGTTGGTTCTGTA

qRT-R GGAGTCATCAATAATCATCAC

ATGST11 AT1G02920 qRT-F CTTTCATCTTCCGCAACCCTTT

qRT-R GTTGGTTTCCTTTGTCTGAGTA

AT2G18690 AT2G18690 qRT-F TTGGCTTTGGCTTCCTCTTCTTT

qRT-R TAGCAAAATAGGACTGAGAGACG

CML38 AT1G76650 qRT-F TCAAGGGAGCGTTTAGACTGTA

qRT-R CTCCATCAGCATTGAGATCAAA

AT1G19020 AT1G19020 qRT-F CGTCGTGAGAAGCAGCGGAAGT

qRT-R GTGGTTTTGTGATACTTGTCCT

PR2 AT3G57260 qRT-F TGGATCACCGAGAAGGCCAGGG

qRT-R TGTCGATCTGGATGAAACAGTCCCCA

FLOT1 AT5G25250 qRT-F GAGCGTCACAGTATTTGGCGAT

qRT-R ACCAATCGTAAAAACAGCGGGA

AT4G39670 AT4G39670 qRT-F TCAACACGCCATTGTCCGTAAT

qRT-R CGACGCTTCCACCAAATCCTTA

AT1G15010 AT1G15010 qRT-F GGACATCACAAAGAATCGCCAC

qRT-R ATGTTCTCGTCCACCGTTCTTC

HSFA2 AT2G26150 qRT-F CTTGGAGTAATGGTCGTA

qRT-R TTGCTATGCTTGAAGTAAC

HSP101 AT1G74310 qRT-F TAGTCTTATTAAGGTCATTCG

qRT-R CATAATCAACTGGTCAACA

DNAJ AT1G71000 qRT-F GTTGGACTCTATGATTCTG

qRT-R CATTGATTGGTTCTGGAA

HSP90.1 AT5G52640 qRT-F TGAGGTTGAAGAAGTTGAT

qRT-R TCTGCTTGTTGATGAGTT

HSP17.6A AT5G12030 qRT-F AACTTCACACCTTCATTC

 

 

91  

qRT-R CCAGATAGAGAACGAGAA

HSP70 AT3G12580 qRT-F GGTGGTGTTGTTATGACTGTT

qRT-R CTGGTTGTCTGAATAGGTAG

HSP17.6II AT5G12020 qRT-F TTCTCGTTGTTGTTGTGGTCTT

qRT-R ACAATGGATTTAGGAAGGTTT

FES1A AT3G09350 qRT-F TAGTGACGATGCTGAGAT

qRT-R TCTATGCTGCTACTTCCA

PMZ AT3G28210 qRT-F CTTATGGCAGGAGGAGGAACAG

qRT-R ACAGTTATGTGACTTGTATG

TZF5 AT5G44260 qRT-F ATCCCACACTTATCTCTTCCTATC

qRT-R GGGGACTTGAAACTGACGAC

HOP3 AT4G12400 qRT-F ATCAACCTTTCACCAACCAATCA

qRT-R TAAACGCAGCACCTAATCGG

PCR2 AT1G14870 qRT-F GGAGAGACAACAGAATCAAGG

qRT-R TTTCACAACAAGCATTTTTTT

AT1G57630 AT1G57630 qRT-F TCATTTCCTTCATCTTCTTTGTCT

qRT-R GACCGATGAACTCTCCTCTCT

AT2G20560 AT2G20560 qRT-F CAAAGGAACCACCAAAAAGATGA

qRT-R CATCCTGGTTTCACATCAAT

AT2G18690 AT2G18690 qRT-F TACCAAAAACCAATAAGCCAAG

qRT-R AGGGAATACCAAGACTGAGAACA

AT5G45630 AT5G45630 qRT-F CAAGAAACGACGAGAAGAAGGGT

qRT-R AGTCTTATCATCCTCCTCCTCC

RD29A AT5G52310 qRT-F CTGAAGAACGAATCTGATATCG

qRT-R CCAGGTCTTCCCTTCGCCAG

AT4G26410 AT4G26410 qRT-F GAGCTGAAGTGGCTTCCATGAC

qRT-R GGTCCGACATACCCATGATCC

Specific primers used for Gateway constructs

Name Sequence (5'- 3') attb1 NPR1 promoter GGGGACAAGTTTGTACAAAAAAGCA

GGCTCAAGGGTTCCTGTTTATAGTTGAA

attb2 NPR1 promoter GGGGACCACTTTGTACAAGAAAGCTGGGTCAACAGGTTCCGATGAATTGAA

attb1 NPR1 CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACACCACCATTGATGGATTCG

attb2 NPR1 CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCCGACGACGATGAGAGAGTTTACGG

attb2 NPR1 CDS+STOP GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACCGACGACGATGAGAGAGTTTACGG

attb1 HSFA1a CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTtcATGTTTGTAAATTTCAAATA

attb2 HSFA1a CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTGTGTTCTGTTTCTGATG

 

 

92  

attb1 HSFA1b CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTtcATGGAATCGGTTCCCGAATC

attb2 HSFA1b CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATTTCCTCTGTGCTTCTGAGG

attb1 HSFA1d CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTtcATGGTGTGAGCAAAGTAAC

attb2 HSFA1d CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAAGGATTTTGCCTTGAGAGAT

Specific primers used for mutant genotyping

Name Sequence (5'- 3') trxh3 TTTATTCACCACCACACAT

trxh5 GTTCACTAATGTTGTCTTCTTC

Left border T-DNA GAACAACACTCAACCCTATCTC

 

 

93  

Supplemental Data Set 5 Total and mapped reads obtained for each sample by RNAseq experiments

Sample Uniquely mapped Total % mapped

WT_cold 20991650 22055413 95,17686202

npr1-1_cold 26084365 27244452 95,74193307

 

 

94  

Supplemental Data Set 6 Full names of the genes mentioned in this article

AGI Gene Symbol Brief description AT1G71000 DNAJ Chaperone DnaJ-domain superfamily protein

AT1G19020 AT1G19020 CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase

AT4G39670 AT4G39670 Glycolipid transfer protein (GLTP) family protein

AT5G45630 AT5G45630 Senescence regulator (Protein of unknown function, DUF584)

AT1G57630 AT1G57630 Toll-Interleukin-Resistance (TIR) domain family protein

AT1G15010 AT1G15010 Mediator of RNA polymerase II transcription subunit

AT2G20560 AT2G20560 DNAJ heat shock family protein

AT2G18690 AT2G18690 Transmembrane protein

AT5G06950 TGA2 TGACG sequence-specific binding factor 2

AT3G28210 PMZ Stress-associated protein 12

AT3G57260 PR2 Pathogenesis-related protein 2

AT5G12020 HSP17.6II 17.6 KDA class II heat shock protein

AT1G52340 ABA2 ABA deficient 2

AT4G25490 CBF1 C-repeat/DRE binding factor 1

AT4G25470 CBF2 C-repeat/DRE binding factor 2

AT1G76650 AT1G76650 Calmodulin-like 38

AT4G25480 CBF3 C-repeat/DRE binding factor 3

AT1G74710 ICS1 Isochorismate synthase 1

AT3G09350 FES1A Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1)

AT5G25250 FLOT1 Flotillin 1

AT1G02920 ATGST11 Arabidopsis glutathione s-transferase 11

AT4G17750 HSFA1a Arabidopsis class A heat shock factor 1a

AT5G16820 HSFA1b Arabidopsis class A heat shock factor 1b

AT1G74310 HSP101 Heat shock protein 101

AT5G12030 HSP17.6A Heat shock protein 17.6A

AT3G12580 HSP70 Arabidopsis heat shock protein 70

AT5G52640 HSP90.1 Heat shock protein 90.1

AT1G32330 HSFA1d Arabidopsis class A heat shock factor 1d

AT3G02990 HSFA1e Arabidopsis class A heat shock factor 1e

AT2G26150 HSFA2 Heat shock transcription factor A2

AT4G12400 HOP3 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins

AT1G18870 ICS2 Arabidopsis isochorismate synthase 2

AT1G52690 LEA7 Late embryogenesis abundant 7

AT5G52310 RD29A Responsive to desiccation 29A

AT1G52890 ANAC019 NAC domain containing protein 19

AT1G64280 NPR1 Arabidopsis nonexpresser of PR genes 1

 

 

95  

AT5G06960 TGA5 TGACG sequence-specific binding factor 5

AT1G14870 PCR2 Plant cadmium resistance 2

AT4G26410 RHIP1 RGS1-HXK1 interacting protein 1

AT1G65700 LSM8 Small nuclear ribonucleoprotein family protein

AT1G78290 SnRK2.8 SNF1-related protein kinase 2.8

AT5G44260 TZF5 Tandem CCCH zinc finger protein 5

AT3G12250 TGA6 TGACG sequence-specific binding factor 6

AT5G42980 TRXH3 Thioredoxin H-type 3

AT1G45145 TRXH5 Thioredoxin H-type 5

AT2G38470 WRKY33 WRKY DNA-binding protein 33

AT4G14365 XBAT34 XB3 ortholog 4 in Arabidopsis

 

 

96  

5. LITERATURE

Adie,  B.A.T.,  Perez-­‐Perez,  J.,  Perez-­‐Perez,  M.M.,  Godoy,  M.,  Sanchez-­‐Serrano,  J.-­‐J.,  Schmelz,  E.A.,   and   Solano,   R.   (2007).   ABA   Is   an   essential   signal   for   plant   resistance   to   pathogens  affecting  JA  biosynthesis  and  the  activation  of  defenses  in  Arabidopsis.  Plant  Cell  19:  1665–1681.  

 Barrero-­‐Gil,   J.   and   Salinas,   J.   (2017).   CBFs   at   the   crossroads  of   plant  hormone   signaling   in  cold  stress  response.  Mol.  Plant  10:  542–544.  

 Belda-­‐Palazón,   B.,   Ruiz,   L.,   Martí,   E.,   Tárraga,   S.,   Tiburcio,   A.F.,   Culiáñez,   F.,   Farràs,   R.,  Carrasco,   P.,   and   Ferrando,   A.   (2012).   Aminopropyltransferases   involved   in   polyamine  biosynthesis  localize  preferentially  in  the  nucleus  of  plant  cells.  PLoS  One  7:  e46907.  

 Bharti,  K.,  Von  Koskull-­‐Döring,  P.,  Bharti,   S.,  Kumar,  P.,   Tintschl-­‐Körbitzer,  A.,   Treuter,   E.,  and  Nover,  L.  (2004).  Tomato  heat  stress  transcription  factor  HsfB1  represents  a  novel  type  of  general  transcription  coactivator  with  a  histone-­‐like  motif  interacting  with  the  plant  CREB  binding  protein  ortholog  HAC1.  Plant  Cell  16:  1521–1535.  

 Blanco,   F.,   Salinas,   P.,   Cecchini,  M.N.,   Jordana,   X.,   Van  Hummelen,   P.,   Alvarez,  M.E.   and  Holuigue,  L.  (2009).  Early  genomic  responses  to  salicylic  acid  in  Arabidopsis.  Plant  Mol.  Biol.  70:  79–102.  

 Bowling,   S.   a,   Clarke,   J.D.,   Liu,   Y.,   Klessig,   D.F.,   and   Dong,   X.   (1997).   The   cpr5  mutant   of  Arabidopsis  expresses  both  NPR1-­‐dependent  and  NPR1-­‐independent  resistance.  Plant  Cell  9:  1573–1584.  

 Cao,  H.,  Bowling,  S.A.,  Gordon,  A.S.,  and  Dong,  X.  (1994).  Characterization  of  an  Arabidopsis  mutant  that  is  nonresponsive  to  inducers  of  systemic  acquired  resistance.  Plant  Cell  6:  1583–1592.  

 Carey,  C.C.,  Gorman,  K.F.,  and  Rutherford,  S.  (2006).  Modularity  and  intrinsic  evolvability  of  Hsp90-­‐buffered  change.  PLoS  One  1:  e76.  

 Catalá,   R.,   Medina,   J.,   and   Salinas,   J.   (2011).   Integration   of   low   temperature   and   light  signaling  during  cold  acclimation  response  in  Arabidopsis.  Proc.  Natl.  Acad.  Sci.  U.  S.  A.  108:  16475–16480.  

 Chinnusamy,  V.,  Zhu,   J.,  and  Zhu,   J.-­‐K.   (2007).  Cold  stress   regulation  of  gene  expression   in  plants.  Trends  Plant  Sci.  12:  444–451.  

 

 

 

97  

Czechowski,  T.,  Stitt,  M.,  Altmann,  T.,  Udvardi,  M.K.,  and  Scheible,  W.-­‐R.  (2005).  Genome-­‐Wide  Identification  and  Testing  of  Superior  Reference  Genes  for  Transcript  Normalization  in  Arabidopsis.  Plant  Physiol.  139:  5-­‐17.  

 English,   J.,   Davenport,   G.,   Elmayan,   T.,   Vaucheret,   H.,   and   Baulcombe,   D.   (1997).  Requirement   of   sense   transcription   for   homology-­‐dependent   virus   resistance   and   trans-­‐inactivation.  Plant  J.  12:  597–603.  

 Fan,  W.  and  Dong,  X.  (2002).  In  vivo  interaction  between  NPR1  and  transcription  factor  TGA2  leads  to  salicylic  acid-­‐mediated  gene  activation  in  Arabidopsis.  Plant  Cell  14:  1377–1389.  

 Fu,   Z.Q.   and   Dong,   X.   (2013).   Systemic   Acquired   Resistance:   Turning   Local   Infection   into  Global  Defense.  Annu.  Rev.  Plant  Biol.  64:  839–863.  

 Fu,  Z.Q.,  Yan,  S.,  Saleh,  A.,  Wang,  W.,  Ruble,   J.,  Oka,  N.,  Mohan,  R.,  Spoel,  S.H.,  Tada,  Y.,  Zheng,  N.,  and  Dong,  X.  (2012).  NPR3  and  NPR4  are  receptors  for  the  immune  signal  salicylic  acid  in  plants.  Nature  486:  228–232.  

 González-­‐Guzmán,  M.,  Apostolova,  N.,  Bellés,  J.M.,  Barrero,  J.M.,  Piqueras,  P.,  Ponce,  M.R.,  Micol,   J.L.,  Serrano,  R.,  and  Rodríguez,  P.L.   (2002).  The  short-­‐chain  alcohol  dehydrogenase  ABA2  catalyzes  the  conversion  of  xanthoxin  to  abscisic  aldehyde.  Plant  Cell  14:  1833–1846.  

 Griffith,  M.  and  Yaish,  M.W.F.  (2004).  Antifreeze  proteins  in  overwintering  plants:  A  tale  of  two  activities.  Trends  Plant  Sci.  9:  399–405.  

 Hermann,  M.,  Maier,   F.,  Masroor,  A.,  Hirth,  S.,  Pfitzner,  A.J.P.,   and  Pfitzner,  U.M.   (2013).  The   Arabidopsis   NIMIN   proteins   affect   NPR1   differentially.   Front.   Plant   Sci.   4:   88.   doi:  10.3389/fpls.2013.00088.  

 Hon,  W.C.,  Griffith,  M.,  Mlynarz,  A.,  Kwok,  Y.C.,  and  Yang,  D.S.  (1995).  Antifreeze  proteins  in  winter  rye  are  similar  to  pathogenesis-­‐related  proteins.  Plant  Physiol.  109:  879–89.  

 Jia,   Y.,   Ding,   Y.,   Shi,   Y.,   Zhang,   X.,   Gong,   Z.,   and   Yang,   S.   (2016).   The   cbfs   triple  mutants  reveal   the   essential   functions   of   CBFs   in   cold   acclimation   and   allow   the   definition   of   CBF  regulons  in  Arabidopsis.  New  Phytol.  212:  345–353.  

 Kilian,   J.,   Whitehead,   D.,   Horak,   J.,   Wanke,   D.,   Weinl,   S.,   Batistic,   O.,   D’Angelo,   C.,  Bornberg-­‐Bauer,   E.,   Kudla,   J.,   and   Harter,   K.   (2007).   The   AtGenExpress   global   stress  expression  data  set:  protocols,  evaluation  and  model  data  analysis  of  UV-­‐B  light,  drought  and  cold  stress  responses.  Plant  J.  50:  347–363.  

   Kim,  Y.,  Park,  S.,  Gilmour,  S.J.,  and  Thomashow,  M.F.  (2013a).  Roles  of  CAMTA  transcription  factors   and   salicylic   acid   in   configuring   the   low-­‐temperature   transcriptome   and   freezing  

 

 

98  

tolerance  of  Arabidopsis.  Plant  J.  75:  364–376.    

Kim,  D.,  Pertea,  G.,  Trapnell,  C.,  Pimentel,  H.,  Kelley,  R.,  and  Salzberg,  S.L.  (2013b).  TopHat2:  accurate   alignment   of   transcriptomes   in   the   presence   of   insertions,   deletions   and   gene  fusions.  Genome  Biol.  14:  R36.  

 Kinkema,  M.,   Fan,  W.,   and   Dong,   X.   (2000).   Nuclear   Localization   of   NPR1   Is   Required   for  Activation  of  PR  Gene  Expression.  Plant  Cell.  12:  2339-­‐2350.  

 Lawton,  K.,  Weymann,  K.,  Friedrich,  L.,  Vernooij,  B.,  Uknes,  S.,  and  Ryals,  J.  (1995).  Systemic  acquired   resistance   in   Arabidopsis   requires   salicylic   acid   but   not   ethylene.   Mol.   Plant.  Microbe.  Interact.  8:  863–870.  

 Lee,   H.-­‐J.,   Park,   Y.-­‐J.,   Seo,   P.J.,   Kim,   J.-­‐H.,   Sim,   H.-­‐J.,   Kim,   S.-­‐G.,   and   Park,   C.-­‐M.   (2015).  Systemic  immunity  requires  SnRK2.8-­‐mediated  nuclear  import  of  NPR1  in  Arabidopsis.  Plant  Cell  27:  3425–3438.  

 Levitt,   J.   (1980).   Responses   of   Plants   to   Environmental   Stress.   Chilling,   Freezing,   and   High  Temperature  Stresses,  2nd  ed.  (New  York:  Academic  Press).  

 Liu,  H.C.,  Liao,  H.T.,  and  Charng,  Y.Y.  (2011).  The  role  of  class  A1  heat  shock  factors  (HSFA1s)  in  response  to  heat  and  other  stresses  in  Arabidopsis.  Plant,  Cell  Environ.  34:  738–751.  

 Locascio,   A.,   Blázquez,   M.A.,   and   Alabadí,   D.   (2013).   Dynamic   regulation   of   cortical  microtubule  organization  through  prefoldin-­‐DELLA  interaction.  Curr.  Biol.  23:  804–809.  

 Love,   M.I,   Huber,   W.,   Anders,   S.l.   (2014).   Moderated   estimation   of   fold   change   and  dispersion  for  RNA-­‐seq  data  with  DESeq2.  Genome  Biol.  15:  550.  

 Medina,  J.,  Catala,  R.,  Salinas,  J.   (2001).  Developmental  and  stress  regulation  of  RCI2A  and  RCI2B,   two   cold-­‐inducible   genes   of   Arabidopsis   encoding   highly   conserved   hydrophobic  proteins.  Plant  Physiol  125:  1655–1666.  

 Miura,   K.   and   Tada,   Y.   (2014).   Regulation   of   water,   salinity,   and   cold   stress   responses   by  salicylic  acid.  Front.  Plant  Sci.  5:  4.  doi:  10.3389/fpls.2014.00004.  

 Nakagawa,  T.,  Suzuki,  T.,  Murata,  S.,  Nakamura,  S.,  Hino,  T.,  Maeo,  K.,  Tabata,  R.,  Kawai,  T.,  Tanaka,  K,  Niwa  Y.,  Watanabe,  Y.,  Nakamura,  K.,  Kimura,  T.,   Ishiguro,  S.   (2007).   Improved  Gateway   binary   vectors:   high-­‐performance   vectors   for   creation   of   fusion   constructs   in  transgenic  analysis  of  plants.  Biosci.  Biotechnol.  Biochem.  71:  2095–2100.  

 Nakai,  Y.,  Nakahira,  Y.,  Sumida,  H.,  Takebayashi,  K.,  Nagasawa,  Y.,  Yamasaki,  K.,  Akiyama,  M.,  Ohme-­‐Takagi,  M.,  Fujiwara,  S.,  Shiina,  T.,  Mitsuda,  N.,  Fukusaki,  E.,  Kubo,  Y.,  Sato,  MH.  

 

 

99  

(2013).  Vascular  plant  one-­‐zinc-­‐finger  protein  1/2   transcription   factors   regulate  abiotic  and  biotic  stress  responses  in  Arabidopsis.  Plant  J.  73:  761–775.  

 Nishizawa,  A.,  Yabuta,  Y.,  Yoshida,  E.,  Maruta,  T.,  Yoshimura,  K.,  and  Shigeoka,  S.   (2006).  Arabidopsis  heat  shock  transcription  factor  A2  as  a  key  regulator  in  response  to  several  types  of  environmental  stress.  Plant  J.  48:  535–547.  

 Pastor,  V.,  Vicent,  C.,  Cerezo,  M.,  Mauch-­‐Mani,  B.,  Dean,  J.,  and  Flors,  V.  (2012).  Detection,  characterization  and  quantification  of  salicylic  acid  conjugates  in  plant  extracts  by  ESI  tandem  mass  spectrometric  techniques.  Plant  Physiol.  Biochem.  53:  19–26.  

 Perea-­‐Resa,  C.,  Hernandez-­‐Verdeja,  T.,  Lopez-­‐Cobollo,  R.,  Castellano,  M.  d.  M.,  and  Salinas,  J.  (2012).  LSM  proteins  provide  accurate  splicing  and  decay  of  selected  transcripts  to  ensure  normal  Arabidopsis  development.  Plant  Cell  24:  4930–4947.  

 Pihakaski-­‐Maunsbach,  K.,  Moffatt,  B.,  Testillano,  P.,  Risueño,  M.,  Yeh,  S.,  Griffith,  M.,  and  Maunsbach,  A.B.  (2001).  Genes  encoding  chitinase-­‐antifreeze  proteins  are  regulated  by  cold  and  expressed  by  all  cell  types  in  winter  rye  shoots.  Physiol.  Plant.  112:  359–371.  

 Ruelland,  E.,  Vaultier,  M.N.,  Zachowski,  A.,  and  Hurry,  V.   (2009).  Chapter  2  Cold  Signalling  and  Cold  Acclimation  in  Plants.  Adv.  Bot.  Res.  49:  35–150.  

 Scharf,   K.-­‐D.,   Berberich,   T.,   Ebersberger,   I.,   and   Nover,   L.   (2012).   The   plant   heat   stress  transcription   factor   (Hsf)   family:   structure,   function   and   evolution.   Biochim.   Biophys.   Acta  1819:  104–119.  

 Seo,  P.J.,  Kim,  M.J.,  Park,  J.-­‐Y.,  Kim,  S.-­‐Y.,  Jeon,  J.,  Lee,  Y.-­‐H.,  Kim,  J.,  and  Park,  C.-­‐M.  (2010).  Cold  activation  of  a  plasma  membrane-­‐tethered  NAC  transcription  factor  induces  a  pathogen  resistance  response  in  Arabidopsis.  Plant  J.  61:  661–671.  

 Shah,   J.,   Tsui,   F.,   and   Klessig,   D.F.   (1997).   Characterization   of   a   Salicylic   Acid–Insensitive  Mutant   (sai1)   of   Arabidopsis   thaliana,   identified   in   a   selective   screen   utilizing   the   SA-­‐inducible  expression  of  the  tms2  Gene.  10:  69–78.  

 Shi,  H.,  Wang,  X.,  Ye,  T.,  Cheng,  F.,  Deng,   J.,  Yang,  P.,  Zhang,  Y.,  and  Chan,  Z.   (2014).  The  Cysteine2/Histidine2-­‐Type   transcription   factor   ZINC   FINGER   OF   ARABIDOPSIS   THALIANA6  modulates  biotic  and  abiotic  stress  responses  by  activating  salicylic  acid-­‐related  genes  and  C-­‐REPEAT-­‐BINDING  FACTOR  genes  in  Arabidopsis.  Plant  Physiol.  165:  1367-­‐1379.  

 Tada,  Y.,  Spoel,  S.H.,  Pajerowska-­‐Mukhtar,  K.,  Mou,  Z.,  Song,  J.,  Wang,  C.,  Zuo,  J.,  and  Dong,  X.   (2008).  Plant   immunity   requires   conformational   changes  of  NPR1  via  S-­‐nitrosylation  and  thioredoxins.  Science  321:  952–956.  

 

 

 

100  

Tsutsui,   T.,   Kato,   W.,   Asada,   Y.,   Sako,   K.,   Sato,   T.,   Sonoda,   Y.,   Kidokoro,   S.,Yamaguchi-­‐Shinozaki,  K.,  Tamaoki,  M.,  Arakawa,  K.,  Ichikawa,  T.,  Nakazawa,  M.,  Seki,  M.,  Shinozaki,  K.,  Matsui,   M.,   Ikeda,   A.,   Yamaguchi,   J.   (2009).   DEAR1,   a   transcriptional   repressor   of   DREB  protein   that  mediates   plant   defense   and   freezing   stress   responses   in   Arabidopsis.   J.   Plant  Res.  122:  633–643.  

 Wathugala,   D.L.,   Hemsley,   P.A.,   Moffat,   C.S.,   Cremelie,   P.,   Knight,   M.R.,   and   Knight,   H.  (2012).   The  Mediator   subunit   SFR6/MED16   controls   defence   gene   expression  mediated   by  salicylic  acid  and  jasmonate  responsive  pathways.  New  Phytol.  195:  217–230.  

 Wildermuth,  M.C.,  Dewdney,  J.,  Wu,  G.,  and  Ausubel,  F.M.  (2001).  Isochorismate  synthase  is  required  to  synthesize  salicylic  acid  for  plant  defence.  Nature  414:  562–565.  

 Xue-­‐Xuan,  X.,  Hong-­‐Bo,  S.,  Yuan-­‐Yuan,  M.,  Gang,  X.,  Jun-­‐Na,  S.,  Dong-­‐Gang,  G.,  and  Cheng-­‐Jiang,   R.   (2010).   Biotechnological   implications   from   abscisic   acid   (ABA)   roles   in   cold   stress  and   leaf   senescence   as   an   important   signal   for   improving   plant   sustainable   survival   under  abiotic-­‐stressed  conditions.  Crit.  Rev.  Biotechnol.  30:  222–230.  

 Yoshida,  T,.  Ohama,  N.,  Nakajima,  J.,  Kidokoro,  S.,  Mizoi,  J.,  Nakashima,  K.,  Maruyama,  K.,  Kim,   JM.,   Seki,   M.,   Todaka,   D.,   Osakabe,   Y.,   Sakuma,   Y.,   Schöffl,   F.,   Shinozaki,   K.,  Yamaguchi-­‐Shinozaki,  K.  (2011).  Arabidopsis  HsfA1  transcription  factors  function  as  the  main  positive   regulators   in   heat   shock-­‐responsive   gene   expression.   Mol.   Genet.   Genomics   286:  321–332.  

 Zhang,   X.,   Henriques,   R.,   Lin,   S.-­‐S.,   Niu,   Q.-­‐W.,   and   Chua,   N.-­‐H.   (2006).   Agrobacterium-­‐mediated  transformation  of  Arabidopsis  thaliana  using  the  floral  dip  method.  Nat.  Protoc.  1:  641–646.  

 Zhang,   Y.,   Tessaro,  M.J.,   Lassner,  M.,   and   Li,   X.   (2003).   Knockout   analysis   of   Arabidopsis  transcription   factors   TGA2,   TGA5,   and   TGA6   reveals   their   redundant   and   essential   roles   in  systemic  acquired  resistance.  Plant  Cell  15:  2647–2653.  

 Zhao,  C.,  Zhang,  Z.,  Xie,  S.,  Si,  T.,   Li,  Y.,  and  Zhu,   J.-­‐K.   (2016).  Mutational  Evidence   for   the  Critical  Role  of  CBF  Genes  in  Cold  Acclimation  in  Arabidopsis.  Plant  Physiol.  171:  2744-­‐59.  

 

 

101  

SECTION 3

1. CONCLUSIONS

Some plants from temperate regions have developed the ability to cold

acclimate, increasing their tolerance to freezing temperatures and other abiotic stress

conditions. This adaptive response involves an extensive transcriptional

reprogramming that is largely unknown. Interestingly, recent studies have related cold

acclimation with biotic stress responses, but the molecular mechanism underlying this

relationship still remains elusive.

The main question that motivated this thesis project was to determine whether

NPR1, the master coregulator that controls most transcriptomic responses in

pathogens resistance, is also implicated in abiotic stress responses. In this work, we

provide molecular and functional evidence that NPR1 is effectively involved in abiotic

stress responses. Specifically, we found implication of NPR1 in the cold acclimation

process in Arabidopsis. In fact, we demonstrate for the first time that NPR1 promotes

this process by activating a novel-signaling pathway. This pathway involves a SA-,

ABA- and CBFs-independent increase of NPR1 levels and the subsequent relocation

of NPR1 from the cytoplasm to the nucleus. Once in the nucleus, NPR1 activates

cold-inducible gene expression by interacting with HSFA1 transcription factors.

Together, these observations indicate that NPR1 constitutes an integration node for

plant responses to both biotic and abiotic stresses.  

The first aim of this thesis was the molecular characterization of Arabidopsis

NPR1 in response to abiotic stresses. The main conclusions of this aim were:

 

 

102  

• The NPR1 gene is upregulated specifically under cold conditions, but not in

response to high salt or drought, and this upregulation occurs principally in leaf

tissues.

• The accumulation of NPR1 transcript levels in response to low temperature

conditions is regulated at the transcriptional level, and is not mediated by SA,

ABA or the CBFs factors.

• Consistent with gene expression results, an increase in NPR1 protein levels

was observed in plants exposed to low temperature.

• NPR1 monomerizes and relocates to the nucleus in Arabidopsis cells under

low temperature. We found that the SnRK2.8 kinase, which phosphorylates

NPR1, and thioredoxins TRXH3/TRXH5, which reduce disulfide bonds in

NPR1 oligomers, are required for NPR1 monomerization and nuclear

localization in the cold.

The second aim of the thesis was the functional characterization of NPR1 in

the cold acclimation process. We obtained the following main conclusions:

• Genetic evidence supports that NPR1 is a positive regulator of the cold

acclimation response.

• Monomerization and nuclear import of NPR1 in response to low temperature is

necessary for full development of cold acclimation.

• Transcriptome analysis revealed that NPR1 operates in cold acclimation by

promoting cold-induced gene expression, including the cold induction of a set

of heat stress-responsive genes belonging to the HSFA1 regulon. This

 

 

103  

function, unlike the pathogen response, is not mediated by the canonical

pathway controlled by TGA class II transcription factors.

• HSFA1s, a family of four partially redundant transcription factors that have a

role as master regulators of the heat-shock response, regulate heat stress-

responsive gene expression dependent of NPR1 under low temperature

conditions.

• Genetic analyses showed that HSFA1 factors and the cold-induced heat

stress-responsive gene expression are required for cold acclimation.

• HSFA1 transcription factors also localize in the nucleus in response to low

temperature.

• NPR1 interacts with HSFA1 factors and this interaction is crucial to promote

cold-induced heat stress-responsive gene expression and, therefore, cold

acclimation.

Based on our results, we proposed a working model for the novel NPR1 function

in cold acclimation. In response to low temperature, NPR1 gene expression is

transcriptionally activated and NPR1 protein accumulates in the nucleus. Two positive

regulators of cold acclimation, SnRK2.8 and TRXH3/H5, post-translationally modify

NPR1, enabling its oligomer to monomer transition and consequently its nuclear

localization. Here, NPR1 interacts with different transcription factors, including the

HSFA1s, to promote cold-induced gene expression. The NPR1/HSFA1s interaction

specifically leads to the activation of a set of cold-inducible heat stress-responsive

genes that are required for full development of the cold acclimation process. We

 

 

104  

speculate that the function of NPR1 in this process might offer plants the selective

advantage of activating the defense response under low temperature conditions,

when they are highly sensitive to pathogens. In this context, this work gives novel

insights for understanding of how plants respond to environmental stresses, providing

important novel evidence of NPR1 function in this process, opening new issues for

future evaluation.

2. PROJECTIONS

Several interesting points for future evaluation emerged from this work.

First, we found that NPR1 transcripts accumulate under cold treatment, that

this accumulation is regulated at the transcriptional level, and that it is independent of

SA, ABA and the CBFs. Further investigations are required to unravel which are the

cis- and trans-acting elements involved in this regulation.

Second, we demonstrate that the post-translational regulation of NPR1 in the

cold is mediated by SnRK2.8 and TRXH3/H5, which promote its monomerization and

nuclear localization. Future work should be oriented to investigate whether this

molecular modification is mediated by redox and/or other biochemical changes that

take place during cold acclimation.

 

 

105  

Third, NPR1 should promote cold-induced gene expression and cold

acclimation by interacting with different transcription factors. Identifying other factors

than HSFA1, would be an important line of research in the next years.

Fourth, in response to low temperature, we show that HSFA1 factors localize

to the nucleus and regulate the induction of a set of cold-induced heat-stress

responsive genes. Determining the molecular mechanisms that control the nuclear

localization of HSFA1 factors in the cold deserves further investigation.

Fifth, NPR1 activity in response to pathogens has been described to be

regulated by multiple posttranslational modifications, including phosphorylation and

ubiquitination. Whether or not these modifications also regulate NPR1 activity in

response to cold, should be the subject of future studies.